[Bioperl-l] Fwd: megablast using bioperl
Smithies, Russell
Russell.Smithies at agresearch.co.nz
Tue Feb 2 00:27:16 UTC 2010
As I suspected, default gap penalties are different when running "megablast" and "blastall -p blastn -n T".
Here are hits to the same sequence obtained both ways:
=========================================
Megablast
>gb|FJ882402.1| Sus scrofa homeodomain transcription factor Nanog-like protein
mRNA, complete cds
Length = 925
Score = 93.7 bits (47), Expect = 2e-15
Identities = 129/155 (83%), Gaps = 8/155 (5%)
Strand = Plus / Plus
Query: 427 atgagtgtggatccagcttgtccccaaagcttgccttgctttgaagcatccgactgtaaa 486
|||||||||||||||||||||||||||||| ||| |||| ||||||||| | | | |
Sbjct: 1 atgagtgtggatccagcttgtccccaaagcctgctttgccccgaagcatcc-att-tcca 58
Query: 487 g--aatcttcacctatgcctgtgatttgtgggcctgaagaaaactat-ccatccttgcaa 543
| |||||||||| ||||||| | ||| ||||||||||||||| ||| || ||||||||
Sbjct: 59 gcgaatcttcaccaatgcctgaggtttatgggcctgaagaaaattatgcc-tccttgcag 117
Query: 544 atgtcttctgctgagatgcctc-acacggagactg 577
||||| ||||||||| |||| |||| |||||||
Sbjct: 118 atgtcagctgctgagac-cctcgacaccgagactg 151
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
Posted date: Jan 26, 2010 5:41 PM
Number of letters in database: 29,627,559,461
Number of sequences in database: 10,420,530
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 0, Extension: 0
==========================================================
blastall -p blastn -n T
>gb|FJ882402.1| Sus scrofa homeodomain transcription factor Nanog-like protein
mRNA, complete cds
Length = 925
Score = 89.7 bits (45), Expect = 3e-14
Identities = 111/133 (83%)
Strand = Plus / Plus
Query: 427 atgagtgtggatccagcttgtccccaaagcttgccttgctttgaagcatccgactgtaaa 486
|||||||||||||||||||||||||||||| ||| |||| ||||||||| | |
Sbjct: 1 atgagtgtggatccagcttgtccccaaagcctgctttgccccgaagcatccatttccagc 60
Query: 487 gaatcttcacctatgcctgtgatttgtgggcctgaagaaaactatccatccttgcaaatg 546
||||||||||| ||||||| | ||| ||||||||||||||| ||| | |||||||| |||
Sbjct: 61 gaatcttcaccaatgcctgaggtttatgggcctgaagaaaattatgcctccttgcagatg 120
Query: 547 tcttctgctgaga 559
|| |||||||||
Sbjct: 121 tcagctgctgaga 133
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
Posted date: Jan 26, 2010 5:41 PM
Number of letters in database: 29,627,559,461
Number of sequences in database: 10,420,530
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
--Russell
> -----Original Message-----
> From: Smithies, Russell
> Sent: Tuesday, 2 February 2010 11:43 a.m.
> To: 'Chris Fields'; 'Xiujing Gu'
> Cc: 'BioPerl List'
> Subject: RE: [Bioperl-l] Fwd: megablast using bioperl
>
> I don't think it allows a discontiguous template when run via blastall
> though.
> "blastall -p blastn -n T" will give you a different result than straight
> megablast.
>
> --Russell
>
> > -----Original Message-----
> > From: Chris Fields [mailto:cjfields at illinois.edu]
> > Sent: Tuesday, 2 February 2010 11:03 a.m.
> > To: Xiujing Gu
> > Cc: 'BioPerl List'; Smithies, Russell
> > Subject: Re: [Bioperl-l] Fwd: megablast using bioperl
> >
> > Acc. to the blastall docs MEGABLAST is just setting -n to T for
> blastall.
> > Is that what you mean?
> >
> > pyrimidine1:~ cjfields$ blast-2.2.22/bin/blastall -
> >
> > blastall 2.2.22 arguments:
> >
> > -p Program Name [String]
> > -d Database [String]
> > default = nr
> > ...
> > -n MegaBlast search [T/F]
> > default = F
> >
> > chris
> >
> > On Feb 1, 2010, at 2:38 PM, Xiujing Gu wrote:
> >
> > > Thanks for the links!
> > > But, they only talk about the regular blastall program, not the
> > megablast.
> > >
> > > I am not sure how can I switch from blastall to megablast. I tried to
> > just call megablast, but I got a very differenct report.
> > >
> > > $VAR1 = bless( {
> > > 'primary_seq' => bless( {
> > > 'display_id' => 'test',
> > > '_seq_length' => undef,
> > > '_root_verbose' => 0,
> > > 'seq' =>
> > >
> >
> 'TGAACCTAGAAGTATTTGTTGCTGGGTTTGTCTTCAGGTTCTGTTGCTCGGTTTTCTAGTTCCCCACCTAGTC
> >
> TGGGTTACTCTGCAGCTACTTTTGCATTACAATGGCCTTGGTGAGACTGGTAGACGGGATTAACTGAGAATTCA
> >
> CAAGGGTGGGTCAGTAGGGGGTGTGCCCGCCAGGAGGGGTGGGTCTAAGGTGATAGAGCCTTCATTATAAATCT
> >
> AGAGACTCCAGGATTTTAACGTTCTGCTGGACTGAGCTGGTTGCCTCATGTTATTATGCAGGCAACTCACTTTA
> >
> TCCCAATTTCTTGATACTTTTCCTTCTGGAGGTCCTATTTCTCTAACATCTTCCAGAAAAGTCTTAAAGCTGCC
> >
> TTAACCTTTTTTCCAGTCCACCTCTTAAATTTTTTCCTCCTCTTCCTCTATACTAACATGAGTGTGGATCCAGC
> >
> TTGTCCCCAAAGCTTGCCTTGCTTTGAAGCATCCGACTGTAAAGAATCTTCACCTATGCCTGTGATTTGTGGGC
> >
> CTGAAGAAAACTATCCATCCTTGCAAATGTCTTCTGCTGAGATGCCTCACACGGAGACTGGTAAGAAAGAAATT
> >
> TATCCTTGAAAGGCCAAGTTCCTTAAGGGAAAAGAGAGAAGGAGAGAGGGTTAAGGGATCATTTCCCTCTTGAG
> >
> CAATGATGGACCATTACTATAAAGAAGTGTTATTATCAACTAATCCTCTGGAAACCCCTTTTTCCATTATAACT
> >
> TGGTGGCACCTGCCCTTTGAACTATGTCCCAGGTCTCAGGAGTGTGCATTGAGTTGAAGGACACAGAATTCGGC
> >
> AGTTGAACAGTGTGCAGTAAGTTTGAGAACCTATGGGCTTAGGCATGGTGGAAACAAAAATGTATCGTTATAGT
> >
> TAAATGAAGGTGATGTGTACATCTTCACATAGTGCTGGACACATGTGAATAAATAGCAGATTTATTGCTAATTA
> > GCCA
> > >
> >
> GAAGACCTAACGTCATAGCTCAGGGATGAGCATGATTTTGTTTTGCCAAAAATGGCATGGCAAATCACGATGAG
> >
> ATTTCTGTAATACATAATTTGGGTAATTCTTTCTATGTCAGTAACGGCTGTCTCTTCTCCATTCTCTGGGTTTG
> >
> TGGATGTTACTGGGCAGCTCTGAGTTTGGGAGCACCTCCCATGTCTAATTCTCCTAAGTCCTGGGAAGCGTTGA
> >
> CCCAACTTTATGGTAAAGATAATTCCAGAAAGTTTAATCTACTGACAGTCAAACAGAATGTAGCTAGAAGTCCA
> >
> GTTTGGCTTCAAAACCTGTGCTAGTACTCATGCTTCTGACTGGTAGCTGCAAGGGGTGGGGGATACTCGGGATA
> >
> CTCATAAAGCCGCTACCACTTTTTTGAAAATCAATTTTTCAGTAGTTTTCAAAAACTTGAGAATGAACCAACTT
> > TACCAAGAATG',
> > > 'alphabet' => 'dna'
> > > }, 'Bio::PrimarySeq' ),
> > > '_root_verbose' => 0
> > > }, 'Bio::Seq' );
> > > Can't locate object method "nextSbjct" via package "Bio::Seq"
> > >
> > >
> > >
> > > Thanks,
> > > Xiujing Gu
> > >
> > >
> > > --- On Mon, 2/1/10, Smithies, Russell
> > <Russell.Smithies at agresearch.co.nz> wrote:
> > >
> > > From: Smithies, Russell <Russell.Smithies at agresearch.co.nz>
> > > Subject: RE: [Bioperl-l] Fwd: megablast using bioperl
> > > To: "'BioPerl List'" <bioperl-l at lists.open-bio.org>
> > > Cc: "'xiujingg at yahoo.com'" <xiujingg at yahoo.com>
> > > Date: Monday, February 1, 2010, 3:12 PM
> > >
> > > Have you read the docs? It's very well documented:
> > > http://search.cpan.org/~cjfields/BioPerl-
> > 1.6.1/Bio/Tools/Run/StandAloneBlast.pm
> > >
> > > Have you searched the BioPerl wiki? Again, well documented with
> > examples:
> > > http://www.bioperl.org/wiki/HOWTO:StandAloneBlast
> > >
> > > And if that doesn't help, perhaps you need to improve your Google
> > skills:
> > > http://www.google.com/support/websearch/?ctx=web
> > >
> > > --Russell
> > >
> > >
> > >
> > >> -----Original Message-----
> > >> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> > >> bounces at lists.open-bio.org] On Behalf Of Jason Stajich
> > >> Sent: Tuesday, 2 February 2010 8:48 a.m.
> > >> To: BioPerl List
> > >> Cc: xiujingg at yahoo.com
> > >> Subject: [Bioperl-l] Fwd: megablast using bioperl
> > >>
> > >> Xiujing -
> > >> Your message is best asked on the mailing list.
> > >>
> > >> Begin forwarded message:
> > >>
> > >>> From: Xiujing Gu <xiujingg at yahoo.com>
> > >>> Date: February 1, 2010 7:58:55 AM PST
> > >>> To: jason at bioperl.org
> > >>> Subject: megablast using bioperl
> > >>>
> > >>> Hello Jason:
> > >>>
> > >>> After numerous googling, I found you might be the only person who
> > >>> knows about this subject. Would you so kindly show me an example of
> > >>> setting up megablast using bioperl Bio::Tools::Run::StandAloneBlast?
> > >>>
> > >>> Thanks a lot!
> > >>>
> > >>> Best regards,
> > >>> Xiujing
> > >> _______________________________________________
> > >> Bioperl-l mailing list
> > >> Bioperl-l at lists.open-bio.org
> > >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > >
> =======================================================================
> > > Attention: The information contained in this message and/or
> attachments
> > > from AgResearch Limited is intended only for the persons or entities
> > > to which it is addressed and may contain confidential and/or
> privileged
> > > material. Any review, retransmission, dissemination or other use of,
> or
> > > taking of any action in reliance upon, this information by persons or
> > > entities other than the intended recipients is prohibited by
> AgResearch
> > > Limited. If you have received this message in error, please notify the
> > > sender immediately.
> > >
> =======================================================================
> > >
> > >
> > >
> > >
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l at lists.open-bio.org
> > > http://lists.open-bio.org/mailman/listinfo/bioperl-l
More information about the Bioperl-l
mailing list