[Bioperl-l] Bio::BroodComb - RFC

[Jay Hannah]

I formalized a little framework so I could stop re-writing little programs that do some things people frequently ask me to do.

   http://github.com/jhannah/bio-broodcomb

It stores everything in SQLite so users can write custom reports if they want to. It uses BioPerl and some shiny CPAN beads (DBIx::Class, Moose::Role). Tests included. 

The first two functions I stuck in the framework:

Find subsequences (Bio::BroodComb::SubSeq):

   use Bio::BroodComb;
   my $bc = Bio::BroodComb->new();
   $bc->load_large_seq(file => "large_seq.fasta");
   $bc->load_small_seq(file => "small_seq.fasta");
   $bc->find_subseqs();
   print $bc->subseq_report1;

In-silico PCR (Bio::BroodComb::PCR):

  use Bio::BroodComb;
  my $bc = Bio::BroodComb->new();
  $bc->load_large_seq(file => "large_seq.fasta");
  $bc->add_primerset(
     description    => "U5/R",   # however you want it reported
     forward_primer => 'GCGGGCAGCAATACTGCTTTGTAA',
     reverse_primer => 'ACCAGCGTTCAGCATATGGAGGAT',
  );
  $bc->find_pcr_hits();
  $bc->find_pcr_products();
  print $bc->pcr_report1;

I find this rather handy, so will probably be adding all my applicable future work to it instead of writing stand-alone programs. Not sure if it should be renamed for eventual CPAN / wherever.

Suggestions, contributions welcome.   :)

   http://github.com/jhannah/bio-broodcomb

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah