From jason at bioperl.org  Mon Sep  1 03:42:26 2008
From: jason at bioperl.org (Jason Stajich)
Date: Mon, 1 Sep 2008 00:42:26 -0700
Subject: [Bioperl-l] Bio::Tools::dpAlign feature request
In-Reply-To: <868888.19741.qm@web30406.mail.mud.yahoo.com>
References: <868888.19741.qm@web30406.mail.mud.yahoo.com>
Message-ID: <99A57523-94B3-4A56-A617-22675FA10AB8@bioperl.org>

Safe to ignore the tests.  Those that are failing aren't even test for  
Bio::Align::dpAlign - but were written to test a bug that has not been  
fixed in the EVD module if I remember correctly that is why they are  
marked in a TODO block, but I can't tell if the Test.pm is actually  
skipping these tests or not.

I think we probably need to deprecate some of these modules as there  
is no maintainer of Ewan's code in here.

At a minimum we need to modularlize the tests for these modules into  
separate t dir and fix the need for multiple Makefile.PL in here and  
probably move to Build.PL

-jason
On Aug 28, 2008, at 11:00 AM, Yee Man Chan wrote:

>
> Hi Alexie
>
> My understanding is that you can ignore these failures.
>
> I believe test cases 17-20 were added by Jason Stajich before I  
> added the feature you requested. I am not sure what he was doing  
> there.
>
> I suppose he can give you the definite answer to whether this is  
> something important or not.
>
> By the way, did you try out the new feature? Does it work?
>
> Thanks
> Yee Man
>
> --- On Thu, 8/28/08, Alexie Papanicolaou <apapanicolaou at ice.mpg.de>  
> wrote:
>
>> From: Alexie Papanicolaou <apapanicolaou at ice.mpg.de>
>> Subject: Re: Bio::Tools::dpAlign feature request
>> To: "Yee Man Chan" <ymc at yahoo.com>
>> Date: Thursday, August 28, 2008, 6:15 AM
>> hi
>>
>> is the version you emailed me newer or older than the
>> subversion one?
>>
>> i'm testing the subversion version for bioperl-ext and
>>
>> not ok 17 # TODO evalues vary based on platform, needs
>> fixing
>> #   Failed (TODO) test at test.pl line 156.
>> #          got: '2027805538'
>> #     expected: '1764904'
>> not ok 18 # TODO evalues vary based on platform, needs
>> fixing
>> #   Failed (TODO) test at test.pl line 157.
>> #          got: '-1375488148'
>> #     expected: '1764872'
>> not ok 19 # TODO evalues vary based on platform, needs
>> fixing
>> #   Failed (TODO) test at test.pl line 158.
>> #          got: '-808808307'
>> #     expected: '1764872'
>> not ok 20 # TODO evalues vary based on platform, needs
>> fixing
>> #   Failed (TODO) test at test.pl line 159.
>> #          got: '-2118162890'
>> #     expected: '1764872'
>>
>> you think these are ok to ignore?
>>
>>
>> On Fri, 2008-08-01 at 21:03 -0700, Yee Man Chan wrote:
>>
>>> Hi Alexie
>>>
>>>   Attached are the files that contains the feature
>> you requested. linspc.c is the one that does the work and
>> test.pl has a test case for it. The scoring scheme is as
>> described before. Please let me know if it works.
>>>
>>> Yee Man
>>>
>>> --- On Wed, 7/30/08, Alexie Papanicolaou
>> <apapanicolaou at ice.mpg.de> wrote:
>>>
>>>> From: Alexie Papanicolaou
>> <apapanicolaou at ice.mpg.de>
>>>> Subject: Re: Bio::Tools::dpAlign feature request
>>>> To: ymc at yahoo.com
>>>> Date: Wednesday, July 30, 2008, 2:44 PM
>>>> Oh sorry
>>>>
>>>> Say match=3 and mismatch=-1, gopen= -10, gext=-5
>>>> for aligning
>>>> seq1: ATG
>>>> seq2: ATT
>>>> match: 3,3,-1
>>>>
>>>> seq1: AT-G
>>>> seq2: ATTG
>>>> match: 3,3,-1,-10,3
>>>>
>>>> is that possible? or am I missing something? I
>> was only
>>>> today wondering
>>>> if it is even possible...
>>>>
>>>> a
>>>>
>>>>
>>>> Yee Man Chan wrote:
>>>>> Sorry, I don't quite get it. Can you
>> give me an
>>>> example of the output you want?
>>>>>
>>>>> Yee Man
>>>>>
>>>>> --- On Wed, 7/30/08, Alexie Papanicolaou
>>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>>
>>>>>
>>>>>> From: Alexie Papanicolaou
>>>> <apapanicolaou at ice.mpg.de>
>>>>>> Subject: Re: Bio::Tools::dpAlign feature
>> request
>>>>>> To: ymc at yahoo.com
>>>>>> Date: Wednesday, July 30, 2008, 9:50 AM
>>>>>> Dear Yee Man,
>>>>>>
>>>>>> Do you think it is possible to code a
>> method for
>>>> creating a
>>>>>> delimited
>>>>>> (space or comma) "score-line"?
>>>>>>
>>>>>> I'd like to parse it into an array
>> and have
>>>> the
>>>>>> individual score for
>>>>>> each alignment position. Is it easy to
>> do?
>>>>>>
>>>>>> a
>>>>>>
>>>>>> Yee Man Chan wrote:
>>>>>>
>>>>>>> Hi Alexie
>>>>>>>
>>>>>>>   How about I implement the simple
>> case?
>>>>>>>
>>>>>>> So for match = +3, mismatch = -1,
>>>>>>>
>>>>>>> A and R = +3
>>>>>>> A and Y = -1
>>>>>>> A and B = -1
>>>>>>> A and D = +3
>>>>>>> A and N = +3
>>>>>>> A and X = -1
>>>>>>>
>>>>>>> What do you think?
>>>>>>> Yee Man
>>>>>>>
>>>>>>>
>>>>>>> --- On Tue, 7/29/08, Alexie
>> Papanicolaou
>>>>>>>
>>>>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>>>
>>>>>>>
>>>>>>>
>>>>>>>> From: Alexie Papanicolaou
>>>>>>>>
>>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>
>>>>>>>> Subject: Re: Bio::Tools::dpAlign
>> feature
>>>> request
>>>>>>>> To: ymc at yahoo.com
>>>>>>>> Date: Tuesday, July 29, 2008,
>> 10:58 AM
>>>>>>>> Dear Yee Man,
>>>>>>>> hello, I was wondering how is
>> this
>>>> progressing and
>>>>>>>>
>>>>>> if you
>>>>>>
>>>>>>>> need help?
>>>>>>>>
>>>>>>>> many thanks
>>>>>>>> alexie
>>>>>>>>
>>>>>>>> Yee Man Chan wrote:
>>>>>>>>
>>>>>>>>
>>>>>>>>> Hi Alexie
>>>>>>>>>
>>>>>>>>>   There are two ways to
>> compute the
>>>> score for
>>>>>>>>>
>>>>>> each
>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>> aligned basepair in dpAlign
>> module. One is
>>>>>>>>
>>>>>> match/mismatch
>>>>>>
>>>>>>>> if you specify your sequence as
>> DNA and
>>>> the other
>>>>>>>>
>>>>>> is a
>>>>>>
>>>>>>>> scoring matrix if you specify
>> your
>>>> sequence as
>>>>>>>>
>>>>>> protein.
>>>>>>
>>>>>>>> Obviously, the latter can
>> completely
>>>> dominate the
>>>>>>>>
>>>>>> former.
>>>>>>
>>>>>>>> If you take the time to type the
>> scoring
>>>> matrix
>>>>>>>>
>>>>>> file, then
>>>>>>
>>>>>>>> you can handle those IUPAC code
>> by
>>>> specifying the
>>>>>>>>
>>>>>> sequence
>>>>>>
>>>>>>>> as proteins.
>>>>>>>>
>>>>>>>>
>>>>>>>>>   If you think this is too
>>>> troublesome, then
>>>>>>>>>
>>>>>> I might
>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>> be able to extend the
>> match/mismatch route
>>>> to
>>>>>>>>
>>>>>> handle IUPAC
>>>>>>
>>>>>>>> codes. But the problem here is,
>> how should
>>>> I score
>>>>>>>>
>>>>>> a match
>>>>>>
>>>>>>>> of A and W when match is +3 and
>> mismatch
>>>> is -1?
>>>>>>>>
>>>>>> Should it
>>>>>>
>>>>>>>> have a score of +3/3 = +1 for
>> match or
>>>> +3/3-1*2/3
>>>>>>>>
>>>>>> = +1/3?
>>>>>>
>>>>>>>> Do you know what the convention
>> is? If
>>>> not, maybe
>>>>>>>>
>>>>>> you can
>>>>>>
>>>>>>>> tell me what you think the score
>> will be?
>>>>>>>>
>>>>>>>>
>>>>>>>>> Yee Man
>>>>>>>>>
>>>>>>>>> --- On Thu, 6/26/08, Alexie
>>>> Papanicolaou
>>>>>>>>>
>>>>>>>>>
>>>>>>>> <apapanicolaou at ice.mpg.de>
>> wrote:
>>>>>>>>
>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>> From: Alexie
>> Papanicolaou
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>>>
>>>>>>>>
>>>>>>>>>> Subject:
>> Bio::Tools::dpAlign
>>>> feature
>>>>>>>>>>
>>>>>> request
>>>>>>
>>>>>>>>>> To: ymc at yahoo.com
>>>>>>>>>> Date: Thursday, June 26,
>> 2008,
>>>> 4:15 AM
>>>>>>>>>> Dear Yee Man Chan,
>>>>>>>>>>
>>>>>>>>>> Many thank you for this
>> module. I
>>>> like it
>>>>>>>>>>
>>>>>> very
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> much. I was
>>>>>>>>
>>>>>>>>
>>>>>>>>>> wondering if
>>>>>>>>>> it would be possible for
>> you to
>>>> allow for
>>>>>>>>>>
>>>>>> IUPAC
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> DNA codes.
>>>>>>>>
>>>>>>>>
>>>>>>>>>> I see it is in your TODO
>> list and
>>>> I hoped
>>>>>>>>>>
>>>>>> to
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> inspire you
>>>>>>>>
>>>>>>>>
>>>>>>>>>> :-)
>>>>>>>>>>
>>>>>>>>>> Even a simple measure
>> with the
>>>> degenerate
>>>>>>>>>>
>>>>>> base
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> containing
>>>>>>>>
>>>>>>>>
>>>>>>>>>> the aligned
>>>>>>>>>> base count as a
>> (perfect) match
>>>> would be
>>>>>>>>>>
>>>>>> very
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> useful to me
>>>>>>>>
>>>>>>>>
>>>>>>>>>> (i'm sorry, i
>>>>>>>>>> 'm not a good coder
>> to do it
>>>> myself).
>>>>>>>>>>
>>>>>>>>>> many thanks for your
>> work so far.
>>>>>>>>>> alexie
>>>>>>>>>>
>>>>>>>>>> -- 
>>>>>>>>>> --
>>>>>>>>>> "Eppur si
>> evolve"
>>>> ("And yet
>>>>>>>>>>
>>>>>> it
>>>>>>
>>>>>>>>>> evolves")
>>>>>>>>>> -Galileo Jr (ca 21st
>> century)
>>>>>>>>>>
>>>>>>>>>> --
>>>>>>>>>> Alexie Papanicolaou
>>>>>>>>>> Entomology
>>>>>>>>>> Max Planck Institute for
>> Chemical
>>>> Ecology
>>>>>>>>>> Hans Knoell Str 8
>>>>>>>>>> Jena 07745
>>>>>>>>>> Germany
>>>>>>>>>> Email
>> apapanicolaou at ice.mpg.de
>>>>>>>>>> Tel +493641571561
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>> -- 
>>>>>>>> --
>>>>>>>> "Eppur si evolve"
>> ("And yet
>>>> it
>>>>>>>> evolves")
>>>>>>>> -Galileo Jr (ca 21st century)
>>>>>>>>
>>>>>>>> "One Galileo in two
>> thousand years is
>>>>>>>>
>>>>>> enough."
>>>>>>
>>>>>>>> -Pope Pius XII
>>>>>>>> --
>>>>>>>> Alexie Papanicolaou
>>>>>>>> Entomology
>>>>>>>> Max Planck Institute for
>> Chemical Ecology
>>>>>>>> Hans Knoell Str 8
>>>>>>>> Jena 07745
>>>>>>>> Germany
>>>>>>>> Email apapanicolaou at ice.mpg.de
>>>>>>>> Tel +493641571561
>>>>>>>>
>>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>> -- 
>>>>>> --
>>>>>> "Eppur si evolve" ("And
>> yet it
>>>>>> evolves")
>>>>>> -Galileo Jr (ca 21st century)
>>>>>>
>>>>>> "One Galileo in two thousand years
>> is
>>>> enough."
>>>>>> -Pope Pius XII
>>>>>> --
>>>>>> Alexie Papanicolaou
>>>>>> Entomology
>>>>>> Max Planck Institute for Chemical
>> Ecology
>>>>>> Hans Knoell Str 8
>>>>>> Jena 07745
>>>>>> Germany
>>>>>> Email apapanicolaou at ice.mpg.de
>>>>>> Tel +493641571561
>>>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>
>>>> -- 
>>>> --
>>>> "Eppur si evolve" ("And yet it
>>>> evolves")
>>>> -Galileo Jr (ca 21st century)
>>>>
>>>> "One Galileo in two thousand years is
>> enough."
>>>> -Pope Pius XII
>>>> --
>>>> Alexie Papanicolaou
>>>> Entomology
>>>> Max Planck Institute for Chemical Ecology
>>>> Hans Knoell Str 8
>>>> Jena 07745
>>>> Germany
>>>> Email apapanicolaou at ice.mpg.de
>>>> Tel +493641571561
>>>
>>>
>>>
>>
>> -- 
>> -- 
>> "Eppur si evolve" ("And yet it
>> evolves")
>> -Galileo Jr (ca 21st century)
>>
>> "One Galileo in two thousand years is enough."
>> -Pope Pius XII
>> -- 
>> Alexie Papanicolaou
>> Entomology
>> Max Planck Institute for Chemical Ecology
>> Hans Knoell Str 8
>> Jena 07745
>> Germany
>> Email apapanicolaou at ice.mpg.de
>> Tel +493641571561
>
>
>

Jason Stajich
jason at bioperl.org




From cjfields at illinois.edu  Mon Sep  1 13:49:56 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Mon, 1 Sep 2008 12:49:56 -0500
Subject: [Bioperl-l] Bio::Tools::dpAlign feature request
In-Reply-To: <99A57523-94B3-4A56-A617-22675FA10AB8@bioperl.org>
References: <868888.19741.qm@web30406.mail.mud.yahoo.com>
	<99A57523-94B3-4A56-A617-22675FA10AB8@bioperl.org>
Message-ID: <44D25826-BE42-4539-8567-468FE74571B4@illinois.edu>

On pSW: I agree, I don't think it is worth maintaining it considering  
there are actively supported C/C++-based toolkits with similar  
functionality (SeqAn) and Petr's BioLib initiative will likely be a  
more maintainable effort.

chris

On Sep 1, 2008, at 2:42 AM, Jason Stajich wrote:

> Safe to ignore the tests.  Those that are failing aren't even test  
> for Bio::Align::dpAlign - but were written to test a bug that has  
> not been fixed in the EVD module if I remember correctly that is why  
> they are marked in a TODO block, but I can't tell if the Test.pm is  
> actually skipping these tests or not.
>
> I think we probably need to deprecate some of these modules as there  
> is no maintainer of Ewan's code in here.
>
> At a minimum we need to modularlize the tests for these modules into  
> separate t dir and fix the need for multiple Makefile.PL in here and  
> probably move to Build.PL
>
> -jason
> On Aug 28, 2008, at 11:00 AM, Yee Man Chan wrote:
>
>>
>> Hi Alexie
>>
>> My understanding is that you can ignore these failures.
>>
>> I believe test cases 17-20 were added by Jason Stajich before I  
>> added the feature you requested. I am not sure what he was doing  
>> there.
>>
>> I suppose he can give you the definite answer to whether this is  
>> something important or not.
>>
>> By the way, did you try out the new feature? Does it work?
>>
>> Thanks
>> Yee Man
>>
>> --- On Thu, 8/28/08, Alexie Papanicolaou <apapanicolaou at ice.mpg.de>  
>> wrote:
>>
>>> From: Alexie Papanicolaou <apapanicolaou at ice.mpg.de>
>>> Subject: Re: Bio::Tools::dpAlign feature request
>>> To: "Yee Man Chan" <ymc at yahoo.com>
>>> Date: Thursday, August 28, 2008, 6:15 AM
>>> hi
>>>
>>> is the version you emailed me newer or older than the
>>> subversion one?
>>>
>>> i'm testing the subversion version for bioperl-ext and
>>>
>>> not ok 17 # TODO evalues vary based on platform, needs
>>> fixing
>>> #   Failed (TODO) test at test.pl line 156.
>>> #          got: '2027805538'
>>> #     expected: '1764904'
>>> not ok 18 # TODO evalues vary based on platform, needs
>>> fixing
>>> #   Failed (TODO) test at test.pl line 157.
>>> #          got: '-1375488148'
>>> #     expected: '1764872'
>>> not ok 19 # TODO evalues vary based on platform, needs
>>> fixing
>>> #   Failed (TODO) test at test.pl line 158.
>>> #          got: '-808808307'
>>> #     expected: '1764872'
>>> not ok 20 # TODO evalues vary based on platform, needs
>>> fixing
>>> #   Failed (TODO) test at test.pl line 159.
>>> #          got: '-2118162890'
>>> #     expected: '1764872'
>>>
>>> you think these are ok to ignore?
>>>
>>>
>>> On Fri, 2008-08-01 at 21:03 -0700, Yee Man Chan wrote:
>>>
>>>> Hi Alexie
>>>>
>>>>  Attached are the files that contains the feature
>>> you requested. linspc.c is the one that does the work and
>>> test.pl has a test case for it. The scoring scheme is as
>>> described before. Please let me know if it works.
>>>>
>>>> Yee Man
>>>>
>>>> --- On Wed, 7/30/08, Alexie Papanicolaou
>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>
>>>>> From: Alexie Papanicolaou
>>> <apapanicolaou at ice.mpg.de>
>>>>> Subject: Re: Bio::Tools::dpAlign feature request
>>>>> To: ymc at yahoo.com
>>>>> Date: Wednesday, July 30, 2008, 2:44 PM
>>>>> Oh sorry
>>>>>
>>>>> Say match=3 and mismatch=-1, gopen= -10, gext=-5
>>>>> for aligning
>>>>> seq1: ATG
>>>>> seq2: ATT
>>>>> match: 3,3,-1
>>>>>
>>>>> seq1: AT-G
>>>>> seq2: ATTG
>>>>> match: 3,3,-1,-10,3
>>>>>
>>>>> is that possible? or am I missing something? I
>>> was only
>>>>> today wondering
>>>>> if it is even possible...
>>>>>
>>>>> a
>>>>>
>>>>>
>>>>> Yee Man Chan wrote:
>>>>>> Sorry, I don't quite get it. Can you
>>> give me an
>>>>> example of the output you want?
>>>>>>
>>>>>> Yee Man
>>>>>>
>>>>>> --- On Wed, 7/30/08, Alexie Papanicolaou
>>>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>>>
>>>>>>
>>>>>>> From: Alexie Papanicolaou
>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>> Subject: Re: Bio::Tools::dpAlign feature
>>> request
>>>>>>> To: ymc at yahoo.com
>>>>>>> Date: Wednesday, July 30, 2008, 9:50 AM
>>>>>>> Dear Yee Man,
>>>>>>>
>>>>>>> Do you think it is possible to code a
>>> method for
>>>>> creating a
>>>>>>> delimited
>>>>>>> (space or comma) "score-line"?
>>>>>>>
>>>>>>> I'd like to parse it into an array
>>> and have
>>>>> the
>>>>>>> individual score for
>>>>>>> each alignment position. Is it easy to
>>> do?
>>>>>>>
>>>>>>> a
>>>>>>>
>>>>>>> Yee Man Chan wrote:
>>>>>>>
>>>>>>>> Hi Alexie
>>>>>>>>
>>>>>>>>  How about I implement the simple
>>> case?
>>>>>>>>
>>>>>>>> So for match = +3, mismatch = -1,
>>>>>>>>
>>>>>>>> A and R = +3
>>>>>>>> A and Y = -1
>>>>>>>> A and B = -1
>>>>>>>> A and D = +3
>>>>>>>> A and N = +3
>>>>>>>> A and X = -1
>>>>>>>>
>>>>>>>> What do you think?
>>>>>>>> Yee Man
>>>>>>>>
>>>>>>>>
>>>>>>>> --- On Tue, 7/29/08, Alexie
>>> Papanicolaou
>>>>>>>>
>>>>>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>>> From: Alexie Papanicolaou
>>>>>>>>>
>>>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>>
>>>>>>>>> Subject: Re: Bio::Tools::dpAlign
>>> feature
>>>>> request
>>>>>>>>> To: ymc at yahoo.com
>>>>>>>>> Date: Tuesday, July 29, 2008,
>>> 10:58 AM
>>>>>>>>> Dear Yee Man,
>>>>>>>>> hello, I was wondering how is
>>> this
>>>>> progressing and
>>>>>>>>>
>>>>>>> if you
>>>>>>>
>>>>>>>>> need help?
>>>>>>>>>
>>>>>>>>> many thanks
>>>>>>>>> alexie
>>>>>>>>>
>>>>>>>>> Yee Man Chan wrote:
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>> Hi Alexie
>>>>>>>>>>
>>>>>>>>>>  There are two ways to
>>> compute the
>>>>> score for
>>>>>>>>>>
>>>>>>> each
>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>> aligned basepair in dpAlign
>>> module. One is
>>>>>>>>>
>>>>>>> match/mismatch
>>>>>>>
>>>>>>>>> if you specify your sequence as
>>> DNA and
>>>>> the other
>>>>>>>>>
>>>>>>> is a
>>>>>>>
>>>>>>>>> scoring matrix if you specify
>>> your
>>>>> sequence as
>>>>>>>>>
>>>>>>> protein.
>>>>>>>
>>>>>>>>> Obviously, the latter can
>>> completely
>>>>> dominate the
>>>>>>>>>
>>>>>>> former.
>>>>>>>
>>>>>>>>> If you take the time to type the
>>> scoring
>>>>> matrix
>>>>>>>>>
>>>>>>> file, then
>>>>>>>
>>>>>>>>> you can handle those IUPAC code
>>> by
>>>>> specifying the
>>>>>>>>>
>>>>>>> sequence
>>>>>>>
>>>>>>>>> as proteins.
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>  If you think this is too
>>>>> troublesome, then
>>>>>>>>>>
>>>>>>> I might
>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>> be able to extend the
>>> match/mismatch route
>>>>> to
>>>>>>>>>
>>>>>>> handle IUPAC
>>>>>>>
>>>>>>>>> codes. But the problem here is,
>>> how should
>>>>> I score
>>>>>>>>>
>>>>>>> a match
>>>>>>>
>>>>>>>>> of A and W when match is +3 and
>>> mismatch
>>>>> is -1?
>>>>>>>>>
>>>>>>> Should it
>>>>>>>
>>>>>>>>> have a score of +3/3 = +1 for
>>> match or
>>>>> +3/3-1*2/3
>>>>>>>>>
>>>>>>> = +1/3?
>>>>>>>
>>>>>>>>> Do you know what the convention
>>> is? If
>>>>> not, maybe
>>>>>>>>>
>>>>>>> you can
>>>>>>>
>>>>>>>>> tell me what you think the score
>>> will be?
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>> Yee Man
>>>>>>>>>>
>>>>>>>>>> --- On Thu, 6/26/08, Alexie
>>>>> Papanicolaou
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>> <apapanicolaou at ice.mpg.de>
>>> wrote:
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>> From: Alexie
>>> Papanicolaou
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> Subject:
>>> Bio::Tools::dpAlign
>>>>> feature
>>>>>>>>>>>
>>>>>>> request
>>>>>>>
>>>>>>>>>>> To: ymc at yahoo.com
>>>>>>>>>>> Date: Thursday, June 26,
>>> 2008,
>>>>> 4:15 AM
>>>>>>>>>>> Dear Yee Man Chan,
>>>>>>>>>>>
>>>>>>>>>>> Many thank you for this
>>> module. I
>>>>> like it
>>>>>>>>>>>
>>>>>>> very
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> much. I was
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> wondering if
>>>>>>>>>>> it would be possible for
>>> you to
>>>>> allow for
>>>>>>>>>>>
>>>>>>> IUPAC
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> DNA codes.
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> I see it is in your TODO
>>> list and
>>>>> I hoped
>>>>>>>>>>>
>>>>>>> to
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> inspire you
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> :-)
>>>>>>>>>>>
>>>>>>>>>>> Even a simple measure
>>> with the
>>>>> degenerate
>>>>>>>>>>>
>>>>>>> base
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> containing
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> the aligned
>>>>>>>>>>> base count as a
>>> (perfect) match
>>>>> would be
>>>>>>>>>>>
>>>>>>> very
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> useful to me
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> (i'm sorry, i
>>>>>>>>>>> 'm not a good coder
>>> to do it
>>>>> myself).
>>>>>>>>>>>
>>>>>>>>>>> many thanks for your
>>> work so far.
>>>>>>>>>>> alexie
>>>>>>>>>>>
>>>>>>>>>>> -- 
>>>>>>>>>>> --
>>>>>>>>>>> "Eppur si
>>> evolve"
>>>>> ("And yet
>>>>>>>>>>>
>>>>>>> it
>>>>>>>
>>>>>>>>>>> evolves")
>>>>>>>>>>> -Galileo Jr (ca 21st
>>> century)
>>>>>>>>>>>
>>>>>>>>>>> --
>>>>>>>>>>> Alexie Papanicolaou
>>>>>>>>>>> Entomology
>>>>>>>>>>> Max Planck Institute for
>>> Chemical
>>>>> Ecology
>>>>>>>>>>> Hans Knoell Str 8
>>>>>>>>>>> Jena 07745
>>>>>>>>>>> Germany
>>>>>>>>>>> Email
>>> apapanicolaou at ice.mpg.de
>>>>>>>>>>> Tel +493641571561
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>> -- 
>>>>>>>>> --
>>>>>>>>> "Eppur si evolve"
>>> ("And yet
>>>>> it
>>>>>>>>> evolves")
>>>>>>>>> -Galileo Jr (ca 21st century)
>>>>>>>>>
>>>>>>>>> "One Galileo in two
>>> thousand years is
>>>>>>>>>
>>>>>>> enough."
>>>>>>>
>>>>>>>>> -Pope Pius XII
>>>>>>>>> --
>>>>>>>>> Alexie Papanicolaou
>>>>>>>>> Entomology
>>>>>>>>> Max Planck Institute for
>>> Chemical Ecology
>>>>>>>>> Hans Knoell Str 8
>>>>>>>>> Jena 07745
>>>>>>>>> Germany
>>>>>>>>> Email apapanicolaou at ice.mpg.de
>>>>>>>>> Tel +493641571561
>>>>>>>>>
>>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>> -- 
>>>>>>> --
>>>>>>> "Eppur si evolve" ("And
>>> yet it
>>>>>>> evolves")
>>>>>>> -Galileo Jr (ca 21st century)
>>>>>>>
>>>>>>> "One Galileo in two thousand years
>>> is
>>>>> enough."
>>>>>>> -Pope Pius XII
>>>>>>> --
>>>>>>> Alexie Papanicolaou
>>>>>>> Entomology
>>>>>>> Max Planck Institute for Chemical
>>> Ecology
>>>>>>> Hans Knoell Str 8
>>>>>>> Jena 07745
>>>>>>> Germany
>>>>>>> Email apapanicolaou at ice.mpg.de
>>>>>>> Tel +493641571561
>>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>
>>>>> -- 
>>>>> --
>>>>> "Eppur si evolve" ("And yet it
>>>>> evolves")
>>>>> -Galileo Jr (ca 21st century)
>>>>>
>>>>> "One Galileo in two thousand years is
>>> enough."
>>>>> -Pope Pius XII
>>>>> --
>>>>> Alexie Papanicolaou
>>>>> Entomology
>>>>> Max Planck Institute for Chemical Ecology
>>>>> Hans Knoell Str 8
>>>>> Jena 07745
>>>>> Germany
>>>>> Email apapanicolaou at ice.mpg.de
>>>>> Tel +493641571561
>>>>
>>>>
>>>>
>>>
>>> -- 
>>> -- 
>>> "Eppur si evolve" ("And yet it
>>> evolves")
>>> -Galileo Jr (ca 21st century)
>>>
>>> "One Galileo in two thousand years is enough."
>>> -Pope Pius XII
>>> -- 
>>> Alexie Papanicolaou
>>> Entomology
>>> Max Planck Institute for Chemical Ecology
>>> Hans Knoell Str 8
>>> Jena 07745
>>> Germany
>>> Email apapanicolaou at ice.mpg.de
>>> Tel +493641571561
>>
>>
>>
>
> Jason Stajich
> jason at bioperl.org
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign





From lmanchon at univ-montp2.fr  Wed Sep  3 09:04:14 2008
From: lmanchon at univ-montp2.fr (Laurent Manchon)
Date: Wed, 03 Sep 2008 15:04:14 +0200
Subject: [Bioperl-l] parsing result of CAP3 (ACE file)
Message-ID: <5.0.2.1.2.20080903150203.00c0db18@pop.univ-montp2.fr>

-- Hi,

Is somebody have a piece of code to parse result of CAP3 assembly program which
format is ACE ?
I need to retrieve the alignment from this file.

thank you,
Laurent --




+---------------------------------------------+
  Laurent Manchon
  Email: lmanchon at univ-montp2.fr
+---------------------------------------------+

From osborne6 at gmail.com  Wed Sep  3 10:33:15 2008
From: osborne6 at gmail.com (John Osborne)
Date: Wed, 3 Sep 2008 09:33:15 -0500
Subject: [Bioperl-l] interpro parsing enhancement?
Message-ID: <324fccf0809030733y5c5e8592t5f0617d0ff4d2203@mail.gmail.com>

Hi -
I'm wondering if anyone is working on adding functionality to
Bio::SeqIO::interpro to grab the Gene Ontology/GO classifications out
of the interpro xml output?

I've started working on that myself, but wanted to check if anyone
else is doing the same.

Thanks!
-- 
John Osborne
osborne6 at ieee.org/osborne6 at gmail.com/jro at freeshell.org

From gundalav at gmail.com  Wed Sep  3 10:48:07 2008
From: gundalav at gmail.com (Gundala Viswanath)
Date: Wed, 3 Sep 2008 23:48:07 +0900
Subject: [Bioperl-l] Fitch's Parsimony Algorithm with Perl
Message-ID: <73f827b50809030748o725d3772m681af9da3c0c26c0@mail.gmail.com>

Hi,

What's a correct way to implement Fitch's parsimony algorithm?
Especially to compute minimum substitiution rate per column
in the aligned sequence.

Is there a Bioperl module to do it?

For example
CGGCGGAAAACTGTCCTCCGTGC   mouse
CGACGGAACATTCTCCTCCGCGC   rat
CGACGGAATATTCCCCTCCGTGC   human
CGACGGAAGACTCTCCTCCGTGC   chimp

00100000302011000000100   -> number of subst per site (max parsimony)

My code below doesn't seem to do the job.

__BEGIN__
use Data::Dumper;
use List::MoreUtils qw(uniq);

# The related phylogenetic in Newick format tree is:
my $tree = ' (mouse,rat,(human,chimp))';

my $sites = [
    'CGGCGGAAAACTGTCCTCCGTGC', # mouse
    'CGACGGAACATTCTCCTCCGCGC', # rat
    'CGACGGAATATTCCCCTCCGTGC', # human
    'CGACGGAAGACTCTCCTCCGTGC', # chimp
];

my @val = my_parsimony($sites);
print Dumper \@val;

sub my_parsimony {

    my  $tfbs   = shift;
    my $mlen = length($tfbs->[0]);

    my $sum_min = 0;
    my @mincol;

    foreach my $pos ( 0 .. $mlen-1 ) {

        my @colbp = ();
        foreach my $site ( @{$tfbs} ) {
            my $bp = substr($site,$pos,1);
            push @colbp, $bp;

        }

       # this heuristic seems to be faulty
       # Column 11 it predicts 1 instead of 2

       # Not sure how can I make use of the tree

        my $min_mm = scalar( uniq(@colbp) ) - 1;
        push @mincol, $min_mm;
    }

    return @mincol;
}

__END__

- Gundala Viswanath
Jakarta - Indonesia

From raulmendez at cbm.uam.es  Wed Sep  3 10:33:46 2008
From: raulmendez at cbm.uam.es (Raul Mendez Giraldez)
Date: Wed, 03 Sep 2008 16:33:46 +0200
Subject: [Bioperl-l] SeqHound
In-Reply-To: <111DD141-75F8-4437-9EAD-E049BBADB515@uiuc.edu>
Message-ID: <1220452426.31595.92.camel@pepa.cbm.uam.es>

Hi Chris,

I'm trying to set up and run bioperl Seqhound donwloaded from:

http://bond.unleashedinformatics.com/downloads/api//seqhound-bioperl-4.0.tar.gz

and I always get connection error messages. Do you know which version of
SeqHound should I use and how can I configure to make it work? I've
tried several possibilities for server1 at .shoundremrc as

[remote]
server1 = bond.unleashedinformatics.com
CGI = /cgi-bin/seqrem
port=8080

Also, I would like to get all the possible protein-protein interaction
for a set of protein sequences. Would this be possible using SeqHound?

Thanks,
Ra?l




-- 
Ra?l M?ndez Gir?ldez, Ph.D.
Bioinformatics Unit
Centre for Molecular Biology "Severo Ochoa"
Universidad Aut?noma de Madrid
C/ Nicol?s Cabrera, 1
Cantoblanco 28049, Madrid
SPAIN

Phone: +34 91 196 4633



From jaudall at gmail.com  Wed Sep  3 11:38:08 2008
From: jaudall at gmail.com (Joshua Udall)
Date: Wed, 3 Sep 2008 09:38:08 -0600
Subject: [Bioperl-l] parsing result of CAP3 (ACE file)
In-Reply-To: <5.0.2.1.2.20080903150203.00c0db18@pop.univ-montp2.fr>
References: <5.0.2.1.2.20080903150203.00c0db18@pop.univ-montp2.fr>
Message-ID: <52cea20c0809030838k6fb1498btc15b8e76d98f9d70@mail.gmail.com>

Laurent -

I have modified modules that will do it as I recently ran into problems with
the DB_FILE module in Assembly::IO.  In addition, the current version of
cap3 seems to put a contig length where a pad length is expected (based on
the Ace format description).  The modules I have will parse the ace file
contig-by-contig rather than having the entire assembly slurped into memory
(or a tied hash) all at once.  You are welcome to them if you are interested
and I'd like to get them in Bioperl at some point.  Bascially, there are
three files - a modified Contig.pm, ContigIO.pm, and a modified ace.pm (in a
ContigIO directory).

Josh

On Wed, Sep 3, 2008 at 7:04 AM, Laurent Manchon <lmanchon at univ-montp2.fr>wrote:

> -- Hi,
>
> Is somebody have a piece of code to parse result of CAP3 assembly program
> which
> format is ACE ?
> I need to retrieve the alignment from this file.
>
> thank you,
> Laurent --
>
>
>
>
> +---------------------------------------------+
>  Laurent Manchon
>  Email: lmanchon at univ-montp2.fr
> +---------------------------------------------+
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Joshua Udall
Assistant Professor
295 WIDB
Plant and Wildlife Science Dept.
Brigham Young University
Provo, UT 84602
801-422-9307
Fax: 801-422-0008
USA

From hartzell at alerce.com  Wed Sep  3 19:19:45 2008
From: hartzell at alerce.com (George Hartzell)
Date: Wed, 3 Sep 2008 16:19:45 -0700
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
Message-ID: <18623.7057.95449.99461@almost.alerce.com>


Ok, confess.  None of you know what's up with line 248 of
Bio::Coordinate::Pair, do you?  You probably don't even know what's
*on* that line.  Wonder how many will go look.

Now that I either have your attention or have pissed you off (or
both...), I think that creating a new Bio::Location::Split object in
Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
quite sure enough to excise it and commit the change.

Anyone up for it?

g.

From cjfields at illinois.edu  Wed Sep  3 21:29:49 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 3 Sep 2008 20:29:49 -0500
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
In-Reply-To: <18623.7057.95449.99461@almost.alerce.com>
References: <18623.7057.95449.99461@almost.alerce.com>
Message-ID: <C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>

Well, it doesn't look like the SplitLocation is even used, so I think  
it is safe to remove.

chris

On Sep 3, 2008, at 6:19 PM, George Hartzell wrote:

>
> Ok, confess.  None of you know what's up with line 248 of
> Bio::Coordinate::Pair, do you?  You probably don't even know what's
> *on* that line.  Wonder how many will go look.
>
> Now that I either have your attention or have pissed you off (or
> both...), I think that creating a new Bio::Location::Split object in
> Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
> quite sure enough to excise it and commit the change.
>
> Anyone up for it?
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign





From jason at bioperl.org  Thu Sep  4 00:40:38 2008
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 3 Sep 2008 21:40:38 -0700
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
In-Reply-To: <C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>
References: <18623.7057.95449.99461@almost.alerce.com>
	<C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>
Message-ID: <222DB5D8-BCCB-448E-BDEE-068A4A432660@bioperl.org>

Agreed - I don't know if that was something was changed mid-stream,  
but removing it should cause no pain...
-j
On Sep 3, 2008, at 6:29 PM, Chris Fields wrote:

> Well, it doesn't look like the SplitLocation is even used, so I  
> think it is safe to remove.
>
> chris
>
> On Sep 3, 2008, at 6:19 PM, George Hartzell wrote:
>
>>
>> Ok, confess.  None of you know what's up with line 248 of
>> Bio::Coordinate::Pair, do you?  You probably don't even know what's
>> *on* that line.  Wonder how many will go look.
>>
>> Now that I either have your attention or have pissed you off (or
>> both...), I think that creating a new Bio::Location::Split object in
>> Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
>> quite sure enough to excise it and commit the change.
>>
>> Anyone up for it?
>>
>> g.
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Marie-Claude Hofmann
> College of Veterinary Medicine
> University of Illinois Urbana-Champaign
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org




From heikki at sanbi.ac.za  Thu Sep  4 02:17:31 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Thu, 4 Sep 2008 08:17:31 +0200
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
In-Reply-To: <222DB5D8-BCCB-448E-BDEE-068A4A432660@bioperl.org>
References: <18623.7057.95449.99461@almost.alerce.com>
	<C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>
	<222DB5D8-BCCB-448E-BDEE-068A4A432660@bioperl.org>
Message-ID: <200809040817.31916.heikki@sanbi.ac.za>

Quilty. So I removed the line.

George, please do not try to piss us off. You can get all the attention you 
want from us. :)

What are you planning to do to Bio::Coordinate classes?

   -Heikki


On Thursday 04 September 2008 06:40:38 Jason Stajich wrote:
> Agreed - I don't know if that was something was changed mid-stream,
> but removing it should cause no pain...
> -j
>
> On Sep 3, 2008, at 6:29 PM, Chris Fields wrote:
> > Well, it doesn't look like the SplitLocation is even used, so I
> > think it is safe to remove.
> >
> > chris
> >
> > On Sep 3, 2008, at 6:19 PM, George Hartzell wrote:
> >> Ok, confess.  None of you know what's up with line 248 of
> >> Bio::Coordinate::Pair, do you?  You probably don't even know what's
> >> *on* that line.  Wonder how many will go look.
> >>
> >> Now that I either have your attention or have pissed you off (or
> >> both...), I think that creating a new Bio::Location::Split object in
> >> Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
> >> quite sure enough to excise it and commit the change.
> >>
> >> Anyone up for it?
> >>
> >> g.
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> > Christopher Fields
> > Postdoctoral Researcher
> > Lab of Dr. Marie-Claude Hofmann
> > College of Veterinary Medicine
> > University of Illinois Urbana-Champaign
> >
> >
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Jason Stajich
> jason at bioperl.org
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________


From hartzell at alerce.com  Thu Sep  4 12:00:21 2008
From: hartzell at alerce.com (George Hartzell)
Date: Thu, 4 Sep 2008 09:00:21 -0700
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
In-Reply-To: <200809040817.31916.heikki@sanbi.ac.za>
References: <18623.7057.95449.99461@almost.alerce.com>
	<C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>
	<222DB5D8-BCCB-448E-BDEE-068A4A432660@bioperl.org>
	<200809040817.31916.heikki@sanbi.ac.za>
Message-ID: <18624.1557.758033.258065@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > Quilty. So I removed the line.
 > 
 > George, please do not try to piss us off. You can get all the attention you 
 > want from us. :)

Try not. Do... or do not. There is no try.

 > What are you planning to do to Bio::Coordinate classes?

It's a project for a paying customer (yikes...).  Pretty much exactly
what GeneMapper does, though I'll probably end up dangling a couple
more named coordinate spaces off of it.  Nothing earth shattering.
The classes look *great*.

g.

From hartzell at alerce.com  Fri Sep  5 15:01:35 2008
From: hartzell at alerce.com (George Hartzell)
Date: Fri, 05 Sep 2008 12:01:35 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean better
	(w/ patch)
Message-ID: <m263pabenk.fsf@almost.alerce.com>


Hi all,

Bio::Coordinate::Collection surprised me a bit.  At first I thought
there was a bug, but it's clearly doing what it's supposed to.  Now
I'm wondering if what it's supposed to be doing makes sense in some
context, or if what I expected would be better functionality.

t/CoordinateMapper.t sets up the following scenario:

#
# Collection
#
#         1   5     6   10
#         |---|     |---|
#-----|-----------------------
#     1   5   9     15  19
#         pair1     pair2

Then goes on to do the following query:

  # match more than two
  $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
  ok $res = $transcribe->map($pos);
  is $res->each_gap, 2;
  is $res->each_match, 2;

I was surprised to see that there were two gaps, one gene:10-19 and
one from gene:5-14.  Looking at the code, what's really happening is
that, for the exon1 mapper there's match with gene:5-9 and a gap with
gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
match with gene:15-19.  All four Result's just get tossed into the
return value.

The result my intuition wants is that there are two matches (gene:5-9
with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).

Yes, I guess that I could just synthesize these myself from the result
in my app.

It still seems that the current result is a bug though, since there's
no way of knowing when you're walking through $res->each_Location that
the first "gap" is with respect to the exon1 mapper and that the
second "gap" is with respect to the exon2 mapper.  The gaps are
meaningless.

I "fixed" it to work the way I think it should (two matches, one
gap).  I actually extended the test case a bit so that there's a
multi-base gap, a match, another multibase-gap, another match, then a
single base gap (just to make sure I got that right...).  I had to
touch up the test file a bit to account for my new test.

The gaps that I return have a strand of 'undef', which seems to be The
Right Thing.  There's also a bit of funny business where I hang onto
the seq_id of the gapped sequence.  It assumes that the "in" sequence
is the same for all of the mappers.  This seems safe since otherwise
the entire query is kind of weird....

There's a patch to todays svn head at:

  http://shrimp.alerce.com/bioperl/collection-diffs.txt

The patch changes Build.PL to include a dependency on Set::IntSpan,
CoordinateMapper.t to update the tests, and
Bio/CoordinateMapper/Collection.pm for the new code.

Who's code would this break.

If anyone's relying on the current behaviour re: gaps, what's the
situation in which you find it useful?

Thanks!

g.

From ajmackey at gmail.com  Fri Sep  5 16:54:56 2008
From: ajmackey at gmail.com (Aaron Mackey)
Date: Fri, 5 Sep 2008 16:54:56 -0400
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better (w/ patch)
In-Reply-To: <m263pabenk.fsf@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
Message-ID: <24c96eca0809051354h5b7218edtaa720140901d023f@mail.gmail.com>

There are two uses for Collection:

1) all the "in" seq_id's are the same, and George's patch makes sense to me
(i.e. agrees with my intuition)

2) all the "in" seq_id's are *not* the same (i.e. the collection is just a
hash of indivual pairs), in which case my query would only match the subset
of pairs having identical seq_id's to that specified by the query ... and
then you're back to case #1

So overall, it looks like this was a bug, but I'd of course want to hear
Heikki's opinion.

Thanks for raising this,

-Aaron

On Fri, Sep 5, 2008 at 3:01 PM, George Hartzell <hartzell at alerce.com> wrote:

>
> Hi all,
>
> Bio::Coordinate::Collection surprised me a bit.  At first I thought
> there was a bug, but it's clearly doing what it's supposed to.  Now
> I'm wondering if what it's supposed to be doing makes sense in some
> context, or if what I expected would be better functionality.
>
> t/CoordinateMapper.t sets up the following scenario:
>
> #
> # Collection
> #
> #         1   5     6   10
> #         |---|     |---|
> #-----|-----------------------
> #     1   5   9     15  19
> #         pair1     pair2
>
> Then goes on to do the following query:
>
>  # match more than two
>  $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
>  ok $res = $transcribe->map($pos);
>  is $res->each_gap, 2;
>  is $res->each_match, 2;
>
> I was surprised to see that there were two gaps, one gene:10-19 and
> one from gene:5-14.  Looking at the code, what's really happening is
> that, for the exon1 mapper there's match with gene:5-9 and a gap with
> gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
> match with gene:15-19.  All four Result's just get tossed into the
> return value.
>
> The result my intuition wants is that there are two matches (gene:5-9
> with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
>
> Yes, I guess that I could just synthesize these myself from the result
> in my app.
>
> It still seems that the current result is a bug though, since there's
> no way of knowing when you're walking through $res->each_Location that
> the first "gap" is with respect to the exon1 mapper and that the
> second "gap" is with respect to the exon2 mapper.  The gaps are
> meaningless.
>
> I "fixed" it to work the way I think it should (two matches, one
> gap).  I actually extended the test case a bit so that there's a
> multi-base gap, a match, another multibase-gap, another match, then a
> single base gap (just to make sure I got that right...).  I had to
> touch up the test file a bit to account for my new test.
>
> The gaps that I return have a strand of 'undef', which seems to be The
> Right Thing.  There's also a bit of funny business where I hang onto
> the seq_id of the gapped sequence.  It assumes that the "in" sequence
> is the same for all of the mappers.  This seems safe since otherwise
> the entire query is kind of weird....
>
> There's a patch to todays svn head at:
>
>  http://shrimp.alerce.com/bioperl/collection-diffs.txt
>
> The patch changes Build.PL to include a dependency on Set::IntSpan,
> CoordinateMapper.t to update the tests, and
> Bio/CoordinateMapper/Collection.pm for the new code.
>
> Who's code would this break.
>
> If anyone's relying on the current behaviour re: gaps, what's the
> situation in which you find it useful?
>
> Thanks!
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From jimhu at tamu.edu  Mon Sep  8 14:44:22 2008
From: jimhu at tamu.edu (Jim Hu)
Date: Mon, 8 Sep 2008 13:44:22 -0500
Subject: [Bioperl-l] Circular genomes in Chado/BioPerl
Message-ID: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>

In discussions with GMOD about Gbrowse, we've come up with a proposal  
for handling circular genomes and features that cross the origin in  
such genomes.  This applies to lots of prokaryotic and viral genomes,  
and might be valuable for some ways of representing terminally  
redundant linear genomes.

1) Keep the requirement that start < end
2) allow end > parent feature length
3) parent feature gets an is_circular boolean
4) use modular arithmetic to calculate the real position of end on the  
parent feature.

We'd like to do this in a way that will be consistent with Chado and  
BioPerl representation of features as much as possible (realizing that  
there is the usual interbase or not coordinate issue).  What do people  
think?  Lincoln is on board for modifying the GFF3 spec.

Thanks!

Jim Hu

=====================================
Jim Hu
Associate Professor
Dept. of Biochemistry and Biophysics
2128 TAMU
Texas A&M Univ.
College Station, TX 77843-2128
979-862-4054



From ajmackey at gmail.com  Mon Sep  8 15:57:50 2008
From: ajmackey at gmail.com (Aaron Mackey)
Date: Mon, 8 Sep 2008 15:57:50 -0400
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
Message-ID: <24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>

How can you handle features that may cross the origin more than once?
The modulus, though simple, seems to be only half the solution.  It
also makes it difficult to place features in the genome "by eye"
(having to do the modulus subtraction in my head), or in
sorting/filtering operations.

I have an alternative that I wondered if you considered: allow the
start/end to have an additional "circular revolution" prefix:

a typical range tuple like: 100 200 -
is thus shorthand for: 0:100 0:200 -
(i.e. both the 100 and 200 are in the same "revolution" around the genome)

and is then distinguishable from an "around the genome + 100" feature of:
1:100 0:200 -

Just an alternative to consider (if you haven't already).  I'm not
wedded to the syntax, but I wouldn't want to see new columns in GFF
just for this.  Essentially, what you want is some form of compound
polar coordinates, it seems.

-Aaron

On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
> In discussions with GMOD about Gbrowse, we've come up with a proposal for
> handling circular genomes and features that cross the origin in such
> genomes.  This applies to lots of prokaryotic and viral genomes, and might
> be valuable for some ways of representing terminally redundant linear
> genomes.
> 1) Keep the requirement that start < end
> 2) allow end > parent feature length
> 3) parent feature gets an is_circular boolean
> 4) use modular arithmetic to calculate the real position of end on the
> parent feature.
> We'd like to do this in a way that will be consistent with Chado and BioPerl
> representation of features as much as possible (realizing that there is the
> usual interbase or not coordinate issue).  What do people think?  Lincoln is
> on board for modifying the GFF3 spec.
> Thanks!
> Jim Hu
>
> =====================================
>
> Jim Hu
>
> Associate Professor
>
> Dept. of Biochemistry and Biophysics
>
> 2128 TAMU
>
> Texas A&M Univ.
>
> College Station, TX 77843-2128
>
> 979-862-4054
>
>
> -------------------------------------------------------------------------
> This SF.Net email is sponsored by the Moblin Your Move Developer's challenge
> Build the coolest Linux based applications with Moblin SDK & win great
> prizes
> Grand prize is a trip for two to an Open Source event anywhere in the world
> http://moblin-contest.org/redirect.php?banner_id=100&url=/
> _______________________________________________
> Gmod-schema mailing list
> Gmod-schema at lists.sourceforge.net
> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>
>

From js5 at sanger.ac.uk  Mon Sep  8 16:13:12 2008
From: js5 at sanger.ac.uk (James Smith)
Date: Mon, 8 Sep 2008 21:13:12 +0100 (BST)
Subject: [Bioperl-l] Circular genomes in Chado/BioPerl
In-Reply-To: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
Message-ID: <Pine.LNX.4.64.0809082111280.23303@cbi4g.internal.sanger.ac.uk>



On Mon, 8 Sep 2008, Jim Hu wrote:

> In discussions with GMOD about Gbrowse, we've come up with a proposal for 
> handling circular genomes and features that cross the origin in such genomes. 
> This applies to lots of prokaryotic and viral genomes, and might be valuable 
> for some ways of representing terminally redundant linear genomes.
>
> 1) Keep the requirement that start < end
> 2) allow end > parent feature length
> 3) parent feature gets an is_circular boolean
> 4) use modular arithmetic to calculate the real position of end on the parent 
> feature.

This is how we are considering handling features in Ensembl as well (the 
Ensembl genomes project will be setting up websites for bacterial and 
viral genomes)


>
> We'd like to do this in a way that will be consistent with Chado and BioPerl 
> representation of features as much as possible (realizing that there is the 
> usual interbase or not coordinate issue).  What do people think?  Lincoln is 
> on board for modifying the GFF3 spec.
>
> Thanks!
>
> Jim Hu
>
> =====================================
> Jim Hu
> Associate Professor
> Dept. of Biochemistry and Biophysics
> 2128 TAMU
> Texas A&M Univ.
> College Station, TX 77843-2128
> 979-862-4054
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 

From heikki at sanbi.ac.za  Tue Sep  9 03:50:11 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Tue, 9 Sep 2008 09:50:11 +0200
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better (w/ patch)
In-Reply-To: <m263pabenk.fsf@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
Message-ID: <200809090950.11821.heikki@sanbi.ac.za>

George,

This is an error from my side. Great that you have a fix already.

My only worry is the number of external dependencies in BioPerl. To limit 
these we have recoded number of functionalities into BioPerl-specific modules. 
Before you commit the fix, could you see if Bio::RangeI could be used or easily 
extended to be used instead of Set::IntSpan?

Thanks,

   -Heikki

On Friday 05 September 2008 21:01:35 George Hartzell wrote:
> Hi all,
>
> Bio::Coordinate::Collection surprised me a bit.  At first I thought
> there was a bug, but it's clearly doing what it's supposed to.  Now
> I'm wondering if what it's supposed to be doing makes sense in some
> context, or if what I expected would be better functionality.
>
> t/CoordinateMapper.t sets up the following scenario:
>
> #
> # Collection
> #
> #         1   5     6   10
> #         |---|     |---|
> #-----|-----------------------
> #     1   5   9     15  19
> #         pair1     pair2
>
> Then goes on to do the following query:
>
>   # match more than two
>   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
>   ok $res = $transcribe->map($pos);
>   is $res->each_gap, 2;
>   is $res->each_match, 2;
>
> I was surprised to see that there were two gaps, one gene:10-19 and
> one from gene:5-14.  Looking at the code, what's really happening is
> that, for the exon1 mapper there's match with gene:5-9 and a gap with
> gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
> match with gene:15-19.  All four Result's just get tossed into the
> return value.
>
> The result my intuition wants is that there are two matches (gene:5-9
> with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
>
> Yes, I guess that I could just synthesize these myself from the result
> in my app.
>
> It still seems that the current result is a bug though, since there's
> no way of knowing when you're walking through $res->each_Location that
> the first "gap" is with respect to the exon1 mapper and that the
> second "gap" is with respect to the exon2 mapper.  The gaps are
> meaningless.
>
> I "fixed" it to work the way I think it should (two matches, one
> gap).  I actually extended the test case a bit so that there's a
> multi-base gap, a match, another multibase-gap, another match, then a
> single base gap (just to make sure I got that right...).  I had to
> touch up the test file a bit to account for my new test.
>
> The gaps that I return have a strand of 'undef', which seems to be The
> Right Thing.  There's also a bit of funny business where I hang onto
> the seq_id of the gapped sequence.  It assumes that the "in" sequence
> is the same for all of the mappers.  This seems safe since otherwise
> the entire query is kind of weird....
>
> There's a patch to todays svn head at:
>
>   http://shrimp.alerce.com/bioperl/collection-diffs.txt
>
> The patch changes Build.PL to include a dependency on Set::IntSpan,
> CoordinateMapper.t to update the tests, and
> Bio/CoordinateMapper/Collection.pm for the new code.
>
> Who's code would this break.
>
> If anyone's relying on the current behaviour re: gaps, what's the
> situation in which you find it useful?
>
> Thanks!
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________


From heikki at sanbi.ac.za  Tue Sep  9 03:50:11 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Tue, 9 Sep 2008 09:50:11 +0200
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better (w/ patch)
In-Reply-To: <m263pabenk.fsf@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
Message-ID: <200809090950.11821.heikki@sanbi.ac.za>

George,

This is an error from my side. Great that you have a fix already.

My only worry is the number of external dependencies in BioPerl. To limit 
these we have recoded number of functionalities into BioPerl-specific modules. 
Before you commit the fix, could you see if Bio::RangeI could be used or easily 
extended to be used instead of Set::IntSpan?

Thanks,

   -Heikki

On Friday 05 September 2008 21:01:35 George Hartzell wrote:
> Hi all,
>
> Bio::Coordinate::Collection surprised me a bit.  At first I thought
> there was a bug, but it's clearly doing what it's supposed to.  Now
> I'm wondering if what it's supposed to be doing makes sense in some
> context, or if what I expected would be better functionality.
>
> t/CoordinateMapper.t sets up the following scenario:
>
> #
> # Collection
> #
> #         1   5     6   10
> #         |---|     |---|
> #-----|-----------------------
> #     1   5   9     15  19
> #         pair1     pair2
>
> Then goes on to do the following query:
>
>   # match more than two
>   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
>   ok $res = $transcribe->map($pos);
>   is $res->each_gap, 2;
>   is $res->each_match, 2;
>
> I was surprised to see that there were two gaps, one gene:10-19 and
> one from gene:5-14.  Looking at the code, what's really happening is
> that, for the exon1 mapper there's match with gene:5-9 and a gap with
> gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
> match with gene:15-19.  All four Result's just get tossed into the
> return value.
>
> The result my intuition wants is that there are two matches (gene:5-9
> with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
>
> Yes, I guess that I could just synthesize these myself from the result
> in my app.
>
> It still seems that the current result is a bug though, since there's
> no way of knowing when you're walking through $res->each_Location that
> the first "gap" is with respect to the exon1 mapper and that the
> second "gap" is with respect to the exon2 mapper.  The gaps are
> meaningless.
>
> I "fixed" it to work the way I think it should (two matches, one
> gap).  I actually extended the test case a bit so that there's a
> multi-base gap, a match, another multibase-gap, another match, then a
> single base gap (just to make sure I got that right...).  I had to
> touch up the test file a bit to account for my new test.
>
> The gaps that I return have a strand of 'undef', which seems to be The
> Right Thing.  There's also a bit of funny business where I hang onto
> the seq_id of the gapped sequence.  It assumes that the "in" sequence
> is the same for all of the mappers.  This seems safe since otherwise
> the entire query is kind of weird....
>
> There's a patch to todays svn head at:
>
>   http://shrimp.alerce.com/bioperl/collection-diffs.txt
>
> The patch changes Build.PL to include a dependency on Set::IntSpan,
> CoordinateMapper.t to update the tests, and
> Bio/CoordinateMapper/Collection.pm for the new code.
>
> Who's code would this break.
>
> If anyone's relying on the current behaviour re: gaps, what's the
> situation in which you find it useful?
>
> Thanks!
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________


From Frigerio at pierroton.inra.fr  Tue Sep  9 04:45:19 2008
From: Frigerio at pierroton.inra.fr (Jean-Marc FRIGERIO)
Date: Tue, 9 Sep 2008 10:45:19 +0200
Subject: [Bioperl-l] parsing result of CAP3 (ACE file)
Message-ID: <200809091045.19249.Frigerio@pierroton.inra.fr>

> > -- Hi,
> >
> > Is somebody have a piece of code to parse result of CAP3 assembly program
> > which
> > format is ACE ?
> > I need to retrieve the alignment from this file.
> >
> > thank you,
> > Laurent --
> >
> >
> >
> >
> > +---------------------------------------------+
> >  Laurent Manchon
> >  Email: lmanchon at univ-montp2.fr
> > +---------------------------------------------+
>
> Laurent -
>
> I have modified modules that will do it as I recently ran into problems
> with the DB_FILE module in Assembly::IO.  In addition, the current version
> of cap3 seems to put a contig length where a pad length is expected (based
> on the Ace format description).  The modules I have will parse the ace file
> contig-by-contig rather than having the entire assembly slurped into memory
> (or a tied hash) all at once.  You are welcome to them if you are
> interested and I'd like to get them in Bioperl at some point.  Bascially,
> there are three files - a modified Contig.pm, ContigIO.pm, and a modified
> ace.pm (in a ContigIO directory).
>
> Josh

Hi,
Here are a 2 pieces of code running on an ace file (output of phrap is that 
the same as cap3 ?)
----------------------------- 1 -----------------------------------------
my $assembly = Bio::Assembly::IO->new('-file'    => $file,
                                 '-format'  => 'ace')->next_assembly;

for my $contig ($assembly->all_contigs)
{
    my $ct_seq  = $contig->get_consensus_sequence;
    (my $ref_seq = uc $ct_seq->seq) =~ s/-//g;

    my $debut  = $pos - 100 > 0 ? $pos - 100 : 1;
    my $fin    = $pos + 100 <= length $ref_seq ?
                 $pos + 100 :  length $ref_seq;

    my $coll = $contig->get_features_collection;
    my @coll = $coll->features_in_range('-start' => $debut, '-end' => $fin);
    for my $tag (@coll)
    {
        next unless  $tag->primary_tag eq 'comment';
#print "TAG: ",$tag->start,"\n";
        my $tag_pos = $contig->change_coord('gapped consensus','ungapped 
consensus',$tag->start);
#print "TAG POS: $tag_pos\n";
        next if $pos == $tag_pos;

        substr($ref_seq,$tag_pos-1,1,'N');

    }
}



------------------------------------ 2 -------------------
 my $assembly = Bio::Assembly::IO->new(
    '-file'    => $file,
    '-format'  => 'ace')->next_assembly;
  for my $contig ($assembly->all_contigs)
  {
    for my $seq ($contig->each_seq)
    {
      my $id = $seq->id;
      my $s = $seq->seq;
      my ($start,$end) =
        ($contig->change_coord("aligned $id","ungapped consensus",
$seq->start),
         $contig->change_coord("aligned $id","ungapped consensus",$seq->end));
      my $dir = $seq->strand < 0 ? 'R' : 'F';
 ......
}
	-- Jean-Marc

From zheboyang at gmail.com  Tue Sep  9 07:05:15 2008
From: zheboyang at gmail.com (boyang zhe)
Date: Tue, 9 Sep 2008 19:05:15 +0800
Subject: [Bioperl-l] help:HMM parsing error
Message-ID: <127e75f60809090405h644e51eftcab073e8bf179720@mail.gmail.com>

  I write a script to parse the HMMER report ,it is as follows:
   #!/usr/bin/perl -w
   #TODO: Parse the HMMER report
   use strict;
   use Bio::SearchIO;
   my $directory="./HMM/";
   opendir(HMMDIR, $directory), or die "Can't open the directory!";
   my @filelist=readdir(HMMDIR);
   foreach my $filename(@filelist)
   {
   if ($filename !~/^\./)
   {
   my $infile="$directory"."$filename";
   my $outfile="$infile"."HMMParse";
   my $in = new Bio::SearchIO(-format => 'hmmer',-file =>"$infile");

- Ignored:
   while (my  $result= $in->next_result )
   {
   # get a Bio::Search::Result::HMMERResult object
   # get hits numbers
   my $hitnumber=$result->num_hits;
   if ($hitnumber != 0)
   {
   open(OUT, ">$outfile"), or die "can't open the output file!!!!";
   while (my $hits= $result->next_hit )
   {
   my $value=$hits->significance;
   if ($value <=0.01)
   {
         print OUT
   $hits->name,"\t",$hits->description,"\t",$hits->significance,"\n";
   }
   }
   close OUT;
   }
   }
   }
   }
   closedir(HMMDIR);
   ##############################################################

   When it run, you will see that:

   -------------------- WARNING ---------------------
   MSG: unrecognized line:                      +E +L i T eek+ e+  ++ +l++H
   Y+   I+ +

   ---------------------------------------------------

   why? I hope to get your help, hanks very much!

- Done.

From bix at sendu.me.uk  Tue Sep  9 07:46:39 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 09 Sep 2008 12:46:39 +0100
Subject: [Bioperl-l] help:HMM parsing error
In-Reply-To: <127e75f60809090405h644e51eftcab073e8bf179720@mail.gmail.com>
References: <127e75f60809090405h644e51eftcab073e8bf179720@mail.gmail.com>
Message-ID: <48C6621F.8040304@sendu.me.uk>

boyang zhe wrote:
>   I write a script to parse the HMMER report ,it is as follows:
[...]
>    my $in = new Bio::SearchIO(-format => 'hmmer',-file =>"$infile");
[...]
>    -------------------- WARNING ---------------------
>    MSG: unrecognized line:                      +E +L i T eek+ e+  ++ +l++H
>    Y+   I+ +
> 
>    ---------------------------------------------------
> 
>    why? I hope to get your help, hanks very much!

I didn't check your code, but the easiest thing to try would be to use 
-format => 'hmmer_pull' to use an alternate parser that may be able to 
recognise that line. You might need to install the latest Bioperl from 
SVN (or at least 1.5.2) to get access to the hmmer_pull parser.

From bosborne11 at verizon.net  Tue Sep  9 10:50:38 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Tue, 9 Sep 2008 10:50:38 -0400
Subject: [Bioperl-l] SeqHound
In-Reply-To: <1220452426.31595.92.camel@pepa.cbm.uam.es>
References: <1220452426.31595.92.camel@pepa.cbm.uam.es>
Message-ID: <55655D67-352A-4E0D-B402-7FC30628C1B1@verizon.net>

Raul,

After spending a few minutes at bond.unleashedinformatics.com I have  
to admit that it's not clear how one accesses their free version of  
BOND. There are no examples that I can see in their packages.

If you are interested in looking at protein-protein networks in the  
Bioperl context you can also check out the bioperl-network package:

http://www.bioperl.org/wiki/Network_package

If you don't care what language you're using then you should consider  
Cytoscape, it's probably the package with the most capability.


Brian O.


On Sep 3, 2008, at 10:33 AM, Raul Mendez Giraldez wrote:

> Hi Chris,
>
> I'm trying to set up and run bioperl Seqhound donwloaded from:
>
> http://bond.unleashedinformatics.com/downloads/api//seqhound-bioperl-4.0.tar.gz
>
> and I always get connection error messages. Do you know which  
> version of
> SeqHound should I use and how can I configure to make it work? I've
> tried several possibilities for server1 at .shoundremrc as
>
> [remote]
> server1 = bond.unleashedinformatics.com
> CGI = /cgi-bin/seqrem
> port=8080
>
> Also, I would like to get all the possible protein-protein interaction
> for a set of protein sequences. Would this be possible using SeqHound?
>
> Thanks,
> Ra?l
>
>
>
>
> -- 
> Ra?l M?ndez Gir?ldez, Ph.D.
> Bioinformatics Unit
> Centre for Molecular Biology "Severo Ochoa"
> Universidad Aut?noma de Madrid
> C/ Nicol?s Cabrera, 1
> Cantoblanco 28049, Madrid
> SPAIN
>
> Phone: +34 91 196 4633
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From jimhu at tamu.edu  Tue Sep  9 12:05:59 2008
From: jimhu at tamu.edu (Jim Hu)
Date: Tue, 9 Sep 2008 11:05:59 -0500
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
Message-ID: <AFDAB313-524D-441B-8723-027484D15142@tamu.edu>

Hi Aaron,

I was thinking this would be handled by making the end=parent feature  
length x 2 + end coord.  end/parent length = number of times crosses  
origin.

Jim

On Sep 8, 2008, at 2:57 PM, Aaron Mackey wrote:

> How can you handle features that may cross the origin more than once?
> The modulus, though simple, seems to be only half the solution.  It
> also makes it difficult to place features in the genome "by eye"
> (having to do the modulus subtraction in my head), or in
> sorting/filtering operations.
>
> I have an alternative that I wondered if you considered: allow the
> start/end to have an additional "circular revolution" prefix:
>
> a typical range tuple like: 100 200 -
> is thus shorthand for: 0:100 0:200 -
> (i.e. both the 100 and 200 are in the same "revolution" around the  
> genome)
>
> and is then distinguishable from an "around the genome + 100"  
> feature of:
> 1:100 0:200 -
>
> Just an alternative to consider (if you haven't already).  I'm not
> wedded to the syntax, but I wouldn't want to see new columns in GFF
> just for this.  Essentially, what you want is some form of compound
> polar coordinates, it seems.
>
> -Aaron
>
> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>> In discussions with GMOD about Gbrowse, we've come up with a  
>> proposal for
>> handling circular genomes and features that cross the origin in such
>> genomes.  This applies to lots of prokaryotic and viral genomes,  
>> and might
>> be valuable for some ways of representing terminally redundant linear
>> genomes.
>> 1) Keep the requirement that start < end
>> 2) allow end > parent feature length
>> 3) parent feature gets an is_circular boolean
>> 4) use modular arithmetic to calculate the real position of end on  
>> the
>> parent feature.
>> We'd like to do this in a way that will be consistent with Chado  
>> and BioPerl
>> representation of features as much as possible (realizing that  
>> there is the
>> usual interbase or not coordinate issue).  What do people think?   
>> Lincoln is
>> on board for modifying the GFF3 spec.
>> Thanks!
>> Jim Hu
>>
>> =====================================
>>
>> Jim Hu
>>
>> Associate Professor
>>
>> Dept. of Biochemistry and Biophysics
>>
>> 2128 TAMU
>>
>> Texas A&M Univ.
>>
>> College Station, TX 77843-2128
>>
>> 979-862-4054
>>
>>
>> -------------------------------------------------------------------------
>> This SF.Net email is sponsored by the Moblin Your Move Developer's  
>> challenge
>> Build the coolest Linux based applications with Moblin SDK & win  
>> great
>> prizes
>> Grand prize is a trip for two to an Open Source event anywhere in  
>> the world
>> http://moblin-contest.org/redirect.php?banner_id=100&url=/
>> _______________________________________________
>> Gmod-schema mailing list
>> Gmod-schema at lists.sourceforge.net
>> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>>
>>

=====================================
Jim Hu
Associate Professor
Dept. of Biochemistry and Biophysics
2128 TAMU
Texas A&M Univ.
College Station, TX 77843-2128
979-862-4054



From jason at bioperl.org  Tue Sep  9 12:07:45 2008
From: jason at bioperl.org (Jason Stajich)
Date: Tue, 9 Sep 2008 09:07:45 -0700
Subject: [Bioperl-l] help:HMM parsing error
In-Reply-To: <48C6621F.8040304@sendu.me.uk>
References: <127e75f60809090405h644e51eftcab073e8bf179720@mail.gmail.com>
	<48C6621F.8040304@sendu.me.uk>
Message-ID: <DE35F9B2-20FE-4554-9F53-6F838849B0C6@bioperl.org>

Although it would be good to fix the parser as well --  best solution  
is to submit that report as a bug to bugzilla
http://bugzilla.open-bio.org/

-jason

On Sep 9, 2008, at 4:46 AM, Sendu Bala wrote:

> boyang zhe wrote:
>>  I write a script to parse the HMMER report ,it is as follows:
> [...]
>>   my $in = new Bio::SearchIO(-format => 'hmmer',-file =>"$infile");
> [...]
>>   -------------------- WARNING ---------------------
>>   MSG: unrecognized line:                      +E +L i T eek+ e+  + 
>> + +l++H
>>   Y+   I+ +
>>   ---------------------------------------------------
>>   why? I hope to get your help, hanks very much!
>
> I didn't check your code, but the easiest thing to try would be to  
> use -format => 'hmmer_pull' to use an alternate parser that may be  
> able to recognise that line. You might need to install the latest  
> Bioperl from SVN (or at least 1.5.2) to get access to the hmmer_pull  
> parser.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org




From cain.cshl at gmail.com  Tue Sep  9 13:33:12 2008
From: cain.cshl at gmail.com (Scott Cain)
Date: Tue, 9 Sep 2008 13:33:12 -0400
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
Message-ID: <536f21b00809091033v1e412f4ft54d8e139c347a20a@mail.gmail.com>

Hi Jim and All,

While I agree with Aaron's point that it is not easy to place features
by visual inspection, this seems like a fairly minor point.  The vast
majority of GFF3 manipulation will be done in software, so as long as
the API handles everything correctly, life is good.  If we discount
that objection, there doesn't seem to be much advantage of using
Aaron's suggested method over Jim's.

(As a side note--I have the same complaint about anything in XML--it
is awful for a human to read.  I still live with XML when I have to
though :-)

Additionally, the fact that Ensembl is using the same method as what
Jim describes is a fairly powerful argument for doing the same.
Hopefully there can be some code reuse.

Scott


On Tue, Sep 9, 2008 at 12:05 PM, Jim Hu <jimhu at tamu.edu> wrote:
> Hi Aaron,
> I was thinking this would be handled by making the end=parent feature length
> x 2 + end coord.  end/parent length = number of times crosses origin.
> Jim
> On Sep 8, 2008, at 2:57 PM, Aaron Mackey wrote:
>
> How can you handle features that may cross the origin more than once?
> The modulus, though simple, seems to be only half the solution.  It
> also makes it difficult to place features in the genome "by eye"
> (having to do the modulus subtraction in my head), or in
> sorting/filtering operations.
>
> I have an alternative that I wondered if you considered: allow the
> start/end to have an additional "circular revolution" prefix:
>
> a typical range tuple like: 100 200 -
> is thus shorthand for: 0:100 0:200 -
> (i.e. both the 100 and 200 are in the same "revolution" around the genome)
>
> and is then distinguishable from an "around the genome + 100" feature of:
> 1:100 0:200 -
>
> Just an alternative to consider (if you haven't already).  I'm not
> wedded to the syntax, but I wouldn't want to see new columns in GFF
> just for this.  Essentially, what you want is some form of compound
> polar coordinates, it seems.
>
> -Aaron
>
> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>
> In discussions with GMOD about Gbrowse, we've come up with a proposal for
>
> handling circular genomes and features that cross the origin in such
>
> genomes.  This applies to lots of prokaryotic and viral genomes, and might
>
> be valuable for some ways of representing terminally redundant linear
>
> genomes.
>
> 1) Keep the requirement that start < end
>
> 2) allow end > parent feature length
>
> 3) parent feature gets an is_circular boolean
>
> 4) use modular arithmetic to calculate the real position of end on the
>
> parent feature.
>
> We'd like to do this in a way that will be consistent with Chado and BioPerl
>
> representation of features as much as possible (realizing that there is the
>
> usual interbase or not coordinate issue).  What do people think?  Lincoln is
>
> on board for modifying the GFF3 spec.
>
> Thanks!
>
> Jim Hu
>
> =====================================
>
> Jim Hu
>
> Associate Professor
>
> Dept. of Biochemistry and Biophysics
>
> 2128 TAMU
>
> Texas A&M Univ.
>
> College Station, TX 77843-2128
>
> 979-862-4054
>
>
> -------------------------------------------------------------------------
>
> This SF.Net email is sponsored by the Moblin Your Move Developer's challenge
>
> Build the coolest Linux based applications with Moblin SDK & win great
>
> prizes
>
> Grand prize is a trip for two to an Open Source event anywhere in the world
>
> http://moblin-contest.org/redirect.php?banner_id=100&url=/
>
> _______________________________________________
>
> Gmod-schema mailing list
>
> Gmod-schema at lists.sourceforge.net
>
> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>
>
>
> =====================================
>
> Jim Hu
>
> Associate Professor
>
> Dept. of Biochemistry and Biophysics
>
> 2128 TAMU
>
> Texas A&M Univ.
>
> College Station, TX 77843-2128
>
> 979-862-4054
>
>
> -------------------------------------------------------------------------
> This SF.Net email is sponsored by the Moblin Your Move Developer's challenge
> Build the coolest Linux based applications with Moblin SDK & win great
> prizes
> Grand prize is a trip for two to an Open Source event anywhere in the world
> http://moblin-contest.org/redirect.php?banner_id=100&url=/
> _______________________________________________
> Gmod-schema mailing list
> Gmod-schema at lists.sourceforge.net
> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>
>



-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   cain.cshl at gmail.com
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory

From lincoln.stein at gmail.com  Tue Sep  9 13:52:36 2008
From: lincoln.stein at gmail.com (Lincoln Stein)
Date: Tue, 9 Sep 2008 13:52:36 -0400
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
Message-ID: <6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>

It seems to me that the proposed modulus syntax handles multiple
revolutions. Consider a 100 bp genome (to make it simple) and a feature that
starts at 50, goes around twice, and ends at position 60:

  start = 50
  end  = 260

length = end - start + 1
revolutions = int (length/genome)
stop position = length % genome + 1

Lincoln

On Mon, Sep 8, 2008 at 3:57 PM, Aaron Mackey <ajmackey at gmail.com> wrote:

> How can you handle features that may cross the origin more than once?
> The modulus, though simple, seems to be only half the solution.  It
> also makes it difficult to place features in the genome "by eye"
> (having to do the modulus subtraction in my head), or in
> sorting/filtering operations.
>
> I have an alternative that I wondered if you considered: allow the
> start/end to have an additional "circular revolution" prefix:
>
> a typical range tuple like: 100 200 -
> is thus shorthand for: 0:100 0:200 -
> (i.e. both the 100 and 200 are in the same "revolution" around the genome)
>
> and is then distinguishable from an "around the genome + 100" feature of:
> 1:100 0:200 -
>
> Just an alternative to consider (if you haven't already).  I'm not
> wedded to the syntax, but I wouldn't want to see new columns in GFF
> just for this.  Essentially, what you want is some form of compound
> polar coordinates, it seems.
>
> -Aaron
>
> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
> > In discussions with GMOD about Gbrowse, we've come up with a proposal for
> > handling circular genomes and features that cross the origin in such
> > genomes.  This applies to lots of prokaryotic and viral genomes, and
> might
> > be valuable for some ways of representing terminally redundant linear
> > genomes.
> > 1) Keep the requirement that start < end
> > 2) allow end > parent feature length
> > 3) parent feature gets an is_circular boolean
> > 4) use modular arithmetic to calculate the real position of end on the
> > parent feature.
> > We'd like to do this in a way that will be consistent with Chado and
> BioPerl
> > representation of features as much as possible (realizing that there is
> the
> > usual interbase or not coordinate issue).  What do people think?  Lincoln
> is
> > on board for modifying the GFF3 spec.
> > Thanks!
> > Jim Hu
> >
> > =====================================
> >
> > Jim Hu
> >
> > Associate Professor
> >
> > Dept. of Biochemistry and Biophysics
> >
> > 2128 TAMU
> >
> > Texas A&M Univ.
> >
> > College Station, TX 77843-2128
> >
> > 979-862-4054
> >
> >
> > -------------------------------------------------------------------------
> > This SF.Net email is sponsored by the Moblin Your Move Developer's
> challenge
> > Build the coolest Linux based applications with Moblin SDK & win great
> > prizes
> > Grand prize is a trip for two to an Open Source event anywhere in the
> world
> > http://moblin-contest.org/redirect.php?banner_id=100&url=/
> > _______________________________________________
> > Gmod-schema mailing list
> > Gmod-schema at lists.sourceforge.net
> > https://lists.sourceforge.net/lists/listinfo/gmod-schema
> >
> >
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Lincoln D. Stein

Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Stacey Quinn <Stacey.Quinn at oicr.on.ca>

Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724 USA
(516) 367-8380
Assistant: Sandra Michelsen <michelse at cshl.edu>

From cjfields at illinois.edu  Tue Sep  9 14:24:49 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 9 Sep 2008 13:24:49 -0500
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
Message-ID: <ACC71DEA-378C-4FB3-8C09-A85EC0858924@illinois.edu>

Is there any particular reason we don't treat this similarly to the  
way BioPerl does, which is to simply treat the origin-overlapping  
feature as a split location?  GenBank treats this similarly.  For an  
faux example, the bug I just fixed for bugzilla has one:

http://bugzilla.open-bio.org/show_bug.cgi?id=2579

An actual GenBank case is the Sulfolobus solfataricus genome  
(NC_002754), and I'm sure Jim could come up with more.  The only  
caveat is whether we should represent this

As for multiple revolutions, I'm not sure the hand-wringing about  
specifics is worth it unless we have explicit workable examples to  
test against (preferably examples which would potentially pop up), but  
Lincoln's proposal sounds fine.

chris

On Sep 9, 2008, at 11:05 AM, Jim Hu wrote:

> Hi Aaron,
>
> I was thinking this would be handled by making the end=parent  
> feature length x 2 + end coord.  end/parent length = number of times  
> crosses origin.
>
> Jim
>
> On Sep 8, 2008, at 2:57 PM, Aaron Mackey wrote:
>
>> How can you handle features that may cross the origin more than once?
>> The modulus, though simple, seems to be only half the solution.  It
>> also makes it difficult to place features in the genome "by eye"
>> (having to do the modulus subtraction in my head), or in
>> sorting/filtering operations.
>>
>> I have an alternative that I wondered if you considered: allow the
>> start/end to have an additional "circular revolution" prefix:
>>
>> a typical range tuple like: 100 200 -
>> is thus shorthand for: 0:100 0:200 -
>> (i.e. both the 100 and 200 are in the same "revolution" around the  
>> genome)
>>
>> and is then distinguishable from an "around the genome + 100"  
>> feature of:
>> 1:100 0:200 -
>>
>> Just an alternative to consider (if you haven't already).  I'm not
>> wedded to the syntax, but I wouldn't want to see new columns in GFF
>> just for this.  Essentially, what you want is some form of compound
>> polar coordinates, it seems.
>>
>> -Aaron
>>
>> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>>> In discussions with GMOD about Gbrowse, we've come up with a  
>>> proposal for
>>> handling circular genomes and features that cross the origin in such
>>> genomes.  This applies to lots of prokaryotic and viral genomes,  
>>> and might
>>> be valuable for some ways of representing terminally redundant  
>>> linear
>>> genomes.
>>> 1) Keep the requirement that start < end
>>> 2) allow end > parent feature length
>>> 3) parent feature gets an is_circular boolean
>>> 4) use modular arithmetic to calculate the real position of end on  
>>> the
>>> parent feature.
>>> We'd like to do this in a way that will be consistent with Chado  
>>> and BioPerl
>>> representation of features as much as possible (realizing that  
>>> there is the
>>> usual interbase or not coordinate issue).  What do people think?   
>>> Lincoln is
>>> on board for modifying the GFF3 spec.
>>> Thanks!
>>> Jim Hu
>>>
>>> =====================================
>>>
>>> Jim Hu
>>>
>>> Associate Professor
>>>
>>> Dept. of Biochemistry and Biophysics
>>>
>>> 2128 TAMU
>>>
>>> Texas A&M Univ.
>>>
>>> College Station, TX 77843-2128
>>>
>>> 979-862-4054
>>>
>>>
>>> -------------------------------------------------------------------------
>>> This SF.Net email is sponsored by the Moblin Your Move Developer's  
>>> challenge
>>> Build the coolest Linux based applications with Moblin SDK & win  
>>> great
>>> prizes
>>> Grand prize is a trip for two to an Open Source event anywhere in  
>>> the world
>>> http://moblin-contest.org/redirect.php?banner_id=100&url=/
>>> _______________________________________________
>>> Gmod-schema mailing list
>>> Gmod-schema at lists.sourceforge.net
>>> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>>>
>>>
>
> =====================================
> Jim Hu
> Associate Professor
> Dept. of Biochemistry and Biophysics
> 2128 TAMU
> Texas A&M Univ.
> College Station, TX 77843-2128
> 979-862-4054
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign





From ajmackey at gmail.com  Tue Sep  9 14:48:12 2008
From: ajmackey at gmail.com (Aaron Mackey)
Date: Tue, 9 Sep 2008 14:48:12 -0400
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
Message-ID: <24c96eca0809091148l738604a7q13fba54ac05de01c@mail.gmail.com>

Right, the modulus calculation continues to work, but for instance,
what'll happen when I now ask Gbrowse (or Ensembl) to show me
positions 50..260?  Will it show me 50 .. 60, 1:100, or "unroll" the
genome twice from 50..260 (that'd be a pretty cute trick, by the way!)

You're (re)using simple arithmetic to compress a compound coordinate
into a single-valued coordinate (which I realize can be trivially
packed and unpacked by software), but I worry about the downstream
consequences of software having to always remember that the
coordinates given may have to be unpacked or not, and not being able
to immediately identify whether "260" is a real or compound
coordinate.

To say it another way, I'm happy (that is, don't care much) whether
Chado or any other underlying data storage uses such compound
coordinates, because only Chado-reliant tools will need to care; but I
do worry about GFF3 as a (relatively) simple exchange format having
that kind of silent bug-causing complexity.  I'd much rather see GFF
be syntactically explicit, and not quite so cleverly implicit.

Just one GFF user's two cents, thanks for listening,

-Aaron

On Tue, Sep 9, 2008 at 1:52 PM, Lincoln Stein <lincoln.stein at gmail.com> wrote:
> It seems to me that the proposed modulus syntax handles multiple
> revolutions. Consider a 100 bp genome (to make it simple) and a feature that
> starts at 50, goes around twice, and ends at position 60:
>
>   start = 50
>   end  = 260
>
> length = end - start + 1
> revolutions = int (length/genome)
> stop position = length % genome + 1
>
> Lincoln
>
> On Mon, Sep 8, 2008 at 3:57 PM, Aaron Mackey <ajmackey at gmail.com> wrote:
>>
>> How can you handle features that may cross the origin more than once?
>> The modulus, though simple, seems to be only half the solution.  It
>> also makes it difficult to place features in the genome "by eye"
>> (having to do the modulus subtraction in my head), or in
>> sorting/filtering operations.
>>
>> I have an alternative that I wondered if you considered: allow the
>> start/end to have an additional "circular revolution" prefix:
>>
>> a typical range tuple like: 100 200 -
>> is thus shorthand for: 0:100 0:200 -
>> (i.e. both the 100 and 200 are in the same "revolution" around the genome)
>>
>> and is then distinguishable from an "around the genome + 100" feature of:
>> 1:100 0:200 -
>>
>> Just an alternative to consider (if you haven't already).  I'm not
>> wedded to the syntax, but I wouldn't want to see new columns in GFF
>> just for this.  Essentially, what you want is some form of compound
>> polar coordinates, it seems.
>>
>> -Aaron
>>
>> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>> > In discussions with GMOD about Gbrowse, we've come up with a proposal
>> > for
>> > handling circular genomes and features that cross the origin in such
>> > genomes.  This applies to lots of prokaryotic and viral genomes, and
>> > might
>> > be valuable for some ways of representing terminally redundant linear
>> > genomes.
>> > 1) Keep the requirement that start < end
>> > 2) allow end > parent feature length
>> > 3) parent feature gets an is_circular boolean
>> > 4) use modular arithmetic to calculate the real position of end on the
>> > parent feature.
>> > We'd like to do this in a way that will be consistent with Chado and
>> > BioPerl
>> > representation of features as much as possible (realizing that there is
>> > the
>> > usual interbase or not coordinate issue).  What do people think?
>> >  Lincoln is
>> > on board for modifying the GFF3 spec.
>> > Thanks!
>> > Jim Hu
>> >
>> > =====================================
>> >
>> > Jim Hu
>> >
>> > Associate Professor
>> >
>> > Dept. of Biochemistry and Biophysics
>> >
>> > 2128 TAMU
>> >
>> > Texas A&M Univ.
>> >
>> > College Station, TX 77843-2128
>> >
>> > 979-862-4054
>> >
>> >
>> >
>> > -------------------------------------------------------------------------
>> > This SF.Net email is sponsored by the Moblin Your Move Developer's
>> > challenge
>> > Build the coolest Linux based applications with Moblin SDK & win great
>> > prizes
>> > Grand prize is a trip for two to an Open Source event anywhere in the
>> > world
>> > http://moblin-contest.org/redirect.php?banner_id=100&url=/
>> > _______________________________________________
>> > Gmod-schema mailing list
>> > Gmod-schema at lists.sourceforge.net
>> > https://lists.sourceforge.net/lists/listinfo/gmod-schema
>> >
>> >
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> --
> Lincoln D. Stein
>
> Ontario Institute for Cancer Research
> 101 College St., Suite 800
> Toronto, ON, Canada M5G0A3
> 416 673-8514
> Assistant: Stacey Quinn <Stacey.Quinn at oicr.on.ca>
>
> Cold Spring Harbor Laboratory
> 1 Bungtown Road
> Cold Spring Harbor, NY 11724 USA
> (516) 367-8380
> Assistant: Sandra Michelsen <michelse at cshl.edu>
>

From cjfields at illinois.edu  Tue Sep  9 14:49:13 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 9 Sep 2008 13:49:13 -0500
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <ACC71DEA-378C-4FB3-8C09-A85EC0858924@illinois.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
	<ACC71DEA-378C-4FB3-8C09-A85EC0858924@illinois.edu>
Message-ID: <8C6E5EBC-25B1-41E3-BB89-FD3C228A6B70@illinois.edu>

Sent just a bit too early!

On Sep 9, 2008, at 1:24 PM, Chris Fields wrote:

> Is there any particular reason we don't treat this similarly to the  
> way BioPerl does, which is to simply treat the origin-overlapping  
> feature as a split location?  GenBank treats this similarly.  For an  
> faux example, the bug I just fixed for bugzilla has one:
>
> http://bugzilla.open-bio.org/show_bug.cgi?id=2579
>
> An actual GenBank case is the Sulfolobus solfataricus genome  
> (NC_002754), and I'm sure Jim could come up with more.  The only  
> caveat is whether we should represent this

... as a 'special case' for features overlapping the origin in a  
circular sequence.

> As for multiple revolutions, I'm not sure the hand-wringing about  
> specifics is worth it unless we have explicit workable examples to  
> test against (preferably examples which would potentially pop up),  
> but Lincoln's proposal sounds fine.
>
> chris



From Russell.Smithies at agresearch.co.nz  Tue Sep  9 16:46:26 2008
From: Russell.Smithies at agresearch.co.nz (Smithies, Russell)
Date: Wed, 10 Sep 2008 08:46:26 +1200
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu><24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
Message-ID: <D5DBA313349A4B458528BE63B387F36C077822B4@imail.agresearch.co.nz>

Excuse my ignorance (I'm not a biologist) but is it biologically possible/likely for a gene or feature to wrap more than once around a genome?
Anyone got an example?


Russell Smithies 

Bioinformatics Applications Developer 

Invermay? Research Centre 
Puddle Alley, 
Mosgiel, 
New Zealand 





> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-
> bio.org] On Behalf Of Lincoln Stein
> Sent: Wednesday, 10 September 2008 5:53 a.m.
> To: Aaron Mackey
> Cc: GMOD Schema List; Jim Hu; Roy Welch; bioperl-l at bioperl.org; Mike Gribskov
> Subject: Re: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
> 
> It seems to me that the proposed modulus syntax handles multiple
> revolutions. Consider a 100 bp genome (to make it simple) and a feature that
> starts at 50, goes around twice, and ends at position 60:
> 
>   start = 50
>   end  = 260
> 
> length = end - start + 1
> revolutions = int (length/genome)
> stop position = length % genome + 1
> 
> Lincoln
> 
> On Mon, Sep 8, 2008 at 3:57 PM, Aaron Mackey <ajmackey at gmail.com> wrote:
> 
> > How can you handle features that may cross the origin more than once?
> > The modulus, though simple, seems to be only half the solution.  It
> > also makes it difficult to place features in the genome "by eye"
> > (having to do the modulus subtraction in my head), or in
> > sorting/filtering operations.
> >
> > I have an alternative that I wondered if you considered: allow the
> > start/end to have an additional "circular revolution" prefix:
> >
> > a typical range tuple like: 100 200 -
> > is thus shorthand for: 0:100 0:200 -
> > (i.e. both the 100 and 200 are in the same "revolution" around the genome)
> >
> > and is then distinguishable from an "around the genome + 100" feature of:
> > 1:100 0:200 -
> >
> > Just an alternative to consider (if you haven't already).  I'm not
> > wedded to the syntax, but I wouldn't want to see new columns in GFF
> > just for this.  Essentially, what you want is some form of compound
> > polar coordinates, it seems.
> >
> > -Aaron
> >
> > On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
> > > In discussions with GMOD about Gbrowse, we've come up with a proposal for
> > > handling circular genomes and features that cross the origin in such
> > > genomes.  This applies to lots of prokaryotic and viral genomes, and
> > might
> > > be valuable for some ways of representing terminally redundant linear
> > > genomes.
> > > 1) Keep the requirement that start < end
> > > 2) allow end > parent feature length
> > > 3) parent feature gets an is_circular boolean
> > > 4) use modular arithmetic to calculate the real position of end on the
> > > parent feature.
> > > We'd like to do this in a way that will be consistent with Chado and
> > BioPerl
> > > representation of features as much as possible (realizing that there is
> > the
> > > usual interbase or not coordinate issue).  What do people think?  Lincoln
> > is
> > > on board for modifying the GFF3 spec.
> > > Thanks!
> > > Jim Hu
> > >
> > > =====================================
> > >
> > > Jim Hu
> > >
> > > Associate Professor
> > >
> > > Dept. of Biochemistry and Biophysics
> > >
> > > 2128 TAMU
> > >
> > > Texas A&M Univ.
> > >
> > > College Station, TX 77843-2128
> > >
> > > 979-862-4054
> > >
> > >
> > > -------------------------------------------------------------------------
> > > This SF.Net email is sponsored by the Moblin Your Move Developer's
> > challenge
> > > Build the coolest Linux based applications with Moblin SDK & win great
> > > prizes
> > > Grand prize is a trip for two to an Open Source event anywhere in the
> > world
> > > http://moblin-contest.org/redirect.php?banner_id=100&url=/
> > > _______________________________________________
> > > Gmod-schema mailing list
> > > Gmod-schema at lists.sourceforge.net
> > > https://lists.sourceforge.net/lists/listinfo/gmod-schema
> > >
> > >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> 
> 
> 
> --
> Lincoln D. Stein
> 
> Ontario Institute for Cancer Research
> 101 College St., Suite 800
> Toronto, ON, Canada M5G0A3
> 416 673-8514
> Assistant: Stacey Quinn <Stacey.Quinn at oicr.on.ca>
> 
> Cold Spring Harbor Laboratory
> 1 Bungtown Road
> Cold Spring Harbor, NY 11724 USA
> (516) 367-8380
> Assistant: Sandra Michelsen <michelse at cshl.edu>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
=======================================================================
Attention: The information contained in this message and/or attachments
from AgResearch Limited is intended only for the persons or entities
to which it is addressed and may contain confidential and/or privileged
material. Any review, retransmission, dissemination or other use of, or
taking of any action in reliance upon, this information by persons or
entities other than the intended recipients is prohibited by AgResearch
Limited. If you have received this message in error, please notify the
sender immediately.
=======================================================================


From cjm at berkeleybop.org  Tue Sep  9 18:56:55 2008
From: cjm at berkeleybop.org (Chris Mungall)
Date: Tue, 9 Sep 2008 15:56:55 -0700
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
Message-ID: <18A0C3BE-ED04-4494-9231-B945158D6CE4@berkeleybop.org>


I think I am happy with the modulo approach.

Though I believe we first of all need for a formal specification of  
genome interval semantics that is independent of any particular syntax  
or implementation. This can be a fairly short specification - along  
the lines of what Lincoln has written below (although I would  
naturally prefer the normative version to be interbase - this doesn't  
preclude derived axioms in GFF coordinates).

This spec should also define and standardize the terminology used:  
Lincoln draws a distinction between 'stop' and 'end'. I'm relatively  
happy with these terms - however, the choice we makes need to become  
enshrined otherwise we'll end up with confusion and mismatches between  
software and specification.

One clarification:

> revolutions = int (length/genome)


This axiom is presumaby contextual on the genome being circular, which  
will have to be indicated using a new flag, as Jim suggest, yep?

So the context independent axiom would be:

> revolutions = IF src_is_circular THEN int (length/genome) ELSE 0


On Sep 9, 2008, at 10:52 AM, Lincoln Stein wrote:

> It seems to me that the proposed modulus syntax handles multiple
> revolutions. Consider a 100 bp genome (to make it simple) and a  
> feature that
> starts at 50, goes around twice, and ends at position 60:
>
>  start = 50
>  end  = 260
>
> length = end - start + 1
> revolutions = int (length/genome)
> stop position = length % genome + 1
>
> Lincoln
>
> On Mon, Sep 8, 2008 at 3:57 PM, Aaron Mackey <ajmackey at gmail.com>  
> wrote:
>
>> How can you handle features that may cross the origin more than once?
>> The modulus, though simple, seems to be only half the solution.  It
>> also makes it difficult to place features in the genome "by eye"
>> (having to do the modulus subtraction in my head), or in
>> sorting/filtering operations.
>>
>> I have an alternative that I wondered if you considered: allow the
>> start/end to have an additional "circular revolution" prefix:
>>
>> a typical range tuple like: 100 200 -
>> is thus shorthand for: 0:100 0:200 -
>> (i.e. both the 100 and 200 are in the same "revolution" around the  
>> genome)
>>
>> and is then distinguishable from an "around the genome + 100"  
>> feature of:
>> 1:100 0:200 -
>>
>> Just an alternative to consider (if you haven't already).  I'm not
>> wedded to the syntax, but I wouldn't want to see new columns in GFF
>> just for this.  Essentially, what you want is some form of compound
>> polar coordinates, it seems.
>>
>> -Aaron
>>
>> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>>> In discussions with GMOD about Gbrowse, we've come up with a  
>>> proposal for
>>> handling circular genomes and features that cross the origin in such
>>> genomes.  This applies to lots of prokaryotic and viral genomes, and
>> might
>>> be valuable for some ways of representing terminally redundant  
>>> linear
>>> genomes.
>>> 1) Keep the requirement that start < end
>>> 2) allow end > parent feature length
>>> 3) parent feature gets an is_circular boolean
>>> 4) use modular arithmetic to calculate the real position of end on  
>>> the
>>> parent feature.
>>> We'd like to do this in a way that will be consistent with Chado and
>> BioPerl
>>> representation of features as much as possible (realizing that  
>>> there is
>> the
>>> usual interbase or not coordinate issue).  What do people think?   
>>> Lincoln
>> is
>>> on board for modifying the GFF3 spec.
>>> Thanks!
>>> Jim Hu
>>>
>>> =====================================
>>>
>>> Jim Hu
>>>
>>> Associate Professor
>>>
>>> Dept. of Biochemistry and Biophysics
>>>
>>> 2128 TAMU
>>>
>>> Texas A&M Univ.
>>>
>>> College Station, TX 77843-2128
>>>
>>> 979-862-4054
>>>
>>>
>>> -------------------------------------------------------------------------
>>> This SF.Net email is sponsored by the Moblin Your Move Developer's
>> challenge
>>> Build the coolest Linux based applications with Moblin SDK & win  
>>> great
>>> prizes
>>> Grand prize is a trip for two to an Open Source event anywhere in  
>>> the
>> world
>>> http://moblin-contest.org/redirect.php?banner_id=100&url=/
>>> _______________________________________________
>>> Gmod-schema mailing list
>>> Gmod-schema at lists.sourceforge.net
>>> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>>>
>>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>
>
> -- 
> Lincoln D. Stein
>
> Ontario Institute for Cancer Research
> 101 College St., Suite 800
> Toronto, ON, Canada M5G0A3
> 416 673-8514
> Assistant: Stacey Quinn <Stacey.Quinn at oicr.on.ca>
>
> Cold Spring Harbor Laboratory
> 1 Bungtown Road
> Cold Spring Harbor, NY 11724 USA
> (516) 367-8380
> Assistant: Sandra Michelsen <michelse at cshl.edu>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From heikki at sanbi.ac.za  Wed Sep 10 07:32:06 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Wed, 10 Sep 2008 13:32:06 +0200
Subject: [Bioperl-l] phylogeny-trait association methods into BioPerl
Message-ID: <200809101332.07137.heikki@sanbi.ac.za>

FYI,

I've been recently writing code to analyse phylogeny-trait associations. These 
traits are typically geographical location of the sequence but they can be any 
phenotypic characters associated with the sequences.

This involves trees, i.e. Bio::Tree::Tree and Bio::Tree::Node objects and 
strings describing the traits. I've been using tags to store trait values 
within nodes. The tag methods are:

Bio::Tree::Node::add_tag_value
Bio::Tree::Node::get_all_tags
Bio::Tree::Node::get_tag_values
Bio::Tree::Node::has_tag
Bio::Tree::Node::remove_all_tags
Bio::Tree::Node::remove_tag

Question: Is  there any particular reason why there is no 
set_tag_value(scalar|@array) method? 

I am getting tired of writing:
  $node->remove_tag($key);
  map {$node->add_tag_value($key)} @values ;
so I am going to implement that unless there is are strong objections.

Otherwise it has been smooth sailing. I am going to add 
Bio::Tree::TreeFunctions::is_binary() and start populating 
Bio::Tree::Statistics soon with these methods:

ps() - Parsimony Score (PS) from Fitch 1971 
ai() - Association index (AI) of Whang et al. 2001
mc() - Monophyletic Clade (MC) size statistics by Salemi at al. 2005
cherries() - number of leaf node pairs

If you have any comments, please feel free to post them here.

    -Heikki

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________


From hlapp at gmx.net  Wed Sep 10 09:44:27 2008
From: hlapp at gmx.net (Hilmar Lapp)
Date: Wed, 10 Sep 2008 07:44:27 -0600
Subject: [Bioperl-l] phylogeny-trait association methods into BioPerl
In-Reply-To: <200809101332.07137.heikki@sanbi.ac.za>
References: <200809101332.07137.heikki@sanbi.ac.za>
Message-ID: <0FA6C4A1-9D83-4850-BC0A-4A55ED528C65@gmx.net>

Sounds great Heikki!

Just FYI, there is a considerable amount of code and packages for  
comparative analysis in R. You might want to look into the resources  
linked to from the http://r-phylo.org page. There is also a R-SIG- 
Phylo special interest group mailing list (should be linked from the  
aforementioned site).

	-hilmar

On Sep 10, 2008, at 5:32 AM, Heikki Lehvaslaiho wrote:

> FYI,
>
> I've been recently writing code to analyse phylogeny-trait  
> associations. These
> traits are typically geographical location of the sequence but they  
> can be any
> phenotypic characters associated with the sequences.
>
> This involves trees, i.e. Bio::Tree::Tree and Bio::Tree::Node  
> objects and
> strings describing the traits. I've been using tags to store trait  
> values
> within nodes. The tag methods are:
>
> Bio::Tree::Node::add_tag_value
> Bio::Tree::Node::get_all_tags
> Bio::Tree::Node::get_tag_values
> Bio::Tree::Node::has_tag
> Bio::Tree::Node::remove_all_tags
> Bio::Tree::Node::remove_tag
>
> Question: Is  there any particular reason why there is no
> set_tag_value(scalar|@array) method?
>
> I am getting tired of writing:
>  $node->remove_tag($key);
>  map {$node->add_tag_value($key)} @values ;
> so I am going to implement that unless there is are strong objections.
>
> Otherwise it has been smooth sailing. I am going to add
> Bio::Tree::TreeFunctions::is_binary() and start populating
> Bio::Tree::Statistics soon with these methods:
>
> ps() - Parsimony Score (PS) from Fitch 1971
> ai() - Association index (AI) of Whang et al. 2001
> mc() - Monophyletic Clade (MC) size statistics by Salemi at al. 2005
> cherries() - number of leaf node pairs
>
> If you have any comments, please feel free to post them here.
>
>    -Heikki
>
> -- 
> ______ _/      _/_____________________________________________________
>      _/      _/
>     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
>    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
>   _/  _/  _/  SANBI, South African National Bioinformatics Institute
>  _/  _/  _/  University of Western Cape, South Africa
>     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
> ___ _/_/_/_/_/________________________________________________________
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================




From Caroline.Johnston at iop.kcl.ac.uk  Wed Sep 10 11:43:26 2008
From: Caroline.Johnston at iop.kcl.ac.uk (Johnston, Caroline)
Date: Wed, 10 Sep 2008 16:43:26 +0100
Subject: [Bioperl-l] seqs, seqfeatures, locations etc
Message-ID: <5626ED9CB91C814197079FB9940312E506445F81@MAIL.bc.iop.kcl.ac.uk>

Hello,

I'm trying to get my head around the various classes for storing sequences, features and locations and was hoping someone could give me some implementation advice:

I've got a Bio::EnsEMBL::Slice and I want to turn it into a Bio::Seq or SeqFeature object, with Bio::SeqFeature;:Gene::GeneStructure/Transcript/Exon info attached. I can create a Bio::Seq fine, but I also need to keep track of the chromosomal co-ordinates (chr, start, end, species, strand, genome release, database name) and I can't figure out how to store this in Bioperl. I was thinking that what I needed was some extension of a standard Bio::Seq to have genome-coordinate data attached and associated methods to translate the SeqFeature positions (relative to the Bio::Seq) to genome positions. I guess it's probably already possible to store this type of info in some collection of Bioperl objects, but between Bioperl and the EnsEMBL API I'm getting lost in perl modules. Can someone point me in the right direction?

Thanks,
Cass
 


From bosborne11 at verizon.net  Wed Sep 10 13:34:35 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Wed, 10 Sep 2008 13:34:35 -0400
Subject: [Bioperl-l] seqs, seqfeatures, locations etc
In-Reply-To: <5626ED9CB91C814197079FB9940312E506445F81@MAIL.bc.iop.kcl.ac.uk>
References: <5626ED9CB91C814197079FB9940312E506445F81@MAIL.bc.iop.kcl.ac.uk>
Message-ID: <FBBD6379-A984-4F8F-81A5-8EF5E18CC3C7@verizon.net>

Cass,

There is a HOWTO about these Bioperl objects:

http://www.bioperl.org/wiki/HOWTO:Feature-Annotation

I think it addresses your questions.


Brian O.



On Sep 10, 2008, at 11:43 AM, Johnston, Caroline wrote:

> Hello,
>
> I'm trying to get my head around the various classes for storing  
> sequences, features and locations and was hoping someone could give  
> me some implementation advice:
>
> I've got a Bio::EnsEMBL::Slice and I want to turn it into a Bio::Seq  
> or SeqFeature object, with Bio::SeqFeature;:Gene::GeneStructure/ 
> Transcript/Exon info attached. I can create a Bio::Seq fine, but I  
> also need to keep track of the chromosomal co-ordinates (chr, start,  
> end, species, strand, genome release, database name) and I can't  
> figure out how to store this in Bioperl. I was thinking that what I  
> needed was some extension of a standard Bio::Seq to have genome- 
> coordinate data attached and associated methods to translate the  
> SeqFeature positions (relative to the Bio::Seq) to genome positions.  
> I guess it's probably already possible to store this type of info in  
> some collection of Bioperl objects, but between Bioperl and the  
> EnsEMBL API I'm getting lost in perl modules. Can someone point me  
> in the right direction?
>
> Thanks,
> Cass
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From jason at bioperl.org  Wed Sep 10 13:44:25 2008
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 10 Sep 2008 10:44:25 -0700
Subject: [Bioperl-l] phylogeny-trait association methods into BioPerl
In-Reply-To: <200809101332.07137.heikki@sanbi.ac.za>
References: <200809101332.07137.heikki@sanbi.ac.za>
Message-ID: <24F25525-0394-45BE-859F-A5735DE610DF@bioperl.org>

Those are just take from Bio::SeqFeature::Generic tag manipulation  
methods so please feel free to add a better one - maybe can propagate  
that new method to Bio::SeqFeature::Generic as well?

Would be nice to see those other methods add as well so am glad to see  
them.

-jason
On Sep 10, 2008, at 4:32 AM, Heikki Lehvaslaiho wrote:

> FYI,
>
> I've been recently writing code to analyse phylogeny-trait  
> associations. These
> traits are typically geographical location of the sequence but they  
> can be any
> phenotypic characters associated with the sequences.
>
> This involves trees, i.e. Bio::Tree::Tree and Bio::Tree::Node  
> objects and
> strings describing the traits. I've been using tags to store trait  
> values
> within nodes. The tag methods are:
>
> Bio::Tree::Node::add_tag_value
> Bio::Tree::Node::get_all_tags
> Bio::Tree::Node::get_tag_values
> Bio::Tree::Node::has_tag
> Bio::Tree::Node::remove_all_tags
> Bio::Tree::Node::remove_tag
>
> Question: Is  there any particular reason why there is no
> set_tag_value(scalar|@array) method?
>
> I am getting tired of writing:
>  $node->remove_tag($key);
>  map {$node->add_tag_value($key)} @values ;
> so I am going to implement that unless there is are strong objections.
>
> Otherwise it has been smooth sailing. I am going to add
> Bio::Tree::TreeFunctions::is_binary() and start populating
> Bio::Tree::Statistics soon with these methods:
>
> ps() - Parsimony Score (PS) from Fitch 1971
> ai() - Association index (AI) of Whang et al. 2001
> mc() - Monophyletic Clade (MC) size statistics by Salemi at al. 2005
> cherries() - number of leaf node pairs
>
> If you have any comments, please feel free to post them here.
>
>    -Heikki
>
> -- 
> ______ _/      _/_____________________________________________________
>      _/      _/
>     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
>    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
>   _/  _/  _/  SANBI, South African National Bioinformatics Institute
>  _/  _/  _/  University of Western Cape, South Africa
>     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
> ___ _/_/_/_/_/________________________________________________________
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org




From philsf79 at gmail.com  Thu Sep 11 04:40:26 2008
From: philsf79 at gmail.com (Felipe Figueiredo)
Date: Thu, 11 Sep 2008 05:40:26 -0300
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
Message-ID: <1221122426.8059.49.camel@localhost>

I'm not sure if this is related to bioperl (Bio::AlignIO) or if it's a
general perl error on my part, but I find strange that the following
code gives differente results depending on how I input the alignment:

--- test.pl ---
#!/usr/bin/perl

use warnings;
use strict;

use Bio::AlignIO;

my $file;
if (@ARGV) {
    $file = shift @ARGV;
}
else {
    $file = "-";
}

my $align = Bio::AlignIO->new(-file=>$file)->next_aln;

printf "Sequences: %s\n",$align->no_sequences;
--- test.pl ---

If I run this using a file containing 4 sequences, the following
hapens: 

--- run tests ---
$ ./test.pl  exemplo-alinhamento.fasta
Sequences: 4

$ ./test.pl < exemplo-alinhamento.fasta
Sequences: 3

$ cat exemplo-alinhamento.fasta | ./test.pl 
Sequences: 3
--- run tests ---

The missing sequence is always the first one. Am I missing something, or
my code for reading stdin is mistaken or is it a bug in Bio::AlignIO?

I'm using bioperl 1.5.2.102-1ubuntu1, in Ubuntu 8.04 Hardy.

best regards
FF


From David.Messina at sbc.su.se  Thu Sep 11 07:21:51 2008
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 11 Sep 2008 13:21:51 +0200
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <1221122426.8059.49.camel@localhost>
References: <1221122426.8059.49.camel@localhost>
Message-ID: <628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>

Hi Felipe,

Specifying STDIN via a '-' argument to the -file parameter is not valid.
While that is a convention with some UNIX tools, it's not, as far as I know,
something you should be able to count on.

In BioPerl, one can specify STDIN by passing the \*STDIN filehandle glob to
the -fh parameter (NOT to -file).

In other words,

my $align = Bio::AlignIO->new(-fh => \*STDIN)->next_aln;

That is a convention in BioPerl, so the -file and -fh parameters should work
the same way in AlignIO, SearchIO, SeqIO, etc.

Take a look at the beginners' HOWTO for some examples.
http://www.bioperl.org/wiki/HOWTO:Beginners


Dave

From bosborne11 at verizon.net  Thu Sep 11 11:01:32 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Thu, 11 Sep 2008 11:01:32 -0400
Subject: [Bioperl-l] SeqHound
Message-ID: <0E295726-33FE-4083-98A1-9035E37455BD@verizon.net>

Raul,

Good question about BIND, I don't know if the public version is up-to- 
date. For the latest protein-protein interaction data I look at public  
databases like IntAct.

If you use bioperl-network you should be able to read IntAct data into  
a graph, then find the interactions that you're interested in in that  
graph. There are a few qualifications to this statement though, like  
do you have the "right" identifiers or names. So you're right, bioperl- 
network constructs graphs from the XML files but the interactions you  
want are in those graphs. Something like:

  my $graphio = Bio::Network::IO->new(-file   => 'human.xml',
                                      -format => 'psi25');
  my $graph = $graphio->next_network();
  my $node = $graph->get_nodes_by_id('UniProt:P12345');
  my @neighbors = $graph->neighbors($node);



Brian O.

On Sep 11, 2008, at 7:32 AM, Raul Mendez Giraldez wrote:

> Hi Brian,
>
> Actually I realized later that SeqHound is a part of Bioperl itself,  
> and
> that regarding BIND (at least the public database) is reachable trough
> BIND SOAP protocol, that can be implemented in perl through the module
> SOAP::Lite. I still don't know whether the public BIND database is out
> of date, or which part of the BOND database it covers.
>
> Regarding the Bio::Network packages, at the Bioperl suite, I guess it
> rather for representing protein - protein interaction graphs, isn't  
> it?
> That could be interesting to me, but in a second step. I am more
> concerned now in getting this protein - protein interaction data,  
> for a
> set of proteins some biologists gave me. I don't know anything about
> Cytoscape, normally I'm trying to exploit perl data management
> capabilities.
>
> Thanks for the info.
>
> Cheers,
>
> Raul
>

From MEC at stowers-institute.org  Thu Sep 11 14:01:01 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Thu, 11 Sep 2008 13:01:01 -0500
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
References: <1221122426.8059.49.camel@localhost>
	<628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>

Filipe and Dave,

I find that the following works generically for SeqIO and AlignIO (at least)...

#after processing all options using GetOpt,
#any remaining options should name files to process...
@ARGV = ('-') unless @ARGV;     # Default to standard input
my %inopt;
$inopt{-fh} ||=  \*ARGV;
my $AlignIO =  Bio::AlignIO->new(
                         %inopt
                        )  or die "calling Bio::AlignIO->new on %inopt" ;



--Malcolm

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Dave Messina
Sent: Thursday, September 11, 2008 6:22 AM
To: Felipe Figueiredo
Cc: bioperl-l at lists.open-bio.org
Subject: Re: [Bioperl-l] difference in opening file from @ARGV and STDIN?

Hi Felipe,

Specifying STDIN via a '-' argument to the -file parameter is not valid.
While that is a convention with some UNIX tools, it's not, as far as I know, something you should be able to count on.

In BioPerl, one can specify STDIN by passing the \*STDIN filehandle glob to the -fh parameter (NOT to -file).

In other words,

my $align = Bio::AlignIO->new(-fh => \*STDIN)->next_aln;

That is a convention in BioPerl, so the -file and -fh parameters should work the same way in AlignIO, SearchIO, SeqIO, etc.

Take a look at the beginners' HOWTO for some examples.
http://www.bioperl.org/wiki/HOWTO:Beginners


Dave
_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l


From David.Messina at sbc.su.se  Thu Sep 11 14:47:04 2008
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 11 Sep 2008 20:47:04 +0200
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>
References: <1221122426.8059.49.camel@localhost>
	<628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>
Message-ID: <628aabb70809111147y7d99e1bdh414a4ab1037c0990@mail.gmail.com>

Thanks, Malcolm.
So then, '-' as STDIN does work?

D

From MEC at stowers-institute.org  Thu Sep 11 16:19:25 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Thu, 11 Sep 2008 15:19:25 -0500
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <628aabb70809111147y7d99e1bdh414a4ab1037c0990@mail.gmail.com>
References: <1221122426.8059.49.camel@localhost>
	<628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>
	<628aabb70809111147y7d99e1bdh414a4ab1037c0990@mail.gmail.com>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD559C@exchmb-02.stowers-institute.org>

Note exactly the way I would put it.


Look at the difference between the first command and the second is the following transcript:

> echo -e ">asdf\natgc\n" | perl -MBio::SeqIO -e 'my $s = Bio::SeqIO->new(-format => qw{fasta}, -fh => \*ARGV); print $ARGV[0] . qq{ has } . $s->next_seq()->seq . qq{\n}' -- '-'
- has atgc
> echo -e ">asdf\natgc\n" | perl -MBio::SeqIO -e 'my $s = Bio::SeqIO->new(-format => qw{fasta}, -fh => \*ARGV); print $ARGV[0] . qq{ has } . $s->next_seq()->seq . qq{\n}' -- 'NoSuchFile'
Can't open NoSuchFile: No such file or directory at /home/mec/cvs/bioperl-live/Bio/Root/IO.pm line 458.
Can't call method "seq" on an undefined value at -e line 1.

THe only difference is that @ARG is the singleton list composed of '-' in the first call, and is the singlton list composed of 'NoSuchFile' in the second.

If you passed in a list of multiple files that actually do exist, it should work fine.

It is really a matter of ARGV processing magic.

from http://perldoc.perl.org/perlop.html

The null filehandle <> is special: it can be used to emulate the behavior of sed and awk. Input from <> comes either from standard input, or from each file listed on the command line. Here's how it works: the first time <> is evaluated, the @ARGV array is checked, and if it is empty, $ARGV[0] is set to "-", which when opened gives you standard input. The @ARGV array is then processed as a list of filenames. The loop

    while (<>) {
        ...                     # code for each line
    }

is equivalent to the following Perl-like pseudo code:

    unshift<http://perldoc.perl.org/functions/unshift.html>(@ARGV, '-') unless @ARGV;
    while ($ARGV = shift<http://perldoc.perl.org/functions/shift.html>) {
        open<http://perldoc.perl.org/functions/open.html>(ARGV, $ARGV);
        while (<ARGV>) {
            ...         # code for each line
        }
    }





Malcolm Cook
Database Applications Manager - Bioinformatics
Stowers Institute for Medical Research - Kansas City, Missouri




________________________________
From: dave at davemessina.com [mailto:dave at davemessina.com] On Behalf Of Dave Messina
Sent: Thursday, September 11, 2008 1:47 PM
To: Cook, Malcolm
Cc: Felipe Figueiredo; bioperl-l at lists.open-bio.org
Subject: Re: [Bioperl-l] difference in opening file from @ARGV and STDIN?

Thanks, Malcolm.

So then, '-' as STDIN does work?

D



From David.Messina at sbc.su.se  Thu Sep 11 17:15:44 2008
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 11 Sep 2008 23:15:44 +0200
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC129FFD559C@exchmb-02.stowers-institute.org>
References: <1221122426.8059.49.camel@localhost>
	<628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>
	<628aabb70809111147y7d99e1bdh414a4ab1037c0990@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD559C@exchmb-02.stowers-institute.org>
Message-ID: <628aabb70809111415w27044d57jd3121adb40900e45@mail.gmail.com>

Cool, thanks for the explanation Malcolm!

At the risk of belaboring this point and your patience, one thing still
confuses me, though:

and if [@ARGV] is empty, $ARGV[0] is set to "-"
>

If $ARGV[0] is set (by Perl's ARGV processing magic) to '-', then why in
your earlier example do you manually set $ARGV[0] to '-' instead of simply
leaving @ARGV empty?

@ARGV = ('-') unless @ARGV;




If I run your example and omit '-' as an argument, it still works:

> echo -e ">asdf\natgc\n" | perl -MBio::SeqIO -e 'my $s =
Bio::SeqIO->new(-format => qw{fasta}, -fh => \*ARGV); print $ARGV[0] . qq{
has } . $s->next_seq()->seq . qq{\n}'
 has atgc



Dave

From acouperthwaite at gmail.com  Fri Sep 12 17:17:53 2008
From: acouperthwaite at gmail.com (Andrew Couperthwaite)
Date: Fri, 12 Sep 2008 15:17:53 -0600
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
Message-ID: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>

Hi,

I'm having difficulty using  the Bio::DB::Query::GenBank module.  The  
sample script on the page http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/DB/Query/GenBank.html 
  doesn't seem to work.

I'm trying to use this and the Bio::DB::GenBank module to find and  
download a set of sequences from GenBank...
I'm rather new to bioperl, can anyone point me in the right direction?

Thanks,
-Andrew

From jason at bioperl.org  Sat Sep 13 02:42:28 2008
From: jason at bioperl.org (Jason Stajich)
Date: Fri, 12 Sep 2008 23:42:28 -0700
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
In-Reply-To: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
References: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
Message-ID: <2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>

Hi Andrew -

a) what is the exact script code you are trying, what are the error  
messages?
b) what version of bioperl?

The first thing we'll suggest is: did you get the latest code from SVN  
yet or a nightly build?

-jason
On Sep 12, 2008, at 2:17 PM, Andrew Couperthwaite wrote:

> Hi,
>
> I'm having difficulty using  the Bio::DB::Query::GenBank module.   
> The sample script on the page http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/DB/Query/GenBank.html 
>  doesn't seem to work.
>
> I'm trying to use this and the Bio::DB::GenBank module to find and  
> download a set of sequences from GenBank...
> I'm rather new to bioperl, can anyone point me in the right direction?
>
> Thanks,
> -Andrew
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org




From cjfields at illinois.edu  Mon Sep 15 00:13:57 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Sun, 14 Sep 2008 23:13:57 -0500
Subject: [Bioperl-l] significant bug with Bio::LocatableSeq
Message-ID: <98938314-4AF1-44C2-8867-B383A44E542E@illinois.edu>

While debugging some tests in bioperl, I noticed a fairly significant  
issue with Bio::LocatableSeq which is probably due to some  
inconsistencies with start/end coordinates.  For some reason this  
started popping up with error messages recently when running AlignIO  
tests on bioperl-live (i.e. something changed which exposed the bug,  
maybe the verbosity level):

1..295
ok 1 - use Bio::AlignIO;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5
ok 6 - The object isa Bio::AlignIO

--------------------- WARNING ---------------------
MSG: In sequence 02 residue count gives end value 399.
Overriding value [355] with value 399 for Bio::LocatableSeq::end().
STACK Bio::LocatableSeq::end /Users/cjfields/bioperl/bioperl-live/blib/ 
lib/Bio/LocatableSeq.pm:150
STACK Bio::LocatableSeq::new /Users/cjfields/bioperl/bioperl-live/blib/ 
lib/Bio/LocatableSeq.pm:103
STACK Bio::AlignIO::arp::next_aln /Users/cjfields/bioperl/bioperl-live/ 
blib/lib/Bio/AlignIO/arp.pm:106
STACK toplevel t/AlignIO.t:34
---------------------------------------------------
.... followed by tons of similar errors.

The problem is, no change is ever made.  This is demonstrated by the  
following:

-----------------------------
#!/usr/bin/perl -w

use strict;
use warnings;
use Bio::LocatableSeq;

my $seq = Bio::LocatableSeq->new(
     -id => 'foo',
     -seq => 'A----TGCGCTTCCTCGCTTCCG',
     -start => 10,
     -end => 100, # intentially bad
     -strand => -1);

print $seq->end."\n";

-----------------------------

Results:

--------------------- WARNING ---------------------
MSG: In sequence foo residue count gives end value 28.
Overriding value [100] with value 28 for Bio::LocatableSeq::end().
STACK Bio::LocatableSeq::end /Users/cjfields/bioperl/bioperl-live/Bio/ 
LocatableSeq.pm:150
STACK Bio::LocatableSeq::new /Users/cjfields/bioperl/bioperl-live/Bio/ 
LocatableSeq.pm:103
STACK toplevel seq.pl:7
---------------------------------------------------
100

The warning pops up when -end is passed to LocatableSeq::new and  
indicates that the passed coordinate doesn't match up with the one  
calculated from the sequence (minus gaps).  I've isolated the bug down  
to the end() method and am working on fixing it.  Note that this  
affects LocatableSeq::length as well.  This appears to affect arp,  
nexus, stockholm, and a few other AlignIO parsers as well.

chris

From acouperthwaite at gmail.com  Mon Sep 15 15:05:13 2008
From: acouperthwaite at gmail.com (Andrew Couperthwaite)
Date: Mon, 15 Sep 2008 13:05:13 -0600
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
In-Reply-To: <2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>
References: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
	<2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>
Message-ID: <2BA47AC9-5A04-460D-BA56-64B152AFFF16@gmail.com>

the code i'm starting with is this:
=====
use Bio::DB::Query::GenBank;
use Bio::DB::GenBank

my $query_string = 'Oryza[Organism] AND EST[Keyword]';
    my $query = Bio::DB::Query::GenBank->new(-query =>  
'Oryza[Organism] AND EST[Keyword]',
    											-db=>'nucleotide');
    my $count = $query->count;
    my @ids   = $query->ids;
    # get a genbank database handle
    my $gb = Bio::DB::GenBank->new();
    my $stream = $gb->get_Stream_by_query($query);

    while (my $seq = $stream->next_seq) {
       # do something with the sequence object
       print "hello";
    }
=====
It doesn't produce any error messages, it simply doesn't enter the  
while loop.  It seems as though it isn't getting any results from  
genbank?/isn't contacting genbank?

We are running version 1.5.2.  Haven't updated since late May.

-Andrew

On 13-Sep-08, at 12:42 AM, Jason Stajich wrote:

> Hi Andrew -
>
> a) what is the exact script code you are trying, what are the error  
> messages?
> b) what version of bioperl?
>
> The first thing we'll suggest is: did you get the latest code from  
> SVN yet or a nightly build?
>
> -jason
> On Sep 12, 2008, at 2:17 PM, Andrew Couperthwaite wrote:
>
>> Hi,
>>
>> I'm having difficulty using  the Bio::DB::Query::GenBank module.   
>> The sample script on the page http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/DB/Query/GenBank.html 
>>  doesn't seem to work.
>>
>> I'm trying to use this and the Bio::DB::GenBank module to find and  
>> download a set of sequences from GenBank...
>> I'm rather new to bioperl, can anyone point me in the right  
>> direction?
>>
>> Thanks,
>> -Andrew
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Jason Stajich
> jason at bioperl.org
>
>
>


From jason at bioperl.org  Mon Sep 15 15:25:49 2008
From: jason at bioperl.org (Jason Stajich)
Date: Mon, 15 Sep 2008 12:25:49 -0700
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
In-Reply-To: <2BA47AC9-5A04-460D-BA56-64B152AFFF16@gmail.com>
References: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
	<2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>
	<2BA47AC9-5A04-460D-BA56-64B152AFFF16@gmail.com>
Message-ID: <25A13987-7306-42E8-BE4E-E50A70538E7D@bioperl.org>

Try removing the line
my @ids = $query->ids;

I don't think GenBank supports this part of the query API now or you  
have to execute the query first before you can ask for the number of  
IDs from that object.  I don't remember exactly what changed  
specifically, but I actually get an error with that line:
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Id list has been truncated even after maxids requested
STACK: Error::throw
STACK: Bio::Root::Root::throw /usr/local/lib/perl5/Bio/Root/Root.pm:357
STACK: Bio::DB::Query::WebQuery::_fetch_ids /usr/local/lib/perl5/Bio/ 
DB/Query/WebQuery.pm:237
STACK: Bio::DB::Query::WebQuery::ids /usr/local/lib/perl5/Bio/DB/Query/ 
WebQuery.pm:201
STACK: query.pl:9
-----------------------------------------------------------


This is the query script I use that works fine for me for my downloads.

http://fungalgenomes.org/~stajich/scripts/download_query_genbank.pl


I'm using SVN code so it is possible things are changed since 1.5.2.

-jason
On Sep 15, 2008, at 12:05 PM, Andrew Couperthwaite wrote:

> the code i'm starting with is this:
> =====
> use Bio::DB::Query::GenBank;
> use Bio::DB::GenBank
>
> my $query_string = 'Oryza[Organism] AND EST[Keyword]';
>   my $query = Bio::DB::Query::GenBank->new(-query =>  
> 'Oryza[Organism] AND EST[Keyword]',
>   											-db=>'nucleotide');
>   my $count = $query->count;
>   my @ids   = $query->ids;
>   # get a genbank database handle
>   my $gb = Bio::DB::GenBank->new();
>   my $stream = $gb->get_Stream_by_query($query);
>
>   while (my $seq = $stream->next_seq) {
>      # do something with the sequence object
>      print "hello";
>   }
> =====
> It doesn't produce any error messages, it simply doesn't enter the  
> while loop.  It seems as though it isn't getting any results from  
> genbank?/isn't contacting genbank?
>
> We are running version 1.5.2.  Haven't updated since late May.
>
> -Andrew
>
> On 13-Sep-08, at 12:42 AM, Jason Stajich wrote:
>
>> Hi Andrew -
>>
>> a) what is the exact script code you are trying, what are the error  
>> messages?
>> b) what version of bioperl?
>>
>> The first thing we'll suggest is: did you get the latest code from  
>> SVN yet or a nightly build?
>>
>> -jason
>> On Sep 12, 2008, at 2:17 PM, Andrew Couperthwaite wrote:
>>
>>> Hi,
>>>
>>> I'm having difficulty using  the Bio::DB::Query::GenBank module.   
>>> The sample script on the page http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/DB/Query/GenBank.html 
>>>  doesn't seem to work.
>>>
>>> I'm trying to use this and the Bio::DB::GenBank module to find and  
>>> download a set of sequences from GenBank...
>>> I'm rather new to bioperl, can anyone point me in the right  
>>> direction?
>>>
>>> Thanks,
>>> -Andrew
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Jason Stajich
>> jason at bioperl.org
>>
>>
>>
>

Jason Stajich
jason at bioperl.org




From biology0046 at hotmail.com  Mon Sep 15 16:00:02 2008
From: biology0046 at hotmail.com (=?gb2312?B?va3OxOL9?=)
Date: Mon, 15 Sep 2008 20:00:02 +0000
Subject: [Bioperl-l] HSP tiling problem
In-Reply-To: <mailman.7944.1221254286.2673.bioperl-l@lists.open-bio.org>
References: <mailman.7944.1221254286.2673.bioperl-l@lists.open-bio.org>
Message-ID: <BLU108-W14DD76360E5100AC535214B4520@phx.gbl>


Dear all:
I try to use bioperl's SearhIO module to parse the blast output, 
the output of blast contain many HSPs from the same hit, each HSP come out with an count of identity residues and alignment length, but what i want to get is the global identiy and alignment length of the query sequence and hit sequence, which may be done by tiling the HSPs and build a HSP contig, 
 
the bioperl BLASTutil module contain "hsp_tiling and length_aln, frac_identical" method fullfill my purpose, but i read through the mailing list, some user said the method used by bioperl were not precise in many cases, they sugguest to use WUBLAST.
 
but i don't know which WUBLAST opinion should i use, i use "links" opinion, but the output still give me lots of HSPs, are these HSPs created from some small HSPs?best regards!wenkaichinese academy of sciences
_________________________________________________________________
????????????????????????????????????????????????????
http://im.live.cn/Share/18.htm

From jason at bioperl.org  Mon Sep 15 16:27:02 2008
From: jason at bioperl.org (Jason Stajich)
Date: Mon, 15 Sep 2008 13:27:02 -0700
Subject: [Bioperl-l] HSP tiling problem
In-Reply-To: <BLU108-W14DD76360E5100AC535214B4520@phx.gbl>
References: <mailman.7944.1221254286.2673.bioperl-l@lists.open-bio.org>
	<BLU108-W14DD76360E5100AC535214B4520@phx.gbl>
Message-ID: <90A30B97-1618-4AAF-86D9-B51929697CDE@bioperl.org>

The -links option gives you a logical ordering of non-overlapping HSPs  
so it is the tiling you desire. You just process each HSP from the  
list provided by -links. There may be several alternative paths so you  
can compute a %id for all of them or just take the longest one, etc.

You need to just decide how you want to compute global identity - an  
average of the HSP identities or just sum up the number of identical  
bases across them all divided by the total length of sequence that is  
aligned.  All those pieces of information are available and described  
in the SearchIO HOWTO on the website.

Or, requiring less coding, re-align the sequences with an aligner like  
SSEARCH to get a single alignment and a single %id/%sim number for the  
sequence pair.

-jason

On Sep 15, 2008, at 1:00 PM, ?????? wrote:

>
> Dear all:
> I try to use bioperl's SearhIO module to parse the blast output,
> the output of blast contain many HSPs from the same hit, each HSP  
> come out with an count of identity residues and alignment length,  
> but what i want to get is the global identiy and alignment length of  
> the query sequence and hit sequence, which may be done by tiling the  
> HSPs and build a HSP contig,
>
> the bioperl BLASTutil module contain "hsp_tiling and length_aln,  
> frac_identical" method fullfill my purpose, but i read through the  
> mailing list, some user said the method used by bioperl were not  
> precise in many cases, they sugguest to use WUBLAST.
>
> but i don't know which WUBLAST opinion should i use, i use "links"  
> opinion, but the output still give me lots of HSPs, are these HSPs  
> created from some small HSPs?best regards!wenkaichinese academy of  
> sciences
> _________________________________________________________________
> ????????????????????????????????????????????????????
> http://im.live.cn/Share/18.htm
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From bosborne11 at verizon.net  Mon Sep 15 22:22:54 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Mon, 15 Sep 2008 22:22:54 -0400
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
In-Reply-To: <25A13987-7306-42E8-BE4E-E50A70538E7D@bioperl.org>
References: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
	<2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>
	<2BA47AC9-5A04-460D-BA56-64B152AFFF16@gmail.com>
	<25A13987-7306-42E8-BE4E-E50A70538E7D@bioperl.org>
Message-ID: <583390B6-1075-4EB0-A22A-E1D07D2EDFA8@verizon.net>

Jason,

I added that script to scripts/, hope you don't mind!

Brian O.



On Sep 15, 2008, at 3:25 PM, Jason Stajich wrote:

> This is the query script I use that works fine for me for my  
> downloads.


From mirhan at indiana.edu  Tue Sep 16 01:18:47 2008
From: mirhan at indiana.edu (Han, Mira)
Date: Tue, 16 Sep 2008 01:18:47 -0400
Subject: [Bioperl-l] [Wg-phyloinformatics] Summer of Code: project
	summaries
In-Reply-To: <2033D247-5E34-4BDE-A98E-BE08D9910951@duke.edu>
Message-ID: <C4F4B9F7.5500%mirhan@indiana.edu>


Hi,
Just writing to summarize the final product of this summer. (even though it's overdue)
The phyloXML support in BioPerl project is finished officially,
I've created three new modules,
Bio::TreeIO::phyloxml,
Bio::Tree::AnnotatableNode,
and Bio::Annotation::Relation.
The parsing is done for all elements except for <ProteinDomain>
And the validation step is still missing.
I'm planning to add those in in the future.

I was contemplating to make a Bio::Annotation::XML till the end,
But decided not to since there was already a new module Bio::Annotation::TagTree, that looked like the same thing.
Currently, the module does not use TagTree, it uses nested AnnotationCollections instead, because TagTree was a temporary stub at the time.
There are methods in phyloxml that seem out of place there,
For example, the print_annotation and print_attr functions that print the annotations in phyloXML format.
Or the read_annotation function that reads the value of the annotation for a certain object.
I feel like these functions should go with the Annotation object,
But since there were no Annotation object that is phyloXML specific,
I just put them in the TreeIO::phyloxml.
This may change too in the future.

The documentations are all finished and can be seen in
http://www.bioperl.org/wiki/Module:Bio::TreeIO::phyloxml
http://www.bioperl.org/wiki/Module:Bio::Tree::AnnotatableNode
http://www.bioperl.org/wiki/Module:Bio::Annotation::Relation

The detailed progress of the project is documented in
http://www.bioperl.org/wiki/PhyloXML_support_in_BioPerl

and there is also a demo page that describes the use in
http://www.bioperl.org/wiki/Phyloxml_Project_Demo


Finally I'd like to thank Chris Fields and Hilmar Lapp,
for the constant support during the summer.
And the people on the list for providing helpful suggestions when I came with a question.
See you around.

Mira Han




On 9/14/08 1:15 PM, "Hilmar Lapp" <hlapp at duke.edu> wrote:

Hi all,

the 2008 Google Summer of Code program is officially over now. First
off, I'd like to congratulate all of our students: you all passed your
end-of-term evaluation, and you all passed solidly. Thanks for all
your hard work, beginning with writing and refining your project
applications and finally wrapping it up with documentation and a
demonstration project.

Based on what I can see, the students have all uploaded the code you
produced over the summer to the Google Code repository, as requested
by Google, so I'm not going to bore you with repeating the
instructions for how to do this. If you are still having trouble with
this process or have other questions regarding this though, don't
hesitate to let me know and ask any question you have.

For our imminently due Annual Report to NSF, we will need to document
your projects, and I am asking you for your help in this. Essentially,
we will need to produce similar information to what we composed for
the 2007 fall NESCent newsletter: for each project we need a short
summary of the project and the benefits of the results, written for a
scientific but otherwise general audience, a headshot of you (the
student), and a visual of the results. See

http://www.nescent.org/news/newsletter_10_07.php#google

for the example from last year as to what we have in mind. Kistin
Jenkins or Jory Weintraub from NESCent's Education and Outreach group
(both copied) will be in touch with you to possibly edit the summaries
and fine-tune the other material, but if the students could please
send your draft summary text, headshot, and visual as soon as you can
to eog at nescent.org that would be great. If you are not sure what to
use for the visual, I'd encourage you to speak with your mentor;
however, feel free to ask me as well.

Thanks again for working with us, and on your projects, and I hope you
all not only had a most enjoyable summer but also will keep involved
in your project as much as possible. I will also arrange for an end-of-
term teleconference with the students shortly, and one of the things
that I'd like to talk about is how we can best facilitate you
remaining involved beyond the official end of the program.

Cheers,

        -hilmar

--
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:- hlapp at duke dot edu :
===========================================================




_______________________________________________
Wg-phyloinformatics mailing list
Wg-phyloinformatics at nescent.org
https://lists.nescent.org/mailman/listinfo/wg-phyloinformatics




From hartzell at alerce.com  Wed Sep 17 00:21:36 2008
From: hartzell at alerce.com (George Hartzell)
Date: Tue, 16 Sep 2008 21:21:36 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18640.34256.305270.924007@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > George,
 > 
 > This is an error from my side. Great that you have a fix already.
 > 
 > My only worry is the number of external dependencies in BioPerl. To limit 
 > these we have recoded number of functionalities into BioPerl-specific modules. 
 > Before you commit the fix, could you see if Bio::RangeI could be used or easily 
 > extended to be used instead of Set::IntSpan?
 > 
 > Thanks,
 > 
 >    -Heikki
 > 
 > On Friday 05 September 2008 21:01:35 George Hartzell wrote:
 > > Hi all,
 > >
 > > Bio::Coordinate::Collection surprised me a bit.  At first I thought
 > > there was a bug, but it's clearly doing what it's supposed to.  Now
 > > I'm wondering if what it's supposed to be doing makes sense in some
 > > context, or if what I expected would be better functionality.
 > >
 > > t/CoordinateMapper.t sets up the following scenario:
 > >
 > > #
 > > # Collection
 > > #
 > > #         1   5     6   10
 > > #         |---|     |---|
 > > #-----|-----------------------
 > > #     1   5   9     15  19
 > > #         pair1     pair2
 > >
 > > Then goes on to do the following query:
 > >
 > >   # match more than two
 > >   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
 > >   ok $res = $transcribe->map($pos);
 > >   is $res->each_gap, 2;
 > >   is $res->each_match, 2;
 > >
 > > I was surprised to see that there were two gaps, one gene:10-19 and
 > > one from gene:5-14.  Looking at the code, what's really happening is
 > > that, for the exon1 mapper there's match with gene:5-9 and a gap with
 > > gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
 > > match with gene:15-19.  All four Result's just get tossed into the
 > > return value.
 > >
 > > The result my intuition wants is that there are two matches (gene:5-9
 > > with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
 > >
 > > Yes, I guess that I could just synthesize these myself from the result
 > > in my app.
 > >
 > > It still seems that the current result is a bug though, since there's
 > > no way of knowing when you're walking through $res->each_Location that
 > > the first "gap" is with respect to the exon1 mapper and that the
 > > second "gap" is with respect to the exon2 mapper.  The gaps are
 > > meaningless.
 > >
 > > I "fixed" it to work the way I think it should (two matches, one
 > > gap).  I actually extended the test case a bit so that there's a
 > > multi-base gap, a match, another multibase-gap, another match, then a
 > > single base gap (just to make sure I got that right...).  I had to
 > > touch up the test file a bit to account for my new test.
 > >
 > > The gaps that I return have a strand of 'undef', which seems to be The
 > > Right Thing.  There's also a bit of funny business where I hang onto
 > > the seq_id of the gapped sequence.  It assumes that the "in" sequence
 > > is the same for all of the mappers.  This seems safe since otherwise
 > > the entire query is kind of weird....
 > >
 > > There's a patch to todays svn head at:
 > >
 > >   http://shrimp.alerce.com/bioperl/collection-diffs.txt
 > >
 > > The patch changes Build.PL to include a dependency on Set::IntSpan,
 > > CoordinateMapper.t to update the tests, and
 > > Bio/CoordinateMapper/Collection.pm for the new code.
 > >
 > > Who's code would this break.
 > >
 > > If anyone's relying on the current behaviour re: gaps, what's the
 > > situation in which you find it useful?
 > >
 > > Thanks!
 > >
 > > g.

I suspect that I can redo it w/ RangeI's.  It'll be a good project.
I'm pushing on a project at the moment but will get to it this weekend
or next week.

thanks,

g.

From hartzell at alerce.com  Wed Sep 17 00:21:36 2008
From: hartzell at alerce.com (George Hartzell)
Date: Tue, 16 Sep 2008 21:21:36 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18640.34256.305270.924007@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > George,
 > 
 > This is an error from my side. Great that you have a fix already.
 > 
 > My only worry is the number of external dependencies in BioPerl. To limit 
 > these we have recoded number of functionalities into BioPerl-specific modules. 
 > Before you commit the fix, could you see if Bio::RangeI could be used or easily 
 > extended to be used instead of Set::IntSpan?
 > 
 > Thanks,
 > 
 >    -Heikki
 > 
 > On Friday 05 September 2008 21:01:35 George Hartzell wrote:
 > > Hi all,
 > >
 > > Bio::Coordinate::Collection surprised me a bit.  At first I thought
 > > there was a bug, but it's clearly doing what it's supposed to.  Now
 > > I'm wondering if what it's supposed to be doing makes sense in some
 > > context, or if what I expected would be better functionality.
 > >
 > > t/CoordinateMapper.t sets up the following scenario:
 > >
 > > #
 > > # Collection
 > > #
 > > #         1   5     6   10
 > > #         |---|     |---|
 > > #-----|-----------------------
 > > #     1   5   9     15  19
 > > #         pair1     pair2
 > >
 > > Then goes on to do the following query:
 > >
 > >   # match more than two
 > >   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
 > >   ok $res = $transcribe->map($pos);
 > >   is $res->each_gap, 2;
 > >   is $res->each_match, 2;
 > >
 > > I was surprised to see that there were two gaps, one gene:10-19 and
 > > one from gene:5-14.  Looking at the code, what's really happening is
 > > that, for the exon1 mapper there's match with gene:5-9 and a gap with
 > > gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
 > > match with gene:15-19.  All four Result's just get tossed into the
 > > return value.
 > >
 > > The result my intuition wants is that there are two matches (gene:5-9
 > > with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
 > >
 > > Yes, I guess that I could just synthesize these myself from the result
 > > in my app.
 > >
 > > It still seems that the current result is a bug though, since there's
 > > no way of knowing when you're walking through $res->each_Location that
 > > the first "gap" is with respect to the exon1 mapper and that the
 > > second "gap" is with respect to the exon2 mapper.  The gaps are
 > > meaningless.
 > >
 > > I "fixed" it to work the way I think it should (two matches, one
 > > gap).  I actually extended the test case a bit so that there's a
 > > multi-base gap, a match, another multibase-gap, another match, then a
 > > single base gap (just to make sure I got that right...).  I had to
 > > touch up the test file a bit to account for my new test.
 > >
 > > The gaps that I return have a strand of 'undef', which seems to be The
 > > Right Thing.  There's also a bit of funny business where I hang onto
 > > the seq_id of the gapped sequence.  It assumes that the "in" sequence
 > > is the same for all of the mappers.  This seems safe since otherwise
 > > the entire query is kind of weird....
 > >
 > > There's a patch to todays svn head at:
 > >
 > >   http://shrimp.alerce.com/bioperl/collection-diffs.txt
 > >
 > > The patch changes Build.PL to include a dependency on Set::IntSpan,
 > > CoordinateMapper.t to update the tests, and
 > > Bio/CoordinateMapper/Collection.pm for the new code.
 > >
 > > Who's code would this break.
 > >
 > > If anyone's relying on the current behaviour re: gaps, what's the
 > > situation in which you find it useful?
 > >
 > > Thanks!
 > >
 > > g.

I suspect that I can redo it w/ RangeI's.  It'll be a good project.
I'm pushing on a project at the moment but will get to it this weekend
or next week.

thanks,

g.

From cjfields at illinois.edu  Wed Sep 17 12:41:52 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 17 Sep 2008 11:41:52 -0500
Subject: [Bioperl-l] [Wg-phyloinformatics] Summer of Code: project
	summaries
In-Reply-To: <C4F4B9F7.5500%mirhan@indiana.edu>
References: <C4F4B9F7.5500%mirhan@indiana.edu>
Message-ID: <25D73268-25A1-4780-A2D2-F27D47081D83@illinois.edu>


On Sep 16, 2008, at 12:18 AM, Han, Mira wrote:

> Hi,
> Just writing to summarize the final product of this summer. (even  
> though it's overdue)

BLTN

> The phyloXML support in BioPerl project is finished officially,
> I've created three new modules,
> Bio::TreeIO::phyloxml,
> Bio::Tree::AnnotatableNode,
> and Bio::Annotation::Relation.
> The parsing is done for all elements except for <ProteinDomain>
> And the validation step is still missing.
> I'm planning to add those in in the future.

Great work!  One issue that will come up: have you tested round- 
tripping?

(i.e. where object data read in from the original phlyoxml data is the  
same as object data read in from bioperl-derived phyloxml output)

> I was contemplating to make a Bio::Annotation::XML till the end,
> But decided not to since there was already a new module  
> Bio::Annotation::TagTree, that looked like the same thing.
> Currently, the module does not use TagTree, it uses nested  
> AnnotationCollections instead, because TagTree was a temporary stub  
> at the time.

I would consider it no longer temporary (just changed it in svn).  The  
'stub' part was left over from the initial commit; it has now been  
tested with bioperl-db (via swissprot tests).  It may need more  
rigorous testing via bioperl-db but it appears to work just fine  
(famous last words...).

There was one issue with Data::Stag (repeated 'Use of undefined  
variable' errors that popped up with Annotation.t tests), but Chris M.  
released a new Data::Stag to CPAN just recently which fixes that.  It  
wasn't a bioperl bug and was relatively harmless.

> There are methods in phyloxml that seem out of place there,
> For example, the print_annotation and print_attr functions that  
> print the annotations in phyloXML format.
> Or the read_annotation function that reads the value of the  
> annotation for a certain object.
> I feel like these functions should go with the Annotation object,
> But since there were no Annotation object that is phyloXML specific,
> I just put them in the TreeIO::phyloxml.
> This may change too in the future.

I don't see a problem with this; if you look at the various IO parsers  
there are several helper methods present (see Bio::SeqIO::genbank for  
an example).

If you were to go that route, I would add a method to the (generic)  
Annotation class that accepts some customization via a callback, maybe  
using a default callback if one isn't supplied.  See the various  
Bio::AnnotationI display_text methods, which were added in as a more  
explicit replacement for operator overloading.

> The documentations are all finished and can be seen in
> http://www.bioperl.org/wiki/Module:Bio::TreeIO::phyloxml
> http://www.bioperl.org/wiki/Module:Bio::Tree::AnnotatableNode
> http://www.bioperl.org/wiki/Module:Bio::Annotation::Relation
>
> The detailed progress of the project is documented in
> http://www.bioperl.org/wiki/PhyloXML_support_in_BioPerl
>
> and there is also a demo page that describes the use in
> http://www.bioperl.org/wiki/Phyloxml_Project_Demo

I'll give them a look over, but that's a great start!

> Finally I'd like to thank Chris Fields and Hilmar Lapp,
> for the constant support during the summer.
> And the people on the list for providing helpful suggestions when I  
> came with a question.
> See you around.
>
> Mira Han

Thanks, and congrats on completeing the summer of code!  Hope you  
stick around a bit longer; we need all the hands we can get.

chris

From gundalav at gmail.com  Thu Sep 18 04:51:54 2008
From: gundalav at gmail.com (Gundala Viswanath)
Date: Thu, 18 Sep 2008 17:51:54 +0900
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with
	Bioperl
Message-ID: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>

Dear all,

Is there a way I can convert such EnSeMBL
probe names into Gene Symbol with BioPerl?

ENSG00000000003_at
ENSG00000000005_at
ENSG00000000419_at
ENSG00000000457_at
ENSG00000000460_at
ENSG00000000938_at
ENSG00000000971_at
ENSG00000001036_at
ENSG00000001084_at
ENSG00000001167_at
ENSG00000001461_at
ENSG00000001497_at
ENSG00000001561_at
... etc ...

Or perhaps there is a flat file for conversion?



- Gundala Viswanath
Jakarta - Indonesia

From cjfields at illinois.edu  Thu Sep 18 08:07:52 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 18 Sep 2008 07:07:52 -0500
Subject: [Bioperl-l] Species.t tests failing with bioperl-live
Message-ID: <C67B2790-EC0C-4F3A-A026-20CFBAE92B74@illinois.edu>

I'm getting a couple of failed tests with

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign





From cjfields at illinois.edu  Thu Sep 18 08:15:03 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 18 Sep 2008 07:15:03 -0500
Subject: [Bioperl-l] Species.t tests failing with bioperl-live
In-Reply-To: <C67B2790-EC0C-4F3A-A026-20CFBAE92B74@illinois.edu>
References: <C67B2790-EC0C-4F3A-A026-20CFBAE92B74@illinois.edu>
Message-ID: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>


On Sep 18, 2008, at 7:07 AM, Chris Fields wrote:

> I'm getting a couple of failed tests with


Um, that was supposed to be:

I'm getting a couple of failed tests with Species.t; I think these are  
due to the last commit to Bio::Species:

http://code.open-bio.org/svnweb/index.cgi/bioperl/revision/?rev=14793

Tests pass after commenting out that line.

chris

From bernd.web at gmail.com  Thu Sep 18 13:34:49 2008
From: bernd.web at gmail.com (Bernd Web)
Date: Thu, 18 Sep 2008 19:34:49 +0200
Subject: [Bioperl-l] SimpleAlign/AlignIO
Message-ID: <716af09c0809181034w2f9cc44do6b2a02502ea81fea@mail.gmail.com>

Hi,

Possibly I overlooked this, but is it not possible to supply an
alphabet to SimpleAlign?
When SimpleAlign starts making sequence objects _guess_alphabet is
executed and in case the sequence (slice) only contains gaps a warning
is raised as the alphabet cannot be guessed.
As all sequences in the alignment (generally) would be of the same
type, it could be good to set the alpabet for the alignment; this also
would prevent the executing of _guess_alphabet for all sequences. Is
this possible?


Regards,
Bernd

From cjfields at illinois.edu  Thu Sep 18 13:56:56 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 18 Sep 2008 12:56:56 -0500
Subject: [Bioperl-l] SimpleAlign/AlignIO
In-Reply-To: <716af09c0809181034w2f9cc44do6b2a02502ea81fea@mail.gmail.com>
References: <716af09c0809181034w2f9cc44do6b2a02502ea81fea@mail.gmail.com>
Message-ID: <9012F474-5762-4ABA-ADAB-7F0ECB38ACC3@illinois.edu>

Bernd,

I'm not sure it's a good idea to constrain the entire alignment (and  
all sequences contained within) to a single alphabet.  For instance,  
what if I wanted to align a translated (protein) sequence, possibly as  
3- or 6-frame, to a DNA sequence of interest?  Or if I wanted to align  
a Meta sequence w/o an alphabet (i.e. a structural consensus sequence)  
with a DNA/RNA/protein sequence?  The former example is fairly common  
and may not be entirely possible with SimpleAlign (I haven't tried it  
to tell the truth), but the latter is what I do with the Stockholm  
parser.

chris

On Sep 18, 2008, at 12:34 PM, Bernd Web wrote:

> Hi,
>
> Possibly I overlooked this, but is it not possible to supply an
> alphabet to SimpleAlign?
> When SimpleAlign starts making sequence objects _guess_alphabet is
> executed and in case the sequence (slice) only contains gaps a warning
> is raised as the alphabet cannot be guessed.
> As all sequences in the alignment (generally) would be of the same
> type, it could be good to set the alpabet for the alignment; this also
> would prevent the executing of _guess_alphabet for all sequences. Is
> this possible?
>
>
> Regards,
> Bernd
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign





From MEC at stowers-institute.org  Thu Sep 18 17:20:02 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Thu, 18 Sep 2008 16:20:02 -0500
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
	with	Bioperl
In-Reply-To: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>

Gundala,

Here is an option - if you want a script...

http://research.stowers-institute.org/mec/software/scripts/affyprobeset2ensg/

It is not bioperl.   It is perl.  It uses DBI to query the ensembl MySQL database using SQL.  It may be outdated due to changes in Ensembl schema.

Good luck,

Malcolm Cook
Stowers Institute for Medical Research - Kansas City, Missouri

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Gundala Viswanath
Sent: Thursday, September 18, 2008 3:52 AM
To: bioperl-l at lists.open-bio.org
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with Bioperl

Dear all,

Is there a way I can convert such EnSeMBL probe names into Gene Symbol with BioPerl?

ENSG00000000003_at
ENSG00000000005_at
ENSG00000000419_at
ENSG00000000457_at
ENSG00000000460_at
ENSG00000000938_at
ENSG00000000971_at
ENSG00000001036_at
ENSG00000001084_at
ENSG00000001167_at
ENSG00000001461_at
ENSG00000001497_at
ENSG00000001561_at
... etc ...

Or perhaps there is a flat file for conversion?



- Gundala Viswanath
Jakarta - Indonesia
_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l


From anjan.purkayastha at gmail.com  Thu Sep 18 17:27:06 2008
From: anjan.purkayastha at gmail.com (ANJAN PURKAYASTHA)
Date: Thu, 18 Sep 2008 17:27:06 -0400
Subject: [Bioperl-l] Retrieving taxonomy information from a GenBank file
Message-ID: <f03f40920809181427k168bfc3cu535c023949735cd9@mail.gmail.com>

Hi,
I'm using the following code to access the "ORGANISM" tag value for the
record NC_002526.
I get a value of 0 even though the ORGANISM tag  has a value.  Any idea how
this might be corrected?
Thanks.
Anjan


my $gb= new Bio::DB::GenBank;

my $seq = $gb->get_Seq_by_acc('NC_002526');

my $des= $seq->get_tag_values("ORGANISM");

-- 
=============================
anjan purkayastha, phd
bioinformatics analyst
whitehead institute for biomedical research
nine cambridge center
cambridge, ma 02142

purkayas [at] wi [dot] mit [dot] edu
703.740.6939

From jason at bioperl.org  Thu Sep 18 17:51:54 2008
From: jason at bioperl.org (Jason Stajich)
Date: Thu, 18 Sep 2008 14:51:54 -0700
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with
	Bioperl
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
Message-ID: <F1CAA89B-D7E9-40B3-9965-9636B4F5F852@bioperl.org>

seems like something that biomart was designed for? There is a  
scripting interface too.
http://biomart.org/

On Sep 18, 2008, at 2:20 PM, Cook, Malcolm wrote:

> Gundala,
>
> Here is an option - if you want a script...
>
> http://research.stowers-institute.org/mec/software/scripts/affyprobeset2ensg/
>
> It is not bioperl.   It is perl.  It uses DBI to query the ensembl  
> MySQL database using SQL.  It may be outdated due to changes in  
> Ensembl schema.
>
> Good luck,
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org 
> ] On Behalf Of Gundala Viswanath
> Sent: Thursday, September 18, 2008 3:52 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol  
> with Bioperl
>
> Dear all,
>
> Is there a way I can convert such EnSeMBL probe names into Gene  
> Symbol with BioPerl?
>
> ENSG00000000003_at
> ENSG00000000005_at
> ENSG00000000419_at
> ENSG00000000457_at
> ENSG00000000460_at
> ENSG00000000938_at
> ENSG00000000971_at
> ENSG00000001036_at
> ENSG00000001084_at
> ENSG00000001167_at
> ENSG00000001461_at
> ENSG00000001497_at
> ENSG00000001561_at
> ... etc ...
>
> Or perhaps there is a flat file for conversion?
>
>
>
> - Gundala Viswanath
> Jakarta - Indonesia
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org




From jason at bioperl.org  Thu Sep 18 17:56:18 2008
From: jason at bioperl.org (Jason Stajich)
Date: Thu, 18 Sep 2008 14:56:18 -0700
Subject: [Bioperl-l] Retrieving taxonomy information from a GenBank file
In-Reply-To: <f03f40920809181427k168bfc3cu535c023949735cd9@mail.gmail.com>
References: <f03f40920809181427k168bfc3cu535c023949735cd9@mail.gmail.com>
Message-ID: <E078758D-D451-4973-A66D-2D6D829FCA53@bioperl.org>

You want the species object ($seq->species)  -- see the Seq HOWTO,  
much of the Seq API is explained.
  http://bioperl.org/wiki/HOWTO:Feature-Annotation#The_Species_Object

-jason
On Sep 18, 2008, at 2:27 PM, ANJAN PURKAYASTHA wrote:

> Hi,
> I'm using the following code to access the "ORGANISM" tag value for  
> the
> record NC_002526.
> I get a value of 0 even though the ORGANISM tag  has a value.  Any  
> idea how
> this might be corrected?
> Thanks.
> Anjan
>
>
> my $gb= new Bio::DB::GenBank;
>
> my $seq = $gb->get_Seq_by_acc('NC_002526');
>
> my $des= $seq->get_tag_values("ORGANISM");
>
> -- 
> =============================
> anjan purkayastha, phd
> bioinformatics analyst
> whitehead institute for biomedical research
> nine cambridge center
> cambridge, ma 02142
>
> purkayas [at] wi [dot] mit [dot] edu
> 703.740.6939
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org




From cjfields at illinois.edu  Thu Sep 18 17:48:26 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 18 Sep 2008 16:48:26 -0500
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
	with	Bioperl
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
Message-ID: <0F56A0A4-AE10-4930-B479-C4D0818EAC7A@illinois.edu>

You can probably use the Ensembl perl API alone or in combination with  
bioperl.  I'm not sure it is working with the latest code (bioperl- 
live), but it's worth a try:

http://www.ensembl.org/info/using/api/core/core_tutorial.html
http://www.bioperl.org/wiki/HOWTO:Getting_Genomic_Sequences#Using_the_Perl_API_at_ENSEMBL

chris

On Sep 18, 2008, at 4:20 PM, Cook, Malcolm wrote:

> Gundala,
>
> Here is an option - if you want a script...
>
> http://research.stowers-institute.org/mec/software/scripts/affyprobeset2ensg/
>
> It is not bioperl.   It is perl.  It uses DBI to query the ensembl  
> MySQL database using SQL.  It may be outdated due to changes in  
> Ensembl schema.
>
> Good luck,
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org 
> ] On Behalf Of Gundala Viswanath
> Sent: Thursday, September 18, 2008 3:52 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol  
> with Bioperl
>
> Dear all,
>
> Is there a way I can convert such EnSeMBL probe names into Gene  
> Symbol with BioPerl?
>
> ENSG00000000003_at
> ENSG00000000005_at
> ENSG00000000419_at
> ENSG00000000457_at
> ENSG00000000460_at
> ENSG00000000938_at
> ENSG00000000971_at
> ENSG00000001036_at
> ENSG00000001084_at
> ENSG00000001167_at
> ENSG00000001461_at
> ENSG00000001497_at
> ENSG00000001561_at
> ... etc ...
>
> Or perhaps there is a flat file for conversion?
>
>
>
> - Gundala Viswanath
> Jakarta - Indonesia
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign





From spiros at lokku.com  Fri Sep 19 06:17:52 2008
From: spiros at lokku.com (Spiros Denaxas)
Date: Fri, 19 Sep 2008 11:17:52 +0100
Subject: [Bioperl-l] code coverage metrics
Message-ID: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>

Hello,

I recently sent Chris an email about an idea I had, quantifying (and
improving) the test coverage that we currently have on the bioperl
core. I know there's a list on the wiki [1] with a list of tests that
have low coverage and/or complete lack of tests. My idea was to
somehow standardize and automate the generation of this list,
preferably on a weekly basis initially. We can then more easily see
where help is needed and possible assign individual tasks to tackle
the most-suffering modules.

There are currently several very good CPAN modules that do this, like
Devel::Cover [2]. Is there any objection if I kick this off and start
doing some work, aiming into creating a more detailed report on code
coverage using the current HEAD and test suite?

Spiros

[1] http://www.bioperl.org/wiki/Untested_Modules_in_BioPerl
[2] http://search.cpan.org/dist/Devel-Cover/lib/Devel/Cover.pm

From spiros at lokku.com  Fri Sep 19 07:51:29 2008
From: spiros at lokku.com (Spiros Denaxas)
Date: Fri, 19 Sep 2008 12:51:29 +0100
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <48D391BD.5010105@sendu.me.uk>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
	<48D391BD.5010105@sendu.me.uk>
Message-ID: <bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>

On Fri, Sep 19, 2008 at 12:49 PM, Sendu Bala <bix at sendu.me.uk> wrote:
> Spiros Denaxas wrote:
>>
>> There are currently several very good CPAN modules that do this, like
>> Devel::Cover [2]. Is there any objection if I kick this off and start
>> doing some work, aiming into creating a more detailed report on code
>> coverage using the current HEAD and test suite?
>
> You should read our previous discussion here:
> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/14586/focus=14588
>
> Basically I think we have it all in place now; someone just needs to take
> that last step and run a cron job that runs the Build commands. We also need
> the website side of things sorted out I think.
>
> If you could make those things happen and take care of any issues that crop
> up, that would be great.
>

Enlightening, thank you for pointing that out. I will have a look, I
don't see a problem with the plan.

Spiros

From spiros at lokku.com  Fri Sep 19 08:01:15 2008
From: spiros at lokku.com (Spiros Denaxas)
Date: Fri, 19 Sep 2008 13:01:15 +0100
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
	<48D391BD.5010105@sendu.me.uk>
	<bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
Message-ID: <bba689ec0809190501v56cb4eedx159410c2ebf76c7a@mail.gmail.com>

>
> Enlightening, thank you for pointing that out. I will have a look, I
> don't see a problem with the plan.
>
> Spiros
>

I have also updated the wiki to make sure we avoid duplicate effort on
this, http://www.bioperl.org/wiki/Project_priority_list

Spiros

From bix at sendu.me.uk  Fri Sep 19 07:49:17 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 19 Sep 2008 12:49:17 +0100
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
Message-ID: <48D391BD.5010105@sendu.me.uk>

Spiros Denaxas wrote:
> There are currently several very good CPAN modules that do this, like
> Devel::Cover [2]. Is there any objection if I kick this off and start
> doing some work, aiming into creating a more detailed report on code
> coverage using the current HEAD and test suite?

You should read our previous discussion here:
http://thread.gmane.org/gmane.comp.lang.perl.bio.general/14586/focus=14588

Basically I think we have it all in place now; someone just needs to 
take that last step and run a cron job that runs the Build commands. We 
also need the website side of things sorted out I think.

If you could make those things happen and take care of any issues that 
crop up, that would be great.

From cjfields at illinois.edu  Fri Sep 19 08:22:02 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 19 Sep 2008 07:22:02 -0500
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
	<48D391BD.5010105@sendu.me.uk>
	<bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
Message-ID: <0C6AAAEE-5D80-4102-B03D-FE0C045492AA@illinois.edu>


On Sep 19, 2008, at 6:51 AM, Spiros Denaxas wrote:

> On Fri, Sep 19, 2008 at 12:49 PM, Sendu Bala <bix at sendu.me.uk> wrote:
>> Spiros Denaxas wrote:
>>>
>>> There are currently several very good CPAN modules that do this,  
>>> like
>>> Devel::Cover [2]. Is there any objection if I kick this off and  
>>> start
>>> doing some work, aiming into creating a more detailed report on code
>>> coverage using the current HEAD and test suite?
>>
>> You should read our previous discussion here:
>> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/14586/focus=14588
>>
>> Basically I think we have it all in place now; someone just needs  
>> to take
>> that last step and run a cron job that runs the Build commands. We  
>> also need
>> the website side of things sorted out I think.
>>
>> If you could make those things happen and take care of any issues  
>> that crop
>> up, that would be great.
>>
>
> Enlightening, thank you for pointing that out. I will have a look, I
> don't see a problem with the plan.
>
> Spiros

Didn't know it was that far along!  Any help pushing this along would  
be wonderful.

chris

From MEC at stowers-institute.org  Fri Sep 19 09:06:08 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Fri, 19 Sep 2008 08:06:08 -0500
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with
 Bioperl
In-Reply-To: <F1CAA89B-D7E9-40B3-9965-9636B4F5F852@bioperl.org>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
	<F1CAA89B-D7E9-40B3-9965-9636B4F5F852@bioperl.org>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD5867@exchmb-02.stowers-institute.org>

Jason,

Yes .... Biomart .... If I remember correctly, at the time I wrote the script, the problem with using biomart interactively for this task was that though you could query for genes or transcripts by affy id, the results would not include the term you queried with, so, you just get a list of genes that match any of your affyids without knowing which goes with which.

But perhaps I was wrong.  Certainly I see now that it is possible interactively to return the affyid for any gene for many standard probesets.

Cheers,

Malcolm Cook

-----Original Message-----
From: Jason Stajich [mailto:jason.stajich at gmail.com] On Behalf Of Jason Stajich
Sent: Thursday, September 18, 2008 4:52 PM
To: Cook, Malcolm
Cc: 'Gundala Viswanath'; 'bioperl-l at lists.open-bio.org'
Subject: Re: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with Bioperl

seems like something that biomart was designed for? There is a scripting interface too.
http://biomart.org/

On Sep 18, 2008, at 2:20 PM, Cook, Malcolm wrote:

> Gundala,
>
> Here is an option - if you want a script...
>
> http://research.stowers-institute.org/mec/software/scripts/affyprobese
> t2ensg/
>
> It is not bioperl.   It is perl.  It uses DBI to query the ensembl
> MySQL database using SQL.  It may be outdated due to changes in
> Ensembl schema.
>
> Good luck,
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org
> ] On Behalf Of Gundala Viswanath
> Sent: Thursday, September 18, 2008 3:52 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
> with Bioperl
>
> Dear all,
>
> Is there a way I can convert such EnSeMBL probe names into Gene Symbol
> with BioPerl?
>
> ENSG00000000003_at
> ENSG00000000005_at
> ENSG00000000419_at
> ENSG00000000457_at
> ENSG00000000460_at
> ENSG00000000938_at
> ENSG00000000971_at
> ENSG00000001036_at
> ENSG00000001084_at
> ENSG00000001167_at
> ENSG00000001461_at
> ENSG00000001497_at
> ENSG00000001561_at
> ... etc ...
>
> Or perhaps there is a flat file for conversion?
>
>
>
> - Gundala Viswanath
> Jakarta - Indonesia
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From MEC at stowers-institute.org  Fri Sep 19 09:09:00 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Fri, 19 Sep 2008 08:09:00 -0500
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
	with	Bioperl
In-Reply-To: <0F56A0A4-AE10-4930-B479-C4D0818EAC7A@illinois.edu>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
	<0F56A0A4-AE10-4930-B479-C4D0818EAC7A@illinois.edu>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD5868@exchmb-02.stowers-institute.org>


Chris is right- the Ensembl perl API works fine. If you care to go this route and want to crib the code, you will see that my script has a commented out implementation using Ensembl perl API - it suffered from being MUCH TOO SLOOOOOOOOOO - accessing the tables directly was MUCH faster (unpublished correspondance with self)

However, the API is much more likely to be backwards compatible in the face of database schema changes at Ensembl....

Malcolm Cook

-----Original Message-----
From: Chris Fields [mailto:cjfields at illinois.edu]
Sent: Thursday, September 18, 2008 4:48 PM
To: Cook, Malcolm
Cc: 'Gundala Viswanath'; 'bioperl-l at lists.open-bio.org'
Subject: Re: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with Bioperl

You can probably use the Ensembl perl API alone or in combination with bioperl.  I'm not sure it is working with the latest code (bioperl- live), but it's worth a try:

http://www.ensembl.org/info/using/api/core/core_tutorial.html
http://www.bioperl.org/wiki/HOWTO:Getting_Genomic_Sequences#Using_the_Perl_API_at_ENSEMBL

chris

On Sep 18, 2008, at 4:20 PM, Cook, Malcolm wrote:

> Gundala,
>
> Here is an option - if you want a script...
>
> http://research.stowers-institute.org/mec/softyware/scripts/affyprobese
> t2ensg/
>
> It is not bioperl.   It is perl.  It uses DBI to query the ensembl
> MySQL database using SQL.  It may be outdated due to changes in
> Ensembl schema.
>
> Good luck,
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org
> ] On Behalf Of Gundala Viswanath
> Sent: Thursday, September 18, 2008 3:52 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
> with Bioperl
>
> Dear all,
>
> Is there a way I can convert such EnSeMBL probe names into Gene Symbol
> with BioPerl?
>
> ENSG00000000003_at
> ENSG00000000005_at
> ENSG00000000419_at
> ENSG00000000457_at
> ENSG00000000460_at
> ENSG00000000938_at
> ENSG00000000971_at
> ENSG00000001036_at
> ENSG00000001084_at
> ENSG00000001167_at
> ENSG00000001461_at
> ENSG00000001497_at
> ENSG00000001561_at
> ... etc ...
>
> Or perhaps there is a flat file for conversion?
>
>
>
> - Gundala Viswanath
> Jakarta - Indonesia
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From mauricio at open-bio.org  Fri Sep 19 10:06:22 2008
From: mauricio at open-bio.org (Mauricio Herrera Cuadra)
Date: Fri, 19 Sep 2008 09:06:22 -0500
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <0C6AAAEE-5D80-4102-B03D-FE0C045492AA@illinois.edu>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>	<48D391BD.5010105@sendu.me.uk>	<bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
	<0C6AAAEE-5D80-4102-B03D-FE0C045492AA@illinois.edu>
Message-ID: <48D3B1DE.7070505@open-bio.org>

Sorry guys, this has been my fault due to lack of time. I have a very 
old ticket waiting for me at the OBF Helpdesk to get the website side of 
things done. Spiros, I have some spare time today to try setting it up, 
assign it to me in the wiki list if you want, I'll send an update in a 
couple of days.

Thanks,
Mauricio.


Chris Fields wrote:
> 
> On Sep 19, 2008, at 6:51 AM, Spiros Denaxas wrote:
> 
>> On Fri, Sep 19, 2008 at 12:49 PM, Sendu Bala <bix at sendu.me.uk> wrote:
>>> Spiros Denaxas wrote:
>>>>
>>>> There are currently several very good CPAN modules that do this, like
>>>> Devel::Cover [2]. Is there any objection if I kick this off and start
>>>> doing some work, aiming into creating a more detailed report on code
>>>> coverage using the current HEAD and test suite?
>>>
>>> You should read our previous discussion here:
>>> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/14586/focus=14588 
>>>
>>>
>>> Basically I think we have it all in place now; someone just needs to 
>>> take
>>> that last step and run a cron job that runs the Build commands. We 
>>> also need
>>> the website side of things sorted out I think.
>>>
>>> If you could make those things happen and take care of any issues 
>>> that crop
>>> up, that would be great.
>>>
>>
>> Enlightening, thank you for pointing that out. I will have a look, I
>> don't see a problem with the plan.
>>
>> Spiros
> 
> Didn't know it was that far along!  Any help pushing this along would be 
> wonderful.
> 
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 

From heikki at sanbi.ac.za  Fri Sep 19 12:22:23 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Fri, 19 Sep 2008 18:22:23 +0200
Subject: [Bioperl-l] phylogeny-trait association methods into BioPerl
In-Reply-To: <200809101332.07137.heikki@sanbi.ac.za>
References: <200809101332.07137.heikki@sanbi.ac.za>
Message-ID: <200809191822.23503.heikki@sanbi.ac.za>

The code is now in SVN. Bio::Tree::TreeFunctionsI::add_trait() can be used to 
set trait values in a tree.

Enjoy,

   -Heikki

On Wednesday 10 September 2008 13:32:06 Heikki Lehvaslaiho wrote:
> FYI,
>
> I've been recently writing code to analyse phylogeny-trait associations.
> These traits are typically geographical location of the sequence but they
> can be any phenotypic characters associated with the sequences.
>
> This involves trees, i.e. Bio::Tree::Tree and Bio::Tree::Node objects and
> strings describing the traits. I've been using tags to store trait values
> within nodes. The tag methods are:
>
> Bio::Tree::Node::add_tag_value
> Bio::Tree::Node::get_all_tags
> Bio::Tree::Node::get_tag_values
> Bio::Tree::Node::has_tag
> Bio::Tree::Node::remove_all_tags
> Bio::Tree::Node::remove_tag
>
> Question: Is  there any particular reason why there is no
> set_tag_value(scalar|@array) method?
>
> I am getting tired of writing:
>   $node->remove_tag($key);
>   map {$node->add_tag_value($key)} @values ;
> so I am going to implement that unless there is are strong objections.
>
> Otherwise it has been smooth sailing. I am going to add
> Bio::Tree::TreeFunctions::is_binary() and start populating
> Bio::Tree::Statistics soon with these methods:
>
> ps() - Parsimony Score (PS) from Fitch 1971
> ai() - Association index (AI) of Whang et al. 2001
> mc() - Monophyletic Clade (MC) size statistics by Salemi at al. 2005
> cherries() - number of leaf node pairs
>
> If you have any comments, please feel free to post them here.
>
>     -Heikki

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________


From hartzell at alerce.com  Tue Sep 23 17:16:48 2008
From: hartzell at alerce.com (George Hartzell)
Date: Tue, 23 Sep 2008 14:16:48 -0700
Subject: [Bioperl-l] confused about version numbers.
Message-ID: <18649.23744.832478.551299@almost.alerce.com>


I recently realized that I needed a feature from
Bio::Search::Hit::GenericHit that exists in the svn trunk but isn't in
the CPAN's version bioperl-1.5.2_102.

I thought I'd just specify a version number in my Build.PL and that
way I could sleep soundly.

But, it looks like $Version in CPAN's Bio::Root::Version is
1.005002_102 while in the trunk it's 1.005002_100.

What's the proper way for a Build.PL to be sure that it has a current
bioperl?

g.

From sac at bioperl.org  Tue Sep 23 18:05:15 2008
From: sac at bioperl.org (Steve Chervitz)
Date: Tue, 23 Sep 2008 15:05:15 -0700
Subject: [Bioperl-l] confused about version numbers.
In-Reply-To: <18649.23744.832478.551299@almost.alerce.com>
References: <18649.23744.832478.551299@almost.alerce.com>
Message-ID: <8f200b4c0809231505p6b3f9e77i278f52bcc355489@mail.gmail.com>

Here's the general recommendation from the FAQ:

http://bio.perl.org/wiki/FAQ#How_can_I_tell_what_version_of_BioPerl_is_installed.3F

Not sure the recommended way to do this from a Build.PL. You could so such
checking within a BEGIN block in your Build.PL, perhaps.

Steve

On Tue, Sep 23, 2008 at 2:16 PM, George Hartzell <hartzell at alerce.com>wrote:

>
> I recently realized that I needed a feature from
> Bio::Search::Hit::GenericHit that exists in the svn trunk but isn't in
> the CPAN's version bioperl-1.5.2_102.
>
> I thought I'd just specify a version number in my Build.PL and that
> way I could sleep soundly.
>
> But, it looks like $Version in CPAN's Bio::Root::Version is
> 1.005002_102 while in the trunk it's 1.005002_100.
>
> What's the proper way for a Build.PL to be sure that it has a current
> bioperl?
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From bix at sendu.me.uk  Tue Sep 23 17:51:57 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 23 Sep 2008 22:51:57 +0100
Subject: [Bioperl-l] confused about version numbers.
In-Reply-To: <18649.23744.832478.551299@almost.alerce.com>
References: <18649.23744.832478.551299@almost.alerce.com>
Message-ID: <48D964FD.7060007@sendu.me.uk>

George Hartzell wrote:
> I recently realized that I needed a feature from
> Bio::Search::Hit::GenericHit that exists in the svn trunk but isn't in
> the CPAN's version bioperl-1.5.2_102.
> 
> I thought I'd just specify a version number in my Build.PL and that
> way I could sleep soundly.
> 
> But, it looks like $Version in CPAN's Bio::Root::Version is
> 1.005002_102 while in the trunk it's 1.005002_100.

Fixed. It's now 1.005002_103.


> What's the proper way for a Build.PL to be sure that it has a current
> bioperl?

Your method was sound, I think.

From cjfields at illinois.edu  Tue Sep 23 21:23:25 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 23 Sep 2008 20:23:25 -0500
Subject: [Bioperl-l] Bio::Species bug,
	was  Species.t tests failing with bioperl-live
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
Message-ID: <CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>

I'm reposting this in case it was lost (or forgotten).  I'll file it  
as a bug if it's not addressed fairly soonish, but I would consider  
this a serious blocker for a 1.6 release.  Any help would be   
appreciated.

The last commit to Bio::Species, which was an effort to fix a memory  
leak, has unfortunately broken Species.t tests.  The relevant commit  
used weaken(); my guess is something is being garbage collected way  
too early.  Any ideas?

chris

Begin forwarded message:

> From: Chris Fields <cjfields at illinois.edu>
> Date: September 18, 2008 7:15:03 AM CDT
> To: Chris Fields <cjfields at illinois.edu>
> Cc: BioPerl List <bioperl-l at lists.open-bio.org>
> Subject: Re: [Bioperl-l] Species.t tests failing with bioperl-live
>
>
> On Sep 18, 2008, at 7:07 AM, Chris Fields wrote:
>
>> I'm getting a couple of failed tests with
>
>
> Um, that was supposed to be:
>
> I'm getting a couple of failed tests with Species.t; I think these  
> are due to the last commit to Bio::Species:
>
> http://code.open-bio.org/svnweb/index.cgi/bioperl/revision/?rev=14793
>
> Tests pass after commenting out that line.
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From Caroline.Johnston at iop.kcl.ac.uk  Wed Sep 24 10:19:05 2008
From: Caroline.Johnston at iop.kcl.ac.uk (Johnston, Caroline)
Date: Wed, 24 Sep 2008 15:19:05 +0100
Subject: [Bioperl-l] Using Storable with SeqFeatures
Message-ID: <5626ED9CB91C814197079FB9940312E506445F9B@MAIL.bc.iop.kcl.ac.uk>

Hello.

I'm trying to use Storable to save a Bio::Seq object and Storable seems to be having a weird problem dealing with freezing and thawing the code ref to Bio::SeqFeature::Generic cleanup_generic. If I change one line (931) in that function from

    foreach my $t ( keys %{$self->{'_gsf_tag_hash'} || {} } ) {
                                                    ------
 to

    foreach my $t ( keys %{$self->{'_gsf_tag_hash'} } ) {

it works fine. I've pasted an example script at http://sial.org/pbot/32320.

Any ideas why this syntax would break Storable? Would wrapping the foreach in an if(defined $self->{'_gsf_tag_hash'}) serve to replace the || {} ?

I get the same problem using Bio::Root::Storable.

Cxx 


From cain.cshl at gmail.com  Wed Sep 24 18:00:35 2008
From: cain.cshl at gmail.com (Scott Cain)
Date: Wed, 24 Sep 2008 18:00:35 -0400
Subject: [Bioperl-l] genbank2gff.pl choking on CONTIG sections
Message-ID: <536f21b00809241500x5414289ayea143c7124758f5e@mail.gmail.com>

Hi all,

The BioPerl script bp_genbank2gff.pl, which will either convert a
Genbank record to GFF or load it directly to a Bio::DB::GFF database,
is choking on GenBank records with CONTIG sections.  Since I don't
think these would ever be useful for generating GFF or loading into a
database (ie, the user will want to get all of the features on the
parts, not know what the parts are), is there a way to force a
Bio::DB::WebDBSeqI/Bio::DB::BioFetch to get the full record (like
specifying view=gbwithparts in the url at ncbi)?

Thanks,
Scott


-- 
------------------------------------------------------------------------
Scott Cain, Ph. D. cain.cshl at gmail.com
GMOD Coordinator (http://gmod.org/) 216-392-3087
Cold Spring Harbor Laboratory

From jason at bioperl.org  Wed Sep 24 19:05:18 2008
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 24 Sep 2008 16:05:18 -0700
Subject: [Bioperl-l] genbank2gff.pl choking on CONTIG sections
In-Reply-To: <536f21b00809241500x5414289ayea143c7124758f5e@mail.gmail.com>
References: <536f21b00809241500x5414289ayea143c7124758f5e@mail.gmail.com>
Message-ID: <5D6FEF22-76B7-4770-B749-A643AFF99169@bioperl.org>

It should already if it is using Bio::DB::GenBank -- do you have  
example of a fail?  There seems to be some defaulting to EMBL for the  
source in the biofetch code so it might be worth twiddling.

from Bio::DB::GenBank

Note that when querying for GenBank accessions starting with 'NT_' you
will need to call $gb->request_format('fasta') beforehand, because
in GenBank format (the default) the sequence part will be left out
(the reason is that NT contigs are rather annotation with references
to clones).

Some work has been done to automatically detect and retrieve whole NT_  
clones
when the data is in that format (NCBI RefSeq clones). The former  
behavior prior
to bioperl 1.6 was to retrieve these from EBI, but now these are  
retrieved
directly from NCBI. The older behavior can be regained by setting the
'redirect_refseq' flag to a value evaluating to TRUE.


On Sep 24, 2008, at 3:00 PM, Scott Cain wrote:

> Hi all,
>
> The BioPerl script bp_genbank2gff.pl, which will either convert a
> Genbank record to GFF or load it directly to a Bio::DB::GFF database,
> is choking on GenBank records with CONTIG sections.  Since I don't
> think these would ever be useful for generating GFF or loading into a
> database (ie, the user will want to get all of the features on the
> parts, not know what the parts are), is there a way to force a
> Bio::DB::WebDBSeqI/Bio::DB::BioFetch to get the full record (like
> specifying view=gbwithparts in the url at ncbi)?
>
> Thanks,
> Scott
>
>
> -- 
> ------------------------------------------------------------------------
> Scott Cain, Ph. D. cain.cshl at gmail.com
> GMOD Coordinator (http://gmod.org/) 216-392-3087
> Cold Spring Harbor Laboratory
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org




From hartzell at alerce.com  Thu Sep 25 01:17:54 2008
From: hartzell at alerce.com (George Hartzell)
Date: Wed, 24 Sep 2008 22:17:54 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18651.7938.496813.710345@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > George,
 > 
 > This is an error from my side. Great that you have a fix already.
 > 
 > My only worry is the number of external dependencies in BioPerl. To limit 
 > these we have recoded number of functionalities into BioPerl-specific modules. 
 > Before you commit the fix, could you see if Bio::RangeI could be used or easily 
 > extended to be used instead of Set::IntSpan?
 > 
 > Thanks,
 > 
 >    -Heikki
 > 
 > On Friday 05 September 2008 21:01:35 George Hartzell wrote:
 > > Hi all,
 > >
 > > Bio::Coordinate::Collection surprised me a bit.  At first I thought
 > > there was a bug, but it's clearly doing what it's supposed to.  Now
 > > I'm wondering if what it's supposed to be doing makes sense in some
 > > context, or if what I expected would be better functionality.
 > >
 > > t/CoordinateMapper.t sets up the following scenario:
 > >
 > > #
 > > # Collection
 > > #
 > > #         1   5     6   10
 > > #         |---|     |---|
 > > #-----|-----------------------
 > > #     1   5   9     15  19
 > > #         pair1     pair2
 > >
 > > Then goes on to do the following query:
 > >
 > >   # match more than two
 > >   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
 > >   ok $res = $transcribe->map($pos);
 > >   is $res->each_gap, 2;
 > >   is $res->each_match, 2;
 > >
 > > I was surprised to see that there were two gaps, one gene:10-19 and
 > > one from gene:5-14.  Looking at the code, what's really happening is
 > > that, for the exon1 mapper there's match with gene:5-9 and a gap with
 > > gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
 > > match with gene:15-19.  All four Result's just get tossed into the
 > > return value.
 > >
 > > The result my intuition wants is that there are two matches (gene:5-9
 > > with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
 > >
 > > Yes, I guess that I could just synthesize these myself from the result
 > > in my app.
 > >
 > > It still seems that the current result is a bug though, since there's
 > > no way of knowing when you're walking through $res->each_Location that
 > > the first "gap" is with respect to the exon1 mapper and that the
 > > second "gap" is with respect to the exon2 mapper.  The gaps are
 > > meaningless.
 > >
 > > I "fixed" it to work the way I think it should (two matches, one
 > > gap).  I actually extended the test case a bit so that there's a
 > > multi-base gap, a match, another multibase-gap, another match, then a
 > > single base gap (just to make sure I got that right...).  I had to
 > > touch up the test file a bit to account for my new test.
 > >
 > > The gaps that I return have a strand of 'undef', which seems to be The
 > > Right Thing.  There's also a bit of funny business where I hang onto
 > > the seq_id of the gapped sequence.  It assumes that the "in" sequence
 > > is the same for all of the mappers.  This seems safe since otherwise
 > > the entire query is kind of weird....
 > >
 > > There's a patch to todays svn head at:
 > >
 > >   http://shrimp.alerce.com/bioperl/collection-diffs.txt
 > >
 > > The patch changes Build.PL to include a dependency on Set::IntSpan,
 > > CoordinateMapper.t to update the tests, and
 > > Bio/CoordinateMapper/Collection.pm for the new code.
 > >
 > > Who's code would this break.
 > >
 > > If anyone's relying on the current behaviour re: gaps, what's the
 > > situation in which you find it useful?
 > >
 > > Thanks!
 > >
 > > g.
 > [...]

So, I'm out of round 'tuit's trying to think of an _easy_ way to do
this using Range/RangeI.  I might just not be thinking clearly, and
I've definitely trained myself to solve these kinds of problems with
Set::IntSpan problems so I may just be waving my favorite hammer
around.

There may also be a BioPerl native way to do it using some fancier
object than a RangeI (split locations?).

It's easy to get the set of gaps for each pair, but is there already
something that takes the intersection of a set of non-intersecting
Range's?

g.

From hartzell at alerce.com  Thu Sep 25 01:17:54 2008
From: hartzell at alerce.com (George Hartzell)
Date: Wed, 24 Sep 2008 22:17:54 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18651.7938.496813.710345@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > George,
 > 
 > This is an error from my side. Great that you have a fix already.
 > 
 > My only worry is the number of external dependencies in BioPerl. To limit 
 > these we have recoded number of functionalities into BioPerl-specific modules. 
 > Before you commit the fix, could you see if Bio::RangeI could be used or easily 
 > extended to be used instead of Set::IntSpan?
 > 
 > Thanks,
 > 
 >    -Heikki
 > 
 > On Friday 05 September 2008 21:01:35 George Hartzell wrote:
 > > Hi all,
 > >
 > > Bio::Coordinate::Collection surprised me a bit.  At first I thought
 > > there was a bug, but it's clearly doing what it's supposed to.  Now
 > > I'm wondering if what it's supposed to be doing makes sense in some
 > > context, or if what I expected would be better functionality.
 > >
 > > t/CoordinateMapper.t sets up the following scenario:
 > >
 > > #
 > > # Collection
 > > #
 > > #         1   5     6   10
 > > #         |---|     |---|
 > > #-----|-----------------------
 > > #     1   5   9     15  19
 > > #         pair1     pair2
 > >
 > > Then goes on to do the following query:
 > >
 > >   # match more than two
 > >   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
 > >   ok $res = $transcribe->map($pos);
 > >   is $res->each_gap, 2;
 > >   is $res->each_match, 2;
 > >
 > > I was surprised to see that there were two gaps, one gene:10-19 and
 > > one from gene:5-14.  Looking at the code, what's really happening is
 > > that, for the exon1 mapper there's match with gene:5-9 and a gap with
 > > gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
 > > match with gene:15-19.  All four Result's just get tossed into the
 > > return value.
 > >
 > > The result my intuition wants is that there are two matches (gene:5-9
 > > with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
 > >
 > > Yes, I guess that I could just synthesize these myself from the result
 > > in my app.
 > >
 > > It still seems that the current result is a bug though, since there's
 > > no way of knowing when you're walking through $res->each_Location that
 > > the first "gap" is with respect to the exon1 mapper and that the
 > > second "gap" is with respect to the exon2 mapper.  The gaps are
 > > meaningless.
 > >
 > > I "fixed" it to work the way I think it should (two matches, one
 > > gap).  I actually extended the test case a bit so that there's a
 > > multi-base gap, a match, another multibase-gap, another match, then a
 > > single base gap (just to make sure I got that right...).  I had to
 > > touch up the test file a bit to account for my new test.
 > >
 > > The gaps that I return have a strand of 'undef', which seems to be The
 > > Right Thing.  There's also a bit of funny business where I hang onto
 > > the seq_id of the gapped sequence.  It assumes that the "in" sequence
 > > is the same for all of the mappers.  This seems safe since otherwise
 > > the entire query is kind of weird....
 > >
 > > There's a patch to todays svn head at:
 > >
 > >   http://shrimp.alerce.com/bioperl/collection-diffs.txt
 > >
 > > The patch changes Build.PL to include a dependency on Set::IntSpan,
 > > CoordinateMapper.t to update the tests, and
 > > Bio/CoordinateMapper/Collection.pm for the new code.
 > >
 > > Who's code would this break.
 > >
 > > If anyone's relying on the current behaviour re: gaps, what's the
 > > situation in which you find it useful?
 > >
 > > Thanks!
 > >
 > > g.
 > [...]

So, I'm out of round 'tuit's trying to think of an _easy_ way to do
this using Range/RangeI.  I might just not be thinking clearly, and
I've definitely trained myself to solve these kinds of problems with
Set::IntSpan problems so I may just be waving my favorite hammer
around.

There may also be a BioPerl native way to do it using some fancier
object than a RangeI (split locations?).

It's easy to get the set of gaps for each pair, but is there already
something that takes the intersection of a set of non-intersecting
Range's?

g.

From tatedger at googlemail.com  Thu Sep 25 11:23:46 2008
From: tatedger at googlemail.com (john paul)
Date: Thu, 25 Sep 2008 16:23:46 +0100
Subject: [Bioperl-l] Can't locate object method "get_dbxrefs"
Message-ID: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>

Hello guys,

I need to pick your brain on this. I was trying to load some sequences in a
fresh RH build using bioperl-db and got the following error:

[tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
--dbuser root --dbname biosql --namespace swissprot --format swiss
/home/tatedger/tmp/uniprot_sprot.dat  --testonly
Loading /home/tatedger/tmp/uniprot_sprot.dat ...
Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via package
"Bio::Ontology::Term" at
/usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
552, <GEN0> line 70.


I have seen some posts on this regard (
http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but it wasn't
clear to me what the solution would be.


My configuration:
- mysql version 4.1.7
- Red Hat Enterprise Linux ES release 4 (Nahant)

to install bioperl and bioperl-db I used the help found on the website
following
- cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
- svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
- biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.

bioperl-db  test 04 shows the same error.

[tatedger at localhost bioperl-db]$ perl t/04swiss.t
1..52
ok 1
ok 2
ok 3
ok 4
ok 5
Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
552, <GEN0> line 78.


my @INC file looks like
/usr/lib/perl5/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/5.8.5
/usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.5
/usr/lib/perl5/site_perl/5.8.4
/usr/lib/perl5/site_perl/5.8.3
/usr/lib/perl5/site_perl/5.8.2
/usr/lib/perl5/site_perl/5.8.1
/usr/lib/perl5/site_perl/5.8.0
/usr/lib/perl5/site_perl
/usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.5
/usr/lib/perl5/vendor_perl/5.8.4
/usr/lib/perl5/vendor_perl/5.8.3
/usr/lib/perl5/vendor_perl/5.8.2
/usr/lib/perl5/vendor_perl/5.8.1
/usr/lib/perl5/vendor_perl/5.8.0
/usr/lib/perl5/vendor_perl

What am I doing wrong? Could you help?

Thanks in advance for your help
Tom

From bosborne11 at verizon.net  Thu Sep 25 11:40:45 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Thu, 25 Sep 2008 11:40:45 -0400
Subject: [Bioperl-l] Can't locate object method "get_dbxrefs"
In-Reply-To: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
References: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
Message-ID: <2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>

John,

What does:

 >locate Bio/Ontology/Term.pm

Say?


Brian O.


On Sep 25, 2008, at 11:23 AM, john paul wrote:

> Hello guys,
>
> I need to pick your brain on this. I was trying to load some  
> sequences in a
> fresh RH build using bioperl-db and got the following error:
>
> [tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
> --dbuser root --dbname biosql --namespace swissprot --format swiss
> /home/tatedger/tmp/uniprot_sprot.dat  --testonly
> Loading /home/tatedger/tmp/uniprot_sprot.dat ...
> Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via  
> package
> "Bio::Ontology::Term" at
> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm  
> line
> 552, <GEN0> line 70.
>
>
> I have seen some posts on this regard (
> http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but  
> it wasn't
> clear to me what the solution would be.
>
>
> My configuration:
> - mysql version 4.1.7
> - Red Hat Enterprise Linux ES release 4 (Nahant)
>
> to install bioperl and bioperl-db I used the help found on the website
> following
> - cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
> - svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
> - biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.
>
> bioperl-db  test 04 shows the same error.
>
> [tatedger at localhost bioperl-db]$ perl t/04swiss.t
> 1..52
> ok 1
> ok 2
> ok 3
> ok 4
> ok 5
> Can't locate object method "get_dbxrefs" via package  
> "Bio::Ontology::Term"
> at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/ 
> PersistentObject.pm line
> 552, <GEN0> line 78.
>
>
> my @INC file looks like
> /usr/lib/perl5/5.8.5/i386-linux-thread-multi
> /usr/lib/perl5/5.8.5
> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.5
> /usr/lib/perl5/site_perl/5.8.4
> /usr/lib/perl5/site_perl/5.8.3
> /usr/lib/perl5/site_perl/5.8.2
> /usr/lib/perl5/site_perl/5.8.1
> /usr/lib/perl5/site_perl/5.8.0
> /usr/lib/perl5/site_perl
> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.5
> /usr/lib/perl5/vendor_perl/5.8.4
> /usr/lib/perl5/vendor_perl/5.8.3
> /usr/lib/perl5/vendor_perl/5.8.2
> /usr/lib/perl5/vendor_perl/5.8.1
> /usr/lib/perl5/vendor_perl/5.8.0
> /usr/lib/perl5/vendor_perl
>
> What am I doing wrong? Could you help?
>
> Thanks in advance for your help
> Tom
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From reece at harts.net  Thu Sep 25 12:15:23 2008
From: reece at harts.net (Reece Hart)
Date: Thu, 25 Sep 2008 09:15:23 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could
	DoWhatIMean	better	(w/ patch)
In-Reply-To: <18651.7938.496813.710345@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
	<18651.7938.496813.710345@almost.alerce.com>
Message-ID: <1222359323.15677.4.camel@snafu>

An embedded and charset-unspecified text was scrubbed...
Name: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20080925/ad977fb3/attachment.pl>

From tatedger at googlemail.com  Thu Sep 25 12:27:29 2008
From: tatedger at googlemail.com (john paul)
Date: Thu, 25 Sep 2008 17:27:29 +0100
Subject: [Bioperl-l] Can't locate object method "get_dbxrefs"
In-Reply-To: <2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>
References: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
	<2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>
Message-ID: <efc5e9750809250927h741c083cl60dca40fee89280@mail.gmail.com>

On Thu, Sep 25, 2008 at 4:40 PM, Brian Osborne <bosborne11 at verizon.net>wrote:

> John,
>
> What does:
>
> >locate Bio/Ontology/Term.pm
>
> Say?
>

Silly me.

$ locate  Bio/Ontology/Term.pm
/usr/lib/perl5/site_perl/5.8.5/Bio/Ontology/Term.pm

and

 $ cat /usr/lib/perl5/site_perl/5.8.5/Bio/Ontology/Term.pm|grep get_dbxrefs
produced no answer

the latest version posted by Sendu on cpan says for that module

# $Id: Term.pm,v 1.31.4.1 2006/10/02 23:10:22 sendu Exp $
#
# BioPerl module for Bio::Ontology::Term
and the live version at (
http://code.open-bio.org/svnweb/index.cgi/bioperl/view/bioperl-live/trunk/Bio/Ontology/Term.pm
)

says
# $Id: Term.pm 14708 2008-06-10 00:08:17Z heikki $
#
# BioPerl module for Bio::Ontology::Term
#
I was using an old distribution from CPAN.

reinstalling from the main trunk

svn co svn://code.open-bio.org/bioperl/bioperl-live/trunk bioperl-live

solved the problem.

Thanks again

Tom


>
> Brian O.
>
>
>
> On Sep 25, 2008, at 11:23 AM, john paul wrote:
>
>   Hello guys,
>>
>> I need to pick your brain on this. I was trying to load some sequences in
>> a
>> fresh RH build using bioperl-db and got the following error:
>>
>> [tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
>> --dbuser root --dbname biosql --namespace swissprot --format swiss
>> /home/tatedger/tmp/uniprot_sprot.dat  --testonly
>> Loading /home/tatedger/tmp/uniprot_sprot.dat ...
>> Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via
>> package
>> "Bio::Ontology::Term" at
>> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
>> 552, <GEN0> line 70.
>>
>>
>> I have seen some posts on this regard (
>> http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but it
>> wasn't
>> clear to me what the solution would be.
>>
>>
>> My configuration:
>> - mysql version 4.1.7
>> - Red Hat Enterprise Linux ES release 4 (Nahant)
>>
>> to install bioperl and bioperl-db I used the help found on the website
>> following
>> - cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
>> - svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
>> - biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.
>>
>> bioperl-db  test 04 shows the same error.
>>
>> [tatedger at localhost bioperl-db]$ perl t/04swiss.t
>> 1..52
>> ok 1
>> ok 2
>> ok 3
>> ok 4
>> ok 5
>> Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
>> at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm
>> line
>> 552, <GEN0> line 78.
>>
>>
>> my @INC file looks like
>> /usr/lib/perl5/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/5.8.5
>> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.5
>> /usr/lib/perl5/site_perl/5.8.4
>> /usr/lib/perl5/site_perl/5.8.3
>> /usr/lib/perl5/site_perl/5.8.2
>> /usr/lib/perl5/site_perl/5.8.1
>> /usr/lib/perl5/site_perl/5.8.0
>> /usr/lib/perl5/site_perl
>> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.5
>> /usr/lib/perl5/vendor_perl/5.8.4
>> /usr/lib/perl5/vendor_perl/5.8.3
>> /usr/lib/perl5/vendor_perl/5.8.2
>> /usr/lib/perl5/vendor_perl/5.8.1
>> /usr/lib/perl5/vendor_perl/5.8.0
>> /usr/lib/perl5/vendor_perl
>>
>> What am I doing wrong? Could you help?
>>
>> Thanks in advance for your help
>> Tom
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>

From bix at sendu.me.uk  Thu Sep 25 13:12:22 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 25 Sep 2008 18:12:22 +0100
Subject: [Bioperl-l] Can't locate object method "get_dbxrefs"
In-Reply-To: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
References: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
Message-ID: <48DBC676.7090704@sendu.me.uk>

john paul wrote:
> - cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
> - svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
[...]
> Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
[...]
> What am I doing wrong? Could you help?

You're using the svb versuib bioperl-db but the release version of core 
(aka live). Don't mix and match; use the same version of both. So either 
install bioperl-live from svn as well, or get rid of you svn bioperl-db 
and install bioperl-db 1.5.2: 
http://bioperl.org/DIST/bioperl-db-1.5.2_100.tar.gz

I'd recommend using svn for both.

From hlapp at gmx.net  Thu Sep 25 18:24:37 2008
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu, 25 Sep 2008 18:24:37 -0400
Subject: [Bioperl-l] Using Storable with SeqFeatures
In-Reply-To: <5626ED9CB91C814197079FB9940312E506445F9B@MAIL.bc.iop.kcl.ac.uk>
References: <5626ED9CB91C814197079FB9940312E506445F9B@MAIL.bc.iop.kcl.ac.uk>
Message-ID: <517FAB85-BC7F-4135-B510-A2087267A314@gmx.net>


On Sep 24, 2008, at 10:19 AM, Johnston, Caroline wrote:

> Hello.
>
> I'm trying to use Storable to save a Bio::Seq object and Storable  
> seems to be having a weird problem dealing with freezing and thawing  
> the code ref to Bio::SeqFeature::Generic cleanup_generic. If I  
> change one line (931) in that function from
>
>    foreach my $t ( keys %{$self->{'_gsf_tag_hash'} || {} } ) {
>                                                    ------
> to
>
>    foreach my $t ( keys %{$self->{'_gsf_tag_hash'} } ) {
>
> it works fine. I've pasted an example script at http://sial.org/pbot/32320 
> .
>
> Any ideas why this syntax would break Storable? Would wrapping the  
> foreach in an if(defined $self->{'_gsf_tag_hash'}) serve to replace  
> the || {} ?

This should have exactly the same behavior as far as I can see.

Would you mind filing this as a bug repot with patch?

	-hilmar

>
>
> I get the same problem using Bio::Root::Storable.
>
> Cxx
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================




From mdschultz at ucdavis.edu  Thu Sep 25 18:06:02 2008
From: mdschultz at ucdavis.edu (Matthew Schultz)
Date: Thu, 25 Sep 2008 15:06:02 -0700 (PDT)
Subject: [Bioperl-l] BioPerl Installation Help
Message-ID: <200809252206.m8PM62Se004142@phaenicia.ucdavis.edu>


Hi Bioperl,

I've been trying to install bioperl on my Ubuntu machine I'm new to Bioperl
and don't have much experience in unix so I'm at a loss for what to do
next.  I tried to follow the instructions on using CPAN to install Bioperl,
but the installation failed.  At first I thought it was because of the few
warnings I received, but after trying the "force install" command without
success either I'm not so sure.  I was about to try the alternate option
using Build.pl, but am not sure where the Bioperl installation should go
(or will the Build.pl script place it in the right folder?).  Any help or
advice you could give would be appreciated.  Thanks for your time.

-Matt Schultz

P.S.  Here are the failed test results:

Failed Test        Stat Wstat Total Fail  Failed  List of Failed
-------------------------------------------------------------------------------
t/BioFetch_DB.t                  27    4  14.81%  8 20-21 27
t/DB.t                           78    2   2.56%  30-31
t/EMBL_DB.t                      15    3  20.00%  6 13-14
t/GuessSeqFormat.t               46    1   2.17%  11
t/InterProParser.t    2   512    47    1   2.13%  2
t/tutorial.t          2   512    21    6  28.57%  19-21
18 subtests skipped.
Failed 6/179 test scripts, 96.65% okay. 14/8122 subtests failed, 99.83% okay.
make: *** [test_dynamic] Error 255
  /usr/bin/make test -- NOT OK
Running make install
  make test had returned bad status, won't install without force


From caroline.johnston at iop.kcl.ac.uk  Thu Sep 25 23:19:38 2008
From: caroline.johnston at iop.kcl.ac.uk (Caroline)
Date: Fri, 26 Sep 2008 04:19:38 +0100
Subject: [Bioperl-l] Using Storable with SeqFeatures
In-Reply-To: <517FAB85-BC7F-4135-B510-A2087267A314@gmx.net>
References: <5626ED9CB91C814197079FB9940312E506445F9B@MAIL.bc.iop.kcl.ac.uk>
	<517FAB85-BC7F-4135-B510-A2087267A314@gmx.net>
Message-ID: <1222399178.18153.0.camel@clive>

On Thu, 2008-09-25 at 18:24 -0400, Hilmar Lapp wrote:

> Would you mind filing this as a bug repot with patch?
> 
> 	-hilmar
> 

Done, I think. I haven't used Bugzilla before, so give me a shout if I
haven't submitted it properly.

Cxx

From hartzell at alerce.com  Fri Sep 26 00:25:08 2008
From: hartzell at alerce.com (George Hartzell)
Date: Thu, 25 Sep 2008 21:25:08 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18652.25636.694188.904749@almost.alerce.com>


What would people think about a Bio::Range::Set (and/or SetI) which
behaves like Set::Intspan (which alone would be a waste of effort) but
also embraces RangeI's concepts of stranded-ness and
strong/weak/unspecified comparisons?

g. (who's sometimes thinks that 'tuits grow on trees...)


From hartzell at alerce.com  Fri Sep 26 00:25:08 2008
From: hartzell at alerce.com (George Hartzell)
Date: Thu, 25 Sep 2008 21:25:08 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18652.25636.694188.904749@almost.alerce.com>


What would people think about a Bio::Range::Set (and/or SetI) which
behaves like Set::Intspan (which alone would be a waste of effort) but
also embraces RangeI's concepts of stranded-ness and
strong/weak/unspecified comparisons?

g. (who's sometimes thinks that 'tuits grow on trees...)


From heikki at sanbi.ac.za  Fri Sep 26 02:25:54 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Fri, 26 Sep 2008 08:25:54 +0200
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better (w/ patch)
In-Reply-To: <18652.25636.694188.904749@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
	<18652.25636.694188.904749@almost.alerce.com>
Message-ID: <200809260825.54638.heikki@sanbi.ac.za>

George,

Bio::Range::Set sounds like great idea.

Sorry to put you in a tight spot with the request for keeping external 
dependencies to the minimum. I should have stressed that follow it only if it 
can be done easily. If you look at the actual dependencies of BioPerl at the 
moment, you'll realize not many have to patience to follow that guideline.

The main thing is the get working code in. If you then have the energy to code 
a module that gets rid of the dependency, that's an added bonus.

Thanks for your effort,

 Yours,
    -Heikki



On Friday 26 September 2008 06:25:08 George Hartzell wrote:
> What would people think about a Bio::Range::Set (and/or SetI) which
> behaves like Set::Intspan (which alone would be a waste of effort) but
> also embraces RangeI's concepts of stranded-ness and
> strong/weak/unspecified comparisons?
>
> g. (who's sometimes thinks that 'tuits grow on trees...)

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________


From tatedger at googlemail.com  Thu Sep 25 12:27:29 2008
From: tatedger at googlemail.com (john paul)
Date: Thu, 25 Sep 2008 17:27:29 +0100
Subject: [Bioperl-l] [BioSQL-l] Can't locate object method "get_dbxrefs"
In-Reply-To: <2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>
References: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
	<2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>
Message-ID: <efc5e9750809250927h741c083cl60dca40fee89280@mail.gmail.com>

On Thu, Sep 25, 2008 at 4:40 PM, Brian Osborne <bosborne11 at verizon.net>wrote:

> John,
>
> What does:
>
> >locate Bio/Ontology/Term.pm
>
> Say?
>

Silly me.

$ locate  Bio/Ontology/Term.pm
/usr/lib/perl5/site_perl/5.8.5/Bio/Ontology/Term.pm

and

 $ cat /usr/lib/perl5/site_perl/5.8.5/Bio/Ontology/Term.pm|grep get_dbxrefs
produced no answer

the latest version posted by Sendu on cpan says for that module

# $Id: Term.pm,v 1.31.4.1 2006/10/02 23:10:22 sendu Exp $
#
# BioPerl module for Bio::Ontology::Term
and the live version at (
http://code.open-bio.org/svnweb/index.cgi/bioperl/view/bioperl-live/trunk/Bio/Ontology/Term.pm
)

says
# $Id: Term.pm 14708 2008-06-10 00:08:17Z heikki $
#
# BioPerl module for Bio::Ontology::Term
#
I was using an old distribution from CPAN.

reinstalling from the main trunk

svn co svn://code.open-bio.org/bioperl/bioperl-live/trunk bioperl-live

solved the problem.

Thanks again

Tom


>
> Brian O.
>
>
>
> On Sep 25, 2008, at 11:23 AM, john paul wrote:
>
>   Hello guys,
>>
>> I need to pick your brain on this. I was trying to load some sequences in
>> a
>> fresh RH build using bioperl-db and got the following error:
>>
>> [tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
>> --dbuser root --dbname biosql --namespace swissprot --format swiss
>> /home/tatedger/tmp/uniprot_sprot.dat  --testonly
>> Loading /home/tatedger/tmp/uniprot_sprot.dat ...
>> Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via
>> package
>> "Bio::Ontology::Term" at
>> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
>> 552, <GEN0> line 70.
>>
>>
>> I have seen some posts on this regard (
>> http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but it
>> wasn't
>> clear to me what the solution would be.
>>
>>
>> My configuration:
>> - mysql version 4.1.7
>> - Red Hat Enterprise Linux ES release 4 (Nahant)
>>
>> to install bioperl and bioperl-db I used the help found on the website
>> following
>> - cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
>> - svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
>> - biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.
>>
>> bioperl-db  test 04 shows the same error.
>>
>> [tatedger at localhost bioperl-db]$ perl t/04swiss.t
>> 1..52
>> ok 1
>> ok 2
>> ok 3
>> ok 4
>> ok 5
>> Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
>> at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm
>> line
>> 552, <GEN0> line 78.
>>
>>
>> my @INC file looks like
>> /usr/lib/perl5/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/5.8.5
>> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.5
>> /usr/lib/perl5/site_perl/5.8.4
>> /usr/lib/perl5/site_perl/5.8.3
>> /usr/lib/perl5/site_perl/5.8.2
>> /usr/lib/perl5/site_perl/5.8.1
>> /usr/lib/perl5/site_perl/5.8.0
>> /usr/lib/perl5/site_perl
>> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.5
>> /usr/lib/perl5/vendor_perl/5.8.4
>> /usr/lib/perl5/vendor_perl/5.8.3
>> /usr/lib/perl5/vendor_perl/5.8.2
>> /usr/lib/perl5/vendor_perl/5.8.1
>> /usr/lib/perl5/vendor_perl/5.8.0
>> /usr/lib/perl5/vendor_perl
>>
>> What am I doing wrong? Could you help?
>>
>> Thanks in advance for your help
>> Tom
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>
_______________________________________________
BioSQL-l mailing list
BioSQL-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/biosql-l




From bix at sendu.me.uk  Fri Sep 26 04:26:36 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 26 Sep 2008 09:26:36 +0100
Subject: [Bioperl-l] Bio::Species bug,
 was  Species.t tests failing with bioperl-live
In-Reply-To: <CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
Message-ID: <48DC9CBC.1090909@sendu.me.uk>

Chris Fields wrote:
> The last commit to Bio::Species, which was an effort to fix a memory 
> leak, has unfortunately broken Species.t tests.  The relevant commit 
> used weaken(); my guess is something is being garbage collected way too 
> early.  Any ideas?

Was that last commit motivated by a bug report, and/or is there an 
associated test? If not, perhaps it can just be reverted?

From tatedger at googlemail.com  Thu Sep 25 11:23:46 2008
From: tatedger at googlemail.com (john paul)
Date: Thu, 25 Sep 2008 16:23:46 +0100
Subject: [Bioperl-l] [BioSQL-l] Can't locate object method "get_dbxrefs"
Message-ID: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>

Hello guys,

I need to pick your brain on this. I was trying to load some sequences in a
fresh RH build using bioperl-db and got the following error:

[tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
--dbuser root --dbname biosql --namespace swissprot --format swiss
/home/tatedger/tmp/uniprot_sprot.dat  --testonly
Loading /home/tatedger/tmp/uniprot_sprot.dat ...
Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via package
"Bio::Ontology::Term" at
/usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
552, <GEN0> line 70.


I have seen some posts on this regard (
http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but it wasn't
clear to me what the solution would be.


My configuration:
- mysql version 4.1.7
- Red Hat Enterprise Linux ES release 4 (Nahant)

to install bioperl and bioperl-db I used the help found on the website
following
- cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
- svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
- biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.

bioperl-db  test 04 shows the same error.

[tatedger at localhost bioperl-db]$ perl t/04swiss.t
1..52
ok 1
ok 2
ok 3
ok 4
ok 5
Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
552, <GEN0> line 78.


my @INC file looks like
/usr/lib/perl5/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/5.8.5
/usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.5
/usr/lib/perl5/site_perl/5.8.4
/usr/lib/perl5/site_perl/5.8.3
/usr/lib/perl5/site_perl/5.8.2
/usr/lib/perl5/site_perl/5.8.1
/usr/lib/perl5/site_perl/5.8.0
/usr/lib/perl5/site_perl
/usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.5
/usr/lib/perl5/vendor_perl/5.8.4
/usr/lib/perl5/vendor_perl/5.8.3
/usr/lib/perl5/vendor_perl/5.8.2
/usr/lib/perl5/vendor_perl/5.8.1
/usr/lib/perl5/vendor_perl/5.8.0
/usr/lib/perl5/vendor_perl

What am I doing wrong? Could you help?

Thanks in advance for your help
Tom
_______________________________________________
BioSQL-l mailing list
BioSQL-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/biosql-l




From cjfields at illinois.edu  Fri Sep 26 08:20:45 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 26 Sep 2008 07:20:45 -0500
Subject: [Bioperl-l] Bio::Species bug,
	was  Species.t tests failing with bioperl-live
In-Reply-To: <48DC9CBC.1090909@sendu.me.uk>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
	<48DC9CBC.1090909@sendu.me.uk>
Message-ID: <F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>


On Sep 26, 2008, at 3:26 AM, Sendu Bala wrote:

> Chris Fields wrote:
>> The last commit to Bio::Species, which was an effort to fix a  
>> memory leak, has unfortunately broken Species.t tests.  The  
>> relevant commit used weaken(); my guess is something is being  
>> garbage collected way too early.  Any ideas?
>
> Was that last commit motivated by a bug report, and/or is there an  
> associated test? If not, perhaps it can just be reverted?


Here's the relevant list thread:

http://thread.gmane.org/gmane.comp.lang.perl.bio.general/17541/focus=17550

The proposed patch was George's, which gets rid of the leak but causes  
the Species.t failures.  I say we revert the patch, but we'll still  
need to address the original problem addressed by Rutger Vos, i.e.  
that there is a significant memory leak in Bio::Species.

chris

From bix at sendu.me.uk  Fri Sep 26 09:45:21 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 26 Sep 2008 14:45:21 +0100
Subject: [Bioperl-l] Bio::Species bug,
 was  Species.t tests failing with bioperl-live
In-Reply-To: <F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
	<48DC9CBC.1090909@sendu.me.uk>
	<F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>
Message-ID: <48DCE771.8050001@sendu.me.uk>

Chris Fields wrote:
> 
> On Sep 26, 2008, at 3:26 AM, Sendu Bala wrote:
> 
>> Chris Fields wrote:
>>> The last commit to Bio::Species, which was an effort to fix a memory 
>>> leak, has unfortunately broken Species.t tests.  The relevant commit 
>>> used weaken(); my guess is something is being garbage collected way 
>>> too early.  Any ideas?
>>
>> Was that last commit motivated by a bug report, and/or is there an 
>> associated test? If not, perhaps it can just be reverted?
> 
> Here's the relevant list thread:
> 
> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/17541/focus=17550
> 
> The proposed patch was George's, which gets rid of the leak but causes 
> the Species.t failures.  I say we revert the patch, but we'll still need 
> to address the original problem addressed by Rutger Vos, i.e. that there 
> is a significant memory leak in Bio::Species.

Thanks. Rather than revert I've kludged it for now. Everything should be 
fine, it's just that I fear my solution isn't 'correct' and could mess 
things up we don't happen to have tests for.

See http://bugzilla.open-bio.org/show_bug.cgi?id=2594

From cjfields at illinois.edu  Fri Sep 26 10:54:55 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 26 Sep 2008 09:54:55 -0500
Subject: [Bioperl-l] Bio::Species bug,
	was  Species.t tests failing with bioperl-live
In-Reply-To: <48DCE771.8050001@sendu.me.uk>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
	<48DC9CBC.1090909@sendu.me.uk>
	<F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>
	<48DCE771.8050001@sendu.me.uk>
Message-ID: <9C49A138-CC07-4716-AFD6-FFB2F217C825@illinois.edu>


On Sep 26, 2008, at 8:45 AM, Sendu Bala wrote:

> Chris Fields wrote:
>> On Sep 26, 2008, at 3:26 AM, Sendu Bala wrote:
>>> Chris Fields wrote:
>>>> The last commit to Bio::Species, which was an effort to fix a  
>>>> memory leak, has unfortunately broken Species.t tests.  The  
>>>> relevant commit used weaken(); my guess is something is being  
>>>> garbage collected way too early.  Any ideas?
>>>
>>> Was that last commit motivated by a bug report, and/or is there an  
>>> associated test? If not, perhaps it can just be reverted?
>> Here's the relevant list thread:
>> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/17541/focus=17550
>> The proposed patch was George's, which gets rid of the leak but  
>> causes the Species.t failures.  I say we revert the patch, but  
>> we'll still need to address the original problem addressed by  
>> Rutger Vos, i.e. that there is a significant memory leak in  
>> Bio::Species.
>
> Thanks. Rather than revert I've kludged it for now. Everything  
> should be fine, it's just that I fear my solution isn't 'correct'  
> and could mess things up we don't happen to have tests for.
>
> See http://bugzilla.open-bio.org/show_bug.cgi?id=2594

Probably something that will go away when we quit using Bio::Species  
altogether (in favor of Bio::Taxon) after 1.6.   I'm not sure whether  
it will be worth the trouble, but it's worth discussing.

Anyway, I'm still a bit unfamiliar with some aspects of Bio::Species  
(and I'm pretty busy ATM) so it make take a few days.

chris

From hartzell at alerce.com  Fri Sep 26 20:21:41 2008
From: hartzell at alerce.com (George Hartzell)
Date: Fri, 26 Sep 2008 17:21:41 -0700
Subject: [Bioperl-l] Bio::Species bug,
	was  Species.t tests failing with bioperl-live
In-Reply-To: <9C49A138-CC07-4716-AFD6-FFB2F217C825@illinois.edu>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
	<48DC9CBC.1090909@sendu.me.uk>
	<F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>
	<48DCE771.8050001@sendu.me.uk>
	<9C49A138-CC07-4716-AFD6-FFB2F217C825@illinois.edu>
Message-ID: <18653.31893.762357.718899@almost.alerce.com>

Chris Fields writes:
 > 
 > On Sep 26, 2008, at 8:45 AM, Sendu Bala wrote:
 > 
 > > Chris Fields wrote:
 > >> On Sep 26, 2008, at 3:26 AM, Sendu Bala wrote:
 > >>> Chris Fields wrote:
 > >>>> The last commit to Bio::Species, which was an effort to fix a  
 > >>>> memory leak, has unfortunately broken Species.t tests.  The  
 > >>>> relevant commit used weaken(); my guess is something is being  
 > >>>> garbage collected way too early.  Any ideas?
 > >>>
 > >>> Was that last commit motivated by a bug report, and/or is there an  
 > >>> associated test? If not, perhaps it can just be reverted?
 > >> Here's the relevant list thread:
 > >> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/17541/focus=17550
 > >> The proposed patch was George's, which gets rid of the leak but  
 > >> causes the Species.t failures.  I say we revert the patch, but  
 > >> we'll still need to address the original problem addressed by  
 > >> Rutger Vos, i.e. that there is a significant memory leak in  
 > >> Bio::Species.
 > >
 > > Thanks. Rather than revert I've kludged it for now. Everything  
 > > should be fine, it's just that I fear my solution isn't 'correct'  
 > > and could mess things up we don't happen to have tests for.
 > >
 > > See http://bugzilla.open-bio.org/show_bug.cgi?id=2594
 > 
 > Probably something that will go away when we quit using Bio::Species  
 > altogether (in favor of Bio::Taxon) after 1.6.   I'm not sure whether  
 > it will be worth the trouble, but it's worth discussing.
 > 
 > Anyway, I'm still a bit unfamiliar with some aspects of Bio::Species  
 > (and I'm pretty busy ATM) so it make take a few days.

I can try to take a look at it again and see if there's a way to make
it work [more] correctly.

g.

From torsten.seemann at infotech.monash.edu.au  Sun Sep 28 21:46:06 2008
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Mon, 29 Sep 2008 11:46:06 +1000
Subject: [Bioperl-l] Retrieving taxonomy information from a GenBank file
In-Reply-To: <E078758D-D451-4973-A66D-2D6D829FCA53@bioperl.org>
References: <f03f40920809181427k168bfc3cu535c023949735cd9@mail.gmail.com>
	<E078758D-D451-4973-A66D-2D6D829FCA53@bioperl.org>
Message-ID: <a79f6a4b0809281846q380b8f77ha445f2112a2dae83@mail.gmail.com>

Anjan,

>> I'm using the following code to access the "ORGANISM" tag value for the
>> record NC_002526.
>> I get a value of 0 even though the ORGANISM tag  has a value.  Any idea
>> how
>> this might be corrected?
>> my $des= $seq->get_tag_values("ORGANISM");

> You want the species object ($seq->species)  -- see the Seq HOWTO, much of
> the Seq API is explained.
>  http://bioperl.org/wiki/HOWTO:Feature-Annotation#The_Species_Object

Of course Jason is correct here but there was still a semantic bug in
your code anyway which you should probably be aware of.
$seq->get_tag_values() returns an ARRAY which you are trying to store
in a SCALAR ($des). An array, in a scalar context, returns the SIZE of
the array, which in your case was zero (0) as there were no ORGANISM
tags. What you probably meant was:

my($des) = $seq->get_tag_values("ORGANISM");
# or
my $des = ($seq->get_tag_values("ORGANISM")) [ 0 ];

-- 
--Torsten Seemann
--Victorian Bioinformatics Consortium, Dept. Microbiology, Monash University
--Tel: 9905 9010 / 0422 923 024

From schwarz at tenaya.caltech.edu  Mon Sep 29 01:57:43 2008
From: schwarz at tenaya.caltech.edu (Erich Schwarz)
Date: Sun, 28 Sep 2008 22:57:43 -0700 (PDT)
Subject: [Bioperl-l] exporting contigs with CDSes, stored via Bio::DB::GFF,
 into individual GenBank records?
Message-ID: <Pine.LNX.4.64.0809282239110.26085@tenaya.caltech.edu>

Hi all,

    I have newly sequenced contigs, with CDS predictions, loaded 
into a Bio::DB::GFF-readable format (i.e., loaded into a MySQL 
database via Bio::DB::GFF).  I'd like to export each contig, with 
its annotated CDSes, into a single GenBank-formatted record for each 
contig (in order to be able submit this stuff to GenBank, without 
having to waste time with Sequin).  Is there some straightforward 
way of getting Bio::DB::GFF to do that?

    Some time ago, when I last had to decipher BioPerl, I came up 
with code that would let me export protein translations of the 
contigs' CDSes in GenBank format:

-------------------------------------------------------------------

#!/usr/bin/env perl

use strict;
use warnings;
use Bio::Seq;
use Bio::SeqIO;
use Bio::DB::GFF;

my $query_database = $ARGV[0];
my $dna = q{};
my $db = Bio::DB::GFF->new( -dsn => $query_database);

my $gb_file = 'example.gb';
my $seq_out = Bio::SeqIO->new( -file => ">$gb_file", -format => 'genbank', );

my @contigs = sort 
              map { $_->display_id }
              $db->features( -types => 'contig:assembly' );

foreach my $contig (@contigs) { 
    my $segment1 = $db->segment($contig);
    my @p_txs = $segment1->features('processed_transcript');
    foreach my $p_t (sort @p_txs) {
        $dna = q{};
        my @CDSes = $p_t->CDS;
        my $cds_name = $CDSes[0]->display_id();
        foreach my $cds (@CDSes) { 
            # $cds->seq == Bio::PrimarySeq, *not* plain nt seq.!
            $dna = $dna . $cds->seq->seq;
        }
        my $full_cds = Bio::Seq->new( -display_id => $cds_name, 
                                      -seq => $dna, );
        my $prot = $full_cds->translate;
        $seq_out->write_seq($prot);
    }
}

--------------------------------------------------------------------

    Returning to this, I tried using

    $db->get_Seq_by_id($contig)

to give me a Bio::Seq object for each contig (which I could then 
output into GenBank form), but that proved futile.

    I'm willing to work this out on my own if I have to, but if 
somebody can answer this in 30 seconds, it will save me a lot of 
time -- and be very appreciated!


--Erich 


From jason at bioperl.org  Tue Sep 30 12:48:17 2008
From: jason at bioperl.org (Jason Stajich)
Date: Tue, 30 Sep 2008 09:48:17 -0700
Subject: [Bioperl-l] exporting contigs with CDSes,
	stored via Bio::DB::GFF, into individual GenBank records?
In-Reply-To: <Pine.LNX.4.64.0809282239110.26085@tenaya.caltech.edu>
References: <Pine.LNX.4.64.0809282239110.26085@tenaya.caltech.edu>
Message-ID: <9880E773-812C-4F16-806F-7DB854346330@bioperl.org>

Eric.
CC-ing Gbrowse since this is regarding Gbrowse data-store.

I've definitely done exactly this although I remember I had to tweak  
the features a bit to make sure i had some some of the necessary stuff  
to sequin.


If you want to get a specific segment you just do what you already  
have in your code:
my $segment = $db->segment($contig_name);

Or you can iterate through all the features - depends on how you named  
your segments/contigs/chromsomes, I named mine "contig:scaffold" for  
type:source
  my $iterator = $dbh->get_seq_stream(-type=>'scaffold');
   while (my $s = $iterator->next_seq) {
   }

Now You *should* be able to pass this segment object to $seqio- 
 >write_seq($segment);
However Bio::DB::GFF::Feature doesn't implement the whole SeqI APi so  
you probably have to create your own sequence and move the features  
over:

y $iterator = $dbh->get_seq_stream(-type=>'scaffold');
   while (my $s = $iterator->next_seq) {
	my $seq = Bio::Seq->new();
	$seq->primary_seq($s->seq);
	for my $feature ( $s->features('processed_transcript') ) {
		my $f = Bio::SeqFeature::Generic->new(-location => $feature->location,
						      -primary_tag => $feature->primary_tag,
						      -source_tag  => $feature->primary_tag,
						      -score => $feature->score,
						      -seq_id => $feature->seq_id);
		$f->add_tag_value('locus_tag',$feature->name);
		# might also add all other tag/value pairs from this feature like  
DBXREF, etc.
		# derive a CDS feature from this feature as well.
		# perhaps derive a gene feature that only has start/end for the  
feature
		# might add a translation tag/value pair for CDS features
		$seq->add_SeqFeature($f);
	}
	$out->write_seq($seq);
  }

I suspect you'll have to edit the feature objects some to
a) remove the ones you don't want to output
b) add additional info like translation frame -- I think there is a  
slightly different way that NCBI wants things labeled wrt translation  
frame
c) add in other annotation information that may or may not be encoded  
as tag/values that

It is also possible I am missing some things in here, but hopefully it  
gets you started.  I think it would be quite useful for us to try and  
write a generic script for this but maybe focus on Bio::DB::SeqFeature  
dbs since it will be easier to assume that all the 3-level gene->mRNA- 
 >CDS/exon relationships will be explicitly specified.


-jason
On Sep 28, 2008, at 10:57 PM, Erich Schwarz wrote:

> Hi all,
>
>    I have newly sequenced contigs, with CDS predictions, loaded
> into a Bio::DB::GFF-readable format (i.e., loaded into a MySQL
> database via Bio::DB::GFF).  I'd like to export each contig, with
> its annotated CDSes, into a single GenBank-formatted record for each
> contig (in order to be able submit this stuff to GenBank, without
> having to waste time with Sequin).  Is there some straightforward
> way of getting Bio::DB::GFF to do that?
>
>    Some time ago, when I last had to decipher BioPerl, I came up
> with code that would let me export protein translations of the
> contigs' CDSes in GenBank format:
>
> -------------------------------------------------------------------
>
> #!/usr/bin/env perl
>
> use strict;
> use warnings;
> use Bio::Seq;
> use Bio::SeqIO;
> use Bio::DB::GFF;
>
> my $query_database = $ARGV[0];
> my $dna = q{};
> my $db = Bio::DB::GFF->new( -dsn => $query_database);
>
> my $gb_file = 'example.gb';
> my $seq_out = Bio::SeqIO->new( -file => ">$gb_file", -format =>  
> 'genbank', );
>
> my @contigs = sort
>              map { $_->display_id }
>              $db->features( -types => 'contig:assembly' );
>
> foreach my $contig (@contigs) {
>    my $segment1 = $db->segment($contig);
>    my @p_txs = $segment1->features('processed_transcript');
>    foreach my $p_t (sort @p_txs) {
>        $dna = q{};
>        my @CDSes = $p_t->CDS;
>        my $cds_name = $CDSes[0]->display_id();
>        foreach my $cds (@CDSes) {
>            # $cds->seq == Bio::PrimarySeq, *not* plain nt seq.!
>            $dna = $dna . $cds->seq->seq;
>        }
>        my $full_cds = Bio::Seq->new( -display_id => $cds_name,
>                                      -seq => $dna, );
>        my $prot = $full_cds->translate;
>        $seq_out->write_seq($prot);
>    }
> }
>
> --------------------------------------------------------------------
>
>    Returning to this, I tried using
>
>    $db->get_Seq_by_id($contig)
>
> to give me a Bio::Seq object for each contig (which I could then
> output into GenBank form), but that proved futile.
>
>    I'm willing to work this out on my own if I have to, but if
> somebody can answer this in 30 seconds, it will save me a lot of
> time -- and be very appreciated!
>
>
> --Erich
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org




From gilbertd at cricket.bio.indiana.edu  Tue Sep 30 13:23:56 2008
From: gilbertd at cricket.bio.indiana.edu (Don Gilbert)
Date: Tue, 30 Sep 2008 12:23:56 -0500 (EST)
Subject: [Bioperl-l] [Gmod-gbrowse]  exporting contigs with CDSes,
	stored via Bio::DB::GFF, into individual GenBank records?
Message-ID: <200809301723.m8UHNuc04293@cricket.bio.indiana.edu>


Eric,

If the Bio::DB::GFF database to Genbank submission route doesn't get you
where you want, you can also look at storing your data in a GMOD Chado
database, then using Bulkfiles to produce the Genbank Submission file set.

- Don Gilbert

Find a GenBank Submit output from Chado dbs in this tool release
http://eugenes.org/gmod/GMODTools/
  GMODTools-1.2b.zip      20-Jun-2008 

- adding (in progress) Genbank Submission table writer, 
  'bulkfiles -format=genbanktbl', with output suited
  to submit to NCBI as per these specifications
  http://www.ncbi.nlm.nih.gov/Genbank/eukaryotic_genome_submission.html

see also http://gmod.org/wiki/GMODTools
and this test case with genbank-submit output
 http://gmod.org/wiki/GMODTools_TestCase


From mauricio at open-bio.org  Tue Sep 30 17:56:04 2008
From: mauricio at open-bio.org (Mauricio Herrera Cuadra)
Date: Tue, 30 Sep 2008 16:56:04 -0500
Subject: [Bioperl-l] Test coverage for BioPerl now available
Message-ID: <48E2A074.5060305@open-bio.org>

Hi all,

Daily-updated test coverage reports are now available for those BioPerl 
packages which make use of the Build.PL mechanism (except bioperl-db):

http://bioperl.org/test-coverage/bioperl-live/
http://bioperl.org/test-coverage/bioperl-network/
http://bioperl.org/test-coverage/bioperl-run/

These reports will help us to know the current 'quality' of the code in 
SVN for most of the BioPerl modules. This idea was started by Nathan 
Haigh and Sendu a long time ago and it was my fault to not implement on 
time the necessary script to run the process on a daily basis, so 
apologies for that.

There are still a few things to be done in order to have this working as 
it should:

- Nathan, current Devel::Cover module from CPAN doesn't include the JS 
modifications to make table columns sortable. Do you know what happened 
to the code you contributed to the author for that?

- Reports could be generated for the rest of the BioPerl packages as 
soon as they're migrated to the Build.PL infrastructure. Anyone up for that?

- bioperl-db tests require BioSQL to be setup in the webserver machine, 
and the same goes for bioperl-run's tests with ALL of its dependencies. 
The bioperl.org site is co-hosted with all of the other OBF projects and 
that machine also takes care of other things (mailing lists, etc), so I 
would like your feedback on possible workarounds to not overload the 
server if we want to setup such test reports.

Thanks & regards,
Mauricio.

From jason at bioperl.org  Mon Sep  1 03:42:26 2008
From: jason at bioperl.org (Jason Stajich)
Date: Mon, 1 Sep 2008 00:42:26 -0700
Subject: [Bioperl-l] Bio::Tools::dpAlign feature request
In-Reply-To: <868888.19741.qm@web30406.mail.mud.yahoo.com>
References: <868888.19741.qm@web30406.mail.mud.yahoo.com>
Message-ID: <99A57523-94B3-4A56-A617-22675FA10AB8@bioperl.org>

Safe to ignore the tests.  Those that are failing aren't even test for  
Bio::Align::dpAlign - but were written to test a bug that has not been  
fixed in the EVD module if I remember correctly that is why they are  
marked in a TODO block, but I can't tell if the Test.pm is actually  
skipping these tests or not.

I think we probably need to deprecate some of these modules as there  
is no maintainer of Ewan's code in here.

At a minimum we need to modularlize the tests for these modules into  
separate t dir and fix the need for multiple Makefile.PL in here and  
probably move to Build.PL

-jason
On Aug 28, 2008, at 11:00 AM, Yee Man Chan wrote:

>
> Hi Alexie
>
> My understanding is that you can ignore these failures.
>
> I believe test cases 17-20 were added by Jason Stajich before I  
> added the feature you requested. I am not sure what he was doing  
> there.
>
> I suppose he can give you the definite answer to whether this is  
> something important or not.
>
> By the way, did you try out the new feature? Does it work?
>
> Thanks
> Yee Man
>
> --- On Thu, 8/28/08, Alexie Papanicolaou <apapanicolaou at ice.mpg.de>  
> wrote:
>
>> From: Alexie Papanicolaou <apapanicolaou at ice.mpg.de>
>> Subject: Re: Bio::Tools::dpAlign feature request
>> To: "Yee Man Chan" <ymc at yahoo.com>
>> Date: Thursday, August 28, 2008, 6:15 AM
>> hi
>>
>> is the version you emailed me newer or older than the
>> subversion one?
>>
>> i'm testing the subversion version for bioperl-ext and
>>
>> not ok 17 # TODO evalues vary based on platform, needs
>> fixing
>> #   Failed (TODO) test at test.pl line 156.
>> #          got: '2027805538'
>> #     expected: '1764904'
>> not ok 18 # TODO evalues vary based on platform, needs
>> fixing
>> #   Failed (TODO) test at test.pl line 157.
>> #          got: '-1375488148'
>> #     expected: '1764872'
>> not ok 19 # TODO evalues vary based on platform, needs
>> fixing
>> #   Failed (TODO) test at test.pl line 158.
>> #          got: '-808808307'
>> #     expected: '1764872'
>> not ok 20 # TODO evalues vary based on platform, needs
>> fixing
>> #   Failed (TODO) test at test.pl line 159.
>> #          got: '-2118162890'
>> #     expected: '1764872'
>>
>> you think these are ok to ignore?
>>
>>
>> On Fri, 2008-08-01 at 21:03 -0700, Yee Man Chan wrote:
>>
>>> Hi Alexie
>>>
>>>   Attached are the files that contains the feature
>> you requested. linspc.c is the one that does the work and
>> test.pl has a test case for it. The scoring scheme is as
>> described before. Please let me know if it works.
>>>
>>> Yee Man
>>>
>>> --- On Wed, 7/30/08, Alexie Papanicolaou
>> <apapanicolaou at ice.mpg.de> wrote:
>>>
>>>> From: Alexie Papanicolaou
>> <apapanicolaou at ice.mpg.de>
>>>> Subject: Re: Bio::Tools::dpAlign feature request
>>>> To: ymc at yahoo.com
>>>> Date: Wednesday, July 30, 2008, 2:44 PM
>>>> Oh sorry
>>>>
>>>> Say match=3 and mismatch=-1, gopen= -10, gext=-5
>>>> for aligning
>>>> seq1: ATG
>>>> seq2: ATT
>>>> match: 3,3,-1
>>>>
>>>> seq1: AT-G
>>>> seq2: ATTG
>>>> match: 3,3,-1,-10,3
>>>>
>>>> is that possible? or am I missing something? I
>> was only
>>>> today wondering
>>>> if it is even possible...
>>>>
>>>> a
>>>>
>>>>
>>>> Yee Man Chan wrote:
>>>>> Sorry, I don't quite get it. Can you
>> give me an
>>>> example of the output you want?
>>>>>
>>>>> Yee Man
>>>>>
>>>>> --- On Wed, 7/30/08, Alexie Papanicolaou
>>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>>
>>>>>
>>>>>> From: Alexie Papanicolaou
>>>> <apapanicolaou at ice.mpg.de>
>>>>>> Subject: Re: Bio::Tools::dpAlign feature
>> request
>>>>>> To: ymc at yahoo.com
>>>>>> Date: Wednesday, July 30, 2008, 9:50 AM
>>>>>> Dear Yee Man,
>>>>>>
>>>>>> Do you think it is possible to code a
>> method for
>>>> creating a
>>>>>> delimited
>>>>>> (space or comma) "score-line"?
>>>>>>
>>>>>> I'd like to parse it into an array
>> and have
>>>> the
>>>>>> individual score for
>>>>>> each alignment position. Is it easy to
>> do?
>>>>>>
>>>>>> a
>>>>>>
>>>>>> Yee Man Chan wrote:
>>>>>>
>>>>>>> Hi Alexie
>>>>>>>
>>>>>>>   How about I implement the simple
>> case?
>>>>>>>
>>>>>>> So for match = +3, mismatch = -1,
>>>>>>>
>>>>>>> A and R = +3
>>>>>>> A and Y = -1
>>>>>>> A and B = -1
>>>>>>> A and D = +3
>>>>>>> A and N = +3
>>>>>>> A and X = -1
>>>>>>>
>>>>>>> What do you think?
>>>>>>> Yee Man
>>>>>>>
>>>>>>>
>>>>>>> --- On Tue, 7/29/08, Alexie
>> Papanicolaou
>>>>>>>
>>>>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>>>
>>>>>>>
>>>>>>>
>>>>>>>> From: Alexie Papanicolaou
>>>>>>>>
>>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>
>>>>>>>> Subject: Re: Bio::Tools::dpAlign
>> feature
>>>> request
>>>>>>>> To: ymc at yahoo.com
>>>>>>>> Date: Tuesday, July 29, 2008,
>> 10:58 AM
>>>>>>>> Dear Yee Man,
>>>>>>>> hello, I was wondering how is
>> this
>>>> progressing and
>>>>>>>>
>>>>>> if you
>>>>>>
>>>>>>>> need help?
>>>>>>>>
>>>>>>>> many thanks
>>>>>>>> alexie
>>>>>>>>
>>>>>>>> Yee Man Chan wrote:
>>>>>>>>
>>>>>>>>
>>>>>>>>> Hi Alexie
>>>>>>>>>
>>>>>>>>>   There are two ways to
>> compute the
>>>> score for
>>>>>>>>>
>>>>>> each
>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>> aligned basepair in dpAlign
>> module. One is
>>>>>>>>
>>>>>> match/mismatch
>>>>>>
>>>>>>>> if you specify your sequence as
>> DNA and
>>>> the other
>>>>>>>>
>>>>>> is a
>>>>>>
>>>>>>>> scoring matrix if you specify
>> your
>>>> sequence as
>>>>>>>>
>>>>>> protein.
>>>>>>
>>>>>>>> Obviously, the latter can
>> completely
>>>> dominate the
>>>>>>>>
>>>>>> former.
>>>>>>
>>>>>>>> If you take the time to type the
>> scoring
>>>> matrix
>>>>>>>>
>>>>>> file, then
>>>>>>
>>>>>>>> you can handle those IUPAC code
>> by
>>>> specifying the
>>>>>>>>
>>>>>> sequence
>>>>>>
>>>>>>>> as proteins.
>>>>>>>>
>>>>>>>>
>>>>>>>>>   If you think this is too
>>>> troublesome, then
>>>>>>>>>
>>>>>> I might
>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>> be able to extend the
>> match/mismatch route
>>>> to
>>>>>>>>
>>>>>> handle IUPAC
>>>>>>
>>>>>>>> codes. But the problem here is,
>> how should
>>>> I score
>>>>>>>>
>>>>>> a match
>>>>>>
>>>>>>>> of A and W when match is +3 and
>> mismatch
>>>> is -1?
>>>>>>>>
>>>>>> Should it
>>>>>>
>>>>>>>> have a score of +3/3 = +1 for
>> match or
>>>> +3/3-1*2/3
>>>>>>>>
>>>>>> = +1/3?
>>>>>>
>>>>>>>> Do you know what the convention
>> is? If
>>>> not, maybe
>>>>>>>>
>>>>>> you can
>>>>>>
>>>>>>>> tell me what you think the score
>> will be?
>>>>>>>>
>>>>>>>>
>>>>>>>>> Yee Man
>>>>>>>>>
>>>>>>>>> --- On Thu, 6/26/08, Alexie
>>>> Papanicolaou
>>>>>>>>>
>>>>>>>>>
>>>>>>>> <apapanicolaou at ice.mpg.de>
>> wrote:
>>>>>>>>
>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>> From: Alexie
>> Papanicolaou
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>>>
>>>>>>>>
>>>>>>>>>> Subject:
>> Bio::Tools::dpAlign
>>>> feature
>>>>>>>>>>
>>>>>> request
>>>>>>
>>>>>>>>>> To: ymc at yahoo.com
>>>>>>>>>> Date: Thursday, June 26,
>> 2008,
>>>> 4:15 AM
>>>>>>>>>> Dear Yee Man Chan,
>>>>>>>>>>
>>>>>>>>>> Many thank you for this
>> module. I
>>>> like it
>>>>>>>>>>
>>>>>> very
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> much. I was
>>>>>>>>
>>>>>>>>
>>>>>>>>>> wondering if
>>>>>>>>>> it would be possible for
>> you to
>>>> allow for
>>>>>>>>>>
>>>>>> IUPAC
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> DNA codes.
>>>>>>>>
>>>>>>>>
>>>>>>>>>> I see it is in your TODO
>> list and
>>>> I hoped
>>>>>>>>>>
>>>>>> to
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> inspire you
>>>>>>>>
>>>>>>>>
>>>>>>>>>> :-)
>>>>>>>>>>
>>>>>>>>>> Even a simple measure
>> with the
>>>> degenerate
>>>>>>>>>>
>>>>>> base
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> containing
>>>>>>>>
>>>>>>>>
>>>>>>>>>> the aligned
>>>>>>>>>> base count as a
>> (perfect) match
>>>> would be
>>>>>>>>>>
>>>>>> very
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> useful to me
>>>>>>>>
>>>>>>>>
>>>>>>>>>> (i'm sorry, i
>>>>>>>>>> 'm not a good coder
>> to do it
>>>> myself).
>>>>>>>>>>
>>>>>>>>>> many thanks for your
>> work so far.
>>>>>>>>>> alexie
>>>>>>>>>>
>>>>>>>>>> -- 
>>>>>>>>>> --
>>>>>>>>>> "Eppur si
>> evolve"
>>>> ("And yet
>>>>>>>>>>
>>>>>> it
>>>>>>
>>>>>>>>>> evolves")
>>>>>>>>>> -Galileo Jr (ca 21st
>> century)
>>>>>>>>>>
>>>>>>>>>> --
>>>>>>>>>> Alexie Papanicolaou
>>>>>>>>>> Entomology
>>>>>>>>>> Max Planck Institute for
>> Chemical
>>>> Ecology
>>>>>>>>>> Hans Knoell Str 8
>>>>>>>>>> Jena 07745
>>>>>>>>>> Germany
>>>>>>>>>> Email
>> apapanicolaou at ice.mpg.de
>>>>>>>>>> Tel +493641571561
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>> -- 
>>>>>>>> --
>>>>>>>> "Eppur si evolve"
>> ("And yet
>>>> it
>>>>>>>> evolves")
>>>>>>>> -Galileo Jr (ca 21st century)
>>>>>>>>
>>>>>>>> "One Galileo in two
>> thousand years is
>>>>>>>>
>>>>>> enough."
>>>>>>
>>>>>>>> -Pope Pius XII
>>>>>>>> --
>>>>>>>> Alexie Papanicolaou
>>>>>>>> Entomology
>>>>>>>> Max Planck Institute for
>> Chemical Ecology
>>>>>>>> Hans Knoell Str 8
>>>>>>>> Jena 07745
>>>>>>>> Germany
>>>>>>>> Email apapanicolaou at ice.mpg.de
>>>>>>>> Tel +493641571561
>>>>>>>>
>>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>> -- 
>>>>>> --
>>>>>> "Eppur si evolve" ("And
>> yet it
>>>>>> evolves")
>>>>>> -Galileo Jr (ca 21st century)
>>>>>>
>>>>>> "One Galileo in two thousand years
>> is
>>>> enough."
>>>>>> -Pope Pius XII
>>>>>> --
>>>>>> Alexie Papanicolaou
>>>>>> Entomology
>>>>>> Max Planck Institute for Chemical
>> Ecology
>>>>>> Hans Knoell Str 8
>>>>>> Jena 07745
>>>>>> Germany
>>>>>> Email apapanicolaou at ice.mpg.de
>>>>>> Tel +493641571561
>>>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>
>>>> -- 
>>>> --
>>>> "Eppur si evolve" ("And yet it
>>>> evolves")
>>>> -Galileo Jr (ca 21st century)
>>>>
>>>> "One Galileo in two thousand years is
>> enough."
>>>> -Pope Pius XII
>>>> --
>>>> Alexie Papanicolaou
>>>> Entomology
>>>> Max Planck Institute for Chemical Ecology
>>>> Hans Knoell Str 8
>>>> Jena 07745
>>>> Germany
>>>> Email apapanicolaou at ice.mpg.de
>>>> Tel +493641571561
>>>
>>>
>>>
>>
>> -- 
>> -- 
>> "Eppur si evolve" ("And yet it
>> evolves")
>> -Galileo Jr (ca 21st century)
>>
>> "One Galileo in two thousand years is enough."
>> -Pope Pius XII
>> -- 
>> Alexie Papanicolaou
>> Entomology
>> Max Planck Institute for Chemical Ecology
>> Hans Knoell Str 8
>> Jena 07745
>> Germany
>> Email apapanicolaou at ice.mpg.de
>> Tel +493641571561
>
>
>

Jason Stajich
jason at bioperl.org





From cjfields at illinois.edu  Mon Sep  1 13:49:56 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Mon, 1 Sep 2008 12:49:56 -0500
Subject: [Bioperl-l] Bio::Tools::dpAlign feature request
In-Reply-To: <99A57523-94B3-4A56-A617-22675FA10AB8@bioperl.org>
References: <868888.19741.qm@web30406.mail.mud.yahoo.com>
	<99A57523-94B3-4A56-A617-22675FA10AB8@bioperl.org>
Message-ID: <44D25826-BE42-4539-8567-468FE74571B4@illinois.edu>

On pSW: I agree, I don't think it is worth maintaining it considering  
there are actively supported C/C++-based toolkits with similar  
functionality (SeqAn) and Petr's BioLib initiative will likely be a  
more maintainable effort.

chris

On Sep 1, 2008, at 2:42 AM, Jason Stajich wrote:

> Safe to ignore the tests.  Those that are failing aren't even test  
> for Bio::Align::dpAlign - but were written to test a bug that has  
> not been fixed in the EVD module if I remember correctly that is why  
> they are marked in a TODO block, but I can't tell if the Test.pm is  
> actually skipping these tests or not.
>
> I think we probably need to deprecate some of these modules as there  
> is no maintainer of Ewan's code in here.
>
> At a minimum we need to modularlize the tests for these modules into  
> separate t dir and fix the need for multiple Makefile.PL in here and  
> probably move to Build.PL
>
> -jason
> On Aug 28, 2008, at 11:00 AM, Yee Man Chan wrote:
>
>>
>> Hi Alexie
>>
>> My understanding is that you can ignore these failures.
>>
>> I believe test cases 17-20 were added by Jason Stajich before I  
>> added the feature you requested. I am not sure what he was doing  
>> there.
>>
>> I suppose he can give you the definite answer to whether this is  
>> something important or not.
>>
>> By the way, did you try out the new feature? Does it work?
>>
>> Thanks
>> Yee Man
>>
>> --- On Thu, 8/28/08, Alexie Papanicolaou <apapanicolaou at ice.mpg.de>  
>> wrote:
>>
>>> From: Alexie Papanicolaou <apapanicolaou at ice.mpg.de>
>>> Subject: Re: Bio::Tools::dpAlign feature request
>>> To: "Yee Man Chan" <ymc at yahoo.com>
>>> Date: Thursday, August 28, 2008, 6:15 AM
>>> hi
>>>
>>> is the version you emailed me newer or older than the
>>> subversion one?
>>>
>>> i'm testing the subversion version for bioperl-ext and
>>>
>>> not ok 17 # TODO evalues vary based on platform, needs
>>> fixing
>>> #   Failed (TODO) test at test.pl line 156.
>>> #          got: '2027805538'
>>> #     expected: '1764904'
>>> not ok 18 # TODO evalues vary based on platform, needs
>>> fixing
>>> #   Failed (TODO) test at test.pl line 157.
>>> #          got: '-1375488148'
>>> #     expected: '1764872'
>>> not ok 19 # TODO evalues vary based on platform, needs
>>> fixing
>>> #   Failed (TODO) test at test.pl line 158.
>>> #          got: '-808808307'
>>> #     expected: '1764872'
>>> not ok 20 # TODO evalues vary based on platform, needs
>>> fixing
>>> #   Failed (TODO) test at test.pl line 159.
>>> #          got: '-2118162890'
>>> #     expected: '1764872'
>>>
>>> you think these are ok to ignore?
>>>
>>>
>>> On Fri, 2008-08-01 at 21:03 -0700, Yee Man Chan wrote:
>>>
>>>> Hi Alexie
>>>>
>>>>  Attached are the files that contains the feature
>>> you requested. linspc.c is the one that does the work and
>>> test.pl has a test case for it. The scoring scheme is as
>>> described before. Please let me know if it works.
>>>>
>>>> Yee Man
>>>>
>>>> --- On Wed, 7/30/08, Alexie Papanicolaou
>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>
>>>>> From: Alexie Papanicolaou
>>> <apapanicolaou at ice.mpg.de>
>>>>> Subject: Re: Bio::Tools::dpAlign feature request
>>>>> To: ymc at yahoo.com
>>>>> Date: Wednesday, July 30, 2008, 2:44 PM
>>>>> Oh sorry
>>>>>
>>>>> Say match=3 and mismatch=-1, gopen= -10, gext=-5
>>>>> for aligning
>>>>> seq1: ATG
>>>>> seq2: ATT
>>>>> match: 3,3,-1
>>>>>
>>>>> seq1: AT-G
>>>>> seq2: ATTG
>>>>> match: 3,3,-1,-10,3
>>>>>
>>>>> is that possible? or am I missing something? I
>>> was only
>>>>> today wondering
>>>>> if it is even possible...
>>>>>
>>>>> a
>>>>>
>>>>>
>>>>> Yee Man Chan wrote:
>>>>>> Sorry, I don't quite get it. Can you
>>> give me an
>>>>> example of the output you want?
>>>>>>
>>>>>> Yee Man
>>>>>>
>>>>>> --- On Wed, 7/30/08, Alexie Papanicolaou
>>>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>>>
>>>>>>
>>>>>>> From: Alexie Papanicolaou
>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>> Subject: Re: Bio::Tools::dpAlign feature
>>> request
>>>>>>> To: ymc at yahoo.com
>>>>>>> Date: Wednesday, July 30, 2008, 9:50 AM
>>>>>>> Dear Yee Man,
>>>>>>>
>>>>>>> Do you think it is possible to code a
>>> method for
>>>>> creating a
>>>>>>> delimited
>>>>>>> (space or comma) "score-line"?
>>>>>>>
>>>>>>> I'd like to parse it into an array
>>> and have
>>>>> the
>>>>>>> individual score for
>>>>>>> each alignment position. Is it easy to
>>> do?
>>>>>>>
>>>>>>> a
>>>>>>>
>>>>>>> Yee Man Chan wrote:
>>>>>>>
>>>>>>>> Hi Alexie
>>>>>>>>
>>>>>>>>  How about I implement the simple
>>> case?
>>>>>>>>
>>>>>>>> So for match = +3, mismatch = -1,
>>>>>>>>
>>>>>>>> A and R = +3
>>>>>>>> A and Y = -1
>>>>>>>> A and B = -1
>>>>>>>> A and D = +3
>>>>>>>> A and N = +3
>>>>>>>> A and X = -1
>>>>>>>>
>>>>>>>> What do you think?
>>>>>>>> Yee Man
>>>>>>>>
>>>>>>>>
>>>>>>>> --- On Tue, 7/29/08, Alexie
>>> Papanicolaou
>>>>>>>>
>>>>>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>>> From: Alexie Papanicolaou
>>>>>>>>>
>>>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>>
>>>>>>>>> Subject: Re: Bio::Tools::dpAlign
>>> feature
>>>>> request
>>>>>>>>> To: ymc at yahoo.com
>>>>>>>>> Date: Tuesday, July 29, 2008,
>>> 10:58 AM
>>>>>>>>> Dear Yee Man,
>>>>>>>>> hello, I was wondering how is
>>> this
>>>>> progressing and
>>>>>>>>>
>>>>>>> if you
>>>>>>>
>>>>>>>>> need help?
>>>>>>>>>
>>>>>>>>> many thanks
>>>>>>>>> alexie
>>>>>>>>>
>>>>>>>>> Yee Man Chan wrote:
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>> Hi Alexie
>>>>>>>>>>
>>>>>>>>>>  There are two ways to
>>> compute the
>>>>> score for
>>>>>>>>>>
>>>>>>> each
>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>> aligned basepair in dpAlign
>>> module. One is
>>>>>>>>>
>>>>>>> match/mismatch
>>>>>>>
>>>>>>>>> if you specify your sequence as
>>> DNA and
>>>>> the other
>>>>>>>>>
>>>>>>> is a
>>>>>>>
>>>>>>>>> scoring matrix if you specify
>>> your
>>>>> sequence as
>>>>>>>>>
>>>>>>> protein.
>>>>>>>
>>>>>>>>> Obviously, the latter can
>>> completely
>>>>> dominate the
>>>>>>>>>
>>>>>>> former.
>>>>>>>
>>>>>>>>> If you take the time to type the
>>> scoring
>>>>> matrix
>>>>>>>>>
>>>>>>> file, then
>>>>>>>
>>>>>>>>> you can handle those IUPAC code
>>> by
>>>>> specifying the
>>>>>>>>>
>>>>>>> sequence
>>>>>>>
>>>>>>>>> as proteins.
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>  If you think this is too
>>>>> troublesome, then
>>>>>>>>>>
>>>>>>> I might
>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>> be able to extend the
>>> match/mismatch route
>>>>> to
>>>>>>>>>
>>>>>>> handle IUPAC
>>>>>>>
>>>>>>>>> codes. But the problem here is,
>>> how should
>>>>> I score
>>>>>>>>>
>>>>>>> a match
>>>>>>>
>>>>>>>>> of A and W when match is +3 and
>>> mismatch
>>>>> is -1?
>>>>>>>>>
>>>>>>> Should it
>>>>>>>
>>>>>>>>> have a score of +3/3 = +1 for
>>> match or
>>>>> +3/3-1*2/3
>>>>>>>>>
>>>>>>> = +1/3?
>>>>>>>
>>>>>>>>> Do you know what the convention
>>> is? If
>>>>> not, maybe
>>>>>>>>>
>>>>>>> you can
>>>>>>>
>>>>>>>>> tell me what you think the score
>>> will be?
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>> Yee Man
>>>>>>>>>>
>>>>>>>>>> --- On Thu, 6/26/08, Alexie
>>>>> Papanicolaou
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>> <apapanicolaou at ice.mpg.de>
>>> wrote:
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>> From: Alexie
>>> Papanicolaou
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> Subject:
>>> Bio::Tools::dpAlign
>>>>> feature
>>>>>>>>>>>
>>>>>>> request
>>>>>>>
>>>>>>>>>>> To: ymc at yahoo.com
>>>>>>>>>>> Date: Thursday, June 26,
>>> 2008,
>>>>> 4:15 AM
>>>>>>>>>>> Dear Yee Man Chan,
>>>>>>>>>>>
>>>>>>>>>>> Many thank you for this
>>> module. I
>>>>> like it
>>>>>>>>>>>
>>>>>>> very
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> much. I was
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> wondering if
>>>>>>>>>>> it would be possible for
>>> you to
>>>>> allow for
>>>>>>>>>>>
>>>>>>> IUPAC
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> DNA codes.
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> I see it is in your TODO
>>> list and
>>>>> I hoped
>>>>>>>>>>>
>>>>>>> to
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> inspire you
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> :-)
>>>>>>>>>>>
>>>>>>>>>>> Even a simple measure
>>> with the
>>>>> degenerate
>>>>>>>>>>>
>>>>>>> base
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> containing
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> the aligned
>>>>>>>>>>> base count as a
>>> (perfect) match
>>>>> would be
>>>>>>>>>>>
>>>>>>> very
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> useful to me
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> (i'm sorry, i
>>>>>>>>>>> 'm not a good coder
>>> to do it
>>>>> myself).
>>>>>>>>>>>
>>>>>>>>>>> many thanks for your
>>> work so far.
>>>>>>>>>>> alexie
>>>>>>>>>>>
>>>>>>>>>>> -- 
>>>>>>>>>>> --
>>>>>>>>>>> "Eppur si
>>> evolve"
>>>>> ("And yet
>>>>>>>>>>>
>>>>>>> it
>>>>>>>
>>>>>>>>>>> evolves")
>>>>>>>>>>> -Galileo Jr (ca 21st
>>> century)
>>>>>>>>>>>
>>>>>>>>>>> --
>>>>>>>>>>> Alexie Papanicolaou
>>>>>>>>>>> Entomology
>>>>>>>>>>> Max Planck Institute for
>>> Chemical
>>>>> Ecology
>>>>>>>>>>> Hans Knoell Str 8
>>>>>>>>>>> Jena 07745
>>>>>>>>>>> Germany
>>>>>>>>>>> Email
>>> apapanicolaou at ice.mpg.de
>>>>>>>>>>> Tel +493641571561
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>> -- 
>>>>>>>>> --
>>>>>>>>> "Eppur si evolve"
>>> ("And yet
>>>>> it
>>>>>>>>> evolves")
>>>>>>>>> -Galileo Jr (ca 21st century)
>>>>>>>>>
>>>>>>>>> "One Galileo in two
>>> thousand years is
>>>>>>>>>
>>>>>>> enough."
>>>>>>>
>>>>>>>>> -Pope Pius XII
>>>>>>>>> --
>>>>>>>>> Alexie Papanicolaou
>>>>>>>>> Entomology
>>>>>>>>> Max Planck Institute for
>>> Chemical Ecology
>>>>>>>>> Hans Knoell Str 8
>>>>>>>>> Jena 07745
>>>>>>>>> Germany
>>>>>>>>> Email apapanicolaou at ice.mpg.de
>>>>>>>>> Tel +493641571561
>>>>>>>>>
>>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>> -- 
>>>>>>> --
>>>>>>> "Eppur si evolve" ("And
>>> yet it
>>>>>>> evolves")
>>>>>>> -Galileo Jr (ca 21st century)
>>>>>>>
>>>>>>> "One Galileo in two thousand years
>>> is
>>>>> enough."
>>>>>>> -Pope Pius XII
>>>>>>> --
>>>>>>> Alexie Papanicolaou
>>>>>>> Entomology
>>>>>>> Max Planck Institute for Chemical
>>> Ecology
>>>>>>> Hans Knoell Str 8
>>>>>>> Jena 07745
>>>>>>> Germany
>>>>>>> Email apapanicolaou at ice.mpg.de
>>>>>>> Tel +493641571561
>>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>
>>>>> -- 
>>>>> --
>>>>> "Eppur si evolve" ("And yet it
>>>>> evolves")
>>>>> -Galileo Jr (ca 21st century)
>>>>>
>>>>> "One Galileo in two thousand years is
>>> enough."
>>>>> -Pope Pius XII
>>>>> --
>>>>> Alexie Papanicolaou
>>>>> Entomology
>>>>> Max Planck Institute for Chemical Ecology
>>>>> Hans Knoell Str 8
>>>>> Jena 07745
>>>>> Germany
>>>>> Email apapanicolaou at ice.mpg.de
>>>>> Tel +493641571561
>>>>
>>>>
>>>>
>>>
>>> -- 
>>> -- 
>>> "Eppur si evolve" ("And yet it
>>> evolves")
>>> -Galileo Jr (ca 21st century)
>>>
>>> "One Galileo in two thousand years is enough."
>>> -Pope Pius XII
>>> -- 
>>> Alexie Papanicolaou
>>> Entomology
>>> Max Planck Institute for Chemical Ecology
>>> Hans Knoell Str 8
>>> Jena 07745
>>> Germany
>>> Email apapanicolaou at ice.mpg.de
>>> Tel +493641571561
>>
>>
>>
>
> Jason Stajich
> jason at bioperl.org
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From lmanchon at univ-montp2.fr  Wed Sep  3 09:04:14 2008
From: lmanchon at univ-montp2.fr (Laurent Manchon)
Date: Wed, 03 Sep 2008 15:04:14 +0200
Subject: [Bioperl-l] parsing result of CAP3 (ACE file)
Message-ID: <5.0.2.1.2.20080903150203.00c0db18@pop.univ-montp2.fr>

-- Hi,

Is somebody have a piece of code to parse result of CAP3 assembly program which
format is ACE ?
I need to retrieve the alignment from this file.

thank you,
Laurent --




+---------------------------------------------+
  Laurent Manchon
  Email: lmanchon at univ-montp2.fr
+---------------------------------------------+


From osborne6 at gmail.com  Wed Sep  3 10:33:15 2008
From: osborne6 at gmail.com (John Osborne)
Date: Wed, 3 Sep 2008 09:33:15 -0500
Subject: [Bioperl-l] interpro parsing enhancement?
Message-ID: <324fccf0809030733y5c5e8592t5f0617d0ff4d2203@mail.gmail.com>

Hi -
I'm wondering if anyone is working on adding functionality to
Bio::SeqIO::interpro to grab the Gene Ontology/GO classifications out
of the interpro xml output?

I've started working on that myself, but wanted to check if anyone
else is doing the same.

Thanks!
-- 
John Osborne
osborne6 at ieee.org/osborne6 at gmail.com/jro at freeshell.org


From gundalav at gmail.com  Wed Sep  3 10:48:07 2008
From: gundalav at gmail.com (Gundala Viswanath)
Date: Wed, 3 Sep 2008 23:48:07 +0900
Subject: [Bioperl-l] Fitch's Parsimony Algorithm with Perl
Message-ID: <73f827b50809030748o725d3772m681af9da3c0c26c0@mail.gmail.com>

Hi,

What's a correct way to implement Fitch's parsimony algorithm?
Especially to compute minimum substitiution rate per column
in the aligned sequence.

Is there a Bioperl module to do it?

For example
CGGCGGAAAACTGTCCTCCGTGC   mouse
CGACGGAACATTCTCCTCCGCGC   rat
CGACGGAATATTCCCCTCCGTGC   human
CGACGGAAGACTCTCCTCCGTGC   chimp

00100000302011000000100   -> number of subst per site (max parsimony)

My code below doesn't seem to do the job.

__BEGIN__
use Data::Dumper;
use List::MoreUtils qw(uniq);

# The related phylogenetic in Newick format tree is:
my $tree = ' (mouse,rat,(human,chimp))';

my $sites = [
    'CGGCGGAAAACTGTCCTCCGTGC', # mouse
    'CGACGGAACATTCTCCTCCGCGC', # rat
    'CGACGGAATATTCCCCTCCGTGC', # human
    'CGACGGAAGACTCTCCTCCGTGC', # chimp
];

my @val = my_parsimony($sites);
print Dumper \@val;

sub my_parsimony {

    my  $tfbs   = shift;
    my $mlen = length($tfbs->[0]);

    my $sum_min = 0;
    my @mincol;

    foreach my $pos ( 0 .. $mlen-1 ) {

        my @colbp = ();
        foreach my $site ( @{$tfbs} ) {
            my $bp = substr($site,$pos,1);
            push @colbp, $bp;

        }

       # this heuristic seems to be faulty
       # Column 11 it predicts 1 instead of 2

       # Not sure how can I make use of the tree

        my $min_mm = scalar( uniq(@colbp) ) - 1;
        push @mincol, $min_mm;
    }

    return @mincol;
}

__END__

- Gundala Viswanath
Jakarta - Indonesia


From raulmendez at cbm.uam.es  Wed Sep  3 10:33:46 2008
From: raulmendez at cbm.uam.es (Raul Mendez Giraldez)
Date: Wed, 03 Sep 2008 16:33:46 +0200
Subject: [Bioperl-l] SeqHound
In-Reply-To: <111DD141-75F8-4437-9EAD-E049BBADB515@uiuc.edu>
Message-ID: <1220452426.31595.92.camel@pepa.cbm.uam.es>

Hi Chris,

I'm trying to set up and run bioperl Seqhound donwloaded from:

http://bond.unleashedinformatics.com/downloads/api//seqhound-bioperl-4.0.tar.gz

and I always get connection error messages. Do you know which version of
SeqHound should I use and how can I configure to make it work? I've
tried several possibilities for server1 at .shoundremrc as

[remote]
server1 = bond.unleashedinformatics.com
CGI = /cgi-bin/seqrem
port=8080

Also, I would like to get all the possible protein-protein interaction
for a set of protein sequences. Would this be possible using SeqHound?

Thanks,
Ra?l




-- 
Ra?l M?ndez Gir?ldez, Ph.D.
Bioinformatics Unit
Centre for Molecular Biology "Severo Ochoa"
Universidad Aut?noma de Madrid
C/ Nicol?s Cabrera, 1
Cantoblanco 28049, Madrid
SPAIN

Phone: +34 91 196 4633




From jaudall at gmail.com  Wed Sep  3 11:38:08 2008
From: jaudall at gmail.com (Joshua Udall)
Date: Wed, 3 Sep 2008 09:38:08 -0600
Subject: [Bioperl-l] parsing result of CAP3 (ACE file)
In-Reply-To: <5.0.2.1.2.20080903150203.00c0db18@pop.univ-montp2.fr>
References: <5.0.2.1.2.20080903150203.00c0db18@pop.univ-montp2.fr>
Message-ID: <52cea20c0809030838k6fb1498btc15b8e76d98f9d70@mail.gmail.com>

Laurent -

I have modified modules that will do it as I recently ran into problems with
the DB_FILE module in Assembly::IO.  In addition, the current version of
cap3 seems to put a contig length where a pad length is expected (based on
the Ace format description).  The modules I have will parse the ace file
contig-by-contig rather than having the entire assembly slurped into memory
(or a tied hash) all at once.  You are welcome to them if you are interested
and I'd like to get them in Bioperl at some point.  Bascially, there are
three files - a modified Contig.pm, ContigIO.pm, and a modified ace.pm (in a
ContigIO directory).

Josh

On Wed, Sep 3, 2008 at 7:04 AM, Laurent Manchon <lmanchon at univ-montp2.fr>wrote:

> -- Hi,
>
> Is somebody have a piece of code to parse result of CAP3 assembly program
> which
> format is ACE ?
> I need to retrieve the alignment from this file.
>
> thank you,
> Laurent --
>
>
>
>
> +---------------------------------------------+
>  Laurent Manchon
>  Email: lmanchon at univ-montp2.fr
> +---------------------------------------------+
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Joshua Udall
Assistant Professor
295 WIDB
Plant and Wildlife Science Dept.
Brigham Young University
Provo, UT 84602
801-422-9307
Fax: 801-422-0008
USA


From hartzell at alerce.com  Wed Sep  3 19:19:45 2008
From: hartzell at alerce.com (George Hartzell)
Date: Wed, 3 Sep 2008 16:19:45 -0700
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
Message-ID: <18623.7057.95449.99461@almost.alerce.com>


Ok, confess.  None of you know what's up with line 248 of
Bio::Coordinate::Pair, do you?  You probably don't even know what's
*on* that line.  Wonder how many will go look.

Now that I either have your attention or have pissed you off (or
both...), I think that creating a new Bio::Location::Split object in
Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
quite sure enough to excise it and commit the change.

Anyone up for it?

g.


From cjfields at illinois.edu  Wed Sep  3 21:29:49 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 3 Sep 2008 20:29:49 -0500
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
In-Reply-To: <18623.7057.95449.99461@almost.alerce.com>
References: <18623.7057.95449.99461@almost.alerce.com>
Message-ID: <C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>

Well, it doesn't look like the SplitLocation is even used, so I think  
it is safe to remove.

chris

On Sep 3, 2008, at 6:19 PM, George Hartzell wrote:

>
> Ok, confess.  None of you know what's up with line 248 of
> Bio::Coordinate::Pair, do you?  You probably don't even know what's
> *on* that line.  Wonder how many will go look.
>
> Now that I either have your attention or have pissed you off (or
> both...), I think that creating a new Bio::Location::Split object in
> Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
> quite sure enough to excise it and commit the change.
>
> Anyone up for it?
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From jason at bioperl.org  Thu Sep  4 00:40:38 2008
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 3 Sep 2008 21:40:38 -0700
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
In-Reply-To: <C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>
References: <18623.7057.95449.99461@almost.alerce.com>
	<C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>
Message-ID: <222DB5D8-BCCB-448E-BDEE-068A4A432660@bioperl.org>

Agreed - I don't know if that was something was changed mid-stream,  
but removing it should cause no pain...
-j
On Sep 3, 2008, at 6:29 PM, Chris Fields wrote:

> Well, it doesn't look like the SplitLocation is even used, so I  
> think it is safe to remove.
>
> chris
>
> On Sep 3, 2008, at 6:19 PM, George Hartzell wrote:
>
>>
>> Ok, confess.  None of you know what's up with line 248 of
>> Bio::Coordinate::Pair, do you?  You probably don't even know what's
>> *on* that line.  Wonder how many will go look.
>>
>> Now that I either have your attention or have pissed you off (or
>> both...), I think that creating a new Bio::Location::Split object in
>> Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
>> quite sure enough to excise it and commit the change.
>>
>> Anyone up for it?
>>
>> g.
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Marie-Claude Hofmann
> College of Veterinary Medicine
> University of Illinois Urbana-Champaign
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From heikki at sanbi.ac.za  Thu Sep  4 02:17:31 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Thu, 4 Sep 2008 08:17:31 +0200
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
In-Reply-To: <222DB5D8-BCCB-448E-BDEE-068A4A432660@bioperl.org>
References: <18623.7057.95449.99461@almost.alerce.com>
	<C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>
	<222DB5D8-BCCB-448E-BDEE-068A4A432660@bioperl.org>
Message-ID: <200809040817.31916.heikki@sanbi.ac.za>

Quilty. So I removed the line.

George, please do not try to piss us off. You can get all the attention you 
want from us. :)

What are you planning to do to Bio::Coordinate classes?

   -Heikki


On Thursday 04 September 2008 06:40:38 Jason Stajich wrote:
> Agreed - I don't know if that was something was changed mid-stream,
> but removing it should cause no pain...
> -j
>
> On Sep 3, 2008, at 6:29 PM, Chris Fields wrote:
> > Well, it doesn't look like the SplitLocation is even used, so I
> > think it is safe to remove.
> >
> > chris
> >
> > On Sep 3, 2008, at 6:19 PM, George Hartzell wrote:
> >> Ok, confess.  None of you know what's up with line 248 of
> >> Bio::Coordinate::Pair, do you?  You probably don't even know what's
> >> *on* that line.  Wonder how many will go look.
> >>
> >> Now that I either have your attention or have pissed you off (or
> >> both...), I think that creating a new Bio::Location::Split object in
> >> Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
> >> quite sure enough to excise it and commit the change.
> >>
> >> Anyone up for it?
> >>
> >> g.
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> > Christopher Fields
> > Postdoctoral Researcher
> > Lab of Dr. Marie-Claude Hofmann
> > College of Veterinary Medicine
> > University of Illinois Urbana-Champaign
> >
> >
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Jason Stajich
> jason at bioperl.org
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From hartzell at alerce.com  Thu Sep  4 12:00:21 2008
From: hartzell at alerce.com (George Hartzell)
Date: Thu, 4 Sep 2008 09:00:21 -0700
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
In-Reply-To: <200809040817.31916.heikki@sanbi.ac.za>
References: <18623.7057.95449.99461@almost.alerce.com>
	<C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>
	<222DB5D8-BCCB-448E-BDEE-068A4A432660@bioperl.org>
	<200809040817.31916.heikki@sanbi.ac.za>
Message-ID: <18624.1557.758033.258065@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > Quilty. So I removed the line.
 > 
 > George, please do not try to piss us off. You can get all the attention you 
 > want from us. :)

Try not. Do... or do not. There is no try.

 > What are you planning to do to Bio::Coordinate classes?

It's a project for a paying customer (yikes...).  Pretty much exactly
what GeneMapper does, though I'll probably end up dangling a couple
more named coordinate spaces off of it.  Nothing earth shattering.
The classes look *great*.

g.


From hartzell at alerce.com  Fri Sep  5 15:01:35 2008
From: hartzell at alerce.com (George Hartzell)
Date: Fri, 05 Sep 2008 12:01:35 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean better
	(w/ patch)
Message-ID: <m263pabenk.fsf@almost.alerce.com>


Hi all,

Bio::Coordinate::Collection surprised me a bit.  At first I thought
there was a bug, but it's clearly doing what it's supposed to.  Now
I'm wondering if what it's supposed to be doing makes sense in some
context, or if what I expected would be better functionality.

t/CoordinateMapper.t sets up the following scenario:

#
# Collection
#
#         1   5     6   10
#         |---|     |---|
#-----|-----------------------
#     1   5   9     15  19
#         pair1     pair2

Then goes on to do the following query:

  # match more than two
  $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
  ok $res = $transcribe->map($pos);
  is $res->each_gap, 2;
  is $res->each_match, 2;

I was surprised to see that there were two gaps, one gene:10-19 and
one from gene:5-14.  Looking at the code, what's really happening is
that, for the exon1 mapper there's match with gene:5-9 and a gap with
gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
match with gene:15-19.  All four Result's just get tossed into the
return value.

The result my intuition wants is that there are two matches (gene:5-9
with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).

Yes, I guess that I could just synthesize these myself from the result
in my app.

It still seems that the current result is a bug though, since there's
no way of knowing when you're walking through $res->each_Location that
the first "gap" is with respect to the exon1 mapper and that the
second "gap" is with respect to the exon2 mapper.  The gaps are
meaningless.

I "fixed" it to work the way I think it should (two matches, one
gap).  I actually extended the test case a bit so that there's a
multi-base gap, a match, another multibase-gap, another match, then a
single base gap (just to make sure I got that right...).  I had to
touch up the test file a bit to account for my new test.

The gaps that I return have a strand of 'undef', which seems to be The
Right Thing.  There's also a bit of funny business where I hang onto
the seq_id of the gapped sequence.  It assumes that the "in" sequence
is the same for all of the mappers.  This seems safe since otherwise
the entire query is kind of weird....

There's a patch to todays svn head at:

  http://shrimp.alerce.com/bioperl/collection-diffs.txt

The patch changes Build.PL to include a dependency on Set::IntSpan,
CoordinateMapper.t to update the tests, and
Bio/CoordinateMapper/Collection.pm for the new code.

Who's code would this break.

If anyone's relying on the current behaviour re: gaps, what's the
situation in which you find it useful?

Thanks!

g.


From ajmackey at gmail.com  Fri Sep  5 16:54:56 2008
From: ajmackey at gmail.com (Aaron Mackey)
Date: Fri, 5 Sep 2008 16:54:56 -0400
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better (w/ patch)
In-Reply-To: <m263pabenk.fsf@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
Message-ID: <24c96eca0809051354h5b7218edtaa720140901d023f@mail.gmail.com>

There are two uses for Collection:

1) all the "in" seq_id's are the same, and George's patch makes sense to me
(i.e. agrees with my intuition)

2) all the "in" seq_id's are *not* the same (i.e. the collection is just a
hash of indivual pairs), in which case my query would only match the subset
of pairs having identical seq_id's to that specified by the query ... and
then you're back to case #1

So overall, it looks like this was a bug, but I'd of course want to hear
Heikki's opinion.

Thanks for raising this,

-Aaron

On Fri, Sep 5, 2008 at 3:01 PM, George Hartzell <hartzell at alerce.com> wrote:

>
> Hi all,
>
> Bio::Coordinate::Collection surprised me a bit.  At first I thought
> there was a bug, but it's clearly doing what it's supposed to.  Now
> I'm wondering if what it's supposed to be doing makes sense in some
> context, or if what I expected would be better functionality.
>
> t/CoordinateMapper.t sets up the following scenario:
>
> #
> # Collection
> #
> #         1   5     6   10
> #         |---|     |---|
> #-----|-----------------------
> #     1   5   9     15  19
> #         pair1     pair2
>
> Then goes on to do the following query:
>
>  # match more than two
>  $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
>  ok $res = $transcribe->map($pos);
>  is $res->each_gap, 2;
>  is $res->each_match, 2;
>
> I was surprised to see that there were two gaps, one gene:10-19 and
> one from gene:5-14.  Looking at the code, what's really happening is
> that, for the exon1 mapper there's match with gene:5-9 and a gap with
> gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
> match with gene:15-19.  All four Result's just get tossed into the
> return value.
>
> The result my intuition wants is that there are two matches (gene:5-9
> with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
>
> Yes, I guess that I could just synthesize these myself from the result
> in my app.
>
> It still seems that the current result is a bug though, since there's
> no way of knowing when you're walking through $res->each_Location that
> the first "gap" is with respect to the exon1 mapper and that the
> second "gap" is with respect to the exon2 mapper.  The gaps are
> meaningless.
>
> I "fixed" it to work the way I think it should (two matches, one
> gap).  I actually extended the test case a bit so that there's a
> multi-base gap, a match, another multibase-gap, another match, then a
> single base gap (just to make sure I got that right...).  I had to
> touch up the test file a bit to account for my new test.
>
> The gaps that I return have a strand of 'undef', which seems to be The
> Right Thing.  There's also a bit of funny business where I hang onto
> the seq_id of the gapped sequence.  It assumes that the "in" sequence
> is the same for all of the mappers.  This seems safe since otherwise
> the entire query is kind of weird....
>
> There's a patch to todays svn head at:
>
>  http://shrimp.alerce.com/bioperl/collection-diffs.txt
>
> The patch changes Build.PL to include a dependency on Set::IntSpan,
> CoordinateMapper.t to update the tests, and
> Bio/CoordinateMapper/Collection.pm for the new code.
>
> Who's code would this break.
>
> If anyone's relying on the current behaviour re: gaps, what's the
> situation in which you find it useful?
>
> Thanks!
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From jimhu at tamu.edu  Mon Sep  8 14:44:22 2008
From: jimhu at tamu.edu (Jim Hu)
Date: Mon, 8 Sep 2008 13:44:22 -0500
Subject: [Bioperl-l] Circular genomes in Chado/BioPerl
Message-ID: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>

In discussions with GMOD about Gbrowse, we've come up with a proposal  
for handling circular genomes and features that cross the origin in  
such genomes.  This applies to lots of prokaryotic and viral genomes,  
and might be valuable for some ways of representing terminally  
redundant linear genomes.

1) Keep the requirement that start < end
2) allow end > parent feature length
3) parent feature gets an is_circular boolean
4) use modular arithmetic to calculate the real position of end on the  
parent feature.

We'd like to do this in a way that will be consistent with Chado and  
BioPerl representation of features as much as possible (realizing that  
there is the usual interbase or not coordinate issue).  What do people  
think?  Lincoln is on board for modifying the GFF3 spec.

Thanks!

Jim Hu

=====================================
Jim Hu
Associate Professor
Dept. of Biochemistry and Biophysics
2128 TAMU
Texas A&M Univ.
College Station, TX 77843-2128
979-862-4054




From ajmackey at gmail.com  Mon Sep  8 15:57:50 2008
From: ajmackey at gmail.com (Aaron Mackey)
Date: Mon, 8 Sep 2008 15:57:50 -0400
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
Message-ID: <24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>

How can you handle features that may cross the origin more than once?
The modulus, though simple, seems to be only half the solution.  It
also makes it difficult to place features in the genome "by eye"
(having to do the modulus subtraction in my head), or in
sorting/filtering operations.

I have an alternative that I wondered if you considered: allow the
start/end to have an additional "circular revolution" prefix:

a typical range tuple like: 100 200 -
is thus shorthand for: 0:100 0:200 -
(i.e. both the 100 and 200 are in the same "revolution" around the genome)

and is then distinguishable from an "around the genome + 100" feature of:
1:100 0:200 -

Just an alternative to consider (if you haven't already).  I'm not
wedded to the syntax, but I wouldn't want to see new columns in GFF
just for this.  Essentially, what you want is some form of compound
polar coordinates, it seems.

-Aaron

On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
> In discussions with GMOD about Gbrowse, we've come up with a proposal for
> handling circular genomes and features that cross the origin in such
> genomes.  This applies to lots of prokaryotic and viral genomes, and might
> be valuable for some ways of representing terminally redundant linear
> genomes.
> 1) Keep the requirement that start < end
> 2) allow end > parent feature length
> 3) parent feature gets an is_circular boolean
> 4) use modular arithmetic to calculate the real position of end on the
> parent feature.
> We'd like to do this in a way that will be consistent with Chado and BioPerl
> representation of features as much as possible (realizing that there is the
> usual interbase or not coordinate issue).  What do people think?  Lincoln is
> on board for modifying the GFF3 spec.
> Thanks!
> Jim Hu
>
> =====================================
>
> Jim Hu
>
> Associate Professor
>
> Dept. of Biochemistry and Biophysics
>
> 2128 TAMU
>
> Texas A&M Univ.
>
> College Station, TX 77843-2128
>
> 979-862-4054
>
>
> -------------------------------------------------------------------------
> This SF.Net email is sponsored by the Moblin Your Move Developer's challenge
> Build the coolest Linux based applications with Moblin SDK & win great
> prizes
> Grand prize is a trip for two to an Open Source event anywhere in the world
> http://moblin-contest.org/redirect.php?banner_id=100&url=/
> _______________________________________________
> Gmod-schema mailing list
> Gmod-schema at lists.sourceforge.net
> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>
>


From js5 at sanger.ac.uk  Mon Sep  8 16:13:12 2008
From: js5 at sanger.ac.uk (James Smith)
Date: Mon, 8 Sep 2008 21:13:12 +0100 (BST)
Subject: [Bioperl-l] Circular genomes in Chado/BioPerl
In-Reply-To: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
Message-ID: <Pine.LNX.4.64.0809082111280.23303@cbi4g.internal.sanger.ac.uk>



On Mon, 8 Sep 2008, Jim Hu wrote:

> In discussions with GMOD about Gbrowse, we've come up with a proposal for 
> handling circular genomes and features that cross the origin in such genomes. 
> This applies to lots of prokaryotic and viral genomes, and might be valuable 
> for some ways of representing terminally redundant linear genomes.
>
> 1) Keep the requirement that start < end
> 2) allow end > parent feature length
> 3) parent feature gets an is_circular boolean
> 4) use modular arithmetic to calculate the real position of end on the parent 
> feature.

This is how we are considering handling features in Ensembl as well (the 
Ensembl genomes project will be setting up websites for bacterial and 
viral genomes)


>
> We'd like to do this in a way that will be consistent with Chado and BioPerl 
> representation of features as much as possible (realizing that there is the 
> usual interbase or not coordinate issue).  What do people think?  Lincoln is 
> on board for modifying the GFF3 spec.
>
> Thanks!
>
> Jim Hu
>
> =====================================
> Jim Hu
> Associate Professor
> Dept. of Biochemistry and Biophysics
> 2128 TAMU
> Texas A&M Univ.
> College Station, TX 77843-2128
> 979-862-4054
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 


From heikki at sanbi.ac.za  Tue Sep  9 03:50:11 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Tue, 9 Sep 2008 09:50:11 +0200
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better (w/ patch)
In-Reply-To: <m263pabenk.fsf@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
Message-ID: <200809090950.11821.heikki@sanbi.ac.za>

George,

This is an error from my side. Great that you have a fix already.

My only worry is the number of external dependencies in BioPerl. To limit 
these we have recoded number of functionalities into BioPerl-specific modules. 
Before you commit the fix, could you see if Bio::RangeI could be used or easily 
extended to be used instead of Set::IntSpan?

Thanks,

   -Heikki

On Friday 05 September 2008 21:01:35 George Hartzell wrote:
> Hi all,
>
> Bio::Coordinate::Collection surprised me a bit.  At first I thought
> there was a bug, but it's clearly doing what it's supposed to.  Now
> I'm wondering if what it's supposed to be doing makes sense in some
> context, or if what I expected would be better functionality.
>
> t/CoordinateMapper.t sets up the following scenario:
>
> #
> # Collection
> #
> #         1   5     6   10
> #         |---|     |---|
> #-----|-----------------------
> #     1   5   9     15  19
> #         pair1     pair2
>
> Then goes on to do the following query:
>
>   # match more than two
>   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
>   ok $res = $transcribe->map($pos);
>   is $res->each_gap, 2;
>   is $res->each_match, 2;
>
> I was surprised to see that there were two gaps, one gene:10-19 and
> one from gene:5-14.  Looking at the code, what's really happening is
> that, for the exon1 mapper there's match with gene:5-9 and a gap with
> gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
> match with gene:15-19.  All four Result's just get tossed into the
> return value.
>
> The result my intuition wants is that there are two matches (gene:5-9
> with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
>
> Yes, I guess that I could just synthesize these myself from the result
> in my app.
>
> It still seems that the current result is a bug though, since there's
> no way of knowing when you're walking through $res->each_Location that
> the first "gap" is with respect to the exon1 mapper and that the
> second "gap" is with respect to the exon2 mapper.  The gaps are
> meaningless.
>
> I "fixed" it to work the way I think it should (two matches, one
> gap).  I actually extended the test case a bit so that there's a
> multi-base gap, a match, another multibase-gap, another match, then a
> single base gap (just to make sure I got that right...).  I had to
> touch up the test file a bit to account for my new test.
>
> The gaps that I return have a strand of 'undef', which seems to be The
> Right Thing.  There's also a bit of funny business where I hang onto
> the seq_id of the gapped sequence.  It assumes that the "in" sequence
> is the same for all of the mappers.  This seems safe since otherwise
> the entire query is kind of weird....
>
> There's a patch to todays svn head at:
>
>   http://shrimp.alerce.com/bioperl/collection-diffs.txt
>
> The patch changes Build.PL to include a dependency on Set::IntSpan,
> CoordinateMapper.t to update the tests, and
> Bio/CoordinateMapper/Collection.pm for the new code.
>
> Who's code would this break.
>
> If anyone's relying on the current behaviour re: gaps, what's the
> situation in which you find it useful?
>
> Thanks!
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From heikki at sanbi.ac.za  Tue Sep  9 03:50:11 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Tue, 9 Sep 2008 09:50:11 +0200
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better (w/ patch)
In-Reply-To: <m263pabenk.fsf@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
Message-ID: <200809090950.11821.heikki@sanbi.ac.za>

George,

This is an error from my side. Great that you have a fix already.

My only worry is the number of external dependencies in BioPerl. To limit 
these we have recoded number of functionalities into BioPerl-specific modules. 
Before you commit the fix, could you see if Bio::RangeI could be used or easily 
extended to be used instead of Set::IntSpan?

Thanks,

   -Heikki

On Friday 05 September 2008 21:01:35 George Hartzell wrote:
> Hi all,
>
> Bio::Coordinate::Collection surprised me a bit.  At first I thought
> there was a bug, but it's clearly doing what it's supposed to.  Now
> I'm wondering if what it's supposed to be doing makes sense in some
> context, or if what I expected would be better functionality.
>
> t/CoordinateMapper.t sets up the following scenario:
>
> #
> # Collection
> #
> #         1   5     6   10
> #         |---|     |---|
> #-----|-----------------------
> #     1   5   9     15  19
> #         pair1     pair2
>
> Then goes on to do the following query:
>
>   # match more than two
>   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
>   ok $res = $transcribe->map($pos);
>   is $res->each_gap, 2;
>   is $res->each_match, 2;
>
> I was surprised to see that there were two gaps, one gene:10-19 and
> one from gene:5-14.  Looking at the code, what's really happening is
> that, for the exon1 mapper there's match with gene:5-9 and a gap with
> gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
> match with gene:15-19.  All four Result's just get tossed into the
> return value.
>
> The result my intuition wants is that there are two matches (gene:5-9
> with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
>
> Yes, I guess that I could just synthesize these myself from the result
> in my app.
>
> It still seems that the current result is a bug though, since there's
> no way of knowing when you're walking through $res->each_Location that
> the first "gap" is with respect to the exon1 mapper and that the
> second "gap" is with respect to the exon2 mapper.  The gaps are
> meaningless.
>
> I "fixed" it to work the way I think it should (two matches, one
> gap).  I actually extended the test case a bit so that there's a
> multi-base gap, a match, another multibase-gap, another match, then a
> single base gap (just to make sure I got that right...).  I had to
> touch up the test file a bit to account for my new test.
>
> The gaps that I return have a strand of 'undef', which seems to be The
> Right Thing.  There's also a bit of funny business where I hang onto
> the seq_id of the gapped sequence.  It assumes that the "in" sequence
> is the same for all of the mappers.  This seems safe since otherwise
> the entire query is kind of weird....
>
> There's a patch to todays svn head at:
>
>   http://shrimp.alerce.com/bioperl/collection-diffs.txt
>
> The patch changes Build.PL to include a dependency on Set::IntSpan,
> CoordinateMapper.t to update the tests, and
> Bio/CoordinateMapper/Collection.pm for the new code.
>
> Who's code would this break.
>
> If anyone's relying on the current behaviour re: gaps, what's the
> situation in which you find it useful?
>
> Thanks!
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From Frigerio at pierroton.inra.fr  Tue Sep  9 04:45:19 2008
From: Frigerio at pierroton.inra.fr (Jean-Marc FRIGERIO)
Date: Tue, 9 Sep 2008 10:45:19 +0200
Subject: [Bioperl-l] parsing result of CAP3 (ACE file)
Message-ID: <200809091045.19249.Frigerio@pierroton.inra.fr>

> > -- Hi,
> >
> > Is somebody have a piece of code to parse result of CAP3 assembly program
> > which
> > format is ACE ?
> > I need to retrieve the alignment from this file.
> >
> > thank you,
> > Laurent --
> >
> >
> >
> >
> > +---------------------------------------------+
> >  Laurent Manchon
> >  Email: lmanchon at univ-montp2.fr
> > +---------------------------------------------+
>
> Laurent -
>
> I have modified modules that will do it as I recently ran into problems
> with the DB_FILE module in Assembly::IO.  In addition, the current version
> of cap3 seems to put a contig length where a pad length is expected (based
> on the Ace format description).  The modules I have will parse the ace file
> contig-by-contig rather than having the entire assembly slurped into memory
> (or a tied hash) all at once.  You are welcome to them if you are
> interested and I'd like to get them in Bioperl at some point.  Bascially,
> there are three files - a modified Contig.pm, ContigIO.pm, and a modified
> ace.pm (in a ContigIO directory).
>
> Josh

Hi,
Here are a 2 pieces of code running on an ace file (output of phrap is that 
the same as cap3 ?)
----------------------------- 1 -----------------------------------------
my $assembly = Bio::Assembly::IO->new('-file'    => $file,
                                 '-format'  => 'ace')->next_assembly;

for my $contig ($assembly->all_contigs)
{
    my $ct_seq  = $contig->get_consensus_sequence;
    (my $ref_seq = uc $ct_seq->seq) =~ s/-//g;

    my $debut  = $pos - 100 > 0 ? $pos - 100 : 1;
    my $fin    = $pos + 100 <= length $ref_seq ?
                 $pos + 100 :  length $ref_seq;

    my $coll = $contig->get_features_collection;
    my @coll = $coll->features_in_range('-start' => $debut, '-end' => $fin);
    for my $tag (@coll)
    {
        next unless  $tag->primary_tag eq 'comment';
#print "TAG: ",$tag->start,"\n";
        my $tag_pos = $contig->change_coord('gapped consensus','ungapped 
consensus',$tag->start);
#print "TAG POS: $tag_pos\n";
        next if $pos == $tag_pos;

        substr($ref_seq,$tag_pos-1,1,'N');

    }
}



------------------------------------ 2 -------------------
 my $assembly = Bio::Assembly::IO->new(
    '-file'    => $file,
    '-format'  => 'ace')->next_assembly;
  for my $contig ($assembly->all_contigs)
  {
    for my $seq ($contig->each_seq)
    {
      my $id = $seq->id;
      my $s = $seq->seq;
      my ($start,$end) =
        ($contig->change_coord("aligned $id","ungapped consensus",
$seq->start),
         $contig->change_coord("aligned $id","ungapped consensus",$seq->end));
      my $dir = $seq->strand < 0 ? 'R' : 'F';
 ......
}
	-- Jean-Marc


From zheboyang at gmail.com  Tue Sep  9 07:05:15 2008
From: zheboyang at gmail.com (boyang zhe)
Date: Tue, 9 Sep 2008 19:05:15 +0800
Subject: [Bioperl-l] help:HMM parsing error
Message-ID: <127e75f60809090405h644e51eftcab073e8bf179720@mail.gmail.com>

  I write a script to parse the HMMER report ,it is as follows:
   #!/usr/bin/perl -w
   #TODO: Parse the HMMER report
   use strict;
   use Bio::SearchIO;
   my $directory="./HMM/";
   opendir(HMMDIR, $directory), or die "Can't open the directory!";
   my @filelist=readdir(HMMDIR);
   foreach my $filename(@filelist)
   {
   if ($filename !~/^\./)
   {
   my $infile="$directory"."$filename";
   my $outfile="$infile"."HMMParse";
   my $in = new Bio::SearchIO(-format => 'hmmer',-file =>"$infile");

- Ignored:
   while (my  $result= $in->next_result )
   {
   # get a Bio::Search::Result::HMMERResult object
   # get hits numbers
   my $hitnumber=$result->num_hits;
   if ($hitnumber != 0)
   {
   open(OUT, ">$outfile"), or die "can't open the output file!!!!";
   while (my $hits= $result->next_hit )
   {
   my $value=$hits->significance;
   if ($value <=0.01)
   {
         print OUT
   $hits->name,"\t",$hits->description,"\t",$hits->significance,"\n";
   }
   }
   close OUT;
   }
   }
   }
   }
   closedir(HMMDIR);
   ##############################################################

   When it run, you will see that:

   -------------------- WARNING ---------------------
   MSG: unrecognized line:                      +E +L i T eek+ e+  ++ +l++H
   Y+   I+ +

   ---------------------------------------------------

   why? I hope to get your help, hanks very much!

- Done.


From bix at sendu.me.uk  Tue Sep  9 07:46:39 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 09 Sep 2008 12:46:39 +0100
Subject: [Bioperl-l] help:HMM parsing error
In-Reply-To: <127e75f60809090405h644e51eftcab073e8bf179720@mail.gmail.com>
References: <127e75f60809090405h644e51eftcab073e8bf179720@mail.gmail.com>
Message-ID: <48C6621F.8040304@sendu.me.uk>

boyang zhe wrote:
>   I write a script to parse the HMMER report ,it is as follows:
[...]
>    my $in = new Bio::SearchIO(-format => 'hmmer',-file =>"$infile");
[...]
>    -------------------- WARNING ---------------------
>    MSG: unrecognized line:                      +E +L i T eek+ e+  ++ +l++H
>    Y+   I+ +
> 
>    ---------------------------------------------------
> 
>    why? I hope to get your help, hanks very much!

I didn't check your code, but the easiest thing to try would be to use 
-format => 'hmmer_pull' to use an alternate parser that may be able to 
recognise that line. You might need to install the latest Bioperl from 
SVN (or at least 1.5.2) to get access to the hmmer_pull parser.


From bosborne11 at verizon.net  Tue Sep  9 10:50:38 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Tue, 9 Sep 2008 10:50:38 -0400
Subject: [Bioperl-l] SeqHound
In-Reply-To: <1220452426.31595.92.camel@pepa.cbm.uam.es>
References: <1220452426.31595.92.camel@pepa.cbm.uam.es>
Message-ID: <55655D67-352A-4E0D-B402-7FC30628C1B1@verizon.net>

Raul,

After spending a few minutes at bond.unleashedinformatics.com I have  
to admit that it's not clear how one accesses their free version of  
BOND. There are no examples that I can see in their packages.

If you are interested in looking at protein-protein networks in the  
Bioperl context you can also check out the bioperl-network package:

http://www.bioperl.org/wiki/Network_package

If you don't care what language you're using then you should consider  
Cytoscape, it's probably the package with the most capability.


Brian O.


On Sep 3, 2008, at 10:33 AM, Raul Mendez Giraldez wrote:

> Hi Chris,
>
> I'm trying to set up and run bioperl Seqhound donwloaded from:
>
> http://bond.unleashedinformatics.com/downloads/api//seqhound-bioperl-4.0.tar.gz
>
> and I always get connection error messages. Do you know which  
> version of
> SeqHound should I use and how can I configure to make it work? I've
> tried several possibilities for server1 at .shoundremrc as
>
> [remote]
> server1 = bond.unleashedinformatics.com
> CGI = /cgi-bin/seqrem
> port=8080
>
> Also, I would like to get all the possible protein-protein interaction
> for a set of protein sequences. Would this be possible using SeqHound?
>
> Thanks,
> Ra?l
>
>
>
>
> -- 
> Ra?l M?ndez Gir?ldez, Ph.D.
> Bioinformatics Unit
> Centre for Molecular Biology "Severo Ochoa"
> Universidad Aut?noma de Madrid
> C/ Nicol?s Cabrera, 1
> Cantoblanco 28049, Madrid
> SPAIN
>
> Phone: +34 91 196 4633
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




From jimhu at tamu.edu  Tue Sep  9 12:05:59 2008
From: jimhu at tamu.edu (Jim Hu)
Date: Tue, 9 Sep 2008 11:05:59 -0500
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
Message-ID: <AFDAB313-524D-441B-8723-027484D15142@tamu.edu>

Hi Aaron,

I was thinking this would be handled by making the end=parent feature  
length x 2 + end coord.  end/parent length = number of times crosses  
origin.

Jim

On Sep 8, 2008, at 2:57 PM, Aaron Mackey wrote:

> How can you handle features that may cross the origin more than once?
> The modulus, though simple, seems to be only half the solution.  It
> also makes it difficult to place features in the genome "by eye"
> (having to do the modulus subtraction in my head), or in
> sorting/filtering operations.
>
> I have an alternative that I wondered if you considered: allow the
> start/end to have an additional "circular revolution" prefix:
>
> a typical range tuple like: 100 200 -
> is thus shorthand for: 0:100 0:200 -
> (i.e. both the 100 and 200 are in the same "revolution" around the  
> genome)
>
> and is then distinguishable from an "around the genome + 100"  
> feature of:
> 1:100 0:200 -
>
> Just an alternative to consider (if you haven't already).  I'm not
> wedded to the syntax, but I wouldn't want to see new columns in GFF
> just for this.  Essentially, what you want is some form of compound
> polar coordinates, it seems.
>
> -Aaron
>
> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>> In discussions with GMOD about Gbrowse, we've come up with a  
>> proposal for
>> handling circular genomes and features that cross the origin in such
>> genomes.  This applies to lots of prokaryotic and viral genomes,  
>> and might
>> be valuable for some ways of representing terminally redundant linear
>> genomes.
>> 1) Keep the requirement that start < end
>> 2) allow end > parent feature length
>> 3) parent feature gets an is_circular boolean
>> 4) use modular arithmetic to calculate the real position of end on  
>> the
>> parent feature.
>> We'd like to do this in a way that will be consistent with Chado  
>> and BioPerl
>> representation of features as much as possible (realizing that  
>> there is the
>> usual interbase or not coordinate issue).  What do people think?   
>> Lincoln is
>> on board for modifying the GFF3 spec.
>> Thanks!
>> Jim Hu
>>
>> =====================================
>>
>> Jim Hu
>>
>> Associate Professor
>>
>> Dept. of Biochemistry and Biophysics
>>
>> 2128 TAMU
>>
>> Texas A&M Univ.
>>
>> College Station, TX 77843-2128
>>
>> 979-862-4054
>>
>>
>> -------------------------------------------------------------------------
>> This SF.Net email is sponsored by the Moblin Your Move Developer's  
>> challenge
>> Build the coolest Linux based applications with Moblin SDK & win  
>> great
>> prizes
>> Grand prize is a trip for two to an Open Source event anywhere in  
>> the world
>> http://moblin-contest.org/redirect.php?banner_id=100&url=/
>> _______________________________________________
>> Gmod-schema mailing list
>> Gmod-schema at lists.sourceforge.net
>> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>>
>>

=====================================
Jim Hu
Associate Professor
Dept. of Biochemistry and Biophysics
2128 TAMU
Texas A&M Univ.
College Station, TX 77843-2128
979-862-4054




From jason at bioperl.org  Tue Sep  9 12:07:45 2008
From: jason at bioperl.org (Jason Stajich)
Date: Tue, 9 Sep 2008 09:07:45 -0700
Subject: [Bioperl-l] help:HMM parsing error
In-Reply-To: <48C6621F.8040304@sendu.me.uk>
References: <127e75f60809090405h644e51eftcab073e8bf179720@mail.gmail.com>
	<48C6621F.8040304@sendu.me.uk>
Message-ID: <DE35F9B2-20FE-4554-9F53-6F838849B0C6@bioperl.org>

Although it would be good to fix the parser as well --  best solution  
is to submit that report as a bug to bugzilla
http://bugzilla.open-bio.org/

-jason

On Sep 9, 2008, at 4:46 AM, Sendu Bala wrote:

> boyang zhe wrote:
>>  I write a script to parse the HMMER report ,it is as follows:
> [...]
>>   my $in = new Bio::SearchIO(-format => 'hmmer',-file =>"$infile");
> [...]
>>   -------------------- WARNING ---------------------
>>   MSG: unrecognized line:                      +E +L i T eek+ e+  + 
>> + +l++H
>>   Y+   I+ +
>>   ---------------------------------------------------
>>   why? I hope to get your help, hanks very much!
>
> I didn't check your code, but the easiest thing to try would be to  
> use -format => 'hmmer_pull' to use an alternate parser that may be  
> able to recognise that line. You might need to install the latest  
> Bioperl from SVN (or at least 1.5.2) to get access to the hmmer_pull  
> parser.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From cain.cshl at gmail.com  Tue Sep  9 13:33:12 2008
From: cain.cshl at gmail.com (Scott Cain)
Date: Tue, 9 Sep 2008 13:33:12 -0400
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
Message-ID: <536f21b00809091033v1e412f4ft54d8e139c347a20a@mail.gmail.com>

Hi Jim and All,

While I agree with Aaron's point that it is not easy to place features
by visual inspection, this seems like a fairly minor point.  The vast
majority of GFF3 manipulation will be done in software, so as long as
the API handles everything correctly, life is good.  If we discount
that objection, there doesn't seem to be much advantage of using
Aaron's suggested method over Jim's.

(As a side note--I have the same complaint about anything in XML--it
is awful for a human to read.  I still live with XML when I have to
though :-)

Additionally, the fact that Ensembl is using the same method as what
Jim describes is a fairly powerful argument for doing the same.
Hopefully there can be some code reuse.

Scott


On Tue, Sep 9, 2008 at 12:05 PM, Jim Hu <jimhu at tamu.edu> wrote:
> Hi Aaron,
> I was thinking this would be handled by making the end=parent feature length
> x 2 + end coord.  end/parent length = number of times crosses origin.
> Jim
> On Sep 8, 2008, at 2:57 PM, Aaron Mackey wrote:
>
> How can you handle features that may cross the origin more than once?
> The modulus, though simple, seems to be only half the solution.  It
> also makes it difficult to place features in the genome "by eye"
> (having to do the modulus subtraction in my head), or in
> sorting/filtering operations.
>
> I have an alternative that I wondered if you considered: allow the
> start/end to have an additional "circular revolution" prefix:
>
> a typical range tuple like: 100 200 -
> is thus shorthand for: 0:100 0:200 -
> (i.e. both the 100 and 200 are in the same "revolution" around the genome)
>
> and is then distinguishable from an "around the genome + 100" feature of:
> 1:100 0:200 -
>
> Just an alternative to consider (if you haven't already).  I'm not
> wedded to the syntax, but I wouldn't want to see new columns in GFF
> just for this.  Essentially, what you want is some form of compound
> polar coordinates, it seems.
>
> -Aaron
>
> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>
> In discussions with GMOD about Gbrowse, we've come up with a proposal for
>
> handling circular genomes and features that cross the origin in such
>
> genomes.  This applies to lots of prokaryotic and viral genomes, and might
>
> be valuable for some ways of representing terminally redundant linear
>
> genomes.
>
> 1) Keep the requirement that start < end
>
> 2) allow end > parent feature length
>
> 3) parent feature gets an is_circular boolean
>
> 4) use modular arithmetic to calculate the real position of end on the
>
> parent feature.
>
> We'd like to do this in a way that will be consistent with Chado and BioPerl
>
> representation of features as much as possible (realizing that there is the
>
> usual interbase or not coordinate issue).  What do people think?  Lincoln is
>
> on board for modifying the GFF3 spec.
>
> Thanks!
>
> Jim Hu
>
> =====================================
>
> Jim Hu
>
> Associate Professor
>
> Dept. of Biochemistry and Biophysics
>
> 2128 TAMU
>
> Texas A&M Univ.
>
> College Station, TX 77843-2128
>
> 979-862-4054
>
>
> -------------------------------------------------------------------------
>
> This SF.Net email is sponsored by the Moblin Your Move Developer's challenge
>
> Build the coolest Linux based applications with Moblin SDK & win great
>
> prizes
>
> Grand prize is a trip for two to an Open Source event anywhere in the world
>
> http://moblin-contest.org/redirect.php?banner_id=100&url=/
>
> _______________________________________________
>
> Gmod-schema mailing list
>
> Gmod-schema at lists.sourceforge.net
>
> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>
>
>
> =====================================
>
> Jim Hu
>
> Associate Professor
>
> Dept. of Biochemistry and Biophysics
>
> 2128 TAMU
>
> Texas A&M Univ.
>
> College Station, TX 77843-2128
>
> 979-862-4054
>
>
> -------------------------------------------------------------------------
> This SF.Net email is sponsored by the Moblin Your Move Developer's challenge
> Build the coolest Linux based applications with Moblin SDK & win great
> prizes
> Grand prize is a trip for two to an Open Source event anywhere in the world
> http://moblin-contest.org/redirect.php?banner_id=100&url=/
> _______________________________________________
> Gmod-schema mailing list
> Gmod-schema at lists.sourceforge.net
> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>
>



-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   cain.cshl at gmail.com
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory


From lincoln.stein at gmail.com  Tue Sep  9 13:52:36 2008
From: lincoln.stein at gmail.com (Lincoln Stein)
Date: Tue, 9 Sep 2008 13:52:36 -0400
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
Message-ID: <6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>

It seems to me that the proposed modulus syntax handles multiple
revolutions. Consider a 100 bp genome (to make it simple) and a feature that
starts at 50, goes around twice, and ends at position 60:

  start = 50
  end  = 260

length = end - start + 1
revolutions = int (length/genome)
stop position = length % genome + 1

Lincoln

On Mon, Sep 8, 2008 at 3:57 PM, Aaron Mackey <ajmackey at gmail.com> wrote:

> How can you handle features that may cross the origin more than once?
> The modulus, though simple, seems to be only half the solution.  It
> also makes it difficult to place features in the genome "by eye"
> (having to do the modulus subtraction in my head), or in
> sorting/filtering operations.
>
> I have an alternative that I wondered if you considered: allow the
> start/end to have an additional "circular revolution" prefix:
>
> a typical range tuple like: 100 200 -
> is thus shorthand for: 0:100 0:200 -
> (i.e. both the 100 and 200 are in the same "revolution" around the genome)
>
> and is then distinguishable from an "around the genome + 100" feature of:
> 1:100 0:200 -
>
> Just an alternative to consider (if you haven't already).  I'm not
> wedded to the syntax, but I wouldn't want to see new columns in GFF
> just for this.  Essentially, what you want is some form of compound
> polar coordinates, it seems.
>
> -Aaron
>
> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
> > In discussions with GMOD about Gbrowse, we've come up with a proposal for
> > handling circular genomes and features that cross the origin in such
> > genomes.  This applies to lots of prokaryotic and viral genomes, and
> might
> > be valuable for some ways of representing terminally redundant linear
> > genomes.
> > 1) Keep the requirement that start < end
> > 2) allow end > parent feature length
> > 3) parent feature gets an is_circular boolean
> > 4) use modular arithmetic to calculate the real position of end on the
> > parent feature.
> > We'd like to do this in a way that will be consistent with Chado and
> BioPerl
> > representation of features as much as possible (realizing that there is
> the
> > usual interbase or not coordinate issue).  What do people think?  Lincoln
> is
> > on board for modifying the GFF3 spec.
> > Thanks!
> > Jim Hu
> >
> > =====================================
> >
> > Jim Hu
> >
> > Associate Professor
> >
> > Dept. of Biochemistry and Biophysics
> >
> > 2128 TAMU
> >
> > Texas A&M Univ.
> >
> > College Station, TX 77843-2128
> >
> > 979-862-4054
> >
> >
> > -------------------------------------------------------------------------
> > This SF.Net email is sponsored by the Moblin Your Move Developer's
> challenge
> > Build the coolest Linux based applications with Moblin SDK & win great
> > prizes
> > Grand prize is a trip for two to an Open Source event anywhere in the
> world
> > http://moblin-contest.org/redirect.php?banner_id=100&url=/
> > _______________________________________________
> > Gmod-schema mailing list
> > Gmod-schema at lists.sourceforge.net
> > https://lists.sourceforge.net/lists/listinfo/gmod-schema
> >
> >
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Lincoln D. Stein

Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Stacey Quinn <Stacey.Quinn at oicr.on.ca>

Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724 USA
(516) 367-8380
Assistant: Sandra Michelsen <michelse at cshl.edu>


From cjfields at illinois.edu  Tue Sep  9 14:24:49 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 9 Sep 2008 13:24:49 -0500
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
Message-ID: <ACC71DEA-378C-4FB3-8C09-A85EC0858924@illinois.edu>

Is there any particular reason we don't treat this similarly to the  
way BioPerl does, which is to simply treat the origin-overlapping  
feature as a split location?  GenBank treats this similarly.  For an  
faux example, the bug I just fixed for bugzilla has one:

http://bugzilla.open-bio.org/show_bug.cgi?id=2579

An actual GenBank case is the Sulfolobus solfataricus genome  
(NC_002754), and I'm sure Jim could come up with more.  The only  
caveat is whether we should represent this

As for multiple revolutions, I'm not sure the hand-wringing about  
specifics is worth it unless we have explicit workable examples to  
test against (preferably examples which would potentially pop up), but  
Lincoln's proposal sounds fine.

chris

On Sep 9, 2008, at 11:05 AM, Jim Hu wrote:

> Hi Aaron,
>
> I was thinking this would be handled by making the end=parent  
> feature length x 2 + end coord.  end/parent length = number of times  
> crosses origin.
>
> Jim
>
> On Sep 8, 2008, at 2:57 PM, Aaron Mackey wrote:
>
>> How can you handle features that may cross the origin more than once?
>> The modulus, though simple, seems to be only half the solution.  It
>> also makes it difficult to place features in the genome "by eye"
>> (having to do the modulus subtraction in my head), or in
>> sorting/filtering operations.
>>
>> I have an alternative that I wondered if you considered: allow the
>> start/end to have an additional "circular revolution" prefix:
>>
>> a typical range tuple like: 100 200 -
>> is thus shorthand for: 0:100 0:200 -
>> (i.e. both the 100 and 200 are in the same "revolution" around the  
>> genome)
>>
>> and is then distinguishable from an "around the genome + 100"  
>> feature of:
>> 1:100 0:200 -
>>
>> Just an alternative to consider (if you haven't already).  I'm not
>> wedded to the syntax, but I wouldn't want to see new columns in GFF
>> just for this.  Essentially, what you want is some form of compound
>> polar coordinates, it seems.
>>
>> -Aaron
>>
>> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>>> In discussions with GMOD about Gbrowse, we've come up with a  
>>> proposal for
>>> handling circular genomes and features that cross the origin in such
>>> genomes.  This applies to lots of prokaryotic and viral genomes,  
>>> and might
>>> be valuable for some ways of representing terminally redundant  
>>> linear
>>> genomes.
>>> 1) Keep the requirement that start < end
>>> 2) allow end > parent feature length
>>> 3) parent feature gets an is_circular boolean
>>> 4) use modular arithmetic to calculate the real position of end on  
>>> the
>>> parent feature.
>>> We'd like to do this in a way that will be consistent with Chado  
>>> and BioPerl
>>> representation of features as much as possible (realizing that  
>>> there is the
>>> usual interbase or not coordinate issue).  What do people think?   
>>> Lincoln is
>>> on board for modifying the GFF3 spec.
>>> Thanks!
>>> Jim Hu
>>>
>>> =====================================
>>>
>>> Jim Hu
>>>
>>> Associate Professor
>>>
>>> Dept. of Biochemistry and Biophysics
>>>
>>> 2128 TAMU
>>>
>>> Texas A&M Univ.
>>>
>>> College Station, TX 77843-2128
>>>
>>> 979-862-4054
>>>
>>>
>>> -------------------------------------------------------------------------
>>> This SF.Net email is sponsored by the Moblin Your Move Developer's  
>>> challenge
>>> Build the coolest Linux based applications with Moblin SDK & win  
>>> great
>>> prizes
>>> Grand prize is a trip for two to an Open Source event anywhere in  
>>> the world
>>> http://moblin-contest.org/redirect.php?banner_id=100&url=/
>>> _______________________________________________
>>> Gmod-schema mailing list
>>> Gmod-schema at lists.sourceforge.net
>>> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>>>
>>>
>
> =====================================
> Jim Hu
> Associate Professor
> Dept. of Biochemistry and Biophysics
> 2128 TAMU
> Texas A&M Univ.
> College Station, TX 77843-2128
> 979-862-4054
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From ajmackey at gmail.com  Tue Sep  9 14:48:12 2008
From: ajmackey at gmail.com (Aaron Mackey)
Date: Tue, 9 Sep 2008 14:48:12 -0400
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
Message-ID: <24c96eca0809091148l738604a7q13fba54ac05de01c@mail.gmail.com>

Right, the modulus calculation continues to work, but for instance,
what'll happen when I now ask Gbrowse (or Ensembl) to show me
positions 50..260?  Will it show me 50 .. 60, 1:100, or "unroll" the
genome twice from 50..260 (that'd be a pretty cute trick, by the way!)

You're (re)using simple arithmetic to compress a compound coordinate
into a single-valued coordinate (which I realize can be trivially
packed and unpacked by software), but I worry about the downstream
consequences of software having to always remember that the
coordinates given may have to be unpacked or not, and not being able
to immediately identify whether "260" is a real or compound
coordinate.

To say it another way, I'm happy (that is, don't care much) whether
Chado or any other underlying data storage uses such compound
coordinates, because only Chado-reliant tools will need to care; but I
do worry about GFF3 as a (relatively) simple exchange format having
that kind of silent bug-causing complexity.  I'd much rather see GFF
be syntactically explicit, and not quite so cleverly implicit.

Just one GFF user's two cents, thanks for listening,

-Aaron

On Tue, Sep 9, 2008 at 1:52 PM, Lincoln Stein <lincoln.stein at gmail.com> wrote:
> It seems to me that the proposed modulus syntax handles multiple
> revolutions. Consider a 100 bp genome (to make it simple) and a feature that
> starts at 50, goes around twice, and ends at position 60:
>
>   start = 50
>   end  = 260
>
> length = end - start + 1
> revolutions = int (length/genome)
> stop position = length % genome + 1
>
> Lincoln
>
> On Mon, Sep 8, 2008 at 3:57 PM, Aaron Mackey <ajmackey at gmail.com> wrote:
>>
>> How can you handle features that may cross the origin more than once?
>> The modulus, though simple, seems to be only half the solution.  It
>> also makes it difficult to place features in the genome "by eye"
>> (having to do the modulus subtraction in my head), or in
>> sorting/filtering operations.
>>
>> I have an alternative that I wondered if you considered: allow the
>> start/end to have an additional "circular revolution" prefix:
>>
>> a typical range tuple like: 100 200 -
>> is thus shorthand for: 0:100 0:200 -
>> (i.e. both the 100 and 200 are in the same "revolution" around the genome)
>>
>> and is then distinguishable from an "around the genome + 100" feature of:
>> 1:100 0:200 -
>>
>> Just an alternative to consider (if you haven't already).  I'm not
>> wedded to the syntax, but I wouldn't want to see new columns in GFF
>> just for this.  Essentially, what you want is some form of compound
>> polar coordinates, it seems.
>>
>> -Aaron
>>
>> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>> > In discussions with GMOD about Gbrowse, we've come up with a proposal
>> > for
>> > handling circular genomes and features that cross the origin in such
>> > genomes.  This applies to lots of prokaryotic and viral genomes, and
>> > might
>> > be valuable for some ways of representing terminally redundant linear
>> > genomes.
>> > 1) Keep the requirement that start < end
>> > 2) allow end > parent feature length
>> > 3) parent feature gets an is_circular boolean
>> > 4) use modular arithmetic to calculate the real position of end on the
>> > parent feature.
>> > We'd like to do this in a way that will be consistent with Chado and
>> > BioPerl
>> > representation of features as much as possible (realizing that there is
>> > the
>> > usual interbase or not coordinate issue).  What do people think?
>> >  Lincoln is
>> > on board for modifying the GFF3 spec.
>> > Thanks!
>> > Jim Hu
>> >
>> > =====================================
>> >
>> > Jim Hu
>> >
>> > Associate Professor
>> >
>> > Dept. of Biochemistry and Biophysics
>> >
>> > 2128 TAMU
>> >
>> > Texas A&M Univ.
>> >
>> > College Station, TX 77843-2128
>> >
>> > 979-862-4054
>> >
>> >
>> >
>> > -------------------------------------------------------------------------
>> > This SF.Net email is sponsored by the Moblin Your Move Developer's
>> > challenge
>> > Build the coolest Linux based applications with Moblin SDK & win great
>> > prizes
>> > Grand prize is a trip for two to an Open Source event anywhere in the
>> > world
>> > http://moblin-contest.org/redirect.php?banner_id=100&url=/
>> > _______________________________________________
>> > Gmod-schema mailing list
>> > Gmod-schema at lists.sourceforge.net
>> > https://lists.sourceforge.net/lists/listinfo/gmod-schema
>> >
>> >
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> --
> Lincoln D. Stein
>
> Ontario Institute for Cancer Research
> 101 College St., Suite 800
> Toronto, ON, Canada M5G0A3
> 416 673-8514
> Assistant: Stacey Quinn <Stacey.Quinn at oicr.on.ca>
>
> Cold Spring Harbor Laboratory
> 1 Bungtown Road
> Cold Spring Harbor, NY 11724 USA
> (516) 367-8380
> Assistant: Sandra Michelsen <michelse at cshl.edu>
>


From cjfields at illinois.edu  Tue Sep  9 14:49:13 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 9 Sep 2008 13:49:13 -0500
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <ACC71DEA-378C-4FB3-8C09-A85EC0858924@illinois.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
	<ACC71DEA-378C-4FB3-8C09-A85EC0858924@illinois.edu>
Message-ID: <8C6E5EBC-25B1-41E3-BB89-FD3C228A6B70@illinois.edu>

Sent just a bit too early!

On Sep 9, 2008, at 1:24 PM, Chris Fields wrote:

> Is there any particular reason we don't treat this similarly to the  
> way BioPerl does, which is to simply treat the origin-overlapping  
> feature as a split location?  GenBank treats this similarly.  For an  
> faux example, the bug I just fixed for bugzilla has one:
>
> http://bugzilla.open-bio.org/show_bug.cgi?id=2579
>
> An actual GenBank case is the Sulfolobus solfataricus genome  
> (NC_002754), and I'm sure Jim could come up with more.  The only  
> caveat is whether we should represent this

... as a 'special case' for features overlapping the origin in a  
circular sequence.

> As for multiple revolutions, I'm not sure the hand-wringing about  
> specifics is worth it unless we have explicit workable examples to  
> test against (preferably examples which would potentially pop up),  
> but Lincoln's proposal sounds fine.
>
> chris




From Russell.Smithies at agresearch.co.nz  Tue Sep  9 16:46:26 2008
From: Russell.Smithies at agresearch.co.nz (Smithies, Russell)
Date: Wed, 10 Sep 2008 08:46:26 +1200
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu><24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
Message-ID: <D5DBA313349A4B458528BE63B387F36C077822B4@imail.agresearch.co.nz>

Excuse my ignorance (I'm not a biologist) but is it biologically possible/likely for a gene or feature to wrap more than once around a genome?
Anyone got an example?


Russell Smithies 

Bioinformatics Applications Developer 

Invermay? Research Centre 
Puddle Alley, 
Mosgiel, 
New Zealand 





> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-
> bio.org] On Behalf Of Lincoln Stein
> Sent: Wednesday, 10 September 2008 5:53 a.m.
> To: Aaron Mackey
> Cc: GMOD Schema List; Jim Hu; Roy Welch; bioperl-l at bioperl.org; Mike Gribskov
> Subject: Re: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
> 
> It seems to me that the proposed modulus syntax handles multiple
> revolutions. Consider a 100 bp genome (to make it simple) and a feature that
> starts at 50, goes around twice, and ends at position 60:
> 
>   start = 50
>   end  = 260
> 
> length = end - start + 1
> revolutions = int (length/genome)
> stop position = length % genome + 1
> 
> Lincoln
> 
> On Mon, Sep 8, 2008 at 3:57 PM, Aaron Mackey <ajmackey at gmail.com> wrote:
> 
> > How can you handle features that may cross the origin more than once?
> > The modulus, though simple, seems to be only half the solution.  It
> > also makes it difficult to place features in the genome "by eye"
> > (having to do the modulus subtraction in my head), or in
> > sorting/filtering operations.
> >
> > I have an alternative that I wondered if you considered: allow the
> > start/end to have an additional "circular revolution" prefix:
> >
> > a typical range tuple like: 100 200 -
> > is thus shorthand for: 0:100 0:200 -
> > (i.e. both the 100 and 200 are in the same "revolution" around the genome)
> >
> > and is then distinguishable from an "around the genome + 100" feature of:
> > 1:100 0:200 -
> >
> > Just an alternative to consider (if you haven't already).  I'm not
> > wedded to the syntax, but I wouldn't want to see new columns in GFF
> > just for this.  Essentially, what you want is some form of compound
> > polar coordinates, it seems.
> >
> > -Aaron
> >
> > On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
> > > In discussions with GMOD about Gbrowse, we've come up with a proposal for
> > > handling circular genomes and features that cross the origin in such
> > > genomes.  This applies to lots of prokaryotic and viral genomes, and
> > might
> > > be valuable for some ways of representing terminally redundant linear
> > > genomes.
> > > 1) Keep the requirement that start < end
> > > 2) allow end > parent feature length
> > > 3) parent feature gets an is_circular boolean
> > > 4) use modular arithmetic to calculate the real position of end on the
> > > parent feature.
> > > We'd like to do this in a way that will be consistent with Chado and
> > BioPerl
> > > representation of features as much as possible (realizing that there is
> > the
> > > usual interbase or not coordinate issue).  What do people think?  Lincoln
> > is
> > > on board for modifying the GFF3 spec.
> > > Thanks!
> > > Jim Hu
> > >
> > > =====================================
> > >
> > > Jim Hu
> > >
> > > Associate Professor
> > >
> > > Dept. of Biochemistry and Biophysics
> > >
> > > 2128 TAMU
> > >
> > > Texas A&M Univ.
> > >
> > > College Station, TX 77843-2128
> > >
> > > 979-862-4054
> > >
> > >
> > > -------------------------------------------------------------------------
> > > This SF.Net email is sponsored by the Moblin Your Move Developer's
> > challenge
> > > Build the coolest Linux based applications with Moblin SDK & win great
> > > prizes
> > > Grand prize is a trip for two to an Open Source event anywhere in the
> > world
> > > http://moblin-contest.org/redirect.php?banner_id=100&url=/
> > > _______________________________________________
> > > Gmod-schema mailing list
> > > Gmod-schema at lists.sourceforge.net
> > > https://lists.sourceforge.net/lists/listinfo/gmod-schema
> > >
> > >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> 
> 
> 
> --
> Lincoln D. Stein
> 
> Ontario Institute for Cancer Research
> 101 College St., Suite 800
> Toronto, ON, Canada M5G0A3
> 416 673-8514
> Assistant: Stacey Quinn <Stacey.Quinn at oicr.on.ca>
> 
> Cold Spring Harbor Laboratory
> 1 Bungtown Road
> Cold Spring Harbor, NY 11724 USA
> (516) 367-8380
> Assistant: Sandra Michelsen <michelse at cshl.edu>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
=======================================================================
Attention: The information contained in this message and/or attachments
from AgResearch Limited is intended only for the persons or entities
to which it is addressed and may contain confidential and/or privileged
material. Any review, retransmission, dissemination or other use of, or
taking of any action in reliance upon, this information by persons or
entities other than the intended recipients is prohibited by AgResearch
Limited. If you have received this message in error, please notify the
sender immediately.
=======================================================================



From cjm at berkeleybop.org  Tue Sep  9 18:56:55 2008
From: cjm at berkeleybop.org (Chris Mungall)
Date: Tue, 9 Sep 2008 15:56:55 -0700
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
Message-ID: <18A0C3BE-ED04-4494-9231-B945158D6CE4@berkeleybop.org>


I think I am happy with the modulo approach.

Though I believe we first of all need for a formal specification of  
genome interval semantics that is independent of any particular syntax  
or implementation. This can be a fairly short specification - along  
the lines of what Lincoln has written below (although I would  
naturally prefer the normative version to be interbase - this doesn't  
preclude derived axioms in GFF coordinates).

This spec should also define and standardize the terminology used:  
Lincoln draws a distinction between 'stop' and 'end'. I'm relatively  
happy with these terms - however, the choice we makes need to become  
enshrined otherwise we'll end up with confusion and mismatches between  
software and specification.

One clarification:

> revolutions = int (length/genome)


This axiom is presumaby contextual on the genome being circular, which  
will have to be indicated using a new flag, as Jim suggest, yep?

So the context independent axiom would be:

> revolutions = IF src_is_circular THEN int (length/genome) ELSE 0


On Sep 9, 2008, at 10:52 AM, Lincoln Stein wrote:

> It seems to me that the proposed modulus syntax handles multiple
> revolutions. Consider a 100 bp genome (to make it simple) and a  
> feature that
> starts at 50, goes around twice, and ends at position 60:
>
>  start = 50
>  end  = 260
>
> length = end - start + 1
> revolutions = int (length/genome)
> stop position = length % genome + 1
>
> Lincoln
>
> On Mon, Sep 8, 2008 at 3:57 PM, Aaron Mackey <ajmackey at gmail.com>  
> wrote:
>
>> How can you handle features that may cross the origin more than once?
>> The modulus, though simple, seems to be only half the solution.  It
>> also makes it difficult to place features in the genome "by eye"
>> (having to do the modulus subtraction in my head), or in
>> sorting/filtering operations.
>>
>> I have an alternative that I wondered if you considered: allow the
>> start/end to have an additional "circular revolution" prefix:
>>
>> a typical range tuple like: 100 200 -
>> is thus shorthand for: 0:100 0:200 -
>> (i.e. both the 100 and 200 are in the same "revolution" around the  
>> genome)
>>
>> and is then distinguishable from an "around the genome + 100"  
>> feature of:
>> 1:100 0:200 -
>>
>> Just an alternative to consider (if you haven't already).  I'm not
>> wedded to the syntax, but I wouldn't want to see new columns in GFF
>> just for this.  Essentially, what you want is some form of compound
>> polar coordinates, it seems.
>>
>> -Aaron
>>
>> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>>> In discussions with GMOD about Gbrowse, we've come up with a  
>>> proposal for
>>> handling circular genomes and features that cross the origin in such
>>> genomes.  This applies to lots of prokaryotic and viral genomes, and
>> might
>>> be valuable for some ways of representing terminally redundant  
>>> linear
>>> genomes.
>>> 1) Keep the requirement that start < end
>>> 2) allow end > parent feature length
>>> 3) parent feature gets an is_circular boolean
>>> 4) use modular arithmetic to calculate the real position of end on  
>>> the
>>> parent feature.
>>> We'd like to do this in a way that will be consistent with Chado and
>> BioPerl
>>> representation of features as much as possible (realizing that  
>>> there is
>> the
>>> usual interbase or not coordinate issue).  What do people think?   
>>> Lincoln
>> is
>>> on board for modifying the GFF3 spec.
>>> Thanks!
>>> Jim Hu
>>>
>>> =====================================
>>>
>>> Jim Hu
>>>
>>> Associate Professor
>>>
>>> Dept. of Biochemistry and Biophysics
>>>
>>> 2128 TAMU
>>>
>>> Texas A&M Univ.
>>>
>>> College Station, TX 77843-2128
>>>
>>> 979-862-4054
>>>
>>>
>>> -------------------------------------------------------------------------
>>> This SF.Net email is sponsored by the Moblin Your Move Developer's
>> challenge
>>> Build the coolest Linux based applications with Moblin SDK & win  
>>> great
>>> prizes
>>> Grand prize is a trip for two to an Open Source event anywhere in  
>>> the
>> world
>>> http://moblin-contest.org/redirect.php?banner_id=100&url=/
>>> _______________________________________________
>>> Gmod-schema mailing list
>>> Gmod-schema at lists.sourceforge.net
>>> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>>>
>>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>
>
> -- 
> Lincoln D. Stein
>
> Ontario Institute for Cancer Research
> 101 College St., Suite 800
> Toronto, ON, Canada M5G0A3
> 416 673-8514
> Assistant: Stacey Quinn <Stacey.Quinn at oicr.on.ca>
>
> Cold Spring Harbor Laboratory
> 1 Bungtown Road
> Cold Spring Harbor, NY 11724 USA
> (516) 367-8380
> Assistant: Sandra Michelsen <michelse at cshl.edu>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



From heikki at sanbi.ac.za  Wed Sep 10 07:32:06 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Wed, 10 Sep 2008 13:32:06 +0200
Subject: [Bioperl-l] phylogeny-trait association methods into BioPerl
Message-ID: <200809101332.07137.heikki@sanbi.ac.za>

FYI,

I've been recently writing code to analyse phylogeny-trait associations. These 
traits are typically geographical location of the sequence but they can be any 
phenotypic characters associated with the sequences.

This involves trees, i.e. Bio::Tree::Tree and Bio::Tree::Node objects and 
strings describing the traits. I've been using tags to store trait values 
within nodes. The tag methods are:

Bio::Tree::Node::add_tag_value
Bio::Tree::Node::get_all_tags
Bio::Tree::Node::get_tag_values
Bio::Tree::Node::has_tag
Bio::Tree::Node::remove_all_tags
Bio::Tree::Node::remove_tag

Question: Is  there any particular reason why there is no 
set_tag_value(scalar|@array) method? 

I am getting tired of writing:
  $node->remove_tag($key);
  map {$node->add_tag_value($key)} @values ;
so I am going to implement that unless there is are strong objections.

Otherwise it has been smooth sailing. I am going to add 
Bio::Tree::TreeFunctions::is_binary() and start populating 
Bio::Tree::Statistics soon with these methods:

ps() - Parsimony Score (PS) from Fitch 1971 
ai() - Association index (AI) of Whang et al. 2001
mc() - Monophyletic Clade (MC) size statistics by Salemi at al. 2005
cherries() - number of leaf node pairs

If you have any comments, please feel free to post them here.

    -Heikki

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From hlapp at gmx.net  Wed Sep 10 09:44:27 2008
From: hlapp at gmx.net (Hilmar Lapp)
Date: Wed, 10 Sep 2008 07:44:27 -0600
Subject: [Bioperl-l] phylogeny-trait association methods into BioPerl
In-Reply-To: <200809101332.07137.heikki@sanbi.ac.za>
References: <200809101332.07137.heikki@sanbi.ac.za>
Message-ID: <0FA6C4A1-9D83-4850-BC0A-4A55ED528C65@gmx.net>

Sounds great Heikki!

Just FYI, there is a considerable amount of code and packages for  
comparative analysis in R. You might want to look into the resources  
linked to from the http://r-phylo.org page. There is also a R-SIG- 
Phylo special interest group mailing list (should be linked from the  
aforementioned site).

	-hilmar

On Sep 10, 2008, at 5:32 AM, Heikki Lehvaslaiho wrote:

> FYI,
>
> I've been recently writing code to analyse phylogeny-trait  
> associations. These
> traits are typically geographical location of the sequence but they  
> can be any
> phenotypic characters associated with the sequences.
>
> This involves trees, i.e. Bio::Tree::Tree and Bio::Tree::Node  
> objects and
> strings describing the traits. I've been using tags to store trait  
> values
> within nodes. The tag methods are:
>
> Bio::Tree::Node::add_tag_value
> Bio::Tree::Node::get_all_tags
> Bio::Tree::Node::get_tag_values
> Bio::Tree::Node::has_tag
> Bio::Tree::Node::remove_all_tags
> Bio::Tree::Node::remove_tag
>
> Question: Is  there any particular reason why there is no
> set_tag_value(scalar|@array) method?
>
> I am getting tired of writing:
>  $node->remove_tag($key);
>  map {$node->add_tag_value($key)} @values ;
> so I am going to implement that unless there is are strong objections.
>
> Otherwise it has been smooth sailing. I am going to add
> Bio::Tree::TreeFunctions::is_binary() and start populating
> Bio::Tree::Statistics soon with these methods:
>
> ps() - Parsimony Score (PS) from Fitch 1971
> ai() - Association index (AI) of Whang et al. 2001
> mc() - Monophyletic Clade (MC) size statistics by Salemi at al. 2005
> cherries() - number of leaf node pairs
>
> If you have any comments, please feel free to post them here.
>
>    -Heikki
>
> -- 
> ______ _/      _/_____________________________________________________
>      _/      _/
>     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
>    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
>   _/  _/  _/  SANBI, South African National Bioinformatics Institute
>  _/  _/  _/  University of Western Cape, South Africa
>     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
> ___ _/_/_/_/_/________________________________________________________
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================





From Caroline.Johnston at iop.kcl.ac.uk  Wed Sep 10 11:43:26 2008
From: Caroline.Johnston at iop.kcl.ac.uk (Johnston, Caroline)
Date: Wed, 10 Sep 2008 16:43:26 +0100
Subject: [Bioperl-l] seqs, seqfeatures, locations etc
Message-ID: <5626ED9CB91C814197079FB9940312E506445F81@MAIL.bc.iop.kcl.ac.uk>

Hello,

I'm trying to get my head around the various classes for storing sequences, features and locations and was hoping someone could give me some implementation advice:

I've got a Bio::EnsEMBL::Slice and I want to turn it into a Bio::Seq or SeqFeature object, with Bio::SeqFeature;:Gene::GeneStructure/Transcript/Exon info attached. I can create a Bio::Seq fine, but I also need to keep track of the chromosomal co-ordinates (chr, start, end, species, strand, genome release, database name) and I can't figure out how to store this in Bioperl. I was thinking that what I needed was some extension of a standard Bio::Seq to have genome-coordinate data attached and associated methods to translate the SeqFeature positions (relative to the Bio::Seq) to genome positions. I guess it's probably already possible to store this type of info in some collection of Bioperl objects, but between Bioperl and the EnsEMBL API I'm getting lost in perl modules. Can someone point me in the right direction?

Thanks,
Cass
 



From bosborne11 at verizon.net  Wed Sep 10 13:34:35 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Wed, 10 Sep 2008 13:34:35 -0400
Subject: [Bioperl-l] seqs, seqfeatures, locations etc
In-Reply-To: <5626ED9CB91C814197079FB9940312E506445F81@MAIL.bc.iop.kcl.ac.uk>
References: <5626ED9CB91C814197079FB9940312E506445F81@MAIL.bc.iop.kcl.ac.uk>
Message-ID: <FBBD6379-A984-4F8F-81A5-8EF5E18CC3C7@verizon.net>

Cass,

There is a HOWTO about these Bioperl objects:

http://www.bioperl.org/wiki/HOWTO:Feature-Annotation

I think it addresses your questions.


Brian O.



On Sep 10, 2008, at 11:43 AM, Johnston, Caroline wrote:

> Hello,
>
> I'm trying to get my head around the various classes for storing  
> sequences, features and locations and was hoping someone could give  
> me some implementation advice:
>
> I've got a Bio::EnsEMBL::Slice and I want to turn it into a Bio::Seq  
> or SeqFeature object, with Bio::SeqFeature;:Gene::GeneStructure/ 
> Transcript/Exon info attached. I can create a Bio::Seq fine, but I  
> also need to keep track of the chromosomal co-ordinates (chr, start,  
> end, species, strand, genome release, database name) and I can't  
> figure out how to store this in Bioperl. I was thinking that what I  
> needed was some extension of a standard Bio::Seq to have genome- 
> coordinate data attached and associated methods to translate the  
> SeqFeature positions (relative to the Bio::Seq) to genome positions.  
> I guess it's probably already possible to store this type of info in  
> some collection of Bioperl objects, but between Bioperl and the  
> EnsEMBL API I'm getting lost in perl modules. Can someone point me  
> in the right direction?
>
> Thanks,
> Cass
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From jason at bioperl.org  Wed Sep 10 13:44:25 2008
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 10 Sep 2008 10:44:25 -0700
Subject: [Bioperl-l] phylogeny-trait association methods into BioPerl
In-Reply-To: <200809101332.07137.heikki@sanbi.ac.za>
References: <200809101332.07137.heikki@sanbi.ac.za>
Message-ID: <24F25525-0394-45BE-859F-A5735DE610DF@bioperl.org>

Those are just take from Bio::SeqFeature::Generic tag manipulation  
methods so please feel free to add a better one - maybe can propagate  
that new method to Bio::SeqFeature::Generic as well?

Would be nice to see those other methods add as well so am glad to see  
them.

-jason
On Sep 10, 2008, at 4:32 AM, Heikki Lehvaslaiho wrote:

> FYI,
>
> I've been recently writing code to analyse phylogeny-trait  
> associations. These
> traits are typically geographical location of the sequence but they  
> can be any
> phenotypic characters associated with the sequences.
>
> This involves trees, i.e. Bio::Tree::Tree and Bio::Tree::Node  
> objects and
> strings describing the traits. I've been using tags to store trait  
> values
> within nodes. The tag methods are:
>
> Bio::Tree::Node::add_tag_value
> Bio::Tree::Node::get_all_tags
> Bio::Tree::Node::get_tag_values
> Bio::Tree::Node::has_tag
> Bio::Tree::Node::remove_all_tags
> Bio::Tree::Node::remove_tag
>
> Question: Is  there any particular reason why there is no
> set_tag_value(scalar|@array) method?
>
> I am getting tired of writing:
>  $node->remove_tag($key);
>  map {$node->add_tag_value($key)} @values ;
> so I am going to implement that unless there is are strong objections.
>
> Otherwise it has been smooth sailing. I am going to add
> Bio::Tree::TreeFunctions::is_binary() and start populating
> Bio::Tree::Statistics soon with these methods:
>
> ps() - Parsimony Score (PS) from Fitch 1971
> ai() - Association index (AI) of Whang et al. 2001
> mc() - Monophyletic Clade (MC) size statistics by Salemi at al. 2005
> cherries() - number of leaf node pairs
>
> If you have any comments, please feel free to post them here.
>
>    -Heikki
>
> -- 
> ______ _/      _/_____________________________________________________
>      _/      _/
>     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
>    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
>   _/  _/  _/  SANBI, South African National Bioinformatics Institute
>  _/  _/  _/  University of Western Cape, South Africa
>     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
> ___ _/_/_/_/_/________________________________________________________
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From philsf79 at gmail.com  Thu Sep 11 04:40:26 2008
From: philsf79 at gmail.com (Felipe Figueiredo)
Date: Thu, 11 Sep 2008 05:40:26 -0300
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
Message-ID: <1221122426.8059.49.camel@localhost>

I'm not sure if this is related to bioperl (Bio::AlignIO) or if it's a
general perl error on my part, but I find strange that the following
code gives differente results depending on how I input the alignment:

--- test.pl ---
#!/usr/bin/perl

use warnings;
use strict;

use Bio::AlignIO;

my $file;
if (@ARGV) {
    $file = shift @ARGV;
}
else {
    $file = "-";
}

my $align = Bio::AlignIO->new(-file=>$file)->next_aln;

printf "Sequences: %s\n",$align->no_sequences;
--- test.pl ---

If I run this using a file containing 4 sequences, the following
hapens: 

--- run tests ---
$ ./test.pl  exemplo-alinhamento.fasta
Sequences: 4

$ ./test.pl < exemplo-alinhamento.fasta
Sequences: 3

$ cat exemplo-alinhamento.fasta | ./test.pl 
Sequences: 3
--- run tests ---

The missing sequence is always the first one. Am I missing something, or
my code for reading stdin is mistaken or is it a bug in Bio::AlignIO?

I'm using bioperl 1.5.2.102-1ubuntu1, in Ubuntu 8.04 Hardy.

best regards
FF



From David.Messina at sbc.su.se  Thu Sep 11 07:21:51 2008
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 11 Sep 2008 13:21:51 +0200
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <1221122426.8059.49.camel@localhost>
References: <1221122426.8059.49.camel@localhost>
Message-ID: <628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>

Hi Felipe,

Specifying STDIN via a '-' argument to the -file parameter is not valid.
While that is a convention with some UNIX tools, it's not, as far as I know,
something you should be able to count on.

In BioPerl, one can specify STDIN by passing the \*STDIN filehandle glob to
the -fh parameter (NOT to -file).

In other words,

my $align = Bio::AlignIO->new(-fh => \*STDIN)->next_aln;

That is a convention in BioPerl, so the -file and -fh parameters should work
the same way in AlignIO, SearchIO, SeqIO, etc.

Take a look at the beginners' HOWTO for some examples.
http://www.bioperl.org/wiki/HOWTO:Beginners


Dave


From bosborne11 at verizon.net  Thu Sep 11 11:01:32 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Thu, 11 Sep 2008 11:01:32 -0400
Subject: [Bioperl-l] SeqHound
Message-ID: <0E295726-33FE-4083-98A1-9035E37455BD@verizon.net>

Raul,

Good question about BIND, I don't know if the public version is up-to- 
date. For the latest protein-protein interaction data I look at public  
databases like IntAct.

If you use bioperl-network you should be able to read IntAct data into  
a graph, then find the interactions that you're interested in in that  
graph. There are a few qualifications to this statement though, like  
do you have the "right" identifiers or names. So you're right, bioperl- 
network constructs graphs from the XML files but the interactions you  
want are in those graphs. Something like:

  my $graphio = Bio::Network::IO->new(-file   => 'human.xml',
                                      -format => 'psi25');
  my $graph = $graphio->next_network();
  my $node = $graph->get_nodes_by_id('UniProt:P12345');
  my @neighbors = $graph->neighbors($node);



Brian O.

On Sep 11, 2008, at 7:32 AM, Raul Mendez Giraldez wrote:

> Hi Brian,
>
> Actually I realized later that SeqHound is a part of Bioperl itself,  
> and
> that regarding BIND (at least the public database) is reachable trough
> BIND SOAP protocol, that can be implemented in perl through the module
> SOAP::Lite. I still don't know whether the public BIND database is out
> of date, or which part of the BOND database it covers.
>
> Regarding the Bio::Network packages, at the Bioperl suite, I guess it
> rather for representing protein - protein interaction graphs, isn't  
> it?
> That could be interesting to me, but in a second step. I am more
> concerned now in getting this protein - protein interaction data,  
> for a
> set of proteins some biologists gave me. I don't know anything about
> Cytoscape, normally I'm trying to exploit perl data management
> capabilities.
>
> Thanks for the info.
>
> Cheers,
>
> Raul
>


From MEC at stowers-institute.org  Thu Sep 11 14:01:01 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Thu, 11 Sep 2008 13:01:01 -0500
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
References: <1221122426.8059.49.camel@localhost>
	<628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>

Filipe and Dave,

I find that the following works generically for SeqIO and AlignIO (at least)...

#after processing all options using GetOpt,
#any remaining options should name files to process...
@ARGV = ('-') unless @ARGV;     # Default to standard input
my %inopt;
$inopt{-fh} ||=  \*ARGV;
my $AlignIO =  Bio::AlignIO->new(
                         %inopt
                        )  or die "calling Bio::AlignIO->new on %inopt" ;



--Malcolm

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Dave Messina
Sent: Thursday, September 11, 2008 6:22 AM
To: Felipe Figueiredo
Cc: bioperl-l at lists.open-bio.org
Subject: Re: [Bioperl-l] difference in opening file from @ARGV and STDIN?

Hi Felipe,

Specifying STDIN via a '-' argument to the -file parameter is not valid.
While that is a convention with some UNIX tools, it's not, as far as I know, something you should be able to count on.

In BioPerl, one can specify STDIN by passing the \*STDIN filehandle glob to the -fh parameter (NOT to -file).

In other words,

my $align = Bio::AlignIO->new(-fh => \*STDIN)->next_aln;

That is a convention in BioPerl, so the -file and -fh parameters should work the same way in AlignIO, SearchIO, SeqIO, etc.

Take a look at the beginners' HOWTO for some examples.
http://www.bioperl.org/wiki/HOWTO:Beginners


Dave
_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l



From David.Messina at sbc.su.se  Thu Sep 11 14:47:04 2008
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 11 Sep 2008 20:47:04 +0200
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>
References: <1221122426.8059.49.camel@localhost>
	<628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>
Message-ID: <628aabb70809111147y7d99e1bdh414a4ab1037c0990@mail.gmail.com>

Thanks, Malcolm.
So then, '-' as STDIN does work?

D


From MEC at stowers-institute.org  Thu Sep 11 16:19:25 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Thu, 11 Sep 2008 15:19:25 -0500
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <628aabb70809111147y7d99e1bdh414a4ab1037c0990@mail.gmail.com>
References: <1221122426.8059.49.camel@localhost>
	<628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>
	<628aabb70809111147y7d99e1bdh414a4ab1037c0990@mail.gmail.com>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD559C@exchmb-02.stowers-institute.org>

Note exactly the way I would put it.


Look at the difference between the first command and the second is the following transcript:

> echo -e ">asdf\natgc\n" | perl -MBio::SeqIO -e 'my $s = Bio::SeqIO->new(-format => qw{fasta}, -fh => \*ARGV); print $ARGV[0] . qq{ has } . $s->next_seq()->seq . qq{\n}' -- '-'
- has atgc
> echo -e ">asdf\natgc\n" | perl -MBio::SeqIO -e 'my $s = Bio::SeqIO->new(-format => qw{fasta}, -fh => \*ARGV); print $ARGV[0] . qq{ has } . $s->next_seq()->seq . qq{\n}' -- 'NoSuchFile'
Can't open NoSuchFile: No such file or directory at /home/mec/cvs/bioperl-live/Bio/Root/IO.pm line 458.
Can't call method "seq" on an undefined value at -e line 1.

THe only difference is that @ARG is the singleton list composed of '-' in the first call, and is the singlton list composed of 'NoSuchFile' in the second.

If you passed in a list of multiple files that actually do exist, it should work fine.

It is really a matter of ARGV processing magic.

from http://perldoc.perl.org/perlop.html

The null filehandle <> is special: it can be used to emulate the behavior of sed and awk. Input from <> comes either from standard input, or from each file listed on the command line. Here's how it works: the first time <> is evaluated, the @ARGV array is checked, and if it is empty, $ARGV[0] is set to "-", which when opened gives you standard input. The @ARGV array is then processed as a list of filenames. The loop

    while (<>) {
        ...                     # code for each line
    }

is equivalent to the following Perl-like pseudo code:

    unshift<http://perldoc.perl.org/functions/unshift.html>(@ARGV, '-') unless @ARGV;
    while ($ARGV = shift<http://perldoc.perl.org/functions/shift.html>) {
        open<http://perldoc.perl.org/functions/open.html>(ARGV, $ARGV);
        while (<ARGV>) {
            ...         # code for each line
        }
    }





Malcolm Cook
Database Applications Manager - Bioinformatics
Stowers Institute for Medical Research - Kansas City, Missouri




________________________________
From: dave at davemessina.com [mailto:dave at davemessina.com] On Behalf Of Dave Messina
Sent: Thursday, September 11, 2008 1:47 PM
To: Cook, Malcolm
Cc: Felipe Figueiredo; bioperl-l at lists.open-bio.org
Subject: Re: [Bioperl-l] difference in opening file from @ARGV and STDIN?

Thanks, Malcolm.

So then, '-' as STDIN does work?

D




From David.Messina at sbc.su.se  Thu Sep 11 17:15:44 2008
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 11 Sep 2008 23:15:44 +0200
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC129FFD559C@exchmb-02.stowers-institute.org>
References: <1221122426.8059.49.camel@localhost>
	<628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>
	<628aabb70809111147y7d99e1bdh414a4ab1037c0990@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD559C@exchmb-02.stowers-institute.org>
Message-ID: <628aabb70809111415w27044d57jd3121adb40900e45@mail.gmail.com>

Cool, thanks for the explanation Malcolm!

At the risk of belaboring this point and your patience, one thing still
confuses me, though:

and if [@ARGV] is empty, $ARGV[0] is set to "-"
>

If $ARGV[0] is set (by Perl's ARGV processing magic) to '-', then why in
your earlier example do you manually set $ARGV[0] to '-' instead of simply
leaving @ARGV empty?

@ARGV = ('-') unless @ARGV;




If I run your example and omit '-' as an argument, it still works:

> echo -e ">asdf\natgc\n" | perl -MBio::SeqIO -e 'my $s =
Bio::SeqIO->new(-format => qw{fasta}, -fh => \*ARGV); print $ARGV[0] . qq{
has } . $s->next_seq()->seq . qq{\n}'
 has atgc



Dave


From acouperthwaite at gmail.com  Fri Sep 12 17:17:53 2008
From: acouperthwaite at gmail.com (Andrew Couperthwaite)
Date: Fri, 12 Sep 2008 15:17:53 -0600
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
Message-ID: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>

Hi,

I'm having difficulty using  the Bio::DB::Query::GenBank module.  The  
sample script on the page http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/DB/Query/GenBank.html 
  doesn't seem to work.

I'm trying to use this and the Bio::DB::GenBank module to find and  
download a set of sequences from GenBank...
I'm rather new to bioperl, can anyone point me in the right direction?

Thanks,
-Andrew


From jason at bioperl.org  Sat Sep 13 02:42:28 2008
From: jason at bioperl.org (Jason Stajich)
Date: Fri, 12 Sep 2008 23:42:28 -0700
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
In-Reply-To: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
References: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
Message-ID: <2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>

Hi Andrew -

a) what is the exact script code you are trying, what are the error  
messages?
b) what version of bioperl?

The first thing we'll suggest is: did you get the latest code from SVN  
yet or a nightly build?

-jason
On Sep 12, 2008, at 2:17 PM, Andrew Couperthwaite wrote:

> Hi,
>
> I'm having difficulty using  the Bio::DB::Query::GenBank module.   
> The sample script on the page http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/DB/Query/GenBank.html 
>  doesn't seem to work.
>
> I'm trying to use this and the Bio::DB::GenBank module to find and  
> download a set of sequences from GenBank...
> I'm rather new to bioperl, can anyone point me in the right direction?
>
> Thanks,
> -Andrew
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From cjfields at illinois.edu  Mon Sep 15 00:13:57 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Sun, 14 Sep 2008 23:13:57 -0500
Subject: [Bioperl-l] significant bug with Bio::LocatableSeq
Message-ID: <98938314-4AF1-44C2-8867-B383A44E542E@illinois.edu>

While debugging some tests in bioperl, I noticed a fairly significant  
issue with Bio::LocatableSeq which is probably due to some  
inconsistencies with start/end coordinates.  For some reason this  
started popping up with error messages recently when running AlignIO  
tests on bioperl-live (i.e. something changed which exposed the bug,  
maybe the verbosity level):

1..295
ok 1 - use Bio::AlignIO;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5
ok 6 - The object isa Bio::AlignIO

--------------------- WARNING ---------------------
MSG: In sequence 02 residue count gives end value 399.
Overriding value [355] with value 399 for Bio::LocatableSeq::end().
STACK Bio::LocatableSeq::end /Users/cjfields/bioperl/bioperl-live/blib/ 
lib/Bio/LocatableSeq.pm:150
STACK Bio::LocatableSeq::new /Users/cjfields/bioperl/bioperl-live/blib/ 
lib/Bio/LocatableSeq.pm:103
STACK Bio::AlignIO::arp::next_aln /Users/cjfields/bioperl/bioperl-live/ 
blib/lib/Bio/AlignIO/arp.pm:106
STACK toplevel t/AlignIO.t:34
---------------------------------------------------
.... followed by tons of similar errors.

The problem is, no change is ever made.  This is demonstrated by the  
following:

-----------------------------
#!/usr/bin/perl -w

use strict;
use warnings;
use Bio::LocatableSeq;

my $seq = Bio::LocatableSeq->new(
     -id => 'foo',
     -seq => 'A----TGCGCTTCCTCGCTTCCG',
     -start => 10,
     -end => 100, # intentially bad
     -strand => -1);

print $seq->end."\n";

-----------------------------

Results:

--------------------- WARNING ---------------------
MSG: In sequence foo residue count gives end value 28.
Overriding value [100] with value 28 for Bio::LocatableSeq::end().
STACK Bio::LocatableSeq::end /Users/cjfields/bioperl/bioperl-live/Bio/ 
LocatableSeq.pm:150
STACK Bio::LocatableSeq::new /Users/cjfields/bioperl/bioperl-live/Bio/ 
LocatableSeq.pm:103
STACK toplevel seq.pl:7
---------------------------------------------------
100

The warning pops up when -end is passed to LocatableSeq::new and  
indicates that the passed coordinate doesn't match up with the one  
calculated from the sequence (minus gaps).  I've isolated the bug down  
to the end() method and am working on fixing it.  Note that this  
affects LocatableSeq::length as well.  This appears to affect arp,  
nexus, stockholm, and a few other AlignIO parsers as well.

chris


From acouperthwaite at gmail.com  Mon Sep 15 15:05:13 2008
From: acouperthwaite at gmail.com (Andrew Couperthwaite)
Date: Mon, 15 Sep 2008 13:05:13 -0600
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
In-Reply-To: <2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>
References: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
	<2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>
Message-ID: <2BA47AC9-5A04-460D-BA56-64B152AFFF16@gmail.com>

the code i'm starting with is this:
=====
use Bio::DB::Query::GenBank;
use Bio::DB::GenBank

my $query_string = 'Oryza[Organism] AND EST[Keyword]';
    my $query = Bio::DB::Query::GenBank->new(-query =>  
'Oryza[Organism] AND EST[Keyword]',
    											-db=>'nucleotide');
    my $count = $query->count;
    my @ids   = $query->ids;
    # get a genbank database handle
    my $gb = Bio::DB::GenBank->new();
    my $stream = $gb->get_Stream_by_query($query);

    while (my $seq = $stream->next_seq) {
       # do something with the sequence object
       print "hello";
    }
=====
It doesn't produce any error messages, it simply doesn't enter the  
while loop.  It seems as though it isn't getting any results from  
genbank?/isn't contacting genbank?

We are running version 1.5.2.  Haven't updated since late May.

-Andrew

On 13-Sep-08, at 12:42 AM, Jason Stajich wrote:

> Hi Andrew -
>
> a) what is the exact script code you are trying, what are the error  
> messages?
> b) what version of bioperl?
>
> The first thing we'll suggest is: did you get the latest code from  
> SVN yet or a nightly build?
>
> -jason
> On Sep 12, 2008, at 2:17 PM, Andrew Couperthwaite wrote:
>
>> Hi,
>>
>> I'm having difficulty using  the Bio::DB::Query::GenBank module.   
>> The sample script on the page http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/DB/Query/GenBank.html 
>>  doesn't seem to work.
>>
>> I'm trying to use this and the Bio::DB::GenBank module to find and  
>> download a set of sequences from GenBank...
>> I'm rather new to bioperl, can anyone point me in the right  
>> direction?
>>
>> Thanks,
>> -Andrew
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Jason Stajich
> jason at bioperl.org
>
>
>



From jason at bioperl.org  Mon Sep 15 15:25:49 2008
From: jason at bioperl.org (Jason Stajich)
Date: Mon, 15 Sep 2008 12:25:49 -0700
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
In-Reply-To: <2BA47AC9-5A04-460D-BA56-64B152AFFF16@gmail.com>
References: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
	<2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>
	<2BA47AC9-5A04-460D-BA56-64B152AFFF16@gmail.com>
Message-ID: <25A13987-7306-42E8-BE4E-E50A70538E7D@bioperl.org>

Try removing the line
my @ids = $query->ids;

I don't think GenBank supports this part of the query API now or you  
have to execute the query first before you can ask for the number of  
IDs from that object.  I don't remember exactly what changed  
specifically, but I actually get an error with that line:
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Id list has been truncated even after maxids requested
STACK: Error::throw
STACK: Bio::Root::Root::throw /usr/local/lib/perl5/Bio/Root/Root.pm:357
STACK: Bio::DB::Query::WebQuery::_fetch_ids /usr/local/lib/perl5/Bio/ 
DB/Query/WebQuery.pm:237
STACK: Bio::DB::Query::WebQuery::ids /usr/local/lib/perl5/Bio/DB/Query/ 
WebQuery.pm:201
STACK: query.pl:9
-----------------------------------------------------------


This is the query script I use that works fine for me for my downloads.

http://fungalgenomes.org/~stajich/scripts/download_query_genbank.pl


I'm using SVN code so it is possible things are changed since 1.5.2.

-jason
On Sep 15, 2008, at 12:05 PM, Andrew Couperthwaite wrote:

> the code i'm starting with is this:
> =====
> use Bio::DB::Query::GenBank;
> use Bio::DB::GenBank
>
> my $query_string = 'Oryza[Organism] AND EST[Keyword]';
>   my $query = Bio::DB::Query::GenBank->new(-query =>  
> 'Oryza[Organism] AND EST[Keyword]',
>   											-db=>'nucleotide');
>   my $count = $query->count;
>   my @ids   = $query->ids;
>   # get a genbank database handle
>   my $gb = Bio::DB::GenBank->new();
>   my $stream = $gb->get_Stream_by_query($query);
>
>   while (my $seq = $stream->next_seq) {
>      # do something with the sequence object
>      print "hello";
>   }
> =====
> It doesn't produce any error messages, it simply doesn't enter the  
> while loop.  It seems as though it isn't getting any results from  
> genbank?/isn't contacting genbank?
>
> We are running version 1.5.2.  Haven't updated since late May.
>
> -Andrew
>
> On 13-Sep-08, at 12:42 AM, Jason Stajich wrote:
>
>> Hi Andrew -
>>
>> a) what is the exact script code you are trying, what are the error  
>> messages?
>> b) what version of bioperl?
>>
>> The first thing we'll suggest is: did you get the latest code from  
>> SVN yet or a nightly build?
>>
>> -jason
>> On Sep 12, 2008, at 2:17 PM, Andrew Couperthwaite wrote:
>>
>>> Hi,
>>>
>>> I'm having difficulty using  the Bio::DB::Query::GenBank module.   
>>> The sample script on the page http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/DB/Query/GenBank.html 
>>>  doesn't seem to work.
>>>
>>> I'm trying to use this and the Bio::DB::GenBank module to find and  
>>> download a set of sequences from GenBank...
>>> I'm rather new to bioperl, can anyone point me in the right  
>>> direction?
>>>
>>> Thanks,
>>> -Andrew
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Jason Stajich
>> jason at bioperl.org
>>
>>
>>
>

Jason Stajich
jason at bioperl.org





From biology0046 at hotmail.com  Mon Sep 15 16:00:02 2008
From: biology0046 at hotmail.com (=?gb2312?B?va3OxOL9?=)
Date: Mon, 15 Sep 2008 20:00:02 +0000
Subject: [Bioperl-l] HSP tiling problem
In-Reply-To: <mailman.7944.1221254286.2673.bioperl-l@lists.open-bio.org>
References: <mailman.7944.1221254286.2673.bioperl-l@lists.open-bio.org>
Message-ID: <BLU108-W14DD76360E5100AC535214B4520@phx.gbl>


Dear all:
I try to use bioperl's SearhIO module to parse the blast output, 
the output of blast contain many HSPs from the same hit, each HSP come out with an count of identity residues and alignment length, but what i want to get is the global identiy and alignment length of the query sequence and hit sequence, which may be done by tiling the HSPs and build a HSP contig, 
 
the bioperl BLASTutil module contain "hsp_tiling and length_aln, frac_identical" method fullfill my purpose, but i read through the mailing list, some user said the method used by bioperl were not precise in many cases, they sugguest to use WUBLAST.
 
but i don't know which WUBLAST opinion should i use, i use "links" opinion, but the output still give me lots of HSPs, are these HSPs created from some small HSPs?best regards!wenkaichinese academy of sciences
_________________________________________________________________
????????????????????????????????????????????????????
http://im.live.cn/Share/18.htm


From jason at bioperl.org  Mon Sep 15 16:27:02 2008
From: jason at bioperl.org (Jason Stajich)
Date: Mon, 15 Sep 2008 13:27:02 -0700
Subject: [Bioperl-l] HSP tiling problem
In-Reply-To: <BLU108-W14DD76360E5100AC535214B4520@phx.gbl>
References: <mailman.7944.1221254286.2673.bioperl-l@lists.open-bio.org>
	<BLU108-W14DD76360E5100AC535214B4520@phx.gbl>
Message-ID: <90A30B97-1618-4AAF-86D9-B51929697CDE@bioperl.org>

The -links option gives you a logical ordering of non-overlapping HSPs  
so it is the tiling you desire. You just process each HSP from the  
list provided by -links. There may be several alternative paths so you  
can compute a %id for all of them or just take the longest one, etc.

You need to just decide how you want to compute global identity - an  
average of the HSP identities or just sum up the number of identical  
bases across them all divided by the total length of sequence that is  
aligned.  All those pieces of information are available and described  
in the SearchIO HOWTO on the website.

Or, requiring less coding, re-align the sequences with an aligner like  
SSEARCH to get a single alignment and a single %id/%sim number for the  
sequence pair.

-jason

On Sep 15, 2008, at 1:00 PM, ?????? wrote:

>
> Dear all:
> I try to use bioperl's SearhIO module to parse the blast output,
> the output of blast contain many HSPs from the same hit, each HSP  
> come out with an count of identity residues and alignment length,  
> but what i want to get is the global identiy and alignment length of  
> the query sequence and hit sequence, which may be done by tiling the  
> HSPs and build a HSP contig,
>
> the bioperl BLASTutil module contain "hsp_tiling and length_aln,  
> frac_identical" method fullfill my purpose, but i read through the  
> mailing list, some user said the method used by bioperl were not  
> precise in many cases, they sugguest to use WUBLAST.
>
> but i don't know which WUBLAST opinion should i use, i use "links"  
> opinion, but the output still give me lots of HSPs, are these HSPs  
> created from some small HSPs?best regards!wenkaichinese academy of  
> sciences
> _________________________________________________________________
> ????????????????????????????????????????????????????
> http://im.live.cn/Share/18.htm
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org






From bosborne11 at verizon.net  Mon Sep 15 22:22:54 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Mon, 15 Sep 2008 22:22:54 -0400
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
In-Reply-To: <25A13987-7306-42E8-BE4E-E50A70538E7D@bioperl.org>
References: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
	<2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>
	<2BA47AC9-5A04-460D-BA56-64B152AFFF16@gmail.com>
	<25A13987-7306-42E8-BE4E-E50A70538E7D@bioperl.org>
Message-ID: <583390B6-1075-4EB0-A22A-E1D07D2EDFA8@verizon.net>

Jason,

I added that script to scripts/, hope you don't mind!

Brian O.



On Sep 15, 2008, at 3:25 PM, Jason Stajich wrote:

> This is the query script I use that works fine for me for my  
> downloads.



From mirhan at indiana.edu  Tue Sep 16 01:18:47 2008
From: mirhan at indiana.edu (Han, Mira)
Date: Tue, 16 Sep 2008 01:18:47 -0400
Subject: [Bioperl-l] [Wg-phyloinformatics] Summer of Code: project
	summaries
In-Reply-To: <2033D247-5E34-4BDE-A98E-BE08D9910951@duke.edu>
Message-ID: <C4F4B9F7.5500%mirhan@indiana.edu>


Hi,
Just writing to summarize the final product of this summer. (even though it's overdue)
The phyloXML support in BioPerl project is finished officially,
I've created three new modules,
Bio::TreeIO::phyloxml,
Bio::Tree::AnnotatableNode,
and Bio::Annotation::Relation.
The parsing is done for all elements except for <ProteinDomain>
And the validation step is still missing.
I'm planning to add those in in the future.

I was contemplating to make a Bio::Annotation::XML till the end,
But decided not to since there was already a new module Bio::Annotation::TagTree, that looked like the same thing.
Currently, the module does not use TagTree, it uses nested AnnotationCollections instead, because TagTree was a temporary stub at the time.
There are methods in phyloxml that seem out of place there,
For example, the print_annotation and print_attr functions that print the annotations in phyloXML format.
Or the read_annotation function that reads the value of the annotation for a certain object.
I feel like these functions should go with the Annotation object,
But since there were no Annotation object that is phyloXML specific,
I just put them in the TreeIO::phyloxml.
This may change too in the future.

The documentations are all finished and can be seen in
http://www.bioperl.org/wiki/Module:Bio::TreeIO::phyloxml
http://www.bioperl.org/wiki/Module:Bio::Tree::AnnotatableNode
http://www.bioperl.org/wiki/Module:Bio::Annotation::Relation

The detailed progress of the project is documented in
http://www.bioperl.org/wiki/PhyloXML_support_in_BioPerl

and there is also a demo page that describes the use in
http://www.bioperl.org/wiki/Phyloxml_Project_Demo


Finally I'd like to thank Chris Fields and Hilmar Lapp,
for the constant support during the summer.
And the people on the list for providing helpful suggestions when I came with a question.
See you around.

Mira Han




On 9/14/08 1:15 PM, "Hilmar Lapp" <hlapp at duke.edu> wrote:

Hi all,

the 2008 Google Summer of Code program is officially over now. First
off, I'd like to congratulate all of our students: you all passed your
end-of-term evaluation, and you all passed solidly. Thanks for all
your hard work, beginning with writing and refining your project
applications and finally wrapping it up with documentation and a
demonstration project.

Based on what I can see, the students have all uploaded the code you
produced over the summer to the Google Code repository, as requested
by Google, so I'm not going to bore you with repeating the
instructions for how to do this. If you are still having trouble with
this process or have other questions regarding this though, don't
hesitate to let me know and ask any question you have.

For our imminently due Annual Report to NSF, we will need to document
your projects, and I am asking you for your help in this. Essentially,
we will need to produce similar information to what we composed for
the 2007 fall NESCent newsletter: for each project we need a short
summary of the project and the benefits of the results, written for a
scientific but otherwise general audience, a headshot of you (the
student), and a visual of the results. See

http://www.nescent.org/news/newsletter_10_07.php#google

for the example from last year as to what we have in mind. Kistin
Jenkins or Jory Weintraub from NESCent's Education and Outreach group
(both copied) will be in touch with you to possibly edit the summaries
and fine-tune the other material, but if the students could please
send your draft summary text, headshot, and visual as soon as you can
to eog at nescent.org that would be great. If you are not sure what to
use for the visual, I'd encourage you to speak with your mentor;
however, feel free to ask me as well.

Thanks again for working with us, and on your projects, and I hope you
all not only had a most enjoyable summer but also will keep involved
in your project as much as possible. I will also arrange for an end-of-
term teleconference with the students shortly, and one of the things
that I'd like to talk about is how we can best facilitate you
remaining involved beyond the official end of the program.

Cheers,

        -hilmar

--
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:- hlapp at duke dot edu :
===========================================================




_______________________________________________
Wg-phyloinformatics mailing list
Wg-phyloinformatics at nescent.org
https://lists.nescent.org/mailman/listinfo/wg-phyloinformatics





From hartzell at alerce.com  Wed Sep 17 00:21:36 2008
From: hartzell at alerce.com (George Hartzell)
Date: Tue, 16 Sep 2008 21:21:36 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18640.34256.305270.924007@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > George,
 > 
 > This is an error from my side. Great that you have a fix already.
 > 
 > My only worry is the number of external dependencies in BioPerl. To limit 
 > these we have recoded number of functionalities into BioPerl-specific modules. 
 > Before you commit the fix, could you see if Bio::RangeI could be used or easily 
 > extended to be used instead of Set::IntSpan?
 > 
 > Thanks,
 > 
 >    -Heikki
 > 
 > On Friday 05 September 2008 21:01:35 George Hartzell wrote:
 > > Hi all,
 > >
 > > Bio::Coordinate::Collection surprised me a bit.  At first I thought
 > > there was a bug, but it's clearly doing what it's supposed to.  Now
 > > I'm wondering if what it's supposed to be doing makes sense in some
 > > context, or if what I expected would be better functionality.
 > >
 > > t/CoordinateMapper.t sets up the following scenario:
 > >
 > > #
 > > # Collection
 > > #
 > > #         1   5     6   10
 > > #         |---|     |---|
 > > #-----|-----------------------
 > > #     1   5   9     15  19
 > > #         pair1     pair2
 > >
 > > Then goes on to do the following query:
 > >
 > >   # match more than two
 > >   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
 > >   ok $res = $transcribe->map($pos);
 > >   is $res->each_gap, 2;
 > >   is $res->each_match, 2;
 > >
 > > I was surprised to see that there were two gaps, one gene:10-19 and
 > > one from gene:5-14.  Looking at the code, what's really happening is
 > > that, for the exon1 mapper there's match with gene:5-9 and a gap with
 > > gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
 > > match with gene:15-19.  All four Result's just get tossed into the
 > > return value.
 > >
 > > The result my intuition wants is that there are two matches (gene:5-9
 > > with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
 > >
 > > Yes, I guess that I could just synthesize these myself from the result
 > > in my app.
 > >
 > > It still seems that the current result is a bug though, since there's
 > > no way of knowing when you're walking through $res->each_Location that
 > > the first "gap" is with respect to the exon1 mapper and that the
 > > second "gap" is with respect to the exon2 mapper.  The gaps are
 > > meaningless.
 > >
 > > I "fixed" it to work the way I think it should (two matches, one
 > > gap).  I actually extended the test case a bit so that there's a
 > > multi-base gap, a match, another multibase-gap, another match, then a
 > > single base gap (just to make sure I got that right...).  I had to
 > > touch up the test file a bit to account for my new test.
 > >
 > > The gaps that I return have a strand of 'undef', which seems to be The
 > > Right Thing.  There's also a bit of funny business where I hang onto
 > > the seq_id of the gapped sequence.  It assumes that the "in" sequence
 > > is the same for all of the mappers.  This seems safe since otherwise
 > > the entire query is kind of weird....
 > >
 > > There's a patch to todays svn head at:
 > >
 > >   http://shrimp.alerce.com/bioperl/collection-diffs.txt
 > >
 > > The patch changes Build.PL to include a dependency on Set::IntSpan,
 > > CoordinateMapper.t to update the tests, and
 > > Bio/CoordinateMapper/Collection.pm for the new code.
 > >
 > > Who's code would this break.
 > >
 > > If anyone's relying on the current behaviour re: gaps, what's the
 > > situation in which you find it useful?
 > >
 > > Thanks!
 > >
 > > g.

I suspect that I can redo it w/ RangeI's.  It'll be a good project.
I'm pushing on a project at the moment but will get to it this weekend
or next week.

thanks,

g.


From hartzell at alerce.com  Wed Sep 17 00:21:36 2008
From: hartzell at alerce.com (George Hartzell)
Date: Tue, 16 Sep 2008 21:21:36 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18640.34256.305270.924007@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > George,
 > 
 > This is an error from my side. Great that you have a fix already.
 > 
 > My only worry is the number of external dependencies in BioPerl. To limit 
 > these we have recoded number of functionalities into BioPerl-specific modules. 
 > Before you commit the fix, could you see if Bio::RangeI could be used or easily 
 > extended to be used instead of Set::IntSpan?
 > 
 > Thanks,
 > 
 >    -Heikki
 > 
 > On Friday 05 September 2008 21:01:35 George Hartzell wrote:
 > > Hi all,
 > >
 > > Bio::Coordinate::Collection surprised me a bit.  At first I thought
 > > there was a bug, but it's clearly doing what it's supposed to.  Now
 > > I'm wondering if what it's supposed to be doing makes sense in some
 > > context, or if what I expected would be better functionality.
 > >
 > > t/CoordinateMapper.t sets up the following scenario:
 > >
 > > #
 > > # Collection
 > > #
 > > #         1   5     6   10
 > > #         |---|     |---|
 > > #-----|-----------------------
 > > #     1   5   9     15  19
 > > #         pair1     pair2
 > >
 > > Then goes on to do the following query:
 > >
 > >   # match more than two
 > >   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
 > >   ok $res = $transcribe->map($pos);
 > >   is $res->each_gap, 2;
 > >   is $res->each_match, 2;
 > >
 > > I was surprised to see that there were two gaps, one gene:10-19 and
 > > one from gene:5-14.  Looking at the code, what's really happening is
 > > that, for the exon1 mapper there's match with gene:5-9 and a gap with
 > > gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
 > > match with gene:15-19.  All four Result's just get tossed into the
 > > return value.
 > >
 > > The result my intuition wants is that there are two matches (gene:5-9
 > > with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
 > >
 > > Yes, I guess that I could just synthesize these myself from the result
 > > in my app.
 > >
 > > It still seems that the current result is a bug though, since there's
 > > no way of knowing when you're walking through $res->each_Location that
 > > the first "gap" is with respect to the exon1 mapper and that the
 > > second "gap" is with respect to the exon2 mapper.  The gaps are
 > > meaningless.
 > >
 > > I "fixed" it to work the way I think it should (two matches, one
 > > gap).  I actually extended the test case a bit so that there's a
 > > multi-base gap, a match, another multibase-gap, another match, then a
 > > single base gap (just to make sure I got that right...).  I had to
 > > touch up the test file a bit to account for my new test.
 > >
 > > The gaps that I return have a strand of 'undef', which seems to be The
 > > Right Thing.  There's also a bit of funny business where I hang onto
 > > the seq_id of the gapped sequence.  It assumes that the "in" sequence
 > > is the same for all of the mappers.  This seems safe since otherwise
 > > the entire query is kind of weird....
 > >
 > > There's a patch to todays svn head at:
 > >
 > >   http://shrimp.alerce.com/bioperl/collection-diffs.txt
 > >
 > > The patch changes Build.PL to include a dependency on Set::IntSpan,
 > > CoordinateMapper.t to update the tests, and
 > > Bio/CoordinateMapper/Collection.pm for the new code.
 > >
 > > Who's code would this break.
 > >
 > > If anyone's relying on the current behaviour re: gaps, what's the
 > > situation in which you find it useful?
 > >
 > > Thanks!
 > >
 > > g.

I suspect that I can redo it w/ RangeI's.  It'll be a good project.
I'm pushing on a project at the moment but will get to it this weekend
or next week.

thanks,

g.


From cjfields at illinois.edu  Wed Sep 17 12:41:52 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 17 Sep 2008 11:41:52 -0500
Subject: [Bioperl-l] [Wg-phyloinformatics] Summer of Code: project
	summaries
In-Reply-To: <C4F4B9F7.5500%mirhan@indiana.edu>
References: <C4F4B9F7.5500%mirhan@indiana.edu>
Message-ID: <25D73268-25A1-4780-A2D2-F27D47081D83@illinois.edu>


On Sep 16, 2008, at 12:18 AM, Han, Mira wrote:

> Hi,
> Just writing to summarize the final product of this summer. (even  
> though it's overdue)

BLTN

> The phyloXML support in BioPerl project is finished officially,
> I've created three new modules,
> Bio::TreeIO::phyloxml,
> Bio::Tree::AnnotatableNode,
> and Bio::Annotation::Relation.
> The parsing is done for all elements except for <ProteinDomain>
> And the validation step is still missing.
> I'm planning to add those in in the future.

Great work!  One issue that will come up: have you tested round- 
tripping?

(i.e. where object data read in from the original phlyoxml data is the  
same as object data read in from bioperl-derived phyloxml output)

> I was contemplating to make a Bio::Annotation::XML till the end,
> But decided not to since there was already a new module  
> Bio::Annotation::TagTree, that looked like the same thing.
> Currently, the module does not use TagTree, it uses nested  
> AnnotationCollections instead, because TagTree was a temporary stub  
> at the time.

I would consider it no longer temporary (just changed it in svn).  The  
'stub' part was left over from the initial commit; it has now been  
tested with bioperl-db (via swissprot tests).  It may need more  
rigorous testing via bioperl-db but it appears to work just fine  
(famous last words...).

There was one issue with Data::Stag (repeated 'Use of undefined  
variable' errors that popped up with Annotation.t tests), but Chris M.  
released a new Data::Stag to CPAN just recently which fixes that.  It  
wasn't a bioperl bug and was relatively harmless.

> There are methods in phyloxml that seem out of place there,
> For example, the print_annotation and print_attr functions that  
> print the annotations in phyloXML format.
> Or the read_annotation function that reads the value of the  
> annotation for a certain object.
> I feel like these functions should go with the Annotation object,
> But since there were no Annotation object that is phyloXML specific,
> I just put them in the TreeIO::phyloxml.
> This may change too in the future.

I don't see a problem with this; if you look at the various IO parsers  
there are several helper methods present (see Bio::SeqIO::genbank for  
an example).

If you were to go that route, I would add a method to the (generic)  
Annotation class that accepts some customization via a callback, maybe  
using a default callback if one isn't supplied.  See the various  
Bio::AnnotationI display_text methods, which were added in as a more  
explicit replacement for operator overloading.

> The documentations are all finished and can be seen in
> http://www.bioperl.org/wiki/Module:Bio::TreeIO::phyloxml
> http://www.bioperl.org/wiki/Module:Bio::Tree::AnnotatableNode
> http://www.bioperl.org/wiki/Module:Bio::Annotation::Relation
>
> The detailed progress of the project is documented in
> http://www.bioperl.org/wiki/PhyloXML_support_in_BioPerl
>
> and there is also a demo page that describes the use in
> http://www.bioperl.org/wiki/Phyloxml_Project_Demo

I'll give them a look over, but that's a great start!

> Finally I'd like to thank Chris Fields and Hilmar Lapp,
> for the constant support during the summer.
> And the people on the list for providing helpful suggestions when I  
> came with a question.
> See you around.
>
> Mira Han

Thanks, and congrats on completeing the summer of code!  Hope you  
stick around a bit longer; we need all the hands we can get.

chris


From gundalav at gmail.com  Thu Sep 18 04:51:54 2008
From: gundalav at gmail.com (Gundala Viswanath)
Date: Thu, 18 Sep 2008 17:51:54 +0900
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with
	Bioperl
Message-ID: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>

Dear all,

Is there a way I can convert such EnSeMBL
probe names into Gene Symbol with BioPerl?

ENSG00000000003_at
ENSG00000000005_at
ENSG00000000419_at
ENSG00000000457_at
ENSG00000000460_at
ENSG00000000938_at
ENSG00000000971_at
ENSG00000001036_at
ENSG00000001084_at
ENSG00000001167_at
ENSG00000001461_at
ENSG00000001497_at
ENSG00000001561_at
... etc ...

Or perhaps there is a flat file for conversion?



- Gundala Viswanath
Jakarta - Indonesia


From cjfields at illinois.edu  Thu Sep 18 08:07:52 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 18 Sep 2008 07:07:52 -0500
Subject: [Bioperl-l] Species.t tests failing with bioperl-live
Message-ID: <C67B2790-EC0C-4F3A-A026-20CFBAE92B74@illinois.edu>

I'm getting a couple of failed tests with

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From cjfields at illinois.edu  Thu Sep 18 08:15:03 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 18 Sep 2008 07:15:03 -0500
Subject: [Bioperl-l] Species.t tests failing with bioperl-live
In-Reply-To: <C67B2790-EC0C-4F3A-A026-20CFBAE92B74@illinois.edu>
References: <C67B2790-EC0C-4F3A-A026-20CFBAE92B74@illinois.edu>
Message-ID: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>


On Sep 18, 2008, at 7:07 AM, Chris Fields wrote:

> I'm getting a couple of failed tests with


Um, that was supposed to be:

I'm getting a couple of failed tests with Species.t; I think these are  
due to the last commit to Bio::Species:

http://code.open-bio.org/svnweb/index.cgi/bioperl/revision/?rev=14793

Tests pass after commenting out that line.

chris


From bernd.web at gmail.com  Thu Sep 18 13:34:49 2008
From: bernd.web at gmail.com (Bernd Web)
Date: Thu, 18 Sep 2008 19:34:49 +0200
Subject: [Bioperl-l] SimpleAlign/AlignIO
Message-ID: <716af09c0809181034w2f9cc44do6b2a02502ea81fea@mail.gmail.com>

Hi,

Possibly I overlooked this, but is it not possible to supply an
alphabet to SimpleAlign?
When SimpleAlign starts making sequence objects _guess_alphabet is
executed and in case the sequence (slice) only contains gaps a warning
is raised as the alphabet cannot be guessed.
As all sequences in the alignment (generally) would be of the same
type, it could be good to set the alpabet for the alignment; this also
would prevent the executing of _guess_alphabet for all sequences. Is
this possible?


Regards,
Bernd


From cjfields at illinois.edu  Thu Sep 18 13:56:56 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 18 Sep 2008 12:56:56 -0500
Subject: [Bioperl-l] SimpleAlign/AlignIO
In-Reply-To: <716af09c0809181034w2f9cc44do6b2a02502ea81fea@mail.gmail.com>
References: <716af09c0809181034w2f9cc44do6b2a02502ea81fea@mail.gmail.com>
Message-ID: <9012F474-5762-4ABA-ADAB-7F0ECB38ACC3@illinois.edu>

Bernd,

I'm not sure it's a good idea to constrain the entire alignment (and  
all sequences contained within) to a single alphabet.  For instance,  
what if I wanted to align a translated (protein) sequence, possibly as  
3- or 6-frame, to a DNA sequence of interest?  Or if I wanted to align  
a Meta sequence w/o an alphabet (i.e. a structural consensus sequence)  
with a DNA/RNA/protein sequence?  The former example is fairly common  
and may not be entirely possible with SimpleAlign (I haven't tried it  
to tell the truth), but the latter is what I do with the Stockholm  
parser.

chris

On Sep 18, 2008, at 12:34 PM, Bernd Web wrote:

> Hi,
>
> Possibly I overlooked this, but is it not possible to supply an
> alphabet to SimpleAlign?
> When SimpleAlign starts making sequence objects _guess_alphabet is
> executed and in case the sequence (slice) only contains gaps a warning
> is raised as the alphabet cannot be guessed.
> As all sequences in the alignment (generally) would be of the same
> type, it could be good to set the alpabet for the alignment; this also
> would prevent the executing of _guess_alphabet for all sequences. Is
> this possible?
>
>
> Regards,
> Bernd
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From MEC at stowers-institute.org  Thu Sep 18 17:20:02 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Thu, 18 Sep 2008 16:20:02 -0500
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
	with	Bioperl
In-Reply-To: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>

Gundala,

Here is an option - if you want a script...

http://research.stowers-institute.org/mec/software/scripts/affyprobeset2ensg/

It is not bioperl.   It is perl.  It uses DBI to query the ensembl MySQL database using SQL.  It may be outdated due to changes in Ensembl schema.

Good luck,

Malcolm Cook
Stowers Institute for Medical Research - Kansas City, Missouri

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Gundala Viswanath
Sent: Thursday, September 18, 2008 3:52 AM
To: bioperl-l at lists.open-bio.org
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with Bioperl

Dear all,

Is there a way I can convert such EnSeMBL probe names into Gene Symbol with BioPerl?

ENSG00000000003_at
ENSG00000000005_at
ENSG00000000419_at
ENSG00000000457_at
ENSG00000000460_at
ENSG00000000938_at
ENSG00000000971_at
ENSG00000001036_at
ENSG00000001084_at
ENSG00000001167_at
ENSG00000001461_at
ENSG00000001497_at
ENSG00000001561_at
... etc ...

Or perhaps there is a flat file for conversion?



- Gundala Viswanath
Jakarta - Indonesia
_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l



From anjan.purkayastha at gmail.com  Thu Sep 18 17:27:06 2008
From: anjan.purkayastha at gmail.com (ANJAN PURKAYASTHA)
Date: Thu, 18 Sep 2008 17:27:06 -0400
Subject: [Bioperl-l] Retrieving taxonomy information from a GenBank file
Message-ID: <f03f40920809181427k168bfc3cu535c023949735cd9@mail.gmail.com>

Hi,
I'm using the following code to access the "ORGANISM" tag value for the
record NC_002526.
I get a value of 0 even though the ORGANISM tag  has a value.  Any idea how
this might be corrected?
Thanks.
Anjan


my $gb= new Bio::DB::GenBank;

my $seq = $gb->get_Seq_by_acc('NC_002526');

my $des= $seq->get_tag_values("ORGANISM");

-- 
=============================
anjan purkayastha, phd
bioinformatics analyst
whitehead institute for biomedical research
nine cambridge center
cambridge, ma 02142

purkayas [at] wi [dot] mit [dot] edu
703.740.6939


From jason at bioperl.org  Thu Sep 18 17:51:54 2008
From: jason at bioperl.org (Jason Stajich)
Date: Thu, 18 Sep 2008 14:51:54 -0700
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with
	Bioperl
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
Message-ID: <F1CAA89B-D7E9-40B3-9965-9636B4F5F852@bioperl.org>

seems like something that biomart was designed for? There is a  
scripting interface too.
http://biomart.org/

On Sep 18, 2008, at 2:20 PM, Cook, Malcolm wrote:

> Gundala,
>
> Here is an option - if you want a script...
>
> http://research.stowers-institute.org/mec/software/scripts/affyprobeset2ensg/
>
> It is not bioperl.   It is perl.  It uses DBI to query the ensembl  
> MySQL database using SQL.  It may be outdated due to changes in  
> Ensembl schema.
>
> Good luck,
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org 
> ] On Behalf Of Gundala Viswanath
> Sent: Thursday, September 18, 2008 3:52 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol  
> with Bioperl
>
> Dear all,
>
> Is there a way I can convert such EnSeMBL probe names into Gene  
> Symbol with BioPerl?
>
> ENSG00000000003_at
> ENSG00000000005_at
> ENSG00000000419_at
> ENSG00000000457_at
> ENSG00000000460_at
> ENSG00000000938_at
> ENSG00000000971_at
> ENSG00000001036_at
> ENSG00000001084_at
> ENSG00000001167_at
> ENSG00000001461_at
> ENSG00000001497_at
> ENSG00000001561_at
> ... etc ...
>
> Or perhaps there is a flat file for conversion?
>
>
>
> - Gundala Viswanath
> Jakarta - Indonesia
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From jason at bioperl.org  Thu Sep 18 17:56:18 2008
From: jason at bioperl.org (Jason Stajich)
Date: Thu, 18 Sep 2008 14:56:18 -0700
Subject: [Bioperl-l] Retrieving taxonomy information from a GenBank file
In-Reply-To: <f03f40920809181427k168bfc3cu535c023949735cd9@mail.gmail.com>
References: <f03f40920809181427k168bfc3cu535c023949735cd9@mail.gmail.com>
Message-ID: <E078758D-D451-4973-A66D-2D6D829FCA53@bioperl.org>

You want the species object ($seq->species)  -- see the Seq HOWTO,  
much of the Seq API is explained.
  http://bioperl.org/wiki/HOWTO:Feature-Annotation#The_Species_Object

-jason
On Sep 18, 2008, at 2:27 PM, ANJAN PURKAYASTHA wrote:

> Hi,
> I'm using the following code to access the "ORGANISM" tag value for  
> the
> record NC_002526.
> I get a value of 0 even though the ORGANISM tag  has a value.  Any  
> idea how
> this might be corrected?
> Thanks.
> Anjan
>
>
> my $gb= new Bio::DB::GenBank;
>
> my $seq = $gb->get_Seq_by_acc('NC_002526');
>
> my $des= $seq->get_tag_values("ORGANISM");
>
> -- 
> =============================
> anjan purkayastha, phd
> bioinformatics analyst
> whitehead institute for biomedical research
> nine cambridge center
> cambridge, ma 02142
>
> purkayas [at] wi [dot] mit [dot] edu
> 703.740.6939
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From cjfields at illinois.edu  Thu Sep 18 17:48:26 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 18 Sep 2008 16:48:26 -0500
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
	with	Bioperl
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
Message-ID: <0F56A0A4-AE10-4930-B479-C4D0818EAC7A@illinois.edu>

You can probably use the Ensembl perl API alone or in combination with  
bioperl.  I'm not sure it is working with the latest code (bioperl- 
live), but it's worth a try:

http://www.ensembl.org/info/using/api/core/core_tutorial.html
http://www.bioperl.org/wiki/HOWTO:Getting_Genomic_Sequences#Using_the_Perl_API_at_ENSEMBL

chris

On Sep 18, 2008, at 4:20 PM, Cook, Malcolm wrote:

> Gundala,
>
> Here is an option - if you want a script...
>
> http://research.stowers-institute.org/mec/software/scripts/affyprobeset2ensg/
>
> It is not bioperl.   It is perl.  It uses DBI to query the ensembl  
> MySQL database using SQL.  It may be outdated due to changes in  
> Ensembl schema.
>
> Good luck,
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org 
> ] On Behalf Of Gundala Viswanath
> Sent: Thursday, September 18, 2008 3:52 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol  
> with Bioperl
>
> Dear all,
>
> Is there a way I can convert such EnSeMBL probe names into Gene  
> Symbol with BioPerl?
>
> ENSG00000000003_at
> ENSG00000000005_at
> ENSG00000000419_at
> ENSG00000000457_at
> ENSG00000000460_at
> ENSG00000000938_at
> ENSG00000000971_at
> ENSG00000001036_at
> ENSG00000001084_at
> ENSG00000001167_at
> ENSG00000001461_at
> ENSG00000001497_at
> ENSG00000001561_at
> ... etc ...
>
> Or perhaps there is a flat file for conversion?
>
>
>
> - Gundala Viswanath
> Jakarta - Indonesia
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From spiros at lokku.com  Fri Sep 19 06:17:52 2008
From: spiros at lokku.com (Spiros Denaxas)
Date: Fri, 19 Sep 2008 11:17:52 +0100
Subject: [Bioperl-l] code coverage metrics
Message-ID: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>

Hello,

I recently sent Chris an email about an idea I had, quantifying (and
improving) the test coverage that we currently have on the bioperl
core. I know there's a list on the wiki [1] with a list of tests that
have low coverage and/or complete lack of tests. My idea was to
somehow standardize and automate the generation of this list,
preferably on a weekly basis initially. We can then more easily see
where help is needed and possible assign individual tasks to tackle
the most-suffering modules.

There are currently several very good CPAN modules that do this, like
Devel::Cover [2]. Is there any objection if I kick this off and start
doing some work, aiming into creating a more detailed report on code
coverage using the current HEAD and test suite?

Spiros

[1] http://www.bioperl.org/wiki/Untested_Modules_in_BioPerl
[2] http://search.cpan.org/dist/Devel-Cover/lib/Devel/Cover.pm


From spiros at lokku.com  Fri Sep 19 07:51:29 2008
From: spiros at lokku.com (Spiros Denaxas)
Date: Fri, 19 Sep 2008 12:51:29 +0100
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <48D391BD.5010105@sendu.me.uk>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
	<48D391BD.5010105@sendu.me.uk>
Message-ID: <bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>

On Fri, Sep 19, 2008 at 12:49 PM, Sendu Bala <bix at sendu.me.uk> wrote:
> Spiros Denaxas wrote:
>>
>> There are currently several very good CPAN modules that do this, like
>> Devel::Cover [2]. Is there any objection if I kick this off and start
>> doing some work, aiming into creating a more detailed report on code
>> coverage using the current HEAD and test suite?
>
> You should read our previous discussion here:
> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/14586/focus=14588
>
> Basically I think we have it all in place now; someone just needs to take
> that last step and run a cron job that runs the Build commands. We also need
> the website side of things sorted out I think.
>
> If you could make those things happen and take care of any issues that crop
> up, that would be great.
>

Enlightening, thank you for pointing that out. I will have a look, I
don't see a problem with the plan.

Spiros


From spiros at lokku.com  Fri Sep 19 08:01:15 2008
From: spiros at lokku.com (Spiros Denaxas)
Date: Fri, 19 Sep 2008 13:01:15 +0100
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
	<48D391BD.5010105@sendu.me.uk>
	<bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
Message-ID: <bba689ec0809190501v56cb4eedx159410c2ebf76c7a@mail.gmail.com>

>
> Enlightening, thank you for pointing that out. I will have a look, I
> don't see a problem with the plan.
>
> Spiros
>

I have also updated the wiki to make sure we avoid duplicate effort on
this, http://www.bioperl.org/wiki/Project_priority_list

Spiros


From bix at sendu.me.uk  Fri Sep 19 07:49:17 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 19 Sep 2008 12:49:17 +0100
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
Message-ID: <48D391BD.5010105@sendu.me.uk>

Spiros Denaxas wrote:
> There are currently several very good CPAN modules that do this, like
> Devel::Cover [2]. Is there any objection if I kick this off and start
> doing some work, aiming into creating a more detailed report on code
> coverage using the current HEAD and test suite?

You should read our previous discussion here:
http://thread.gmane.org/gmane.comp.lang.perl.bio.general/14586/focus=14588

Basically I think we have it all in place now; someone just needs to 
take that last step and run a cron job that runs the Build commands. We 
also need the website side of things sorted out I think.

If you could make those things happen and take care of any issues that 
crop up, that would be great.


From cjfields at illinois.edu  Fri Sep 19 08:22:02 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 19 Sep 2008 07:22:02 -0500
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
	<48D391BD.5010105@sendu.me.uk>
	<bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
Message-ID: <0C6AAAEE-5D80-4102-B03D-FE0C045492AA@illinois.edu>


On Sep 19, 2008, at 6:51 AM, Spiros Denaxas wrote:

> On Fri, Sep 19, 2008 at 12:49 PM, Sendu Bala <bix at sendu.me.uk> wrote:
>> Spiros Denaxas wrote:
>>>
>>> There are currently several very good CPAN modules that do this,  
>>> like
>>> Devel::Cover [2]. Is there any objection if I kick this off and  
>>> start
>>> doing some work, aiming into creating a more detailed report on code
>>> coverage using the current HEAD and test suite?
>>
>> You should read our previous discussion here:
>> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/14586/focus=14588
>>
>> Basically I think we have it all in place now; someone just needs  
>> to take
>> that last step and run a cron job that runs the Build commands. We  
>> also need
>> the website side of things sorted out I think.
>>
>> If you could make those things happen and take care of any issues  
>> that crop
>> up, that would be great.
>>
>
> Enlightening, thank you for pointing that out. I will have a look, I
> don't see a problem with the plan.
>
> Spiros

Didn't know it was that far along!  Any help pushing this along would  
be wonderful.

chris


From MEC at stowers-institute.org  Fri Sep 19 09:06:08 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Fri, 19 Sep 2008 08:06:08 -0500
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with
 Bioperl
In-Reply-To: <F1CAA89B-D7E9-40B3-9965-9636B4F5F852@bioperl.org>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
	<F1CAA89B-D7E9-40B3-9965-9636B4F5F852@bioperl.org>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD5867@exchmb-02.stowers-institute.org>

Jason,

Yes .... Biomart .... If I remember correctly, at the time I wrote the script, the problem with using biomart interactively for this task was that though you could query for genes or transcripts by affy id, the results would not include the term you queried with, so, you just get a list of genes that match any of your affyids without knowing which goes with which.

But perhaps I was wrong.  Certainly I see now that it is possible interactively to return the affyid for any gene for many standard probesets.

Cheers,

Malcolm Cook

-----Original Message-----
From: Jason Stajich [mailto:jason.stajich at gmail.com] On Behalf Of Jason Stajich
Sent: Thursday, September 18, 2008 4:52 PM
To: Cook, Malcolm
Cc: 'Gundala Viswanath'; 'bioperl-l at lists.open-bio.org'
Subject: Re: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with Bioperl

seems like something that biomart was designed for? There is a scripting interface too.
http://biomart.org/

On Sep 18, 2008, at 2:20 PM, Cook, Malcolm wrote:

> Gundala,
>
> Here is an option - if you want a script...
>
> http://research.stowers-institute.org/mec/software/scripts/affyprobese
> t2ensg/
>
> It is not bioperl.   It is perl.  It uses DBI to query the ensembl
> MySQL database using SQL.  It may be outdated due to changes in
> Ensembl schema.
>
> Good luck,
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org
> ] On Behalf Of Gundala Viswanath
> Sent: Thursday, September 18, 2008 3:52 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
> with Bioperl
>
> Dear all,
>
> Is there a way I can convert such EnSeMBL probe names into Gene Symbol
> with BioPerl?
>
> ENSG00000000003_at
> ENSG00000000005_at
> ENSG00000000419_at
> ENSG00000000457_at
> ENSG00000000460_at
> ENSG00000000938_at
> ENSG00000000971_at
> ENSG00000001036_at
> ENSG00000001084_at
> ENSG00000001167_at
> ENSG00000001461_at
> ENSG00000001497_at
> ENSG00000001561_at
> ... etc ...
>
> Or perhaps there is a flat file for conversion?
>
>
>
> - Gundala Viswanath
> Jakarta - Indonesia
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org






From MEC at stowers-institute.org  Fri Sep 19 09:09:00 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Fri, 19 Sep 2008 08:09:00 -0500
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
	with	Bioperl
In-Reply-To: <0F56A0A4-AE10-4930-B479-C4D0818EAC7A@illinois.edu>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
	<0F56A0A4-AE10-4930-B479-C4D0818EAC7A@illinois.edu>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD5868@exchmb-02.stowers-institute.org>


Chris is right- the Ensembl perl API works fine. If you care to go this route and want to crib the code, you will see that my script has a commented out implementation using Ensembl perl API - it suffered from being MUCH TOO SLOOOOOOOOOO - accessing the tables directly was MUCH faster (unpublished correspondance with self)

However, the API is much more likely to be backwards compatible in the face of database schema changes at Ensembl....

Malcolm Cook

-----Original Message-----
From: Chris Fields [mailto:cjfields at illinois.edu]
Sent: Thursday, September 18, 2008 4:48 PM
To: Cook, Malcolm
Cc: 'Gundala Viswanath'; 'bioperl-l at lists.open-bio.org'
Subject: Re: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with Bioperl

You can probably use the Ensembl perl API alone or in combination with bioperl.  I'm not sure it is working with the latest code (bioperl- live), but it's worth a try:

http://www.ensembl.org/info/using/api/core/core_tutorial.html
http://www.bioperl.org/wiki/HOWTO:Getting_Genomic_Sequences#Using_the_Perl_API_at_ENSEMBL

chris

On Sep 18, 2008, at 4:20 PM, Cook, Malcolm wrote:

> Gundala,
>
> Here is an option - if you want a script...
>
> http://research.stowers-institute.org/mec/softyware/scripts/affyprobese
> t2ensg/
>
> It is not bioperl.   It is perl.  It uses DBI to query the ensembl
> MySQL database using SQL.  It may be outdated due to changes in
> Ensembl schema.
>
> Good luck,
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org
> ] On Behalf Of Gundala Viswanath
> Sent: Thursday, September 18, 2008 3:52 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
> with Bioperl
>
> Dear all,
>
> Is there a way I can convert such EnSeMBL probe names into Gene Symbol
> with BioPerl?
>
> ENSG00000000003_at
> ENSG00000000005_at
> ENSG00000000419_at
> ENSG00000000457_at
> ENSG00000000460_at
> ENSG00000000938_at
> ENSG00000000971_at
> ENSG00000001036_at
> ENSG00000001084_at
> ENSG00000001167_at
> ENSG00000001461_at
> ENSG00000001497_at
> ENSG00000001561_at
> ... etc ...
>
> Or perhaps there is a flat file for conversion?
>
>
>
> - Gundala Viswanath
> Jakarta - Indonesia
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign







From mauricio at open-bio.org  Fri Sep 19 10:06:22 2008
From: mauricio at open-bio.org (Mauricio Herrera Cuadra)
Date: Fri, 19 Sep 2008 09:06:22 -0500
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <0C6AAAEE-5D80-4102-B03D-FE0C045492AA@illinois.edu>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>	<48D391BD.5010105@sendu.me.uk>	<bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
	<0C6AAAEE-5D80-4102-B03D-FE0C045492AA@illinois.edu>
Message-ID: <48D3B1DE.7070505@open-bio.org>

Sorry guys, this has been my fault due to lack of time. I have a very 
old ticket waiting for me at the OBF Helpdesk to get the website side of 
things done. Spiros, I have some spare time today to try setting it up, 
assign it to me in the wiki list if you want, I'll send an update in a 
couple of days.

Thanks,
Mauricio.


Chris Fields wrote:
> 
> On Sep 19, 2008, at 6:51 AM, Spiros Denaxas wrote:
> 
>> On Fri, Sep 19, 2008 at 12:49 PM, Sendu Bala <bix at sendu.me.uk> wrote:
>>> Spiros Denaxas wrote:
>>>>
>>>> There are currently several very good CPAN modules that do this, like
>>>> Devel::Cover [2]. Is there any objection if I kick this off and start
>>>> doing some work, aiming into creating a more detailed report on code
>>>> coverage using the current HEAD and test suite?
>>>
>>> You should read our previous discussion here:
>>> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/14586/focus=14588 
>>>
>>>
>>> Basically I think we have it all in place now; someone just needs to 
>>> take
>>> that last step and run a cron job that runs the Build commands. We 
>>> also need
>>> the website side of things sorted out I think.
>>>
>>> If you could make those things happen and take care of any issues 
>>> that crop
>>> up, that would be great.
>>>
>>
>> Enlightening, thank you for pointing that out. I will have a look, I
>> don't see a problem with the plan.
>>
>> Spiros
> 
> Didn't know it was that far along!  Any help pushing this along would be 
> wonderful.
> 
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 


From heikki at sanbi.ac.za  Fri Sep 19 12:22:23 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Fri, 19 Sep 2008 18:22:23 +0200
Subject: [Bioperl-l] phylogeny-trait association methods into BioPerl
In-Reply-To: <200809101332.07137.heikki@sanbi.ac.za>
References: <200809101332.07137.heikki@sanbi.ac.za>
Message-ID: <200809191822.23503.heikki@sanbi.ac.za>

The code is now in SVN. Bio::Tree::TreeFunctionsI::add_trait() can be used to 
set trait values in a tree.

Enjoy,

   -Heikki

On Wednesday 10 September 2008 13:32:06 Heikki Lehvaslaiho wrote:
> FYI,
>
> I've been recently writing code to analyse phylogeny-trait associations.
> These traits are typically geographical location of the sequence but they
> can be any phenotypic characters associated with the sequences.
>
> This involves trees, i.e. Bio::Tree::Tree and Bio::Tree::Node objects and
> strings describing the traits. I've been using tags to store trait values
> within nodes. The tag methods are:
>
> Bio::Tree::Node::add_tag_value
> Bio::Tree::Node::get_all_tags
> Bio::Tree::Node::get_tag_values
> Bio::Tree::Node::has_tag
> Bio::Tree::Node::remove_all_tags
> Bio::Tree::Node::remove_tag
>
> Question: Is  there any particular reason why there is no
> set_tag_value(scalar|@array) method?
>
> I am getting tired of writing:
>   $node->remove_tag($key);
>   map {$node->add_tag_value($key)} @values ;
> so I am going to implement that unless there is are strong objections.
>
> Otherwise it has been smooth sailing. I am going to add
> Bio::Tree::TreeFunctions::is_binary() and start populating
> Bio::Tree::Statistics soon with these methods:
>
> ps() - Parsimony Score (PS) from Fitch 1971
> ai() - Association index (AI) of Whang et al. 2001
> mc() - Monophyletic Clade (MC) size statistics by Salemi at al. 2005
> cherries() - number of leaf node pairs
>
> If you have any comments, please feel free to post them here.
>
>     -Heikki

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From hartzell at alerce.com  Tue Sep 23 17:16:48 2008
From: hartzell at alerce.com (George Hartzell)
Date: Tue, 23 Sep 2008 14:16:48 -0700
Subject: [Bioperl-l] confused about version numbers.
Message-ID: <18649.23744.832478.551299@almost.alerce.com>


I recently realized that I needed a feature from
Bio::Search::Hit::GenericHit that exists in the svn trunk but isn't in
the CPAN's version bioperl-1.5.2_102.

I thought I'd just specify a version number in my Build.PL and that
way I could sleep soundly.

But, it looks like $Version in CPAN's Bio::Root::Version is
1.005002_102 while in the trunk it's 1.005002_100.

What's the proper way for a Build.PL to be sure that it has a current
bioperl?

g.


From sac at bioperl.org  Tue Sep 23 18:05:15 2008
From: sac at bioperl.org (Steve Chervitz)
Date: Tue, 23 Sep 2008 15:05:15 -0700
Subject: [Bioperl-l] confused about version numbers.
In-Reply-To: <18649.23744.832478.551299@almost.alerce.com>
References: <18649.23744.832478.551299@almost.alerce.com>
Message-ID: <8f200b4c0809231505p6b3f9e77i278f52bcc355489@mail.gmail.com>

Here's the general recommendation from the FAQ:

http://bio.perl.org/wiki/FAQ#How_can_I_tell_what_version_of_BioPerl_is_installed.3F

Not sure the recommended way to do this from a Build.PL. You could so such
checking within a BEGIN block in your Build.PL, perhaps.

Steve

On Tue, Sep 23, 2008 at 2:16 PM, George Hartzell <hartzell at alerce.com>wrote:

>
> I recently realized that I needed a feature from
> Bio::Search::Hit::GenericHit that exists in the svn trunk but isn't in
> the CPAN's version bioperl-1.5.2_102.
>
> I thought I'd just specify a version number in my Build.PL and that
> way I could sleep soundly.
>
> But, it looks like $Version in CPAN's Bio::Root::Version is
> 1.005002_102 while in the trunk it's 1.005002_100.
>
> What's the proper way for a Build.PL to be sure that it has a current
> bioperl?
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From bix at sendu.me.uk  Tue Sep 23 17:51:57 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 23 Sep 2008 22:51:57 +0100
Subject: [Bioperl-l] confused about version numbers.
In-Reply-To: <18649.23744.832478.551299@almost.alerce.com>
References: <18649.23744.832478.551299@almost.alerce.com>
Message-ID: <48D964FD.7060007@sendu.me.uk>

George Hartzell wrote:
> I recently realized that I needed a feature from
> Bio::Search::Hit::GenericHit that exists in the svn trunk but isn't in
> the CPAN's version bioperl-1.5.2_102.
> 
> I thought I'd just specify a version number in my Build.PL and that
> way I could sleep soundly.
> 
> But, it looks like $Version in CPAN's Bio::Root::Version is
> 1.005002_102 while in the trunk it's 1.005002_100.

Fixed. It's now 1.005002_103.


> What's the proper way for a Build.PL to be sure that it has a current
> bioperl?

Your method was sound, I think.


From cjfields at illinois.edu  Tue Sep 23 21:23:25 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 23 Sep 2008 20:23:25 -0500
Subject: [Bioperl-l] Bio::Species bug,
	was  Species.t tests failing with bioperl-live
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
Message-ID: <CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>

I'm reposting this in case it was lost (or forgotten).  I'll file it  
as a bug if it's not addressed fairly soonish, but I would consider  
this a serious blocker for a 1.6 release.  Any help would be   
appreciated.

The last commit to Bio::Species, which was an effort to fix a memory  
leak, has unfortunately broken Species.t tests.  The relevant commit  
used weaken(); my guess is something is being garbage collected way  
too early.  Any ideas?

chris

Begin forwarded message:

> From: Chris Fields <cjfields at illinois.edu>
> Date: September 18, 2008 7:15:03 AM CDT
> To: Chris Fields <cjfields at illinois.edu>
> Cc: BioPerl List <bioperl-l at lists.open-bio.org>
> Subject: Re: [Bioperl-l] Species.t tests failing with bioperl-live
>
>
> On Sep 18, 2008, at 7:07 AM, Chris Fields wrote:
>
>> I'm getting a couple of failed tests with
>
>
> Um, that was supposed to be:
>
> I'm getting a couple of failed tests with Species.t; I think these  
> are due to the last commit to Bio::Species:
>
> http://code.open-bio.org/svnweb/index.cgi/bioperl/revision/?rev=14793
>
> Tests pass after commenting out that line.
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




From Caroline.Johnston at iop.kcl.ac.uk  Wed Sep 24 10:19:05 2008
From: Caroline.Johnston at iop.kcl.ac.uk (Johnston, Caroline)
Date: Wed, 24 Sep 2008 15:19:05 +0100
Subject: [Bioperl-l] Using Storable with SeqFeatures
Message-ID: <5626ED9CB91C814197079FB9940312E506445F9B@MAIL.bc.iop.kcl.ac.uk>

Hello.

I'm trying to use Storable to save a Bio::Seq object and Storable seems to be having a weird problem dealing with freezing and thawing the code ref to Bio::SeqFeature::Generic cleanup_generic. If I change one line (931) in that function from

    foreach my $t ( keys %{$self->{'_gsf_tag_hash'} || {} } ) {
                                                    ------
 to

    foreach my $t ( keys %{$self->{'_gsf_tag_hash'} } ) {

it works fine. I've pasted an example script at http://sial.org/pbot/32320.

Any ideas why this syntax would break Storable? Would wrapping the foreach in an if(defined $self->{'_gsf_tag_hash'}) serve to replace the || {} ?

I get the same problem using Bio::Root::Storable.

Cxx 



From cain.cshl at gmail.com  Wed Sep 24 18:00:35 2008
From: cain.cshl at gmail.com (Scott Cain)
Date: Wed, 24 Sep 2008 18:00:35 -0400
Subject: [Bioperl-l] genbank2gff.pl choking on CONTIG sections
Message-ID: <536f21b00809241500x5414289ayea143c7124758f5e@mail.gmail.com>

Hi all,

The BioPerl script bp_genbank2gff.pl, which will either convert a
Genbank record to GFF or load it directly to a Bio::DB::GFF database,
is choking on GenBank records with CONTIG sections.  Since I don't
think these would ever be useful for generating GFF or loading into a
database (ie, the user will want to get all of the features on the
parts, not know what the parts are), is there a way to force a
Bio::DB::WebDBSeqI/Bio::DB::BioFetch to get the full record (like
specifying view=gbwithparts in the url at ncbi)?

Thanks,
Scott


-- 
------------------------------------------------------------------------
Scott Cain, Ph. D. cain.cshl at gmail.com
GMOD Coordinator (http://gmod.org/) 216-392-3087
Cold Spring Harbor Laboratory


From jason at bioperl.org  Wed Sep 24 19:05:18 2008
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 24 Sep 2008 16:05:18 -0700
Subject: [Bioperl-l] genbank2gff.pl choking on CONTIG sections
In-Reply-To: <536f21b00809241500x5414289ayea143c7124758f5e@mail.gmail.com>
References: <536f21b00809241500x5414289ayea143c7124758f5e@mail.gmail.com>
Message-ID: <5D6FEF22-76B7-4770-B749-A643AFF99169@bioperl.org>

It should already if it is using Bio::DB::GenBank -- do you have  
example of a fail?  There seems to be some defaulting to EMBL for the  
source in the biofetch code so it might be worth twiddling.

from Bio::DB::GenBank

Note that when querying for GenBank accessions starting with 'NT_' you
will need to call $gb->request_format('fasta') beforehand, because
in GenBank format (the default) the sequence part will be left out
(the reason is that NT contigs are rather annotation with references
to clones).

Some work has been done to automatically detect and retrieve whole NT_  
clones
when the data is in that format (NCBI RefSeq clones). The former  
behavior prior
to bioperl 1.6 was to retrieve these from EBI, but now these are  
retrieved
directly from NCBI. The older behavior can be regained by setting the
'redirect_refseq' flag to a value evaluating to TRUE.


On Sep 24, 2008, at 3:00 PM, Scott Cain wrote:

> Hi all,
>
> The BioPerl script bp_genbank2gff.pl, which will either convert a
> Genbank record to GFF or load it directly to a Bio::DB::GFF database,
> is choking on GenBank records with CONTIG sections.  Since I don't
> think these would ever be useful for generating GFF or loading into a
> database (ie, the user will want to get all of the features on the
> parts, not know what the parts are), is there a way to force a
> Bio::DB::WebDBSeqI/Bio::DB::BioFetch to get the full record (like
> specifying view=gbwithparts in the url at ncbi)?
>
> Thanks,
> Scott
>
>
> -- 
> ------------------------------------------------------------------------
> Scott Cain, Ph. D. cain.cshl at gmail.com
> GMOD Coordinator (http://gmod.org/) 216-392-3087
> Cold Spring Harbor Laboratory
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From hartzell at alerce.com  Thu Sep 25 01:17:54 2008
From: hartzell at alerce.com (George Hartzell)
Date: Wed, 24 Sep 2008 22:17:54 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18651.7938.496813.710345@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > George,
 > 
 > This is an error from my side. Great that you have a fix already.
 > 
 > My only worry is the number of external dependencies in BioPerl. To limit 
 > these we have recoded number of functionalities into BioPerl-specific modules. 
 > Before you commit the fix, could you see if Bio::RangeI could be used or easily 
 > extended to be used instead of Set::IntSpan?
 > 
 > Thanks,
 > 
 >    -Heikki
 > 
 > On Friday 05 September 2008 21:01:35 George Hartzell wrote:
 > > Hi all,
 > >
 > > Bio::Coordinate::Collection surprised me a bit.  At first I thought
 > > there was a bug, but it's clearly doing what it's supposed to.  Now
 > > I'm wondering if what it's supposed to be doing makes sense in some
 > > context, or if what I expected would be better functionality.
 > >
 > > t/CoordinateMapper.t sets up the following scenario:
 > >
 > > #
 > > # Collection
 > > #
 > > #         1   5     6   10
 > > #         |---|     |---|
 > > #-----|-----------------------
 > > #     1   5   9     15  19
 > > #         pair1     pair2
 > >
 > > Then goes on to do the following query:
 > >
 > >   # match more than two
 > >   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
 > >   ok $res = $transcribe->map($pos);
 > >   is $res->each_gap, 2;
 > >   is $res->each_match, 2;
 > >
 > > I was surprised to see that there were two gaps, one gene:10-19 and
 > > one from gene:5-14.  Looking at the code, what's really happening is
 > > that, for the exon1 mapper there's match with gene:5-9 and a gap with
 > > gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
 > > match with gene:15-19.  All four Result's just get tossed into the
 > > return value.
 > >
 > > The result my intuition wants is that there are two matches (gene:5-9
 > > with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
 > >
 > > Yes, I guess that I could just synthesize these myself from the result
 > > in my app.
 > >
 > > It still seems that the current result is a bug though, since there's
 > > no way of knowing when you're walking through $res->each_Location that
 > > the first "gap" is with respect to the exon1 mapper and that the
 > > second "gap" is with respect to the exon2 mapper.  The gaps are
 > > meaningless.
 > >
 > > I "fixed" it to work the way I think it should (two matches, one
 > > gap).  I actually extended the test case a bit so that there's a
 > > multi-base gap, a match, another multibase-gap, another match, then a
 > > single base gap (just to make sure I got that right...).  I had to
 > > touch up the test file a bit to account for my new test.
 > >
 > > The gaps that I return have a strand of 'undef', which seems to be The
 > > Right Thing.  There's also a bit of funny business where I hang onto
 > > the seq_id of the gapped sequence.  It assumes that the "in" sequence
 > > is the same for all of the mappers.  This seems safe since otherwise
 > > the entire query is kind of weird....
 > >
 > > There's a patch to todays svn head at:
 > >
 > >   http://shrimp.alerce.com/bioperl/collection-diffs.txt
 > >
 > > The patch changes Build.PL to include a dependency on Set::IntSpan,
 > > CoordinateMapper.t to update the tests, and
 > > Bio/CoordinateMapper/Collection.pm for the new code.
 > >
 > > Who's code would this break.
 > >
 > > If anyone's relying on the current behaviour re: gaps, what's the
 > > situation in which you find it useful?
 > >
 > > Thanks!
 > >
 > > g.
 > [...]

So, I'm out of round 'tuit's trying to think of an _easy_ way to do
this using Range/RangeI.  I might just not be thinking clearly, and
I've definitely trained myself to solve these kinds of problems with
Set::IntSpan problems so I may just be waving my favorite hammer
around.

There may also be a BioPerl native way to do it using some fancier
object than a RangeI (split locations?).

It's easy to get the set of gaps for each pair, but is there already
something that takes the intersection of a set of non-intersecting
Range's?

g.


From hartzell at alerce.com  Thu Sep 25 01:17:54 2008
From: hartzell at alerce.com (George Hartzell)
Date: Wed, 24 Sep 2008 22:17:54 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18651.7938.496813.710345@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > George,
 > 
 > This is an error from my side. Great that you have a fix already.
 > 
 > My only worry is the number of external dependencies in BioPerl. To limit 
 > these we have recoded number of functionalities into BioPerl-specific modules. 
 > Before you commit the fix, could you see if Bio::RangeI could be used or easily 
 > extended to be used instead of Set::IntSpan?
 > 
 > Thanks,
 > 
 >    -Heikki
 > 
 > On Friday 05 September 2008 21:01:35 George Hartzell wrote:
 > > Hi all,
 > >
 > > Bio::Coordinate::Collection surprised me a bit.  At first I thought
 > > there was a bug, but it's clearly doing what it's supposed to.  Now
 > > I'm wondering if what it's supposed to be doing makes sense in some
 > > context, or if what I expected would be better functionality.
 > >
 > > t/CoordinateMapper.t sets up the following scenario:
 > >
 > > #
 > > # Collection
 > > #
 > > #         1   5     6   10
 > > #         |---|     |---|
 > > #-----|-----------------------
 > > #     1   5   9     15  19
 > > #         pair1     pair2
 > >
 > > Then goes on to do the following query:
 > >
 > >   # match more than two
 > >   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
 > >   ok $res = $transcribe->map($pos);
 > >   is $res->each_gap, 2;
 > >   is $res->each_match, 2;
 > >
 > > I was surprised to see that there were two gaps, one gene:10-19 and
 > > one from gene:5-14.  Looking at the code, what's really happening is
 > > that, for the exon1 mapper there's match with gene:5-9 and a gap with
 > > gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
 > > match with gene:15-19.  All four Result's just get tossed into the
 > > return value.
 > >
 > > The result my intuition wants is that there are two matches (gene:5-9
 > > with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
 > >
 > > Yes, I guess that I could just synthesize these myself from the result
 > > in my app.
 > >
 > > It still seems that the current result is a bug though, since there's
 > > no way of knowing when you're walking through $res->each_Location that
 > > the first "gap" is with respect to the exon1 mapper and that the
 > > second "gap" is with respect to the exon2 mapper.  The gaps are
 > > meaningless.
 > >
 > > I "fixed" it to work the way I think it should (two matches, one
 > > gap).  I actually extended the test case a bit so that there's a
 > > multi-base gap, a match, another multibase-gap, another match, then a
 > > single base gap (just to make sure I got that right...).  I had to
 > > touch up the test file a bit to account for my new test.
 > >
 > > The gaps that I return have a strand of 'undef', which seems to be The
 > > Right Thing.  There's also a bit of funny business where I hang onto
 > > the seq_id of the gapped sequence.  It assumes that the "in" sequence
 > > is the same for all of the mappers.  This seems safe since otherwise
 > > the entire query is kind of weird....
 > >
 > > There's a patch to todays svn head at:
 > >
 > >   http://shrimp.alerce.com/bioperl/collection-diffs.txt
 > >
 > > The patch changes Build.PL to include a dependency on Set::IntSpan,
 > > CoordinateMapper.t to update the tests, and
 > > Bio/CoordinateMapper/Collection.pm for the new code.
 > >
 > > Who's code would this break.
 > >
 > > If anyone's relying on the current behaviour re: gaps, what's the
 > > situation in which you find it useful?
 > >
 > > Thanks!
 > >
 > > g.
 > [...]

So, I'm out of round 'tuit's trying to think of an _easy_ way to do
this using Range/RangeI.  I might just not be thinking clearly, and
I've definitely trained myself to solve these kinds of problems with
Set::IntSpan problems so I may just be waving my favorite hammer
around.

There may also be a BioPerl native way to do it using some fancier
object than a RangeI (split locations?).

It's easy to get the set of gaps for each pair, but is there already
something that takes the intersection of a set of non-intersecting
Range's?

g.


From tatedger at googlemail.com  Thu Sep 25 11:23:46 2008
From: tatedger at googlemail.com (john paul)
Date: Thu, 25 Sep 2008 16:23:46 +0100
Subject: [Bioperl-l] Can't locate object method "get_dbxrefs"
Message-ID: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>

Hello guys,

I need to pick your brain on this. I was trying to load some sequences in a
fresh RH build using bioperl-db and got the following error:

[tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
--dbuser root --dbname biosql --namespace swissprot --format swiss
/home/tatedger/tmp/uniprot_sprot.dat  --testonly
Loading /home/tatedger/tmp/uniprot_sprot.dat ...
Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via package
"Bio::Ontology::Term" at
/usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
552, <GEN0> line 70.


I have seen some posts on this regard (
http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but it wasn't
clear to me what the solution would be.


My configuration:
- mysql version 4.1.7
- Red Hat Enterprise Linux ES release 4 (Nahant)

to install bioperl and bioperl-db I used the help found on the website
following
- cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
- svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
- biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.

bioperl-db  test 04 shows the same error.

[tatedger at localhost bioperl-db]$ perl t/04swiss.t
1..52
ok 1
ok 2
ok 3
ok 4
ok 5
Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
552, <GEN0> line 78.


my @INC file looks like
/usr/lib/perl5/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/5.8.5
/usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.5
/usr/lib/perl5/site_perl/5.8.4
/usr/lib/perl5/site_perl/5.8.3
/usr/lib/perl5/site_perl/5.8.2
/usr/lib/perl5/site_perl/5.8.1
/usr/lib/perl5/site_perl/5.8.0
/usr/lib/perl5/site_perl
/usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.5
/usr/lib/perl5/vendor_perl/5.8.4
/usr/lib/perl5/vendor_perl/5.8.3
/usr/lib/perl5/vendor_perl/5.8.2
/usr/lib/perl5/vendor_perl/5.8.1
/usr/lib/perl5/vendor_perl/5.8.0
/usr/lib/perl5/vendor_perl

What am I doing wrong? Could you help?

Thanks in advance for your help
Tom


From bosborne11 at verizon.net  Thu Sep 25 11:40:45 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Thu, 25 Sep 2008 11:40:45 -0400
Subject: [Bioperl-l] Can't locate object method "get_dbxrefs"
In-Reply-To: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
References: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
Message-ID: <2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>

John,

What does:

 >locate Bio/Ontology/Term.pm

Say?


Brian O.


On Sep 25, 2008, at 11:23 AM, john paul wrote:

> Hello guys,
>
> I need to pick your brain on this. I was trying to load some  
> sequences in a
> fresh RH build using bioperl-db and got the following error:
>
> [tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
> --dbuser root --dbname biosql --namespace swissprot --format swiss
> /home/tatedger/tmp/uniprot_sprot.dat  --testonly
> Loading /home/tatedger/tmp/uniprot_sprot.dat ...
> Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via  
> package
> "Bio::Ontology::Term" at
> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm  
> line
> 552, <GEN0> line 70.
>
>
> I have seen some posts on this regard (
> http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but  
> it wasn't
> clear to me what the solution would be.
>
>
> My configuration:
> - mysql version 4.1.7
> - Red Hat Enterprise Linux ES release 4 (Nahant)
>
> to install bioperl and bioperl-db I used the help found on the website
> following
> - cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
> - svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
> - biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.
>
> bioperl-db  test 04 shows the same error.
>
> [tatedger at localhost bioperl-db]$ perl t/04swiss.t
> 1..52
> ok 1
> ok 2
> ok 3
> ok 4
> ok 5
> Can't locate object method "get_dbxrefs" via package  
> "Bio::Ontology::Term"
> at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/ 
> PersistentObject.pm line
> 552, <GEN0> line 78.
>
>
> my @INC file looks like
> /usr/lib/perl5/5.8.5/i386-linux-thread-multi
> /usr/lib/perl5/5.8.5
> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.5
> /usr/lib/perl5/site_perl/5.8.4
> /usr/lib/perl5/site_perl/5.8.3
> /usr/lib/perl5/site_perl/5.8.2
> /usr/lib/perl5/site_perl/5.8.1
> /usr/lib/perl5/site_perl/5.8.0
> /usr/lib/perl5/site_perl
> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.5
> /usr/lib/perl5/vendor_perl/5.8.4
> /usr/lib/perl5/vendor_perl/5.8.3
> /usr/lib/perl5/vendor_perl/5.8.2
> /usr/lib/perl5/vendor_perl/5.8.1
> /usr/lib/perl5/vendor_perl/5.8.0
> /usr/lib/perl5/vendor_perl
>
> What am I doing wrong? Could you help?
>
> Thanks in advance for your help
> Tom
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From reece at harts.net  Thu Sep 25 12:15:23 2008
From: reece at harts.net (Reece Hart)
Date: Thu, 25 Sep 2008 09:15:23 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could
	DoWhatIMean	better	(w/ patch)
In-Reply-To: <18651.7938.496813.710345@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
	<18651.7938.496813.710345@almost.alerce.com>
Message-ID: <1222359323.15677.4.camel@snafu>

An embedded and charset-unspecified text was scrubbed...
Name: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20080925/ad977fb3/attachment-0001.pl>

From tatedger at googlemail.com  Thu Sep 25 12:27:29 2008
From: tatedger at googlemail.com (john paul)
Date: Thu, 25 Sep 2008 17:27:29 +0100
Subject: [Bioperl-l] Can't locate object method "get_dbxrefs"
In-Reply-To: <2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>
References: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
	<2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>
Message-ID: <efc5e9750809250927h741c083cl60dca40fee89280@mail.gmail.com>

On Thu, Sep 25, 2008 at 4:40 PM, Brian Osborne <bosborne11 at verizon.net>wrote:

> John,
>
> What does:
>
> >locate Bio/Ontology/Term.pm
>
> Say?
>

Silly me.

$ locate  Bio/Ontology/Term.pm
/usr/lib/perl5/site_perl/5.8.5/Bio/Ontology/Term.pm

and

 $ cat /usr/lib/perl5/site_perl/5.8.5/Bio/Ontology/Term.pm|grep get_dbxrefs
produced no answer

the latest version posted by Sendu on cpan says for that module

# $Id: Term.pm,v 1.31.4.1 2006/10/02 23:10:22 sendu Exp $
#
# BioPerl module for Bio::Ontology::Term
and the live version at (
http://code.open-bio.org/svnweb/index.cgi/bioperl/view/bioperl-live/trunk/Bio/Ontology/Term.pm
)

says
# $Id: Term.pm 14708 2008-06-10 00:08:17Z heikki $
#
# BioPerl module for Bio::Ontology::Term
#
I was using an old distribution from CPAN.

reinstalling from the main trunk

svn co svn://code.open-bio.org/bioperl/bioperl-live/trunk bioperl-live

solved the problem.

Thanks again

Tom


>
> Brian O.
>
>
>
> On Sep 25, 2008, at 11:23 AM, john paul wrote:
>
>   Hello guys,
>>
>> I need to pick your brain on this. I was trying to load some sequences in
>> a
>> fresh RH build using bioperl-db and got the following error:
>>
>> [tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
>> --dbuser root --dbname biosql --namespace swissprot --format swiss
>> /home/tatedger/tmp/uniprot_sprot.dat  --testonly
>> Loading /home/tatedger/tmp/uniprot_sprot.dat ...
>> Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via
>> package
>> "Bio::Ontology::Term" at
>> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
>> 552, <GEN0> line 70.
>>
>>
>> I have seen some posts on this regard (
>> http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but it
>> wasn't
>> clear to me what the solution would be.
>>
>>
>> My configuration:
>> - mysql version 4.1.7
>> - Red Hat Enterprise Linux ES release 4 (Nahant)
>>
>> to install bioperl and bioperl-db I used the help found on the website
>> following
>> - cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
>> - svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
>> - biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.
>>
>> bioperl-db  test 04 shows the same error.
>>
>> [tatedger at localhost bioperl-db]$ perl t/04swiss.t
>> 1..52
>> ok 1
>> ok 2
>> ok 3
>> ok 4
>> ok 5
>> Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
>> at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm
>> line
>> 552, <GEN0> line 78.
>>
>>
>> my @INC file looks like
>> /usr/lib/perl5/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/5.8.5
>> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.5
>> /usr/lib/perl5/site_perl/5.8.4
>> /usr/lib/perl5/site_perl/5.8.3
>> /usr/lib/perl5/site_perl/5.8.2
>> /usr/lib/perl5/site_perl/5.8.1
>> /usr/lib/perl5/site_perl/5.8.0
>> /usr/lib/perl5/site_perl
>> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.5
>> /usr/lib/perl5/vendor_perl/5.8.4
>> /usr/lib/perl5/vendor_perl/5.8.3
>> /usr/lib/perl5/vendor_perl/5.8.2
>> /usr/lib/perl5/vendor_perl/5.8.1
>> /usr/lib/perl5/vendor_perl/5.8.0
>> /usr/lib/perl5/vendor_perl
>>
>> What am I doing wrong? Could you help?
>>
>> Thanks in advance for your help
>> Tom
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>


From bix at sendu.me.uk  Thu Sep 25 13:12:22 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 25 Sep 2008 18:12:22 +0100
Subject: [Bioperl-l] Can't locate object method "get_dbxrefs"
In-Reply-To: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
References: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
Message-ID: <48DBC676.7090704@sendu.me.uk>

john paul wrote:
> - cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
> - svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
[...]
> Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
[...]
> What am I doing wrong? Could you help?

You're using the svb versuib bioperl-db but the release version of core 
(aka live). Don't mix and match; use the same version of both. So either 
install bioperl-live from svn as well, or get rid of you svn bioperl-db 
and install bioperl-db 1.5.2: 
http://bioperl.org/DIST/bioperl-db-1.5.2_100.tar.gz

I'd recommend using svn for both.


From hlapp at gmx.net  Thu Sep 25 18:24:37 2008
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu, 25 Sep 2008 18:24:37 -0400
Subject: [Bioperl-l] Using Storable with SeqFeatures
In-Reply-To: <5626ED9CB91C814197079FB9940312E506445F9B@MAIL.bc.iop.kcl.ac.uk>
References: <5626ED9CB91C814197079FB9940312E506445F9B@MAIL.bc.iop.kcl.ac.uk>
Message-ID: <517FAB85-BC7F-4135-B510-A2087267A314@gmx.net>


On Sep 24, 2008, at 10:19 AM, Johnston, Caroline wrote:

> Hello.
>
> I'm trying to use Storable to save a Bio::Seq object and Storable  
> seems to be having a weird problem dealing with freezing and thawing  
> the code ref to Bio::SeqFeature::Generic cleanup_generic. If I  
> change one line (931) in that function from
>
>    foreach my $t ( keys %{$self->{'_gsf_tag_hash'} || {} } ) {
>                                                    ------
> to
>
>    foreach my $t ( keys %{$self->{'_gsf_tag_hash'} } ) {
>
> it works fine. I've pasted an example script at http://sial.org/pbot/32320 
> .
>
> Any ideas why this syntax would break Storable? Would wrapping the  
> foreach in an if(defined $self->{'_gsf_tag_hash'}) serve to replace  
> the || {} ?

This should have exactly the same behavior as far as I can see.

Would you mind filing this as a bug repot with patch?

	-hilmar

>
>
> I get the same problem using Bio::Root::Storable.
>
> Cxx
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================





From mdschultz at ucdavis.edu  Thu Sep 25 18:06:02 2008
From: mdschultz at ucdavis.edu (Matthew Schultz)
Date: Thu, 25 Sep 2008 15:06:02 -0700 (PDT)
Subject: [Bioperl-l] BioPerl Installation Help
Message-ID: <200809252206.m8PM62Se004142@phaenicia.ucdavis.edu>


Hi Bioperl,

I've been trying to install bioperl on my Ubuntu machine I'm new to Bioperl
and don't have much experience in unix so I'm at a loss for what to do
next.  I tried to follow the instructions on using CPAN to install Bioperl,
but the installation failed.  At first I thought it was because of the few
warnings I received, but after trying the "force install" command without
success either I'm not so sure.  I was about to try the alternate option
using Build.pl, but am not sure where the Bioperl installation should go
(or will the Build.pl script place it in the right folder?).  Any help or
advice you could give would be appreciated.  Thanks for your time.

-Matt Schultz

P.S.  Here are the failed test results:

Failed Test        Stat Wstat Total Fail  Failed  List of Failed
-------------------------------------------------------------------------------
t/BioFetch_DB.t                  27    4  14.81%  8 20-21 27
t/DB.t                           78    2   2.56%  30-31
t/EMBL_DB.t                      15    3  20.00%  6 13-14
t/GuessSeqFormat.t               46    1   2.17%  11
t/InterProParser.t    2   512    47    1   2.13%  2
t/tutorial.t          2   512    21    6  28.57%  19-21
18 subtests skipped.
Failed 6/179 test scripts, 96.65% okay. 14/8122 subtests failed, 99.83% okay.
make: *** [test_dynamic] Error 255
  /usr/bin/make test -- NOT OK
Running make install
  make test had returned bad status, won't install without force



From caroline.johnston at iop.kcl.ac.uk  Thu Sep 25 23:19:38 2008
From: caroline.johnston at iop.kcl.ac.uk (Caroline)
Date: Fri, 26 Sep 2008 04:19:38 +0100
Subject: [Bioperl-l] Using Storable with SeqFeatures
In-Reply-To: <517FAB85-BC7F-4135-B510-A2087267A314@gmx.net>
References: <5626ED9CB91C814197079FB9940312E506445F9B@MAIL.bc.iop.kcl.ac.uk>
	<517FAB85-BC7F-4135-B510-A2087267A314@gmx.net>
Message-ID: <1222399178.18153.0.camel@clive>

On Thu, 2008-09-25 at 18:24 -0400, Hilmar Lapp wrote:

> Would you mind filing this as a bug repot with patch?
> 
> 	-hilmar
> 

Done, I think. I haven't used Bugzilla before, so give me a shout if I
haven't submitted it properly.

Cxx


From hartzell at alerce.com  Fri Sep 26 00:25:08 2008
From: hartzell at alerce.com (George Hartzell)
Date: Thu, 25 Sep 2008 21:25:08 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18652.25636.694188.904749@almost.alerce.com>


What would people think about a Bio::Range::Set (and/or SetI) which
behaves like Set::Intspan (which alone would be a waste of effort) but
also embraces RangeI's concepts of stranded-ness and
strong/weak/unspecified comparisons?

g. (who's sometimes thinks that 'tuits grow on trees...)



From hartzell at alerce.com  Fri Sep 26 00:25:08 2008
From: hartzell at alerce.com (George Hartzell)
Date: Thu, 25 Sep 2008 21:25:08 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18652.25636.694188.904749@almost.alerce.com>


What would people think about a Bio::Range::Set (and/or SetI) which
behaves like Set::Intspan (which alone would be a waste of effort) but
also embraces RangeI's concepts of stranded-ness and
strong/weak/unspecified comparisons?

g. (who's sometimes thinks that 'tuits grow on trees...)



From heikki at sanbi.ac.za  Fri Sep 26 02:25:54 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Fri, 26 Sep 2008 08:25:54 +0200
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better (w/ patch)
In-Reply-To: <18652.25636.694188.904749@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
	<18652.25636.694188.904749@almost.alerce.com>
Message-ID: <200809260825.54638.heikki@sanbi.ac.za>

George,

Bio::Range::Set sounds like great idea.

Sorry to put you in a tight spot with the request for keeping external 
dependencies to the minimum. I should have stressed that follow it only if it 
can be done easily. If you look at the actual dependencies of BioPerl at the 
moment, you'll realize not many have to patience to follow that guideline.

The main thing is the get working code in. If you then have the energy to code 
a module that gets rid of the dependency, that's an added bonus.

Thanks for your effort,

 Yours,
    -Heikki



On Friday 26 September 2008 06:25:08 George Hartzell wrote:
> What would people think about a Bio::Range::Set (and/or SetI) which
> behaves like Set::Intspan (which alone would be a waste of effort) but
> also embraces RangeI's concepts of stranded-ness and
> strong/weak/unspecified comparisons?
>
> g. (who's sometimes thinks that 'tuits grow on trees...)

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From tatedger at googlemail.com  Thu Sep 25 12:27:29 2008
From: tatedger at googlemail.com (john paul)
Date: Thu, 25 Sep 2008 17:27:29 +0100
Subject: [Bioperl-l] [BioSQL-l] Can't locate object method "get_dbxrefs"
In-Reply-To: <2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>
References: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
	<2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>
Message-ID: <efc5e9750809250927h741c083cl60dca40fee89280@mail.gmail.com>

On Thu, Sep 25, 2008 at 4:40 PM, Brian Osborne <bosborne11 at verizon.net>wrote:

> John,
>
> What does:
>
> >locate Bio/Ontology/Term.pm
>
> Say?
>

Silly me.

$ locate  Bio/Ontology/Term.pm
/usr/lib/perl5/site_perl/5.8.5/Bio/Ontology/Term.pm

and

 $ cat /usr/lib/perl5/site_perl/5.8.5/Bio/Ontology/Term.pm|grep get_dbxrefs
produced no answer

the latest version posted by Sendu on cpan says for that module

# $Id: Term.pm,v 1.31.4.1 2006/10/02 23:10:22 sendu Exp $
#
# BioPerl module for Bio::Ontology::Term
and the live version at (
http://code.open-bio.org/svnweb/index.cgi/bioperl/view/bioperl-live/trunk/Bio/Ontology/Term.pm
)

says
# $Id: Term.pm 14708 2008-06-10 00:08:17Z heikki $
#
# BioPerl module for Bio::Ontology::Term
#
I was using an old distribution from CPAN.

reinstalling from the main trunk

svn co svn://code.open-bio.org/bioperl/bioperl-live/trunk bioperl-live

solved the problem.

Thanks again

Tom


>
> Brian O.
>
>
>
> On Sep 25, 2008, at 11:23 AM, john paul wrote:
>
>   Hello guys,
>>
>> I need to pick your brain on this. I was trying to load some sequences in
>> a
>> fresh RH build using bioperl-db and got the following error:
>>
>> [tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
>> --dbuser root --dbname biosql --namespace swissprot --format swiss
>> /home/tatedger/tmp/uniprot_sprot.dat  --testonly
>> Loading /home/tatedger/tmp/uniprot_sprot.dat ...
>> Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via
>> package
>> "Bio::Ontology::Term" at
>> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
>> 552, <GEN0> line 70.
>>
>>
>> I have seen some posts on this regard (
>> http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but it
>> wasn't
>> clear to me what the solution would be.
>>
>>
>> My configuration:
>> - mysql version 4.1.7
>> - Red Hat Enterprise Linux ES release 4 (Nahant)
>>
>> to install bioperl and bioperl-db I used the help found on the website
>> following
>> - cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
>> - svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
>> - biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.
>>
>> bioperl-db  test 04 shows the same error.
>>
>> [tatedger at localhost bioperl-db]$ perl t/04swiss.t
>> 1..52
>> ok 1
>> ok 2
>> ok 3
>> ok 4
>> ok 5
>> Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
>> at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm
>> line
>> 552, <GEN0> line 78.
>>
>>
>> my @INC file looks like
>> /usr/lib/perl5/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/5.8.5
>> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.5
>> /usr/lib/perl5/site_perl/5.8.4
>> /usr/lib/perl5/site_perl/5.8.3
>> /usr/lib/perl5/site_perl/5.8.2
>> /usr/lib/perl5/site_perl/5.8.1
>> /usr/lib/perl5/site_perl/5.8.0
>> /usr/lib/perl5/site_perl
>> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.5
>> /usr/lib/perl5/vendor_perl/5.8.4
>> /usr/lib/perl5/vendor_perl/5.8.3
>> /usr/lib/perl5/vendor_perl/5.8.2
>> /usr/lib/perl5/vendor_perl/5.8.1
>> /usr/lib/perl5/vendor_perl/5.8.0
>> /usr/lib/perl5/vendor_perl
>>
>> What am I doing wrong? Could you help?
>>
>> Thanks in advance for your help
>> Tom
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>
_______________________________________________
BioSQL-l mailing list
BioSQL-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/biosql-l





From bix at sendu.me.uk  Fri Sep 26 04:26:36 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 26 Sep 2008 09:26:36 +0100
Subject: [Bioperl-l] Bio::Species bug,
 was  Species.t tests failing with bioperl-live
In-Reply-To: <CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
Message-ID: <48DC9CBC.1090909@sendu.me.uk>

Chris Fields wrote:
> The last commit to Bio::Species, which was an effort to fix a memory 
> leak, has unfortunately broken Species.t tests.  The relevant commit 
> used weaken(); my guess is something is being garbage collected way too 
> early.  Any ideas?

Was that last commit motivated by a bug report, and/or is there an 
associated test? If not, perhaps it can just be reverted?


From tatedger at googlemail.com  Thu Sep 25 11:23:46 2008
From: tatedger at googlemail.com (john paul)
Date: Thu, 25 Sep 2008 16:23:46 +0100
Subject: [Bioperl-l] [BioSQL-l] Can't locate object method "get_dbxrefs"
Message-ID: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>

Hello guys,

I need to pick your brain on this. I was trying to load some sequences in a
fresh RH build using bioperl-db and got the following error:

[tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
--dbuser root --dbname biosql --namespace swissprot --format swiss
/home/tatedger/tmp/uniprot_sprot.dat  --testonly
Loading /home/tatedger/tmp/uniprot_sprot.dat ...
Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via package
"Bio::Ontology::Term" at
/usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
552, <GEN0> line 70.


I have seen some posts on this regard (
http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but it wasn't
clear to me what the solution would be.


My configuration:
- mysql version 4.1.7
- Red Hat Enterprise Linux ES release 4 (Nahant)

to install bioperl and bioperl-db I used the help found on the website
following
- cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
- svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
- biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.

bioperl-db  test 04 shows the same error.

[tatedger at localhost bioperl-db]$ perl t/04swiss.t
1..52
ok 1
ok 2
ok 3
ok 4
ok 5
Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
552, <GEN0> line 78.


my @INC file looks like
/usr/lib/perl5/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/5.8.5
/usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.5
/usr/lib/perl5/site_perl/5.8.4
/usr/lib/perl5/site_perl/5.8.3
/usr/lib/perl5/site_perl/5.8.2
/usr/lib/perl5/site_perl/5.8.1
/usr/lib/perl5/site_perl/5.8.0
/usr/lib/perl5/site_perl
/usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.5
/usr/lib/perl5/vendor_perl/5.8.4
/usr/lib/perl5/vendor_perl/5.8.3
/usr/lib/perl5/vendor_perl/5.8.2
/usr/lib/perl5/vendor_perl/5.8.1
/usr/lib/perl5/vendor_perl/5.8.0
/usr/lib/perl5/vendor_perl

What am I doing wrong? Could you help?

Thanks in advance for your help
Tom
_______________________________________________
BioSQL-l mailing list
BioSQL-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/biosql-l





From cjfields at illinois.edu  Fri Sep 26 08:20:45 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 26 Sep 2008 07:20:45 -0500
Subject: [Bioperl-l] Bio::Species bug,
	was  Species.t tests failing with bioperl-live
In-Reply-To: <48DC9CBC.1090909@sendu.me.uk>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
	<48DC9CBC.1090909@sendu.me.uk>
Message-ID: <F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>


On Sep 26, 2008, at 3:26 AM, Sendu Bala wrote:

> Chris Fields wrote:
>> The last commit to Bio::Species, which was an effort to fix a  
>> memory leak, has unfortunately broken Species.t tests.  The  
>> relevant commit used weaken(); my guess is something is being  
>> garbage collected way too early.  Any ideas?
>
> Was that last commit motivated by a bug report, and/or is there an  
> associated test? If not, perhaps it can just be reverted?


Here's the relevant list thread:

http://thread.gmane.org/gmane.comp.lang.perl.bio.general/17541/focus=17550

The proposed patch was George's, which gets rid of the leak but causes  
the Species.t failures.  I say we revert the patch, but we'll still  
need to address the original problem addressed by Rutger Vos, i.e.  
that there is a significant memory leak in Bio::Species.

chris


From bix at sendu.me.uk  Fri Sep 26 09:45:21 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 26 Sep 2008 14:45:21 +0100
Subject: [Bioperl-l] Bio::Species bug,
 was  Species.t tests failing with bioperl-live
In-Reply-To: <F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
	<48DC9CBC.1090909@sendu.me.uk>
	<F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>
Message-ID: <48DCE771.8050001@sendu.me.uk>

Chris Fields wrote:
> 
> On Sep 26, 2008, at 3:26 AM, Sendu Bala wrote:
> 
>> Chris Fields wrote:
>>> The last commit to Bio::Species, which was an effort to fix a memory 
>>> leak, has unfortunately broken Species.t tests.  The relevant commit 
>>> used weaken(); my guess is something is being garbage collected way 
>>> too early.  Any ideas?
>>
>> Was that last commit motivated by a bug report, and/or is there an 
>> associated test? If not, perhaps it can just be reverted?
> 
> Here's the relevant list thread:
> 
> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/17541/focus=17550
> 
> The proposed patch was George's, which gets rid of the leak but causes 
> the Species.t failures.  I say we revert the patch, but we'll still need 
> to address the original problem addressed by Rutger Vos, i.e. that there 
> is a significant memory leak in Bio::Species.

Thanks. Rather than revert I've kludged it for now. Everything should be 
fine, it's just that I fear my solution isn't 'correct' and could mess 
things up we don't happen to have tests for.

See http://bugzilla.open-bio.org/show_bug.cgi?id=2594


From cjfields at illinois.edu  Fri Sep 26 10:54:55 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 26 Sep 2008 09:54:55 -0500
Subject: [Bioperl-l] Bio::Species bug,
	was  Species.t tests failing with bioperl-live
In-Reply-To: <48DCE771.8050001@sendu.me.uk>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
	<48DC9CBC.1090909@sendu.me.uk>
	<F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>
	<48DCE771.8050001@sendu.me.uk>
Message-ID: <9C49A138-CC07-4716-AFD6-FFB2F217C825@illinois.edu>


On Sep 26, 2008, at 8:45 AM, Sendu Bala wrote:

> Chris Fields wrote:
>> On Sep 26, 2008, at 3:26 AM, Sendu Bala wrote:
>>> Chris Fields wrote:
>>>> The last commit to Bio::Species, which was an effort to fix a  
>>>> memory leak, has unfortunately broken Species.t tests.  The  
>>>> relevant commit used weaken(); my guess is something is being  
>>>> garbage collected way too early.  Any ideas?
>>>
>>> Was that last commit motivated by a bug report, and/or is there an  
>>> associated test? If not, perhaps it can just be reverted?
>> Here's the relevant list thread:
>> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/17541/focus=17550
>> The proposed patch was George's, which gets rid of the leak but  
>> causes the Species.t failures.  I say we revert the patch, but  
>> we'll still need to address the original problem addressed by  
>> Rutger Vos, i.e. that there is a significant memory leak in  
>> Bio::Species.
>
> Thanks. Rather than revert I've kludged it for now. Everything  
> should be fine, it's just that I fear my solution isn't 'correct'  
> and could mess things up we don't happen to have tests for.
>
> See http://bugzilla.open-bio.org/show_bug.cgi?id=2594

Probably something that will go away when we quit using Bio::Species  
altogether (in favor of Bio::Taxon) after 1.6.   I'm not sure whether  
it will be worth the trouble, but it's worth discussing.

Anyway, I'm still a bit unfamiliar with some aspects of Bio::Species  
(and I'm pretty busy ATM) so it make take a few days.

chris


From hartzell at alerce.com  Fri Sep 26 20:21:41 2008
From: hartzell at alerce.com (George Hartzell)
Date: Fri, 26 Sep 2008 17:21:41 -0700
Subject: [Bioperl-l] Bio::Species bug,
	was  Species.t tests failing with bioperl-live
In-Reply-To: <9C49A138-CC07-4716-AFD6-FFB2F217C825@illinois.edu>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
	<48DC9CBC.1090909@sendu.me.uk>
	<F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>
	<48DCE771.8050001@sendu.me.uk>
	<9C49A138-CC07-4716-AFD6-FFB2F217C825@illinois.edu>
Message-ID: <18653.31893.762357.718899@almost.alerce.com>

Chris Fields writes:
 > 
 > On Sep 26, 2008, at 8:45 AM, Sendu Bala wrote:
 > 
 > > Chris Fields wrote:
 > >> On Sep 26, 2008, at 3:26 AM, Sendu Bala wrote:
 > >>> Chris Fields wrote:
 > >>>> The last commit to Bio::Species, which was an effort to fix a  
 > >>>> memory leak, has unfortunately broken Species.t tests.  The  
 > >>>> relevant commit used weaken(); my guess is something is being  
 > >>>> garbage collected way too early.  Any ideas?
 > >>>
 > >>> Was that last commit motivated by a bug report, and/or is there an  
 > >>> associated test? If not, perhaps it can just be reverted?
 > >> Here's the relevant list thread:
 > >> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/17541/focus=17550
 > >> The proposed patch was George's, which gets rid of the leak but  
 > >> causes the Species.t failures.  I say we revert the patch, but  
 > >> we'll still need to address the original problem addressed by  
 > >> Rutger Vos, i.e. that there is a significant memory leak in  
 > >> Bio::Species.
 > >
 > > Thanks. Rather than revert I've kludged it for now. Everything  
 > > should be fine, it's just that I fear my solution isn't 'correct'  
 > > and could mess things up we don't happen to have tests for.
 > >
 > > See http://bugzilla.open-bio.org/show_bug.cgi?id=2594
 > 
 > Probably something that will go away when we quit using Bio::Species  
 > altogether (in favor of Bio::Taxon) after 1.6.   I'm not sure whether  
 > it will be worth the trouble, but it's worth discussing.
 > 
 > Anyway, I'm still a bit unfamiliar with some aspects of Bio::Species  
 > (and I'm pretty busy ATM) so it make take a few days.

I can try to take a look at it again and see if there's a way to make
it work [more] correctly.

g.


From torsten.seemann at infotech.monash.edu.au  Sun Sep 28 21:46:06 2008
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Mon, 29 Sep 2008 11:46:06 +1000
Subject: [Bioperl-l] Retrieving taxonomy information from a GenBank file
In-Reply-To: <E078758D-D451-4973-A66D-2D6D829FCA53@bioperl.org>
References: <f03f40920809181427k168bfc3cu535c023949735cd9@mail.gmail.com>
	<E078758D-D451-4973-A66D-2D6D829FCA53@bioperl.org>
Message-ID: <a79f6a4b0809281846q380b8f77ha445f2112a2dae83@mail.gmail.com>

Anjan,

>> I'm using the following code to access the "ORGANISM" tag value for the
>> record NC_002526.
>> I get a value of 0 even though the ORGANISM tag  has a value.  Any idea
>> how
>> this might be corrected?
>> my $des= $seq->get_tag_values("ORGANISM");

> You want the species object ($seq->species)  -- see the Seq HOWTO, much of
> the Seq API is explained.
>  http://bioperl.org/wiki/HOWTO:Feature-Annotation#The_Species_Object

Of course Jason is correct here but there was still a semantic bug in
your code anyway which you should probably be aware of.
$seq->get_tag_values() returns an ARRAY which you are trying to store
in a SCALAR ($des). An array, in a scalar context, returns the SIZE of
the array, which in your case was zero (0) as there were no ORGANISM
tags. What you probably meant was:

my($des) = $seq->get_tag_values("ORGANISM");
# or
my $des = ($seq->get_tag_values("ORGANISM")) [ 0 ];

-- 
--Torsten Seemann
--Victorian Bioinformatics Consortium, Dept. Microbiology, Monash University
--Tel: 9905 9010 / 0422 923 024


From schwarz at tenaya.caltech.edu  Mon Sep 29 01:57:43 2008
From: schwarz at tenaya.caltech.edu (Erich Schwarz)
Date: Sun, 28 Sep 2008 22:57:43 -0700 (PDT)
Subject: [Bioperl-l] exporting contigs with CDSes, stored via Bio::DB::GFF,
 into individual GenBank records?
Message-ID: <Pine.LNX.4.64.0809282239110.26085@tenaya.caltech.edu>

Hi all,

    I have newly sequenced contigs, with CDS predictions, loaded 
into a Bio::DB::GFF-readable format (i.e., loaded into a MySQL 
database via Bio::DB::GFF).  I'd like to export each contig, with 
its annotated CDSes, into a single GenBank-formatted record for each 
contig (in order to be able submit this stuff to GenBank, without 
having to waste time with Sequin).  Is there some straightforward 
way of getting Bio::DB::GFF to do that?

    Some time ago, when I last had to decipher BioPerl, I came up 
with code that would let me export protein translations of the 
contigs' CDSes in GenBank format:

-------------------------------------------------------------------

#!/usr/bin/env perl

use strict;
use warnings;
use Bio::Seq;
use Bio::SeqIO;
use Bio::DB::GFF;

my $query_database = $ARGV[0];
my $dna = q{};
my $db = Bio::DB::GFF->new( -dsn => $query_database);

my $gb_file = 'example.gb';
my $seq_out = Bio::SeqIO->new( -file => ">$gb_file", -format => 'genbank', );

my @contigs = sort 
              map { $_->display_id }
              $db->features( -types => 'contig:assembly' );

foreach my $contig (@contigs) { 
    my $segment1 = $db->segment($contig);
    my @p_txs = $segment1->features('processed_transcript');
    foreach my $p_t (sort @p_txs) {
        $dna = q{};
        my @CDSes = $p_t->CDS;
        my $cds_name = $CDSes[0]->display_id();
        foreach my $cds (@CDSes) { 
            # $cds->seq == Bio::PrimarySeq, *not* plain nt seq.!
            $dna = $dna . $cds->seq->seq;
        }
        my $full_cds = Bio::Seq->new( -display_id => $cds_name, 
                                      -seq => $dna, );
        my $prot = $full_cds->translate;
        $seq_out->write_seq($prot);
    }
}

--------------------------------------------------------------------

    Returning to this, I tried using

    $db->get_Seq_by_id($contig)

to give me a Bio::Seq object for each contig (which I could then 
output into GenBank form), but that proved futile.

    I'm willing to work this out on my own if I have to, but if 
somebody can answer this in 30 seconds, it will save me a lot of 
time -- and be very appreciated!


--Erich 



From jason at bioperl.org  Tue Sep 30 12:48:17 2008
From: jason at bioperl.org (Jason Stajich)
Date: Tue, 30 Sep 2008 09:48:17 -0700
Subject: [Bioperl-l] exporting contigs with CDSes,
	stored via Bio::DB::GFF, into individual GenBank records?
In-Reply-To: <Pine.LNX.4.64.0809282239110.26085@tenaya.caltech.edu>
References: <Pine.LNX.4.64.0809282239110.26085@tenaya.caltech.edu>
Message-ID: <9880E773-812C-4F16-806F-7DB854346330@bioperl.org>

Eric.
CC-ing Gbrowse since this is regarding Gbrowse data-store.

I've definitely done exactly this although I remember I had to tweak  
the features a bit to make sure i had some some of the necessary stuff  
to sequin.


If you want to get a specific segment you just do what you already  
have in your code:
my $segment = $db->segment($contig_name);

Or you can iterate through all the features - depends on how you named  
your segments/contigs/chromsomes, I named mine "contig:scaffold" for  
type:source
  my $iterator = $dbh->get_seq_stream(-type=>'scaffold');
   while (my $s = $iterator->next_seq) {
   }

Now You *should* be able to pass this segment object to $seqio- 
 >write_seq($segment);
However Bio::DB::GFF::Feature doesn't implement the whole SeqI APi so  
you probably have to create your own sequence and move the features  
over:

y $iterator = $dbh->get_seq_stream(-type=>'scaffold');
   while (my $s = $iterator->next_seq) {
	my $seq = Bio::Seq->new();
	$seq->primary_seq($s->seq);
	for my $feature ( $s->features('processed_transcript') ) {
		my $f = Bio::SeqFeature::Generic->new(-location => $feature->location,
						      -primary_tag => $feature->primary_tag,
						      -source_tag  => $feature->primary_tag,
						      -score => $feature->score,
						      -seq_id => $feature->seq_id);
		$f->add_tag_value('locus_tag',$feature->name);
		# might also add all other tag/value pairs from this feature like  
DBXREF, etc.
		# derive a CDS feature from this feature as well.
		# perhaps derive a gene feature that only has start/end for the  
feature
		# might add a translation tag/value pair for CDS features
		$seq->add_SeqFeature($f);
	}
	$out->write_seq($seq);
  }

I suspect you'll have to edit the feature objects some to
a) remove the ones you don't want to output
b) add additional info like translation frame -- I think there is a  
slightly different way that NCBI wants things labeled wrt translation  
frame
c) add in other annotation information that may or may not be encoded  
as tag/values that

It is also possible I am missing some things in here, but hopefully it  
gets you started.  I think it would be quite useful for us to try and  
write a generic script for this but maybe focus on Bio::DB::SeqFeature  
dbs since it will be easier to assume that all the 3-level gene->mRNA- 
 >CDS/exon relationships will be explicitly specified.


-jason
On Sep 28, 2008, at 10:57 PM, Erich Schwarz wrote:

> Hi all,
>
>    I have newly sequenced contigs, with CDS predictions, loaded
> into a Bio::DB::GFF-readable format (i.e., loaded into a MySQL
> database via Bio::DB::GFF).  I'd like to export each contig, with
> its annotated CDSes, into a single GenBank-formatted record for each
> contig (in order to be able submit this stuff to GenBank, without
> having to waste time with Sequin).  Is there some straightforward
> way of getting Bio::DB::GFF to do that?
>
>    Some time ago, when I last had to decipher BioPerl, I came up
> with code that would let me export protein translations of the
> contigs' CDSes in GenBank format:
>
> -------------------------------------------------------------------
>
> #!/usr/bin/env perl
>
> use strict;
> use warnings;
> use Bio::Seq;
> use Bio::SeqIO;
> use Bio::DB::GFF;
>
> my $query_database = $ARGV[0];
> my $dna = q{};
> my $db = Bio::DB::GFF->new( -dsn => $query_database);
>
> my $gb_file = 'example.gb';
> my $seq_out = Bio::SeqIO->new( -file => ">$gb_file", -format =>  
> 'genbank', );
>
> my @contigs = sort
>              map { $_->display_id }
>              $db->features( -types => 'contig:assembly' );
>
> foreach my $contig (@contigs) {
>    my $segment1 = $db->segment($contig);
>    my @p_txs = $segment1->features('processed_transcript');
>    foreach my $p_t (sort @p_txs) {
>        $dna = q{};
>        my @CDSes = $p_t->CDS;
>        my $cds_name = $CDSes[0]->display_id();
>        foreach my $cds (@CDSes) {
>            # $cds->seq == Bio::PrimarySeq, *not* plain nt seq.!
>            $dna = $dna . $cds->seq->seq;
>        }
>        my $full_cds = Bio::Seq->new( -display_id => $cds_name,
>                                      -seq => $dna, );
>        my $prot = $full_cds->translate;
>        $seq_out->write_seq($prot);
>    }
> }
>
> --------------------------------------------------------------------
>
>    Returning to this, I tried using
>
>    $db->get_Seq_by_id($contig)
>
> to give me a Bio::Seq object for each contig (which I could then
> output into GenBank form), but that proved futile.
>
>    I'm willing to work this out on my own if I have to, but if
> somebody can answer this in 30 seconds, it will save me a lot of
> time -- and be very appreciated!
>
>
> --Erich
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From gilbertd at cricket.bio.indiana.edu  Tue Sep 30 13:23:56 2008
From: gilbertd at cricket.bio.indiana.edu (Don Gilbert)
Date: Tue, 30 Sep 2008 12:23:56 -0500 (EST)
Subject: [Bioperl-l] [Gmod-gbrowse]  exporting contigs with CDSes,
	stored via Bio::DB::GFF, into individual GenBank records?
Message-ID: <200809301723.m8UHNuc04293@cricket.bio.indiana.edu>


Eric,

If the Bio::DB::GFF database to Genbank submission route doesn't get you
where you want, you can also look at storing your data in a GMOD Chado
database, then using Bulkfiles to produce the Genbank Submission file set.

- Don Gilbert

Find a GenBank Submit output from Chado dbs in this tool release
http://eugenes.org/gmod/GMODTools/
  GMODTools-1.2b.zip      20-Jun-2008 

- adding (in progress) Genbank Submission table writer, 
  'bulkfiles -format=genbanktbl', with output suited
  to submit to NCBI as per these specifications
  http://www.ncbi.nlm.nih.gov/Genbank/eukaryotic_genome_submission.html

see also http://gmod.org/wiki/GMODTools
and this test case with genbank-submit output
 http://gmod.org/wiki/GMODTools_TestCase



From mauricio at open-bio.org  Tue Sep 30 17:56:04 2008
From: mauricio at open-bio.org (Mauricio Herrera Cuadra)
Date: Tue, 30 Sep 2008 16:56:04 -0500
Subject: [Bioperl-l] Test coverage for BioPerl now available
Message-ID: <48E2A074.5060305@open-bio.org>

Hi all,

Daily-updated test coverage reports are now available for those BioPerl 
packages which make use of the Build.PL mechanism (except bioperl-db):

http://bioperl.org/test-coverage/bioperl-live/
http://bioperl.org/test-coverage/bioperl-network/
http://bioperl.org/test-coverage/bioperl-run/

These reports will help us to know the current 'quality' of the code in 
SVN for most of the BioPerl modules. This idea was started by Nathan 
Haigh and Sendu a long time ago and it was my fault to not implement on 
time the necessary script to run the process on a daily basis, so 
apologies for that.

There are still a few things to be done in order to have this working as 
it should:

- Nathan, current Devel::Cover module from CPAN doesn't include the JS 
modifications to make table columns sortable. Do you know what happened 
to the code you contributed to the author for that?

- Reports could be generated for the rest of the BioPerl packages as 
soon as they're migrated to the Build.PL infrastructure. Anyone up for that?

- bioperl-db tests require BioSQL to be setup in the webserver machine, 
and the same goes for bioperl-run's tests with ALL of its dependencies. 
The bioperl.org site is co-hosted with all of the other OBF projects and 
that machine also takes care of other things (mailing lists, etc), so I 
would like your feedback on possible workarounds to not overload the 
server if we want to setup such test reports.

Thanks & regards,
Mauricio.


From jason at bioperl.org  Mon Sep  1 03:42:26 2008
From: jason at bioperl.org (Jason Stajich)
Date: Mon, 1 Sep 2008 00:42:26 -0700
Subject: [Bioperl-l] Bio::Tools::dpAlign feature request
In-Reply-To: <868888.19741.qm@web30406.mail.mud.yahoo.com>
References: <868888.19741.qm@web30406.mail.mud.yahoo.com>
Message-ID: <99A57523-94B3-4A56-A617-22675FA10AB8@bioperl.org>

Safe to ignore the tests.  Those that are failing aren't even test for  
Bio::Align::dpAlign - but were written to test a bug that has not been  
fixed in the EVD module if I remember correctly that is why they are  
marked in a TODO block, but I can't tell if the Test.pm is actually  
skipping these tests or not.

I think we probably need to deprecate some of these modules as there  
is no maintainer of Ewan's code in here.

At a minimum we need to modularlize the tests for these modules into  
separate t dir and fix the need for multiple Makefile.PL in here and  
probably move to Build.PL

-jason
On Aug 28, 2008, at 11:00 AM, Yee Man Chan wrote:

>
> Hi Alexie
>
> My understanding is that you can ignore these failures.
>
> I believe test cases 17-20 were added by Jason Stajich before I  
> added the feature you requested. I am not sure what he was doing  
> there.
>
> I suppose he can give you the definite answer to whether this is  
> something important or not.
>
> By the way, did you try out the new feature? Does it work?
>
> Thanks
> Yee Man
>
> --- On Thu, 8/28/08, Alexie Papanicolaou <apapanicolaou at ice.mpg.de>  
> wrote:
>
>> From: Alexie Papanicolaou <apapanicolaou at ice.mpg.de>
>> Subject: Re: Bio::Tools::dpAlign feature request
>> To: "Yee Man Chan" <ymc at yahoo.com>
>> Date: Thursday, August 28, 2008, 6:15 AM
>> hi
>>
>> is the version you emailed me newer or older than the
>> subversion one?
>>
>> i'm testing the subversion version for bioperl-ext and
>>
>> not ok 17 # TODO evalues vary based on platform, needs
>> fixing
>> #   Failed (TODO) test at test.pl line 156.
>> #          got: '2027805538'
>> #     expected: '1764904'
>> not ok 18 # TODO evalues vary based on platform, needs
>> fixing
>> #   Failed (TODO) test at test.pl line 157.
>> #          got: '-1375488148'
>> #     expected: '1764872'
>> not ok 19 # TODO evalues vary based on platform, needs
>> fixing
>> #   Failed (TODO) test at test.pl line 158.
>> #          got: '-808808307'
>> #     expected: '1764872'
>> not ok 20 # TODO evalues vary based on platform, needs
>> fixing
>> #   Failed (TODO) test at test.pl line 159.
>> #          got: '-2118162890'
>> #     expected: '1764872'
>>
>> you think these are ok to ignore?
>>
>>
>> On Fri, 2008-08-01 at 21:03 -0700, Yee Man Chan wrote:
>>
>>> Hi Alexie
>>>
>>>   Attached are the files that contains the feature
>> you requested. linspc.c is the one that does the work and
>> test.pl has a test case for it. The scoring scheme is as
>> described before. Please let me know if it works.
>>>
>>> Yee Man
>>>
>>> --- On Wed, 7/30/08, Alexie Papanicolaou
>> <apapanicolaou at ice.mpg.de> wrote:
>>>
>>>> From: Alexie Papanicolaou
>> <apapanicolaou at ice.mpg.de>
>>>> Subject: Re: Bio::Tools::dpAlign feature request
>>>> To: ymc at yahoo.com
>>>> Date: Wednesday, July 30, 2008, 2:44 PM
>>>> Oh sorry
>>>>
>>>> Say match=3 and mismatch=-1, gopen= -10, gext=-5
>>>> for aligning
>>>> seq1: ATG
>>>> seq2: ATT
>>>> match: 3,3,-1
>>>>
>>>> seq1: AT-G
>>>> seq2: ATTG
>>>> match: 3,3,-1,-10,3
>>>>
>>>> is that possible? or am I missing something? I
>> was only
>>>> today wondering
>>>> if it is even possible...
>>>>
>>>> a
>>>>
>>>>
>>>> Yee Man Chan wrote:
>>>>> Sorry, I don't quite get it. Can you
>> give me an
>>>> example of the output you want?
>>>>>
>>>>> Yee Man
>>>>>
>>>>> --- On Wed, 7/30/08, Alexie Papanicolaou
>>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>>
>>>>>
>>>>>> From: Alexie Papanicolaou
>>>> <apapanicolaou at ice.mpg.de>
>>>>>> Subject: Re: Bio::Tools::dpAlign feature
>> request
>>>>>> To: ymc at yahoo.com
>>>>>> Date: Wednesday, July 30, 2008, 9:50 AM
>>>>>> Dear Yee Man,
>>>>>>
>>>>>> Do you think it is possible to code a
>> method for
>>>> creating a
>>>>>> delimited
>>>>>> (space or comma) "score-line"?
>>>>>>
>>>>>> I'd like to parse it into an array
>> and have
>>>> the
>>>>>> individual score for
>>>>>> each alignment position. Is it easy to
>> do?
>>>>>>
>>>>>> a
>>>>>>
>>>>>> Yee Man Chan wrote:
>>>>>>
>>>>>>> Hi Alexie
>>>>>>>
>>>>>>>   How about I implement the simple
>> case?
>>>>>>>
>>>>>>> So for match = +3, mismatch = -1,
>>>>>>>
>>>>>>> A and R = +3
>>>>>>> A and Y = -1
>>>>>>> A and B = -1
>>>>>>> A and D = +3
>>>>>>> A and N = +3
>>>>>>> A and X = -1
>>>>>>>
>>>>>>> What do you think?
>>>>>>> Yee Man
>>>>>>>
>>>>>>>
>>>>>>> --- On Tue, 7/29/08, Alexie
>> Papanicolaou
>>>>>>>
>>>>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>>>
>>>>>>>
>>>>>>>
>>>>>>>> From: Alexie Papanicolaou
>>>>>>>>
>>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>
>>>>>>>> Subject: Re: Bio::Tools::dpAlign
>> feature
>>>> request
>>>>>>>> To: ymc at yahoo.com
>>>>>>>> Date: Tuesday, July 29, 2008,
>> 10:58 AM
>>>>>>>> Dear Yee Man,
>>>>>>>> hello, I was wondering how is
>> this
>>>> progressing and
>>>>>>>>
>>>>>> if you
>>>>>>
>>>>>>>> need help?
>>>>>>>>
>>>>>>>> many thanks
>>>>>>>> alexie
>>>>>>>>
>>>>>>>> Yee Man Chan wrote:
>>>>>>>>
>>>>>>>>
>>>>>>>>> Hi Alexie
>>>>>>>>>
>>>>>>>>>   There are two ways to
>> compute the
>>>> score for
>>>>>>>>>
>>>>>> each
>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>> aligned basepair in dpAlign
>> module. One is
>>>>>>>>
>>>>>> match/mismatch
>>>>>>
>>>>>>>> if you specify your sequence as
>> DNA and
>>>> the other
>>>>>>>>
>>>>>> is a
>>>>>>
>>>>>>>> scoring matrix if you specify
>> your
>>>> sequence as
>>>>>>>>
>>>>>> protein.
>>>>>>
>>>>>>>> Obviously, the latter can
>> completely
>>>> dominate the
>>>>>>>>
>>>>>> former.
>>>>>>
>>>>>>>> If you take the time to type the
>> scoring
>>>> matrix
>>>>>>>>
>>>>>> file, then
>>>>>>
>>>>>>>> you can handle those IUPAC code
>> by
>>>> specifying the
>>>>>>>>
>>>>>> sequence
>>>>>>
>>>>>>>> as proteins.
>>>>>>>>
>>>>>>>>
>>>>>>>>>   If you think this is too
>>>> troublesome, then
>>>>>>>>>
>>>>>> I might
>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>> be able to extend the
>> match/mismatch route
>>>> to
>>>>>>>>
>>>>>> handle IUPAC
>>>>>>
>>>>>>>> codes. But the problem here is,
>> how should
>>>> I score
>>>>>>>>
>>>>>> a match
>>>>>>
>>>>>>>> of A and W when match is +3 and
>> mismatch
>>>> is -1?
>>>>>>>>
>>>>>> Should it
>>>>>>
>>>>>>>> have a score of +3/3 = +1 for
>> match or
>>>> +3/3-1*2/3
>>>>>>>>
>>>>>> = +1/3?
>>>>>>
>>>>>>>> Do you know what the convention
>> is? If
>>>> not, maybe
>>>>>>>>
>>>>>> you can
>>>>>>
>>>>>>>> tell me what you think the score
>> will be?
>>>>>>>>
>>>>>>>>
>>>>>>>>> Yee Man
>>>>>>>>>
>>>>>>>>> --- On Thu, 6/26/08, Alexie
>>>> Papanicolaou
>>>>>>>>>
>>>>>>>>>
>>>>>>>> <apapanicolaou at ice.mpg.de>
>> wrote:
>>>>>>>>
>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>> From: Alexie
>> Papanicolaou
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>>>
>>>>>>>>
>>>>>>>>>> Subject:
>> Bio::Tools::dpAlign
>>>> feature
>>>>>>>>>>
>>>>>> request
>>>>>>
>>>>>>>>>> To: ymc at yahoo.com
>>>>>>>>>> Date: Thursday, June 26,
>> 2008,
>>>> 4:15 AM
>>>>>>>>>> Dear Yee Man Chan,
>>>>>>>>>>
>>>>>>>>>> Many thank you for this
>> module. I
>>>> like it
>>>>>>>>>>
>>>>>> very
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> much. I was
>>>>>>>>
>>>>>>>>
>>>>>>>>>> wondering if
>>>>>>>>>> it would be possible for
>> you to
>>>> allow for
>>>>>>>>>>
>>>>>> IUPAC
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> DNA codes.
>>>>>>>>
>>>>>>>>
>>>>>>>>>> I see it is in your TODO
>> list and
>>>> I hoped
>>>>>>>>>>
>>>>>> to
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> inspire you
>>>>>>>>
>>>>>>>>
>>>>>>>>>> :-)
>>>>>>>>>>
>>>>>>>>>> Even a simple measure
>> with the
>>>> degenerate
>>>>>>>>>>
>>>>>> base
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> containing
>>>>>>>>
>>>>>>>>
>>>>>>>>>> the aligned
>>>>>>>>>> base count as a
>> (perfect) match
>>>> would be
>>>>>>>>>>
>>>>>> very
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> useful to me
>>>>>>>>
>>>>>>>>
>>>>>>>>>> (i'm sorry, i
>>>>>>>>>> 'm not a good coder
>> to do it
>>>> myself).
>>>>>>>>>>
>>>>>>>>>> many thanks for your
>> work so far.
>>>>>>>>>> alexie
>>>>>>>>>>
>>>>>>>>>> -- 
>>>>>>>>>> --
>>>>>>>>>> "Eppur si
>> evolve"
>>>> ("And yet
>>>>>>>>>>
>>>>>> it
>>>>>>
>>>>>>>>>> evolves")
>>>>>>>>>> -Galileo Jr (ca 21st
>> century)
>>>>>>>>>>
>>>>>>>>>> --
>>>>>>>>>> Alexie Papanicolaou
>>>>>>>>>> Entomology
>>>>>>>>>> Max Planck Institute for
>> Chemical
>>>> Ecology
>>>>>>>>>> Hans Knoell Str 8
>>>>>>>>>> Jena 07745
>>>>>>>>>> Germany
>>>>>>>>>> Email
>> apapanicolaou at ice.mpg.de
>>>>>>>>>> Tel +493641571561
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>> -- 
>>>>>>>> --
>>>>>>>> "Eppur si evolve"
>> ("And yet
>>>> it
>>>>>>>> evolves")
>>>>>>>> -Galileo Jr (ca 21st century)
>>>>>>>>
>>>>>>>> "One Galileo in two
>> thousand years is
>>>>>>>>
>>>>>> enough."
>>>>>>
>>>>>>>> -Pope Pius XII
>>>>>>>> --
>>>>>>>> Alexie Papanicolaou
>>>>>>>> Entomology
>>>>>>>> Max Planck Institute for
>> Chemical Ecology
>>>>>>>> Hans Knoell Str 8
>>>>>>>> Jena 07745
>>>>>>>> Germany
>>>>>>>> Email apapanicolaou at ice.mpg.de
>>>>>>>> Tel +493641571561
>>>>>>>>
>>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>> -- 
>>>>>> --
>>>>>> "Eppur si evolve" ("And
>> yet it
>>>>>> evolves")
>>>>>> -Galileo Jr (ca 21st century)
>>>>>>
>>>>>> "One Galileo in two thousand years
>> is
>>>> enough."
>>>>>> -Pope Pius XII
>>>>>> --
>>>>>> Alexie Papanicolaou
>>>>>> Entomology
>>>>>> Max Planck Institute for Chemical
>> Ecology
>>>>>> Hans Knoell Str 8
>>>>>> Jena 07745
>>>>>> Germany
>>>>>> Email apapanicolaou at ice.mpg.de
>>>>>> Tel +493641571561
>>>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>
>>>> -- 
>>>> --
>>>> "Eppur si evolve" ("And yet it
>>>> evolves")
>>>> -Galileo Jr (ca 21st century)
>>>>
>>>> "One Galileo in two thousand years is
>> enough."
>>>> -Pope Pius XII
>>>> --
>>>> Alexie Papanicolaou
>>>> Entomology
>>>> Max Planck Institute for Chemical Ecology
>>>> Hans Knoell Str 8
>>>> Jena 07745
>>>> Germany
>>>> Email apapanicolaou at ice.mpg.de
>>>> Tel +493641571561
>>>
>>>
>>>
>>
>> -- 
>> -- 
>> "Eppur si evolve" ("And yet it
>> evolves")
>> -Galileo Jr (ca 21st century)
>>
>> "One Galileo in two thousand years is enough."
>> -Pope Pius XII
>> -- 
>> Alexie Papanicolaou
>> Entomology
>> Max Planck Institute for Chemical Ecology
>> Hans Knoell Str 8
>> Jena 07745
>> Germany
>> Email apapanicolaou at ice.mpg.de
>> Tel +493641571561
>
>
>

Jason Stajich
jason at bioperl.org





From cjfields at illinois.edu  Mon Sep  1 13:49:56 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Mon, 1 Sep 2008 12:49:56 -0500
Subject: [Bioperl-l] Bio::Tools::dpAlign feature request
In-Reply-To: <99A57523-94B3-4A56-A617-22675FA10AB8@bioperl.org>
References: <868888.19741.qm@web30406.mail.mud.yahoo.com>
	<99A57523-94B3-4A56-A617-22675FA10AB8@bioperl.org>
Message-ID: <44D25826-BE42-4539-8567-468FE74571B4@illinois.edu>

On pSW: I agree, I don't think it is worth maintaining it considering  
there are actively supported C/C++-based toolkits with similar  
functionality (SeqAn) and Petr's BioLib initiative will likely be a  
more maintainable effort.

chris

On Sep 1, 2008, at 2:42 AM, Jason Stajich wrote:

> Safe to ignore the tests.  Those that are failing aren't even test  
> for Bio::Align::dpAlign - but were written to test a bug that has  
> not been fixed in the EVD module if I remember correctly that is why  
> they are marked in a TODO block, but I can't tell if the Test.pm is  
> actually skipping these tests or not.
>
> I think we probably need to deprecate some of these modules as there  
> is no maintainer of Ewan's code in here.
>
> At a minimum we need to modularlize the tests for these modules into  
> separate t dir and fix the need for multiple Makefile.PL in here and  
> probably move to Build.PL
>
> -jason
> On Aug 28, 2008, at 11:00 AM, Yee Man Chan wrote:
>
>>
>> Hi Alexie
>>
>> My understanding is that you can ignore these failures.
>>
>> I believe test cases 17-20 were added by Jason Stajich before I  
>> added the feature you requested. I am not sure what he was doing  
>> there.
>>
>> I suppose he can give you the definite answer to whether this is  
>> something important or not.
>>
>> By the way, did you try out the new feature? Does it work?
>>
>> Thanks
>> Yee Man
>>
>> --- On Thu, 8/28/08, Alexie Papanicolaou <apapanicolaou at ice.mpg.de>  
>> wrote:
>>
>>> From: Alexie Papanicolaou <apapanicolaou at ice.mpg.de>
>>> Subject: Re: Bio::Tools::dpAlign feature request
>>> To: "Yee Man Chan" <ymc at yahoo.com>
>>> Date: Thursday, August 28, 2008, 6:15 AM
>>> hi
>>>
>>> is the version you emailed me newer or older than the
>>> subversion one?
>>>
>>> i'm testing the subversion version for bioperl-ext and
>>>
>>> not ok 17 # TODO evalues vary based on platform, needs
>>> fixing
>>> #   Failed (TODO) test at test.pl line 156.
>>> #          got: '2027805538'
>>> #     expected: '1764904'
>>> not ok 18 # TODO evalues vary based on platform, needs
>>> fixing
>>> #   Failed (TODO) test at test.pl line 157.
>>> #          got: '-1375488148'
>>> #     expected: '1764872'
>>> not ok 19 # TODO evalues vary based on platform, needs
>>> fixing
>>> #   Failed (TODO) test at test.pl line 158.
>>> #          got: '-808808307'
>>> #     expected: '1764872'
>>> not ok 20 # TODO evalues vary based on platform, needs
>>> fixing
>>> #   Failed (TODO) test at test.pl line 159.
>>> #          got: '-2118162890'
>>> #     expected: '1764872'
>>>
>>> you think these are ok to ignore?
>>>
>>>
>>> On Fri, 2008-08-01 at 21:03 -0700, Yee Man Chan wrote:
>>>
>>>> Hi Alexie
>>>>
>>>>  Attached are the files that contains the feature
>>> you requested. linspc.c is the one that does the work and
>>> test.pl has a test case for it. The scoring scheme is as
>>> described before. Please let me know if it works.
>>>>
>>>> Yee Man
>>>>
>>>> --- On Wed, 7/30/08, Alexie Papanicolaou
>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>
>>>>> From: Alexie Papanicolaou
>>> <apapanicolaou at ice.mpg.de>
>>>>> Subject: Re: Bio::Tools::dpAlign feature request
>>>>> To: ymc at yahoo.com
>>>>> Date: Wednesday, July 30, 2008, 2:44 PM
>>>>> Oh sorry
>>>>>
>>>>> Say match=3 and mismatch=-1, gopen= -10, gext=-5
>>>>> for aligning
>>>>> seq1: ATG
>>>>> seq2: ATT
>>>>> match: 3,3,-1
>>>>>
>>>>> seq1: AT-G
>>>>> seq2: ATTG
>>>>> match: 3,3,-1,-10,3
>>>>>
>>>>> is that possible? or am I missing something? I
>>> was only
>>>>> today wondering
>>>>> if it is even possible...
>>>>>
>>>>> a
>>>>>
>>>>>
>>>>> Yee Man Chan wrote:
>>>>>> Sorry, I don't quite get it. Can you
>>> give me an
>>>>> example of the output you want?
>>>>>>
>>>>>> Yee Man
>>>>>>
>>>>>> --- On Wed, 7/30/08, Alexie Papanicolaou
>>>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>>>
>>>>>>
>>>>>>> From: Alexie Papanicolaou
>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>> Subject: Re: Bio::Tools::dpAlign feature
>>> request
>>>>>>> To: ymc at yahoo.com
>>>>>>> Date: Wednesday, July 30, 2008, 9:50 AM
>>>>>>> Dear Yee Man,
>>>>>>>
>>>>>>> Do you think it is possible to code a
>>> method for
>>>>> creating a
>>>>>>> delimited
>>>>>>> (space or comma) "score-line"?
>>>>>>>
>>>>>>> I'd like to parse it into an array
>>> and have
>>>>> the
>>>>>>> individual score for
>>>>>>> each alignment position. Is it easy to
>>> do?
>>>>>>>
>>>>>>> a
>>>>>>>
>>>>>>> Yee Man Chan wrote:
>>>>>>>
>>>>>>>> Hi Alexie
>>>>>>>>
>>>>>>>>  How about I implement the simple
>>> case?
>>>>>>>>
>>>>>>>> So for match = +3, mismatch = -1,
>>>>>>>>
>>>>>>>> A and R = +3
>>>>>>>> A and Y = -1
>>>>>>>> A and B = -1
>>>>>>>> A and D = +3
>>>>>>>> A and N = +3
>>>>>>>> A and X = -1
>>>>>>>>
>>>>>>>> What do you think?
>>>>>>>> Yee Man
>>>>>>>>
>>>>>>>>
>>>>>>>> --- On Tue, 7/29/08, Alexie
>>> Papanicolaou
>>>>>>>>
>>>>>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>>> From: Alexie Papanicolaou
>>>>>>>>>
>>>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>>
>>>>>>>>> Subject: Re: Bio::Tools::dpAlign
>>> feature
>>>>> request
>>>>>>>>> To: ymc at yahoo.com
>>>>>>>>> Date: Tuesday, July 29, 2008,
>>> 10:58 AM
>>>>>>>>> Dear Yee Man,
>>>>>>>>> hello, I was wondering how is
>>> this
>>>>> progressing and
>>>>>>>>>
>>>>>>> if you
>>>>>>>
>>>>>>>>> need help?
>>>>>>>>>
>>>>>>>>> many thanks
>>>>>>>>> alexie
>>>>>>>>>
>>>>>>>>> Yee Man Chan wrote:
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>> Hi Alexie
>>>>>>>>>>
>>>>>>>>>>  There are two ways to
>>> compute the
>>>>> score for
>>>>>>>>>>
>>>>>>> each
>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>> aligned basepair in dpAlign
>>> module. One is
>>>>>>>>>
>>>>>>> match/mismatch
>>>>>>>
>>>>>>>>> if you specify your sequence as
>>> DNA and
>>>>> the other
>>>>>>>>>
>>>>>>> is a
>>>>>>>
>>>>>>>>> scoring matrix if you specify
>>> your
>>>>> sequence as
>>>>>>>>>
>>>>>>> protein.
>>>>>>>
>>>>>>>>> Obviously, the latter can
>>> completely
>>>>> dominate the
>>>>>>>>>
>>>>>>> former.
>>>>>>>
>>>>>>>>> If you take the time to type the
>>> scoring
>>>>> matrix
>>>>>>>>>
>>>>>>> file, then
>>>>>>>
>>>>>>>>> you can handle those IUPAC code
>>> by
>>>>> specifying the
>>>>>>>>>
>>>>>>> sequence
>>>>>>>
>>>>>>>>> as proteins.
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>  If you think this is too
>>>>> troublesome, then
>>>>>>>>>>
>>>>>>> I might
>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>> be able to extend the
>>> match/mismatch route
>>>>> to
>>>>>>>>>
>>>>>>> handle IUPAC
>>>>>>>
>>>>>>>>> codes. But the problem here is,
>>> how should
>>>>> I score
>>>>>>>>>
>>>>>>> a match
>>>>>>>
>>>>>>>>> of A and W when match is +3 and
>>> mismatch
>>>>> is -1?
>>>>>>>>>
>>>>>>> Should it
>>>>>>>
>>>>>>>>> have a score of +3/3 = +1 for
>>> match or
>>>>> +3/3-1*2/3
>>>>>>>>>
>>>>>>> = +1/3?
>>>>>>>
>>>>>>>>> Do you know what the convention
>>> is? If
>>>>> not, maybe
>>>>>>>>>
>>>>>>> you can
>>>>>>>
>>>>>>>>> tell me what you think the score
>>> will be?
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>> Yee Man
>>>>>>>>>>
>>>>>>>>>> --- On Thu, 6/26/08, Alexie
>>>>> Papanicolaou
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>> <apapanicolaou at ice.mpg.de>
>>> wrote:
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>> From: Alexie
>>> Papanicolaou
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> Subject:
>>> Bio::Tools::dpAlign
>>>>> feature
>>>>>>>>>>>
>>>>>>> request
>>>>>>>
>>>>>>>>>>> To: ymc at yahoo.com
>>>>>>>>>>> Date: Thursday, June 26,
>>> 2008,
>>>>> 4:15 AM
>>>>>>>>>>> Dear Yee Man Chan,
>>>>>>>>>>>
>>>>>>>>>>> Many thank you for this
>>> module. I
>>>>> like it
>>>>>>>>>>>
>>>>>>> very
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> much. I was
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> wondering if
>>>>>>>>>>> it would be possible for
>>> you to
>>>>> allow for
>>>>>>>>>>>
>>>>>>> IUPAC
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> DNA codes.
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> I see it is in your TODO
>>> list and
>>>>> I hoped
>>>>>>>>>>>
>>>>>>> to
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> inspire you
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> :-)
>>>>>>>>>>>
>>>>>>>>>>> Even a simple measure
>>> with the
>>>>> degenerate
>>>>>>>>>>>
>>>>>>> base
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> containing
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> the aligned
>>>>>>>>>>> base count as a
>>> (perfect) match
>>>>> would be
>>>>>>>>>>>
>>>>>>> very
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> useful to me
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> (i'm sorry, i
>>>>>>>>>>> 'm not a good coder
>>> to do it
>>>>> myself).
>>>>>>>>>>>
>>>>>>>>>>> many thanks for your
>>> work so far.
>>>>>>>>>>> alexie
>>>>>>>>>>>
>>>>>>>>>>> -- 
>>>>>>>>>>> --
>>>>>>>>>>> "Eppur si
>>> evolve"
>>>>> ("And yet
>>>>>>>>>>>
>>>>>>> it
>>>>>>>
>>>>>>>>>>> evolves")
>>>>>>>>>>> -Galileo Jr (ca 21st
>>> century)
>>>>>>>>>>>
>>>>>>>>>>> --
>>>>>>>>>>> Alexie Papanicolaou
>>>>>>>>>>> Entomology
>>>>>>>>>>> Max Planck Institute for
>>> Chemical
>>>>> Ecology
>>>>>>>>>>> Hans Knoell Str 8
>>>>>>>>>>> Jena 07745
>>>>>>>>>>> Germany
>>>>>>>>>>> Email
>>> apapanicolaou at ice.mpg.de
>>>>>>>>>>> Tel +493641571561
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>> -- 
>>>>>>>>> --
>>>>>>>>> "Eppur si evolve"
>>> ("And yet
>>>>> it
>>>>>>>>> evolves")
>>>>>>>>> -Galileo Jr (ca 21st century)
>>>>>>>>>
>>>>>>>>> "One Galileo in two
>>> thousand years is
>>>>>>>>>
>>>>>>> enough."
>>>>>>>
>>>>>>>>> -Pope Pius XII
>>>>>>>>> --
>>>>>>>>> Alexie Papanicolaou
>>>>>>>>> Entomology
>>>>>>>>> Max Planck Institute for
>>> Chemical Ecology
>>>>>>>>> Hans Knoell Str 8
>>>>>>>>> Jena 07745
>>>>>>>>> Germany
>>>>>>>>> Email apapanicolaou at ice.mpg.de
>>>>>>>>> Tel +493641571561
>>>>>>>>>
>>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>> -- 
>>>>>>> --
>>>>>>> "Eppur si evolve" ("And
>>> yet it
>>>>>>> evolves")
>>>>>>> -Galileo Jr (ca 21st century)
>>>>>>>
>>>>>>> "One Galileo in two thousand years
>>> is
>>>>> enough."
>>>>>>> -Pope Pius XII
>>>>>>> --
>>>>>>> Alexie Papanicolaou
>>>>>>> Entomology
>>>>>>> Max Planck Institute for Chemical
>>> Ecology
>>>>>>> Hans Knoell Str 8
>>>>>>> Jena 07745
>>>>>>> Germany
>>>>>>> Email apapanicolaou at ice.mpg.de
>>>>>>> Tel +493641571561
>>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>
>>>>> -- 
>>>>> --
>>>>> "Eppur si evolve" ("And yet it
>>>>> evolves")
>>>>> -Galileo Jr (ca 21st century)
>>>>>
>>>>> "One Galileo in two thousand years is
>>> enough."
>>>>> -Pope Pius XII
>>>>> --
>>>>> Alexie Papanicolaou
>>>>> Entomology
>>>>> Max Planck Institute for Chemical Ecology
>>>>> Hans Knoell Str 8
>>>>> Jena 07745
>>>>> Germany
>>>>> Email apapanicolaou at ice.mpg.de
>>>>> Tel +493641571561
>>>>
>>>>
>>>>
>>>
>>> -- 
>>> -- 
>>> "Eppur si evolve" ("And yet it
>>> evolves")
>>> -Galileo Jr (ca 21st century)
>>>
>>> "One Galileo in two thousand years is enough."
>>> -Pope Pius XII
>>> -- 
>>> Alexie Papanicolaou
>>> Entomology
>>> Max Planck Institute for Chemical Ecology
>>> Hans Knoell Str 8
>>> Jena 07745
>>> Germany
>>> Email apapanicolaou at ice.mpg.de
>>> Tel +493641571561
>>
>>
>>
>
> Jason Stajich
> jason at bioperl.org
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From lmanchon at univ-montp2.fr  Wed Sep  3 09:04:14 2008
From: lmanchon at univ-montp2.fr (Laurent Manchon)
Date: Wed, 03 Sep 2008 15:04:14 +0200
Subject: [Bioperl-l] parsing result of CAP3 (ACE file)
Message-ID: <5.0.2.1.2.20080903150203.00c0db18@pop.univ-montp2.fr>

-- Hi,

Is somebody have a piece of code to parse result of CAP3 assembly program which
format is ACE ?
I need to retrieve the alignment from this file.

thank you,
Laurent --




+---------------------------------------------+
  Laurent Manchon
  Email: lmanchon at univ-montp2.fr
+---------------------------------------------+


From osborne6 at gmail.com  Wed Sep  3 10:33:15 2008
From: osborne6 at gmail.com (John Osborne)
Date: Wed, 3 Sep 2008 09:33:15 -0500
Subject: [Bioperl-l] interpro parsing enhancement?
Message-ID: <324fccf0809030733y5c5e8592t5f0617d0ff4d2203@mail.gmail.com>

Hi -
I'm wondering if anyone is working on adding functionality to
Bio::SeqIO::interpro to grab the Gene Ontology/GO classifications out
of the interpro xml output?

I've started working on that myself, but wanted to check if anyone
else is doing the same.

Thanks!
-- 
John Osborne
osborne6 at ieee.org/osborne6 at gmail.com/jro at freeshell.org


From gundalav at gmail.com  Wed Sep  3 10:48:07 2008
From: gundalav at gmail.com (Gundala Viswanath)
Date: Wed, 3 Sep 2008 23:48:07 +0900
Subject: [Bioperl-l] Fitch's Parsimony Algorithm with Perl
Message-ID: <73f827b50809030748o725d3772m681af9da3c0c26c0@mail.gmail.com>

Hi,

What's a correct way to implement Fitch's parsimony algorithm?
Especially to compute minimum substitiution rate per column
in the aligned sequence.

Is there a Bioperl module to do it?

For example
CGGCGGAAAACTGTCCTCCGTGC   mouse
CGACGGAACATTCTCCTCCGCGC   rat
CGACGGAATATTCCCCTCCGTGC   human
CGACGGAAGACTCTCCTCCGTGC   chimp

00100000302011000000100   -> number of subst per site (max parsimony)

My code below doesn't seem to do the job.

__BEGIN__
use Data::Dumper;
use List::MoreUtils qw(uniq);

# The related phylogenetic in Newick format tree is:
my $tree = ' (mouse,rat,(human,chimp))';

my $sites = [
    'CGGCGGAAAACTGTCCTCCGTGC', # mouse
    'CGACGGAACATTCTCCTCCGCGC', # rat
    'CGACGGAATATTCCCCTCCGTGC', # human
    'CGACGGAAGACTCTCCTCCGTGC', # chimp
];

my @val = my_parsimony($sites);
print Dumper \@val;

sub my_parsimony {

    my  $tfbs   = shift;
    my $mlen = length($tfbs->[0]);

    my $sum_min = 0;
    my @mincol;

    foreach my $pos ( 0 .. $mlen-1 ) {

        my @colbp = ();
        foreach my $site ( @{$tfbs} ) {
            my $bp = substr($site,$pos,1);
            push @colbp, $bp;

        }

       # this heuristic seems to be faulty
       # Column 11 it predicts 1 instead of 2

       # Not sure how can I make use of the tree

        my $min_mm = scalar( uniq(@colbp) ) - 1;
        push @mincol, $min_mm;
    }

    return @mincol;
}

__END__

- Gundala Viswanath
Jakarta - Indonesia


From raulmendez at cbm.uam.es  Wed Sep  3 10:33:46 2008
From: raulmendez at cbm.uam.es (Raul Mendez Giraldez)
Date: Wed, 03 Sep 2008 16:33:46 +0200
Subject: [Bioperl-l] SeqHound
In-Reply-To: <111DD141-75F8-4437-9EAD-E049BBADB515@uiuc.edu>
Message-ID: <1220452426.31595.92.camel@pepa.cbm.uam.es>

Hi Chris,

I'm trying to set up and run bioperl Seqhound donwloaded from:

http://bond.unleashedinformatics.com/downloads/api//seqhound-bioperl-4.0.tar.gz

and I always get connection error messages. Do you know which version of
SeqHound should I use and how can I configure to make it work? I've
tried several possibilities for server1 at .shoundremrc as

[remote]
server1 = bond.unleashedinformatics.com
CGI = /cgi-bin/seqrem
port=8080

Also, I would like to get all the possible protein-protein interaction
for a set of protein sequences. Would this be possible using SeqHound?

Thanks,
Ra?l




-- 
Ra?l M?ndez Gir?ldez, Ph.D.
Bioinformatics Unit
Centre for Molecular Biology "Severo Ochoa"
Universidad Aut?noma de Madrid
C/ Nicol?s Cabrera, 1
Cantoblanco 28049, Madrid
SPAIN

Phone: +34 91 196 4633




From jaudall at gmail.com  Wed Sep  3 11:38:08 2008
From: jaudall at gmail.com (Joshua Udall)
Date: Wed, 3 Sep 2008 09:38:08 -0600
Subject: [Bioperl-l] parsing result of CAP3 (ACE file)
In-Reply-To: <5.0.2.1.2.20080903150203.00c0db18@pop.univ-montp2.fr>
References: <5.0.2.1.2.20080903150203.00c0db18@pop.univ-montp2.fr>
Message-ID: <52cea20c0809030838k6fb1498btc15b8e76d98f9d70@mail.gmail.com>

Laurent -

I have modified modules that will do it as I recently ran into problems with
the DB_FILE module in Assembly::IO.  In addition, the current version of
cap3 seems to put a contig length where a pad length is expected (based on
the Ace format description).  The modules I have will parse the ace file
contig-by-contig rather than having the entire assembly slurped into memory
(or a tied hash) all at once.  You are welcome to them if you are interested
and I'd like to get them in Bioperl at some point.  Bascially, there are
three files - a modified Contig.pm, ContigIO.pm, and a modified ace.pm (in a
ContigIO directory).

Josh

On Wed, Sep 3, 2008 at 7:04 AM, Laurent Manchon <lmanchon at univ-montp2.fr>wrote:

> -- Hi,
>
> Is somebody have a piece of code to parse result of CAP3 assembly program
> which
> format is ACE ?
> I need to retrieve the alignment from this file.
>
> thank you,
> Laurent --
>
>
>
>
> +---------------------------------------------+
>  Laurent Manchon
>  Email: lmanchon at univ-montp2.fr
> +---------------------------------------------+
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Joshua Udall
Assistant Professor
295 WIDB
Plant and Wildlife Science Dept.
Brigham Young University
Provo, UT 84602
801-422-9307
Fax: 801-422-0008
USA


From hartzell at alerce.com  Wed Sep  3 19:19:45 2008
From: hartzell at alerce.com (George Hartzell)
Date: Wed, 3 Sep 2008 16:19:45 -0700
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
Message-ID: <18623.7057.95449.99461@almost.alerce.com>


Ok, confess.  None of you know what's up with line 248 of
Bio::Coordinate::Pair, do you?  You probably don't even know what's
*on* that line.  Wonder how many will go look.

Now that I either have your attention or have pissed you off (or
both...), I think that creating a new Bio::Location::Split object in
Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
quite sure enough to excise it and commit the change.

Anyone up for it?

g.


From cjfields at illinois.edu  Wed Sep  3 21:29:49 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 3 Sep 2008 20:29:49 -0500
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
In-Reply-To: <18623.7057.95449.99461@almost.alerce.com>
References: <18623.7057.95449.99461@almost.alerce.com>
Message-ID: <C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>

Well, it doesn't look like the SplitLocation is even used, so I think  
it is safe to remove.

chris

On Sep 3, 2008, at 6:19 PM, George Hartzell wrote:

>
> Ok, confess.  None of you know what's up with line 248 of
> Bio::Coordinate::Pair, do you?  You probably don't even know what's
> *on* that line.  Wonder how many will go look.
>
> Now that I either have your attention or have pissed you off (or
> both...), I think that creating a new Bio::Location::Split object in
> Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
> quite sure enough to excise it and commit the change.
>
> Anyone up for it?
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From jason at bioperl.org  Thu Sep  4 00:40:38 2008
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 3 Sep 2008 21:40:38 -0700
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
In-Reply-To: <C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>
References: <18623.7057.95449.99461@almost.alerce.com>
	<C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>
Message-ID: <222DB5D8-BCCB-448E-BDEE-068A4A432660@bioperl.org>

Agreed - I don't know if that was something was changed mid-stream,  
but removing it should cause no pain...
-j
On Sep 3, 2008, at 6:29 PM, Chris Fields wrote:

> Well, it doesn't look like the SplitLocation is even used, so I  
> think it is safe to remove.
>
> chris
>
> On Sep 3, 2008, at 6:19 PM, George Hartzell wrote:
>
>>
>> Ok, confess.  None of you know what's up with line 248 of
>> Bio::Coordinate::Pair, do you?  You probably don't even know what's
>> *on* that line.  Wonder how many will go look.
>>
>> Now that I either have your attention or have pissed you off (or
>> both...), I think that creating a new Bio::Location::Split object in
>> Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
>> quite sure enough to excise it and commit the change.
>>
>> Anyone up for it?
>>
>> g.
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Marie-Claude Hofmann
> College of Veterinary Medicine
> University of Illinois Urbana-Champaign
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From heikki at sanbi.ac.za  Thu Sep  4 02:17:31 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Thu, 4 Sep 2008 08:17:31 +0200
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
In-Reply-To: <222DB5D8-BCCB-448E-BDEE-068A4A432660@bioperl.org>
References: <18623.7057.95449.99461@almost.alerce.com>
	<C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>
	<222DB5D8-BCCB-448E-BDEE-068A4A432660@bioperl.org>
Message-ID: <200809040817.31916.heikki@sanbi.ac.za>

Quilty. So I removed the line.

George, please do not try to piss us off. You can get all the attention you 
want from us. :)

What are you planning to do to Bio::Coordinate classes?

   -Heikki


On Thursday 04 September 2008 06:40:38 Jason Stajich wrote:
> Agreed - I don't know if that was something was changed mid-stream,
> but removing it should cause no pain...
> -j
>
> On Sep 3, 2008, at 6:29 PM, Chris Fields wrote:
> > Well, it doesn't look like the SplitLocation is even used, so I
> > think it is safe to remove.
> >
> > chris
> >
> > On Sep 3, 2008, at 6:19 PM, George Hartzell wrote:
> >> Ok, confess.  None of you know what's up with line 248 of
> >> Bio::Coordinate::Pair, do you?  You probably don't even know what's
> >> *on* that line.  Wonder how many will go look.
> >>
> >> Now that I either have your attention or have pissed you off (or
> >> both...), I think that creating a new Bio::Location::Split object in
> >> Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
> >> quite sure enough to excise it and commit the change.
> >>
> >> Anyone up for it?
> >>
> >> g.
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> > Christopher Fields
> > Postdoctoral Researcher
> > Lab of Dr. Marie-Claude Hofmann
> > College of Veterinary Medicine
> > University of Illinois Urbana-Champaign
> >
> >
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Jason Stajich
> jason at bioperl.org
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From hartzell at alerce.com  Thu Sep  4 12:00:21 2008
From: hartzell at alerce.com (George Hartzell)
Date: Thu, 4 Sep 2008 09:00:21 -0700
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
In-Reply-To: <200809040817.31916.heikki@sanbi.ac.za>
References: <18623.7057.95449.99461@almost.alerce.com>
	<C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>
	<222DB5D8-BCCB-448E-BDEE-068A4A432660@bioperl.org>
	<200809040817.31916.heikki@sanbi.ac.za>
Message-ID: <18624.1557.758033.258065@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > Quilty. So I removed the line.
 > 
 > George, please do not try to piss us off. You can get all the attention you 
 > want from us. :)

Try not. Do... or do not. There is no try.

 > What are you planning to do to Bio::Coordinate classes?

It's a project for a paying customer (yikes...).  Pretty much exactly
what GeneMapper does, though I'll probably end up dangling a couple
more named coordinate spaces off of it.  Nothing earth shattering.
The classes look *great*.

g.


From hartzell at alerce.com  Fri Sep  5 15:01:35 2008
From: hartzell at alerce.com (George Hartzell)
Date: Fri, 05 Sep 2008 12:01:35 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean better
	(w/ patch)
Message-ID: <m263pabenk.fsf@almost.alerce.com>


Hi all,

Bio::Coordinate::Collection surprised me a bit.  At first I thought
there was a bug, but it's clearly doing what it's supposed to.  Now
I'm wondering if what it's supposed to be doing makes sense in some
context, or if what I expected would be better functionality.

t/CoordinateMapper.t sets up the following scenario:

#
# Collection
#
#         1   5     6   10
#         |---|     |---|
#-----|-----------------------
#     1   5   9     15  19
#         pair1     pair2

Then goes on to do the following query:

  # match more than two
  $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
  ok $res = $transcribe->map($pos);
  is $res->each_gap, 2;
  is $res->each_match, 2;

I was surprised to see that there were two gaps, one gene:10-19 and
one from gene:5-14.  Looking at the code, what's really happening is
that, for the exon1 mapper there's match with gene:5-9 and a gap with
gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
match with gene:15-19.  All four Result's just get tossed into the
return value.

The result my intuition wants is that there are two matches (gene:5-9
with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).

Yes, I guess that I could just synthesize these myself from the result
in my app.

It still seems that the current result is a bug though, since there's
no way of knowing when you're walking through $res->each_Location that
the first "gap" is with respect to the exon1 mapper and that the
second "gap" is with respect to the exon2 mapper.  The gaps are
meaningless.

I "fixed" it to work the way I think it should (two matches, one
gap).  I actually extended the test case a bit so that there's a
multi-base gap, a match, another multibase-gap, another match, then a
single base gap (just to make sure I got that right...).  I had to
touch up the test file a bit to account for my new test.

The gaps that I return have a strand of 'undef', which seems to be The
Right Thing.  There's also a bit of funny business where I hang onto
the seq_id of the gapped sequence.  It assumes that the "in" sequence
is the same for all of the mappers.  This seems safe since otherwise
the entire query is kind of weird....

There's a patch to todays svn head at:

  http://shrimp.alerce.com/bioperl/collection-diffs.txt

The patch changes Build.PL to include a dependency on Set::IntSpan,
CoordinateMapper.t to update the tests, and
Bio/CoordinateMapper/Collection.pm for the new code.

Who's code would this break.

If anyone's relying on the current behaviour re: gaps, what's the
situation in which you find it useful?

Thanks!

g.


From ajmackey at gmail.com  Fri Sep  5 16:54:56 2008
From: ajmackey at gmail.com (Aaron Mackey)
Date: Fri, 5 Sep 2008 16:54:56 -0400
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better (w/ patch)
In-Reply-To: <m263pabenk.fsf@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
Message-ID: <24c96eca0809051354h5b7218edtaa720140901d023f@mail.gmail.com>

There are two uses for Collection:

1) all the "in" seq_id's are the same, and George's patch makes sense to me
(i.e. agrees with my intuition)

2) all the "in" seq_id's are *not* the same (i.e. the collection is just a
hash of indivual pairs), in which case my query would only match the subset
of pairs having identical seq_id's to that specified by the query ... and
then you're back to case #1

So overall, it looks like this was a bug, but I'd of course want to hear
Heikki's opinion.

Thanks for raising this,

-Aaron

On Fri, Sep 5, 2008 at 3:01 PM, George Hartzell <hartzell at alerce.com> wrote:

>
> Hi all,
>
> Bio::Coordinate::Collection surprised me a bit.  At first I thought
> there was a bug, but it's clearly doing what it's supposed to.  Now
> I'm wondering if what it's supposed to be doing makes sense in some
> context, or if what I expected would be better functionality.
>
> t/CoordinateMapper.t sets up the following scenario:
>
> #
> # Collection
> #
> #         1   5     6   10
> #         |---|     |---|
> #-----|-----------------------
> #     1   5   9     15  19
> #         pair1     pair2
>
> Then goes on to do the following query:
>
>  # match more than two
>  $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
>  ok $res = $transcribe->map($pos);
>  is $res->each_gap, 2;
>  is $res->each_match, 2;
>
> I was surprised to see that there were two gaps, one gene:10-19 and
> one from gene:5-14.  Looking at the code, what's really happening is
> that, for the exon1 mapper there's match with gene:5-9 and a gap with
> gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
> match with gene:15-19.  All four Result's just get tossed into the
> return value.
>
> The result my intuition wants is that there are two matches (gene:5-9
> with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
>
> Yes, I guess that I could just synthesize these myself from the result
> in my app.
>
> It still seems that the current result is a bug though, since there's
> no way of knowing when you're walking through $res->each_Location that
> the first "gap" is with respect to the exon1 mapper and that the
> second "gap" is with respect to the exon2 mapper.  The gaps are
> meaningless.
>
> I "fixed" it to work the way I think it should (two matches, one
> gap).  I actually extended the test case a bit so that there's a
> multi-base gap, a match, another multibase-gap, another match, then a
> single base gap (just to make sure I got that right...).  I had to
> touch up the test file a bit to account for my new test.
>
> The gaps that I return have a strand of 'undef', which seems to be The
> Right Thing.  There's also a bit of funny business where I hang onto
> the seq_id of the gapped sequence.  It assumes that the "in" sequence
> is the same for all of the mappers.  This seems safe since otherwise
> the entire query is kind of weird....
>
> There's a patch to todays svn head at:
>
>  http://shrimp.alerce.com/bioperl/collection-diffs.txt
>
> The patch changes Build.PL to include a dependency on Set::IntSpan,
> CoordinateMapper.t to update the tests, and
> Bio/CoordinateMapper/Collection.pm for the new code.
>
> Who's code would this break.
>
> If anyone's relying on the current behaviour re: gaps, what's the
> situation in which you find it useful?
>
> Thanks!
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From jimhu at tamu.edu  Mon Sep  8 14:44:22 2008
From: jimhu at tamu.edu (Jim Hu)
Date: Mon, 8 Sep 2008 13:44:22 -0500
Subject: [Bioperl-l] Circular genomes in Chado/BioPerl
Message-ID: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>

In discussions with GMOD about Gbrowse, we've come up with a proposal  
for handling circular genomes and features that cross the origin in  
such genomes.  This applies to lots of prokaryotic and viral genomes,  
and might be valuable for some ways of representing terminally  
redundant linear genomes.

1) Keep the requirement that start < end
2) allow end > parent feature length
3) parent feature gets an is_circular boolean
4) use modular arithmetic to calculate the real position of end on the  
parent feature.

We'd like to do this in a way that will be consistent with Chado and  
BioPerl representation of features as much as possible (realizing that  
there is the usual interbase or not coordinate issue).  What do people  
think?  Lincoln is on board for modifying the GFF3 spec.

Thanks!

Jim Hu

=====================================
Jim Hu
Associate Professor
Dept. of Biochemistry and Biophysics
2128 TAMU
Texas A&M Univ.
College Station, TX 77843-2128
979-862-4054




From ajmackey at gmail.com  Mon Sep  8 15:57:50 2008
From: ajmackey at gmail.com (Aaron Mackey)
Date: Mon, 8 Sep 2008 15:57:50 -0400
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
Message-ID: <24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>

How can you handle features that may cross the origin more than once?
The modulus, though simple, seems to be only half the solution.  It
also makes it difficult to place features in the genome "by eye"
(having to do the modulus subtraction in my head), or in
sorting/filtering operations.

I have an alternative that I wondered if you considered: allow the
start/end to have an additional "circular revolution" prefix:

a typical range tuple like: 100 200 -
is thus shorthand for: 0:100 0:200 -
(i.e. both the 100 and 200 are in the same "revolution" around the genome)

and is then distinguishable from an "around the genome + 100" feature of:
1:100 0:200 -

Just an alternative to consider (if you haven't already).  I'm not
wedded to the syntax, but I wouldn't want to see new columns in GFF
just for this.  Essentially, what you want is some form of compound
polar coordinates, it seems.

-Aaron

On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
> In discussions with GMOD about Gbrowse, we've come up with a proposal for
> handling circular genomes and features that cross the origin in such
> genomes.  This applies to lots of prokaryotic and viral genomes, and might
> be valuable for some ways of representing terminally redundant linear
> genomes.
> 1) Keep the requirement that start < end
> 2) allow end > parent feature length
> 3) parent feature gets an is_circular boolean
> 4) use modular arithmetic to calculate the real position of end on the
> parent feature.
> We'd like to do this in a way that will be consistent with Chado and BioPerl
> representation of features as much as possible (realizing that there is the
> usual interbase or not coordinate issue).  What do people think?  Lincoln is
> on board for modifying the GFF3 spec.
> Thanks!
> Jim Hu
>
> =====================================
>
> Jim Hu
>
> Associate Professor
>
> Dept. of Biochemistry and Biophysics
>
> 2128 TAMU
>
> Texas A&M Univ.
>
> College Station, TX 77843-2128
>
> 979-862-4054
>
>
> -------------------------------------------------------------------------
> This SF.Net email is sponsored by the Moblin Your Move Developer's challenge
> Build the coolest Linux based applications with Moblin SDK & win great
> prizes
> Grand prize is a trip for two to an Open Source event anywhere in the world
> http://moblin-contest.org/redirect.php?banner_id=100&url=/
> _______________________________________________
> Gmod-schema mailing list
> Gmod-schema at lists.sourceforge.net
> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>
>


From js5 at sanger.ac.uk  Mon Sep  8 16:13:12 2008
From: js5 at sanger.ac.uk (James Smith)
Date: Mon, 8 Sep 2008 21:13:12 +0100 (BST)
Subject: [Bioperl-l] Circular genomes in Chado/BioPerl
In-Reply-To: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
Message-ID: <Pine.LNX.4.64.0809082111280.23303@cbi4g.internal.sanger.ac.uk>



On Mon, 8 Sep 2008, Jim Hu wrote:

> In discussions with GMOD about Gbrowse, we've come up with a proposal for 
> handling circular genomes and features that cross the origin in such genomes. 
> This applies to lots of prokaryotic and viral genomes, and might be valuable 
> for some ways of representing terminally redundant linear genomes.
>
> 1) Keep the requirement that start < end
> 2) allow end > parent feature length
> 3) parent feature gets an is_circular boolean
> 4) use modular arithmetic to calculate the real position of end on the parent 
> feature.

This is how we are considering handling features in Ensembl as well (the 
Ensembl genomes project will be setting up websites for bacterial and 
viral genomes)


>
> We'd like to do this in a way that will be consistent with Chado and BioPerl 
> representation of features as much as possible (realizing that there is the 
> usual interbase or not coordinate issue).  What do people think?  Lincoln is 
> on board for modifying the GFF3 spec.
>
> Thanks!
>
> Jim Hu
>
> =====================================
> Jim Hu
> Associate Professor
> Dept. of Biochemistry and Biophysics
> 2128 TAMU
> Texas A&M Univ.
> College Station, TX 77843-2128
> 979-862-4054
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 


From heikki at sanbi.ac.za  Tue Sep  9 03:50:11 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Tue, 9 Sep 2008 09:50:11 +0200
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better (w/ patch)
In-Reply-To: <m263pabenk.fsf@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
Message-ID: <200809090950.11821.heikki@sanbi.ac.za>

George,

This is an error from my side. Great that you have a fix already.

My only worry is the number of external dependencies in BioPerl. To limit 
these we have recoded number of functionalities into BioPerl-specific modules. 
Before you commit the fix, could you see if Bio::RangeI could be used or easily 
extended to be used instead of Set::IntSpan?

Thanks,

   -Heikki

On Friday 05 September 2008 21:01:35 George Hartzell wrote:
> Hi all,
>
> Bio::Coordinate::Collection surprised me a bit.  At first I thought
> there was a bug, but it's clearly doing what it's supposed to.  Now
> I'm wondering if what it's supposed to be doing makes sense in some
> context, or if what I expected would be better functionality.
>
> t/CoordinateMapper.t sets up the following scenario:
>
> #
> # Collection
> #
> #         1   5     6   10
> #         |---|     |---|
> #-----|-----------------------
> #     1   5   9     15  19
> #         pair1     pair2
>
> Then goes on to do the following query:
>
>   # match more than two
>   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
>   ok $res = $transcribe->map($pos);
>   is $res->each_gap, 2;
>   is $res->each_match, 2;
>
> I was surprised to see that there were two gaps, one gene:10-19 and
> one from gene:5-14.  Looking at the code, what's really happening is
> that, for the exon1 mapper there's match with gene:5-9 and a gap with
> gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
> match with gene:15-19.  All four Result's just get tossed into the
> return value.
>
> The result my intuition wants is that there are two matches (gene:5-9
> with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
>
> Yes, I guess that I could just synthesize these myself from the result
> in my app.
>
> It still seems that the current result is a bug though, since there's
> no way of knowing when you're walking through $res->each_Location that
> the first "gap" is with respect to the exon1 mapper and that the
> second "gap" is with respect to the exon2 mapper.  The gaps are
> meaningless.
>
> I "fixed" it to work the way I think it should (two matches, one
> gap).  I actually extended the test case a bit so that there's a
> multi-base gap, a match, another multibase-gap, another match, then a
> single base gap (just to make sure I got that right...).  I had to
> touch up the test file a bit to account for my new test.
>
> The gaps that I return have a strand of 'undef', which seems to be The
> Right Thing.  There's also a bit of funny business where I hang onto
> the seq_id of the gapped sequence.  It assumes that the "in" sequence
> is the same for all of the mappers.  This seems safe since otherwise
> the entire query is kind of weird....
>
> There's a patch to todays svn head at:
>
>   http://shrimp.alerce.com/bioperl/collection-diffs.txt
>
> The patch changes Build.PL to include a dependency on Set::IntSpan,
> CoordinateMapper.t to update the tests, and
> Bio/CoordinateMapper/Collection.pm for the new code.
>
> Who's code would this break.
>
> If anyone's relying on the current behaviour re: gaps, what's the
> situation in which you find it useful?
>
> Thanks!
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From heikki at sanbi.ac.za  Tue Sep  9 03:50:11 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Tue, 9 Sep 2008 09:50:11 +0200
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better (w/ patch)
In-Reply-To: <m263pabenk.fsf@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
Message-ID: <200809090950.11821.heikki@sanbi.ac.za>

George,

This is an error from my side. Great that you have a fix already.

My only worry is the number of external dependencies in BioPerl. To limit 
these we have recoded number of functionalities into BioPerl-specific modules. 
Before you commit the fix, could you see if Bio::RangeI could be used or easily 
extended to be used instead of Set::IntSpan?

Thanks,

   -Heikki

On Friday 05 September 2008 21:01:35 George Hartzell wrote:
> Hi all,
>
> Bio::Coordinate::Collection surprised me a bit.  At first I thought
> there was a bug, but it's clearly doing what it's supposed to.  Now
> I'm wondering if what it's supposed to be doing makes sense in some
> context, or if what I expected would be better functionality.
>
> t/CoordinateMapper.t sets up the following scenario:
>
> #
> # Collection
> #
> #         1   5     6   10
> #         |---|     |---|
> #-----|-----------------------
> #     1   5   9     15  19
> #         pair1     pair2
>
> Then goes on to do the following query:
>
>   # match more than two
>   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
>   ok $res = $transcribe->map($pos);
>   is $res->each_gap, 2;
>   is $res->each_match, 2;
>
> I was surprised to see that there were two gaps, one gene:10-19 and
> one from gene:5-14.  Looking at the code, what's really happening is
> that, for the exon1 mapper there's match with gene:5-9 and a gap with
> gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
> match with gene:15-19.  All four Result's just get tossed into the
> return value.
>
> The result my intuition wants is that there are two matches (gene:5-9
> with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
>
> Yes, I guess that I could just synthesize these myself from the result
> in my app.
>
> It still seems that the current result is a bug though, since there's
> no way of knowing when you're walking through $res->each_Location that
> the first "gap" is with respect to the exon1 mapper and that the
> second "gap" is with respect to the exon2 mapper.  The gaps are
> meaningless.
>
> I "fixed" it to work the way I think it should (two matches, one
> gap).  I actually extended the test case a bit so that there's a
> multi-base gap, a match, another multibase-gap, another match, then a
> single base gap (just to make sure I got that right...).  I had to
> touch up the test file a bit to account for my new test.
>
> The gaps that I return have a strand of 'undef', which seems to be The
> Right Thing.  There's also a bit of funny business where I hang onto
> the seq_id of the gapped sequence.  It assumes that the "in" sequence
> is the same for all of the mappers.  This seems safe since otherwise
> the entire query is kind of weird....
>
> There's a patch to todays svn head at:
>
>   http://shrimp.alerce.com/bioperl/collection-diffs.txt
>
> The patch changes Build.PL to include a dependency on Set::IntSpan,
> CoordinateMapper.t to update the tests, and
> Bio/CoordinateMapper/Collection.pm for the new code.
>
> Who's code would this break.
>
> If anyone's relying on the current behaviour re: gaps, what's the
> situation in which you find it useful?
>
> Thanks!
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From Frigerio at pierroton.inra.fr  Tue Sep  9 04:45:19 2008
From: Frigerio at pierroton.inra.fr (Jean-Marc FRIGERIO)
Date: Tue, 9 Sep 2008 10:45:19 +0200
Subject: [Bioperl-l] parsing result of CAP3 (ACE file)
Message-ID: <200809091045.19249.Frigerio@pierroton.inra.fr>

> > -- Hi,
> >
> > Is somebody have a piece of code to parse result of CAP3 assembly program
> > which
> > format is ACE ?
> > I need to retrieve the alignment from this file.
> >
> > thank you,
> > Laurent --
> >
> >
> >
> >
> > +---------------------------------------------+
> >  Laurent Manchon
> >  Email: lmanchon at univ-montp2.fr
> > +---------------------------------------------+
>
> Laurent -
>
> I have modified modules that will do it as I recently ran into problems
> with the DB_FILE module in Assembly::IO.  In addition, the current version
> of cap3 seems to put a contig length where a pad length is expected (based
> on the Ace format description).  The modules I have will parse the ace file
> contig-by-contig rather than having the entire assembly slurped into memory
> (or a tied hash) all at once.  You are welcome to them if you are
> interested and I'd like to get them in Bioperl at some point.  Bascially,
> there are three files - a modified Contig.pm, ContigIO.pm, and a modified
> ace.pm (in a ContigIO directory).
>
> Josh

Hi,
Here are a 2 pieces of code running on an ace file (output of phrap is that 
the same as cap3 ?)
----------------------------- 1 -----------------------------------------
my $assembly = Bio::Assembly::IO->new('-file'    => $file,
                                 '-format'  => 'ace')->next_assembly;

for my $contig ($assembly->all_contigs)
{
    my $ct_seq  = $contig->get_consensus_sequence;
    (my $ref_seq = uc $ct_seq->seq) =~ s/-//g;

    my $debut  = $pos - 100 > 0 ? $pos - 100 : 1;
    my $fin    = $pos + 100 <= length $ref_seq ?
                 $pos + 100 :  length $ref_seq;

    my $coll = $contig->get_features_collection;
    my @coll = $coll->features_in_range('-start' => $debut, '-end' => $fin);
    for my $tag (@coll)
    {
        next unless  $tag->primary_tag eq 'comment';
#print "TAG: ",$tag->start,"\n";
        my $tag_pos = $contig->change_coord('gapped consensus','ungapped 
consensus',$tag->start);
#print "TAG POS: $tag_pos\n";
        next if $pos == $tag_pos;

        substr($ref_seq,$tag_pos-1,1,'N');

    }
}



------------------------------------ 2 -------------------
 my $assembly = Bio::Assembly::IO->new(
    '-file'    => $file,
    '-format'  => 'ace')->next_assembly;
  for my $contig ($assembly->all_contigs)
  {
    for my $seq ($contig->each_seq)
    {
      my $id = $seq->id;
      my $s = $seq->seq;
      my ($start,$end) =
        ($contig->change_coord("aligned $id","ungapped consensus",
$seq->start),
         $contig->change_coord("aligned $id","ungapped consensus",$seq->end));
      my $dir = $seq->strand < 0 ? 'R' : 'F';
 ......
}
	-- Jean-Marc


From zheboyang at gmail.com  Tue Sep  9 07:05:15 2008
From: zheboyang at gmail.com (boyang zhe)
Date: Tue, 9 Sep 2008 19:05:15 +0800
Subject: [Bioperl-l] help:HMM parsing error
Message-ID: <127e75f60809090405h644e51eftcab073e8bf179720@mail.gmail.com>

  I write a script to parse the HMMER report ,it is as follows:
   #!/usr/bin/perl -w
   #TODO: Parse the HMMER report
   use strict;
   use Bio::SearchIO;
   my $directory="./HMM/";
   opendir(HMMDIR, $directory), or die "Can't open the directory!";
   my @filelist=readdir(HMMDIR);
   foreach my $filename(@filelist)
   {
   if ($filename !~/^\./)
   {
   my $infile="$directory"."$filename";
   my $outfile="$infile"."HMMParse";
   my $in = new Bio::SearchIO(-format => 'hmmer',-file =>"$infile");

- Ignored:
   while (my  $result= $in->next_result )
   {
   # get a Bio::Search::Result::HMMERResult object
   # get hits numbers
   my $hitnumber=$result->num_hits;
   if ($hitnumber != 0)
   {
   open(OUT, ">$outfile"), or die "can't open the output file!!!!";
   while (my $hits= $result->next_hit )
   {
   my $value=$hits->significance;
   if ($value <=0.01)
   {
         print OUT
   $hits->name,"\t",$hits->description,"\t",$hits->significance,"\n";
   }
   }
   close OUT;
   }
   }
   }
   }
   closedir(HMMDIR);
   ##############################################################

   When it run, you will see that:

   -------------------- WARNING ---------------------
   MSG: unrecognized line:                      +E +L i T eek+ e+  ++ +l++H
   Y+   I+ +

   ---------------------------------------------------

   why? I hope to get your help, hanks very much!

- Done.


From bix at sendu.me.uk  Tue Sep  9 07:46:39 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 09 Sep 2008 12:46:39 +0100
Subject: [Bioperl-l] help:HMM parsing error
In-Reply-To: <127e75f60809090405h644e51eftcab073e8bf179720@mail.gmail.com>
References: <127e75f60809090405h644e51eftcab073e8bf179720@mail.gmail.com>
Message-ID: <48C6621F.8040304@sendu.me.uk>

boyang zhe wrote:
>   I write a script to parse the HMMER report ,it is as follows:
[...]
>    my $in = new Bio::SearchIO(-format => 'hmmer',-file =>"$infile");
[...]
>    -------------------- WARNING ---------------------
>    MSG: unrecognized line:                      +E +L i T eek+ e+  ++ +l++H
>    Y+   I+ +
> 
>    ---------------------------------------------------
> 
>    why? I hope to get your help, hanks very much!

I didn't check your code, but the easiest thing to try would be to use 
-format => 'hmmer_pull' to use an alternate parser that may be able to 
recognise that line. You might need to install the latest Bioperl from 
SVN (or at least 1.5.2) to get access to the hmmer_pull parser.


From bosborne11 at verizon.net  Tue Sep  9 10:50:38 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Tue, 9 Sep 2008 10:50:38 -0400
Subject: [Bioperl-l] SeqHound
In-Reply-To: <1220452426.31595.92.camel@pepa.cbm.uam.es>
References: <1220452426.31595.92.camel@pepa.cbm.uam.es>
Message-ID: <55655D67-352A-4E0D-B402-7FC30628C1B1@verizon.net>

Raul,

After spending a few minutes at bond.unleashedinformatics.com I have  
to admit that it's not clear how one accesses their free version of  
BOND. There are no examples that I can see in their packages.

If you are interested in looking at protein-protein networks in the  
Bioperl context you can also check out the bioperl-network package:

http://www.bioperl.org/wiki/Network_package

If you don't care what language you're using then you should consider  
Cytoscape, it's probably the package with the most capability.


Brian O.


On Sep 3, 2008, at 10:33 AM, Raul Mendez Giraldez wrote:

> Hi Chris,
>
> I'm trying to set up and run bioperl Seqhound donwloaded from:
>
> http://bond.unleashedinformatics.com/downloads/api//seqhound-bioperl-4.0.tar.gz
>
> and I always get connection error messages. Do you know which  
> version of
> SeqHound should I use and how can I configure to make it work? I've
> tried several possibilities for server1 at .shoundremrc as
>
> [remote]
> server1 = bond.unleashedinformatics.com
> CGI = /cgi-bin/seqrem
> port=8080
>
> Also, I would like to get all the possible protein-protein interaction
> for a set of protein sequences. Would this be possible using SeqHound?
>
> Thanks,
> Ra?l
>
>
>
>
> -- 
> Ra?l M?ndez Gir?ldez, Ph.D.
> Bioinformatics Unit
> Centre for Molecular Biology "Severo Ochoa"
> Universidad Aut?noma de Madrid
> C/ Nicol?s Cabrera, 1
> Cantoblanco 28049, Madrid
> SPAIN
>
> Phone: +34 91 196 4633
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




From jimhu at tamu.edu  Tue Sep  9 12:05:59 2008
From: jimhu at tamu.edu (Jim Hu)
Date: Tue, 9 Sep 2008 11:05:59 -0500
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
Message-ID: <AFDAB313-524D-441B-8723-027484D15142@tamu.edu>

Hi Aaron,

I was thinking this would be handled by making the end=parent feature  
length x 2 + end coord.  end/parent length = number of times crosses  
origin.

Jim

On Sep 8, 2008, at 2:57 PM, Aaron Mackey wrote:

> How can you handle features that may cross the origin more than once?
> The modulus, though simple, seems to be only half the solution.  It
> also makes it difficult to place features in the genome "by eye"
> (having to do the modulus subtraction in my head), or in
> sorting/filtering operations.
>
> I have an alternative that I wondered if you considered: allow the
> start/end to have an additional "circular revolution" prefix:
>
> a typical range tuple like: 100 200 -
> is thus shorthand for: 0:100 0:200 -
> (i.e. both the 100 and 200 are in the same "revolution" around the  
> genome)
>
> and is then distinguishable from an "around the genome + 100"  
> feature of:
> 1:100 0:200 -
>
> Just an alternative to consider (if you haven't already).  I'm not
> wedded to the syntax, but I wouldn't want to see new columns in GFF
> just for this.  Essentially, what you want is some form of compound
> polar coordinates, it seems.
>
> -Aaron
>
> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>> In discussions with GMOD about Gbrowse, we've come up with a  
>> proposal for
>> handling circular genomes and features that cross the origin in such
>> genomes.  This applies to lots of prokaryotic and viral genomes,  
>> and might
>> be valuable for some ways of representing terminally redundant linear
>> genomes.
>> 1) Keep the requirement that start < end
>> 2) allow end > parent feature length
>> 3) parent feature gets an is_circular boolean
>> 4) use modular arithmetic to calculate the real position of end on  
>> the
>> parent feature.
>> We'd like to do this in a way that will be consistent with Chado  
>> and BioPerl
>> representation of features as much as possible (realizing that  
>> there is the
>> usual interbase or not coordinate issue).  What do people think?   
>> Lincoln is
>> on board for modifying the GFF3 spec.
>> Thanks!
>> Jim Hu
>>
>> =====================================
>>
>> Jim Hu
>>
>> Associate Professor
>>
>> Dept. of Biochemistry and Biophysics
>>
>> 2128 TAMU
>>
>> Texas A&M Univ.
>>
>> College Station, TX 77843-2128
>>
>> 979-862-4054
>>
>>
>> -------------------------------------------------------------------------
>> This SF.Net email is sponsored by the Moblin Your Move Developer's  
>> challenge
>> Build the coolest Linux based applications with Moblin SDK & win  
>> great
>> prizes
>> Grand prize is a trip for two to an Open Source event anywhere in  
>> the world
>> http://moblin-contest.org/redirect.php?banner_id=100&url=/
>> _______________________________________________
>> Gmod-schema mailing list
>> Gmod-schema at lists.sourceforge.net
>> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>>
>>

=====================================
Jim Hu
Associate Professor
Dept. of Biochemistry and Biophysics
2128 TAMU
Texas A&M Univ.
College Station, TX 77843-2128
979-862-4054




From jason at bioperl.org  Tue Sep  9 12:07:45 2008
From: jason at bioperl.org (Jason Stajich)
Date: Tue, 9 Sep 2008 09:07:45 -0700
Subject: [Bioperl-l] help:HMM parsing error
In-Reply-To: <48C6621F.8040304@sendu.me.uk>
References: <127e75f60809090405h644e51eftcab073e8bf179720@mail.gmail.com>
	<48C6621F.8040304@sendu.me.uk>
Message-ID: <DE35F9B2-20FE-4554-9F53-6F838849B0C6@bioperl.org>

Although it would be good to fix the parser as well --  best solution  
is to submit that report as a bug to bugzilla
http://bugzilla.open-bio.org/

-jason

On Sep 9, 2008, at 4:46 AM, Sendu Bala wrote:

> boyang zhe wrote:
>>  I write a script to parse the HMMER report ,it is as follows:
> [...]
>>   my $in = new Bio::SearchIO(-format => 'hmmer',-file =>"$infile");
> [...]
>>   -------------------- WARNING ---------------------
>>   MSG: unrecognized line:                      +E +L i T eek+ e+  + 
>> + +l++H
>>   Y+   I+ +
>>   ---------------------------------------------------
>>   why? I hope to get your help, hanks very much!
>
> I didn't check your code, but the easiest thing to try would be to  
> use -format => 'hmmer_pull' to use an alternate parser that may be  
> able to recognise that line. You might need to install the latest  
> Bioperl from SVN (or at least 1.5.2) to get access to the hmmer_pull  
> parser.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From cain.cshl at gmail.com  Tue Sep  9 13:33:12 2008
From: cain.cshl at gmail.com (Scott Cain)
Date: Tue, 9 Sep 2008 13:33:12 -0400
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
Message-ID: <536f21b00809091033v1e412f4ft54d8e139c347a20a@mail.gmail.com>

Hi Jim and All,

While I agree with Aaron's point that it is not easy to place features
by visual inspection, this seems like a fairly minor point.  The vast
majority of GFF3 manipulation will be done in software, so as long as
the API handles everything correctly, life is good.  If we discount
that objection, there doesn't seem to be much advantage of using
Aaron's suggested method over Jim's.

(As a side note--I have the same complaint about anything in XML--it
is awful for a human to read.  I still live with XML when I have to
though :-)

Additionally, the fact that Ensembl is using the same method as what
Jim describes is a fairly powerful argument for doing the same.
Hopefully there can be some code reuse.

Scott


On Tue, Sep 9, 2008 at 12:05 PM, Jim Hu <jimhu at tamu.edu> wrote:
> Hi Aaron,
> I was thinking this would be handled by making the end=parent feature length
> x 2 + end coord.  end/parent length = number of times crosses origin.
> Jim
> On Sep 8, 2008, at 2:57 PM, Aaron Mackey wrote:
>
> How can you handle features that may cross the origin more than once?
> The modulus, though simple, seems to be only half the solution.  It
> also makes it difficult to place features in the genome "by eye"
> (having to do the modulus subtraction in my head), or in
> sorting/filtering operations.
>
> I have an alternative that I wondered if you considered: allow the
> start/end to have an additional "circular revolution" prefix:
>
> a typical range tuple like: 100 200 -
> is thus shorthand for: 0:100 0:200 -
> (i.e. both the 100 and 200 are in the same "revolution" around the genome)
>
> and is then distinguishable from an "around the genome + 100" feature of:
> 1:100 0:200 -
>
> Just an alternative to consider (if you haven't already).  I'm not
> wedded to the syntax, but I wouldn't want to see new columns in GFF
> just for this.  Essentially, what you want is some form of compound
> polar coordinates, it seems.
>
> -Aaron
>
> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>
> In discussions with GMOD about Gbrowse, we've come up with a proposal for
>
> handling circular genomes and features that cross the origin in such
>
> genomes.  This applies to lots of prokaryotic and viral genomes, and might
>
> be valuable for some ways of representing terminally redundant linear
>
> genomes.
>
> 1) Keep the requirement that start < end
>
> 2) allow end > parent feature length
>
> 3) parent feature gets an is_circular boolean
>
> 4) use modular arithmetic to calculate the real position of end on the
>
> parent feature.
>
> We'd like to do this in a way that will be consistent with Chado and BioPerl
>
> representation of features as much as possible (realizing that there is the
>
> usual interbase or not coordinate issue).  What do people think?  Lincoln is
>
> on board for modifying the GFF3 spec.
>
> Thanks!
>
> Jim Hu
>
> =====================================
>
> Jim Hu
>
> Associate Professor
>
> Dept. of Biochemistry and Biophysics
>
> 2128 TAMU
>
> Texas A&M Univ.
>
> College Station, TX 77843-2128
>
> 979-862-4054
>
>
> -------------------------------------------------------------------------
>
> This SF.Net email is sponsored by the Moblin Your Move Developer's challenge
>
> Build the coolest Linux based applications with Moblin SDK & win great
>
> prizes
>
> Grand prize is a trip for two to an Open Source event anywhere in the world
>
> http://moblin-contest.org/redirect.php?banner_id=100&url=/
>
> _______________________________________________
>
> Gmod-schema mailing list
>
> Gmod-schema at lists.sourceforge.net
>
> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>
>
>
> =====================================
>
> Jim Hu
>
> Associate Professor
>
> Dept. of Biochemistry and Biophysics
>
> 2128 TAMU
>
> Texas A&M Univ.
>
> College Station, TX 77843-2128
>
> 979-862-4054
>
>
> -------------------------------------------------------------------------
> This SF.Net email is sponsored by the Moblin Your Move Developer's challenge
> Build the coolest Linux based applications with Moblin SDK & win great
> prizes
> Grand prize is a trip for two to an Open Source event anywhere in the world
> http://moblin-contest.org/redirect.php?banner_id=100&url=/
> _______________________________________________
> Gmod-schema mailing list
> Gmod-schema at lists.sourceforge.net
> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>
>



-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   cain.cshl at gmail.com
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory


From lincoln.stein at gmail.com  Tue Sep  9 13:52:36 2008
From: lincoln.stein at gmail.com (Lincoln Stein)
Date: Tue, 9 Sep 2008 13:52:36 -0400
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
Message-ID: <6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>

It seems to me that the proposed modulus syntax handles multiple
revolutions. Consider a 100 bp genome (to make it simple) and a feature that
starts at 50, goes around twice, and ends at position 60:

  start = 50
  end  = 260

length = end - start + 1
revolutions = int (length/genome)
stop position = length % genome + 1

Lincoln

On Mon, Sep 8, 2008 at 3:57 PM, Aaron Mackey <ajmackey at gmail.com> wrote:

> How can you handle features that may cross the origin more than once?
> The modulus, though simple, seems to be only half the solution.  It
> also makes it difficult to place features in the genome "by eye"
> (having to do the modulus subtraction in my head), or in
> sorting/filtering operations.
>
> I have an alternative that I wondered if you considered: allow the
> start/end to have an additional "circular revolution" prefix:
>
> a typical range tuple like: 100 200 -
> is thus shorthand for: 0:100 0:200 -
> (i.e. both the 100 and 200 are in the same "revolution" around the genome)
>
> and is then distinguishable from an "around the genome + 100" feature of:
> 1:100 0:200 -
>
> Just an alternative to consider (if you haven't already).  I'm not
> wedded to the syntax, but I wouldn't want to see new columns in GFF
> just for this.  Essentially, what you want is some form of compound
> polar coordinates, it seems.
>
> -Aaron
>
> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
> > In discussions with GMOD about Gbrowse, we've come up with a proposal for
> > handling circular genomes and features that cross the origin in such
> > genomes.  This applies to lots of prokaryotic and viral genomes, and
> might
> > be valuable for some ways of representing terminally redundant linear
> > genomes.
> > 1) Keep the requirement that start < end
> > 2) allow end > parent feature length
> > 3) parent feature gets an is_circular boolean
> > 4) use modular arithmetic to calculate the real position of end on the
> > parent feature.
> > We'd like to do this in a way that will be consistent with Chado and
> BioPerl
> > representation of features as much as possible (realizing that there is
> the
> > usual interbase or not coordinate issue).  What do people think?  Lincoln
> is
> > on board for modifying the GFF3 spec.
> > Thanks!
> > Jim Hu
> >
> > =====================================
> >
> > Jim Hu
> >
> > Associate Professor
> >
> > Dept. of Biochemistry and Biophysics
> >
> > 2128 TAMU
> >
> > Texas A&M Univ.
> >
> > College Station, TX 77843-2128
> >
> > 979-862-4054
> >
> >
> > -------------------------------------------------------------------------
> > This SF.Net email is sponsored by the Moblin Your Move Developer's
> challenge
> > Build the coolest Linux based applications with Moblin SDK & win great
> > prizes
> > Grand prize is a trip for two to an Open Source event anywhere in the
> world
> > http://moblin-contest.org/redirect.php?banner_id=100&url=/
> > _______________________________________________
> > Gmod-schema mailing list
> > Gmod-schema at lists.sourceforge.net
> > https://lists.sourceforge.net/lists/listinfo/gmod-schema
> >
> >
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Lincoln D. Stein

Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Stacey Quinn <Stacey.Quinn at oicr.on.ca>

Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724 USA
(516) 367-8380
Assistant: Sandra Michelsen <michelse at cshl.edu>


From cjfields at illinois.edu  Tue Sep  9 14:24:49 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 9 Sep 2008 13:24:49 -0500
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
Message-ID: <ACC71DEA-378C-4FB3-8C09-A85EC0858924@illinois.edu>

Is there any particular reason we don't treat this similarly to the  
way BioPerl does, which is to simply treat the origin-overlapping  
feature as a split location?  GenBank treats this similarly.  For an  
faux example, the bug I just fixed for bugzilla has one:

http://bugzilla.open-bio.org/show_bug.cgi?id=2579

An actual GenBank case is the Sulfolobus solfataricus genome  
(NC_002754), and I'm sure Jim could come up with more.  The only  
caveat is whether we should represent this

As for multiple revolutions, I'm not sure the hand-wringing about  
specifics is worth it unless we have explicit workable examples to  
test against (preferably examples which would potentially pop up), but  
Lincoln's proposal sounds fine.

chris

On Sep 9, 2008, at 11:05 AM, Jim Hu wrote:

> Hi Aaron,
>
> I was thinking this would be handled by making the end=parent  
> feature length x 2 + end coord.  end/parent length = number of times  
> crosses origin.
>
> Jim
>
> On Sep 8, 2008, at 2:57 PM, Aaron Mackey wrote:
>
>> How can you handle features that may cross the origin more than once?
>> The modulus, though simple, seems to be only half the solution.  It
>> also makes it difficult to place features in the genome "by eye"
>> (having to do the modulus subtraction in my head), or in
>> sorting/filtering operations.
>>
>> I have an alternative that I wondered if you considered: allow the
>> start/end to have an additional "circular revolution" prefix:
>>
>> a typical range tuple like: 100 200 -
>> is thus shorthand for: 0:100 0:200 -
>> (i.e. both the 100 and 200 are in the same "revolution" around the  
>> genome)
>>
>> and is then distinguishable from an "around the genome + 100"  
>> feature of:
>> 1:100 0:200 -
>>
>> Just an alternative to consider (if you haven't already).  I'm not
>> wedded to the syntax, but I wouldn't want to see new columns in GFF
>> just for this.  Essentially, what you want is some form of compound
>> polar coordinates, it seems.
>>
>> -Aaron
>>
>> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>>> In discussions with GMOD about Gbrowse, we've come up with a  
>>> proposal for
>>> handling circular genomes and features that cross the origin in such
>>> genomes.  This applies to lots of prokaryotic and viral genomes,  
>>> and might
>>> be valuable for some ways of representing terminally redundant  
>>> linear
>>> genomes.
>>> 1) Keep the requirement that start < end
>>> 2) allow end > parent feature length
>>> 3) parent feature gets an is_circular boolean
>>> 4) use modular arithmetic to calculate the real position of end on  
>>> the
>>> parent feature.
>>> We'd like to do this in a way that will be consistent with Chado  
>>> and BioPerl
>>> representation of features as much as possible (realizing that  
>>> there is the
>>> usual interbase or not coordinate issue).  What do people think?   
>>> Lincoln is
>>> on board for modifying the GFF3 spec.
>>> Thanks!
>>> Jim Hu
>>>
>>> =====================================
>>>
>>> Jim Hu
>>>
>>> Associate Professor
>>>
>>> Dept. of Biochemistry and Biophysics
>>>
>>> 2128 TAMU
>>>
>>> Texas A&M Univ.
>>>
>>> College Station, TX 77843-2128
>>>
>>> 979-862-4054
>>>
>>>
>>> -------------------------------------------------------------------------
>>> This SF.Net email is sponsored by the Moblin Your Move Developer's  
>>> challenge
>>> Build the coolest Linux based applications with Moblin SDK & win  
>>> great
>>> prizes
>>> Grand prize is a trip for two to an Open Source event anywhere in  
>>> the world
>>> http://moblin-contest.org/redirect.php?banner_id=100&url=/
>>> _______________________________________________
>>> Gmod-schema mailing list
>>> Gmod-schema at lists.sourceforge.net
>>> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>>>
>>>
>
> =====================================
> Jim Hu
> Associate Professor
> Dept. of Biochemistry and Biophysics
> 2128 TAMU
> Texas A&M Univ.
> College Station, TX 77843-2128
> 979-862-4054
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From ajmackey at gmail.com  Tue Sep  9 14:48:12 2008
From: ajmackey at gmail.com (Aaron Mackey)
Date: Tue, 9 Sep 2008 14:48:12 -0400
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
Message-ID: <24c96eca0809091148l738604a7q13fba54ac05de01c@mail.gmail.com>

Right, the modulus calculation continues to work, but for instance,
what'll happen when I now ask Gbrowse (or Ensembl) to show me
positions 50..260?  Will it show me 50 .. 60, 1:100, or "unroll" the
genome twice from 50..260 (that'd be a pretty cute trick, by the way!)

You're (re)using simple arithmetic to compress a compound coordinate
into a single-valued coordinate (which I realize can be trivially
packed and unpacked by software), but I worry about the downstream
consequences of software having to always remember that the
coordinates given may have to be unpacked or not, and not being able
to immediately identify whether "260" is a real or compound
coordinate.

To say it another way, I'm happy (that is, don't care much) whether
Chado or any other underlying data storage uses such compound
coordinates, because only Chado-reliant tools will need to care; but I
do worry about GFF3 as a (relatively) simple exchange format having
that kind of silent bug-causing complexity.  I'd much rather see GFF
be syntactically explicit, and not quite so cleverly implicit.

Just one GFF user's two cents, thanks for listening,

-Aaron

On Tue, Sep 9, 2008 at 1:52 PM, Lincoln Stein <lincoln.stein at gmail.com> wrote:
> It seems to me that the proposed modulus syntax handles multiple
> revolutions. Consider a 100 bp genome (to make it simple) and a feature that
> starts at 50, goes around twice, and ends at position 60:
>
>   start = 50
>   end  = 260
>
> length = end - start + 1
> revolutions = int (length/genome)
> stop position = length % genome + 1
>
> Lincoln
>
> On Mon, Sep 8, 2008 at 3:57 PM, Aaron Mackey <ajmackey at gmail.com> wrote:
>>
>> How can you handle features that may cross the origin more than once?
>> The modulus, though simple, seems to be only half the solution.  It
>> also makes it difficult to place features in the genome "by eye"
>> (having to do the modulus subtraction in my head), or in
>> sorting/filtering operations.
>>
>> I have an alternative that I wondered if you considered: allow the
>> start/end to have an additional "circular revolution" prefix:
>>
>> a typical range tuple like: 100 200 -
>> is thus shorthand for: 0:100 0:200 -
>> (i.e. both the 100 and 200 are in the same "revolution" around the genome)
>>
>> and is then distinguishable from an "around the genome + 100" feature of:
>> 1:100 0:200 -
>>
>> Just an alternative to consider (if you haven't already).  I'm not
>> wedded to the syntax, but I wouldn't want to see new columns in GFF
>> just for this.  Essentially, what you want is some form of compound
>> polar coordinates, it seems.
>>
>> -Aaron
>>
>> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>> > In discussions with GMOD about Gbrowse, we've come up with a proposal
>> > for
>> > handling circular genomes and features that cross the origin in such
>> > genomes.  This applies to lots of prokaryotic and viral genomes, and
>> > might
>> > be valuable for some ways of representing terminally redundant linear
>> > genomes.
>> > 1) Keep the requirement that start < end
>> > 2) allow end > parent feature length
>> > 3) parent feature gets an is_circular boolean
>> > 4) use modular arithmetic to calculate the real position of end on the
>> > parent feature.
>> > We'd like to do this in a way that will be consistent with Chado and
>> > BioPerl
>> > representation of features as much as possible (realizing that there is
>> > the
>> > usual interbase or not coordinate issue).  What do people think?
>> >  Lincoln is
>> > on board for modifying the GFF3 spec.
>> > Thanks!
>> > Jim Hu
>> >
>> > =====================================
>> >
>> > Jim Hu
>> >
>> > Associate Professor
>> >
>> > Dept. of Biochemistry and Biophysics
>> >
>> > 2128 TAMU
>> >
>> > Texas A&M Univ.
>> >
>> > College Station, TX 77843-2128
>> >
>> > 979-862-4054
>> >
>> >
>> >
>> > -------------------------------------------------------------------------
>> > This SF.Net email is sponsored by the Moblin Your Move Developer's
>> > challenge
>> > Build the coolest Linux based applications with Moblin SDK & win great
>> > prizes
>> > Grand prize is a trip for two to an Open Source event anywhere in the
>> > world
>> > http://moblin-contest.org/redirect.php?banner_id=100&url=/
>> > _______________________________________________
>> > Gmod-schema mailing list
>> > Gmod-schema at lists.sourceforge.net
>> > https://lists.sourceforge.net/lists/listinfo/gmod-schema
>> >
>> >
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> --
> Lincoln D. Stein
>
> Ontario Institute for Cancer Research
> 101 College St., Suite 800
> Toronto, ON, Canada M5G0A3
> 416 673-8514
> Assistant: Stacey Quinn <Stacey.Quinn at oicr.on.ca>
>
> Cold Spring Harbor Laboratory
> 1 Bungtown Road
> Cold Spring Harbor, NY 11724 USA
> (516) 367-8380
> Assistant: Sandra Michelsen <michelse at cshl.edu>
>


From cjfields at illinois.edu  Tue Sep  9 14:49:13 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 9 Sep 2008 13:49:13 -0500
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <ACC71DEA-378C-4FB3-8C09-A85EC0858924@illinois.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
	<ACC71DEA-378C-4FB3-8C09-A85EC0858924@illinois.edu>
Message-ID: <8C6E5EBC-25B1-41E3-BB89-FD3C228A6B70@illinois.edu>

Sent just a bit too early!

On Sep 9, 2008, at 1:24 PM, Chris Fields wrote:

> Is there any particular reason we don't treat this similarly to the  
> way BioPerl does, which is to simply treat the origin-overlapping  
> feature as a split location?  GenBank treats this similarly.  For an  
> faux example, the bug I just fixed for bugzilla has one:
>
> http://bugzilla.open-bio.org/show_bug.cgi?id=2579
>
> An actual GenBank case is the Sulfolobus solfataricus genome  
> (NC_002754), and I'm sure Jim could come up with more.  The only  
> caveat is whether we should represent this

... as a 'special case' for features overlapping the origin in a  
circular sequence.

> As for multiple revolutions, I'm not sure the hand-wringing about  
> specifics is worth it unless we have explicit workable examples to  
> test against (preferably examples which would potentially pop up),  
> but Lincoln's proposal sounds fine.
>
> chris




From Russell.Smithies at agresearch.co.nz  Tue Sep  9 16:46:26 2008
From: Russell.Smithies at agresearch.co.nz (Smithies, Russell)
Date: Wed, 10 Sep 2008 08:46:26 +1200
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu><24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
Message-ID: <D5DBA313349A4B458528BE63B387F36C077822B4@imail.agresearch.co.nz>

Excuse my ignorance (I'm not a biologist) but is it biologically possible/likely for a gene or feature to wrap more than once around a genome?
Anyone got an example?


Russell Smithies 

Bioinformatics Applications Developer 

Invermay? Research Centre 
Puddle Alley, 
Mosgiel, 
New Zealand 





> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-
> bio.org] On Behalf Of Lincoln Stein
> Sent: Wednesday, 10 September 2008 5:53 a.m.
> To: Aaron Mackey
> Cc: GMOD Schema List; Jim Hu; Roy Welch; bioperl-l at bioperl.org; Mike Gribskov
> Subject: Re: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
> 
> It seems to me that the proposed modulus syntax handles multiple
> revolutions. Consider a 100 bp genome (to make it simple) and a feature that
> starts at 50, goes around twice, and ends at position 60:
> 
>   start = 50
>   end  = 260
> 
> length = end - start + 1
> revolutions = int (length/genome)
> stop position = length % genome + 1
> 
> Lincoln
> 
> On Mon, Sep 8, 2008 at 3:57 PM, Aaron Mackey <ajmackey at gmail.com> wrote:
> 
> > How can you handle features that may cross the origin more than once?
> > The modulus, though simple, seems to be only half the solution.  It
> > also makes it difficult to place features in the genome "by eye"
> > (having to do the modulus subtraction in my head), or in
> > sorting/filtering operations.
> >
> > I have an alternative that I wondered if you considered: allow the
> > start/end to have an additional "circular revolution" prefix:
> >
> > a typical range tuple like: 100 200 -
> > is thus shorthand for: 0:100 0:200 -
> > (i.e. both the 100 and 200 are in the same "revolution" around the genome)
> >
> > and is then distinguishable from an "around the genome + 100" feature of:
> > 1:100 0:200 -
> >
> > Just an alternative to consider (if you haven't already).  I'm not
> > wedded to the syntax, but I wouldn't want to see new columns in GFF
> > just for this.  Essentially, what you want is some form of compound
> > polar coordinates, it seems.
> >
> > -Aaron
> >
> > On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
> > > In discussions with GMOD about Gbrowse, we've come up with a proposal for
> > > handling circular genomes and features that cross the origin in such
> > > genomes.  This applies to lots of prokaryotic and viral genomes, and
> > might
> > > be valuable for some ways of representing terminally redundant linear
> > > genomes.
> > > 1) Keep the requirement that start < end
> > > 2) allow end > parent feature length
> > > 3) parent feature gets an is_circular boolean
> > > 4) use modular arithmetic to calculate the real position of end on the
> > > parent feature.
> > > We'd like to do this in a way that will be consistent with Chado and
> > BioPerl
> > > representation of features as much as possible (realizing that there is
> > the
> > > usual interbase or not coordinate issue).  What do people think?  Lincoln
> > is
> > > on board for modifying the GFF3 spec.
> > > Thanks!
> > > Jim Hu
> > >
> > > =====================================
> > >
> > > Jim Hu
> > >
> > > Associate Professor
> > >
> > > Dept. of Biochemistry and Biophysics
> > >
> > > 2128 TAMU
> > >
> > > Texas A&M Univ.
> > >
> > > College Station, TX 77843-2128
> > >
> > > 979-862-4054
> > >
> > >
> > > -------------------------------------------------------------------------
> > > This SF.Net email is sponsored by the Moblin Your Move Developer's
> > challenge
> > > Build the coolest Linux based applications with Moblin SDK & win great
> > > prizes
> > > Grand prize is a trip for two to an Open Source event anywhere in the
> > world
> > > http://moblin-contest.org/redirect.php?banner_id=100&url=/
> > > _______________________________________________
> > > Gmod-schema mailing list
> > > Gmod-schema at lists.sourceforge.net
> > > https://lists.sourceforge.net/lists/listinfo/gmod-schema
> > >
> > >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> 
> 
> 
> --
> Lincoln D. Stein
> 
> Ontario Institute for Cancer Research
> 101 College St., Suite 800
> Toronto, ON, Canada M5G0A3
> 416 673-8514
> Assistant: Stacey Quinn <Stacey.Quinn at oicr.on.ca>
> 
> Cold Spring Harbor Laboratory
> 1 Bungtown Road
> Cold Spring Harbor, NY 11724 USA
> (516) 367-8380
> Assistant: Sandra Michelsen <michelse at cshl.edu>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
=======================================================================
Attention: The information contained in this message and/or attachments
from AgResearch Limited is intended only for the persons or entities
to which it is addressed and may contain confidential and/or privileged
material. Any review, retransmission, dissemination or other use of, or
taking of any action in reliance upon, this information by persons or
entities other than the intended recipients is prohibited by AgResearch
Limited. If you have received this message in error, please notify the
sender immediately.
=======================================================================



From cjm at berkeleybop.org  Tue Sep  9 18:56:55 2008
From: cjm at berkeleybop.org (Chris Mungall)
Date: Tue, 9 Sep 2008 15:56:55 -0700
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
Message-ID: <18A0C3BE-ED04-4494-9231-B945158D6CE4@berkeleybop.org>


I think I am happy with the modulo approach.

Though I believe we first of all need for a formal specification of  
genome interval semantics that is independent of any particular syntax  
or implementation. This can be a fairly short specification - along  
the lines of what Lincoln has written below (although I would  
naturally prefer the normative version to be interbase - this doesn't  
preclude derived axioms in GFF coordinates).

This spec should also define and standardize the terminology used:  
Lincoln draws a distinction between 'stop' and 'end'. I'm relatively  
happy with these terms - however, the choice we makes need to become  
enshrined otherwise we'll end up with confusion and mismatches between  
software and specification.

One clarification:

> revolutions = int (length/genome)


This axiom is presumaby contextual on the genome being circular, which  
will have to be indicated using a new flag, as Jim suggest, yep?

So the context independent axiom would be:

> revolutions = IF src_is_circular THEN int (length/genome) ELSE 0


On Sep 9, 2008, at 10:52 AM, Lincoln Stein wrote:

> It seems to me that the proposed modulus syntax handles multiple
> revolutions. Consider a 100 bp genome (to make it simple) and a  
> feature that
> starts at 50, goes around twice, and ends at position 60:
>
>  start = 50
>  end  = 260
>
> length = end - start + 1
> revolutions = int (length/genome)
> stop position = length % genome + 1
>
> Lincoln
>
> On Mon, Sep 8, 2008 at 3:57 PM, Aaron Mackey <ajmackey at gmail.com>  
> wrote:
>
>> How can you handle features that may cross the origin more than once?
>> The modulus, though simple, seems to be only half the solution.  It
>> also makes it difficult to place features in the genome "by eye"
>> (having to do the modulus subtraction in my head), or in
>> sorting/filtering operations.
>>
>> I have an alternative that I wondered if you considered: allow the
>> start/end to have an additional "circular revolution" prefix:
>>
>> a typical range tuple like: 100 200 -
>> is thus shorthand for: 0:100 0:200 -
>> (i.e. both the 100 and 200 are in the same "revolution" around the  
>> genome)
>>
>> and is then distinguishable from an "around the genome + 100"  
>> feature of:
>> 1:100 0:200 -
>>
>> Just an alternative to consider (if you haven't already).  I'm not
>> wedded to the syntax, but I wouldn't want to see new columns in GFF
>> just for this.  Essentially, what you want is some form of compound
>> polar coordinates, it seems.
>>
>> -Aaron
>>
>> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>>> In discussions with GMOD about Gbrowse, we've come up with a  
>>> proposal for
>>> handling circular genomes and features that cross the origin in such
>>> genomes.  This applies to lots of prokaryotic and viral genomes, and
>> might
>>> be valuable for some ways of representing terminally redundant  
>>> linear
>>> genomes.
>>> 1) Keep the requirement that start < end
>>> 2) allow end > parent feature length
>>> 3) parent feature gets an is_circular boolean
>>> 4) use modular arithmetic to calculate the real position of end on  
>>> the
>>> parent feature.
>>> We'd like to do this in a way that will be consistent with Chado and
>> BioPerl
>>> representation of features as much as possible (realizing that  
>>> there is
>> the
>>> usual interbase or not coordinate issue).  What do people think?   
>>> Lincoln
>> is
>>> on board for modifying the GFF3 spec.
>>> Thanks!
>>> Jim Hu
>>>
>>> =====================================
>>>
>>> Jim Hu
>>>
>>> Associate Professor
>>>
>>> Dept. of Biochemistry and Biophysics
>>>
>>> 2128 TAMU
>>>
>>> Texas A&M Univ.
>>>
>>> College Station, TX 77843-2128
>>>
>>> 979-862-4054
>>>
>>>
>>> -------------------------------------------------------------------------
>>> This SF.Net email is sponsored by the Moblin Your Move Developer's
>> challenge
>>> Build the coolest Linux based applications with Moblin SDK & win  
>>> great
>>> prizes
>>> Grand prize is a trip for two to an Open Source event anywhere in  
>>> the
>> world
>>> http://moblin-contest.org/redirect.php?banner_id=100&url=/
>>> _______________________________________________
>>> Gmod-schema mailing list
>>> Gmod-schema at lists.sourceforge.net
>>> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>>>
>>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>
>
> -- 
> Lincoln D. Stein
>
> Ontario Institute for Cancer Research
> 101 College St., Suite 800
> Toronto, ON, Canada M5G0A3
> 416 673-8514
> Assistant: Stacey Quinn <Stacey.Quinn at oicr.on.ca>
>
> Cold Spring Harbor Laboratory
> 1 Bungtown Road
> Cold Spring Harbor, NY 11724 USA
> (516) 367-8380
> Assistant: Sandra Michelsen <michelse at cshl.edu>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



From heikki at sanbi.ac.za  Wed Sep 10 07:32:06 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Wed, 10 Sep 2008 13:32:06 +0200
Subject: [Bioperl-l] phylogeny-trait association methods into BioPerl
Message-ID: <200809101332.07137.heikki@sanbi.ac.za>

FYI,

I've been recently writing code to analyse phylogeny-trait associations. These 
traits are typically geographical location of the sequence but they can be any 
phenotypic characters associated with the sequences.

This involves trees, i.e. Bio::Tree::Tree and Bio::Tree::Node objects and 
strings describing the traits. I've been using tags to store trait values 
within nodes. The tag methods are:

Bio::Tree::Node::add_tag_value
Bio::Tree::Node::get_all_tags
Bio::Tree::Node::get_tag_values
Bio::Tree::Node::has_tag
Bio::Tree::Node::remove_all_tags
Bio::Tree::Node::remove_tag

Question: Is  there any particular reason why there is no 
set_tag_value(scalar|@array) method? 

I am getting tired of writing:
  $node->remove_tag($key);
  map {$node->add_tag_value($key)} @values ;
so I am going to implement that unless there is are strong objections.

Otherwise it has been smooth sailing. I am going to add 
Bio::Tree::TreeFunctions::is_binary() and start populating 
Bio::Tree::Statistics soon with these methods:

ps() - Parsimony Score (PS) from Fitch 1971 
ai() - Association index (AI) of Whang et al. 2001
mc() - Monophyletic Clade (MC) size statistics by Salemi at al. 2005
cherries() - number of leaf node pairs

If you have any comments, please feel free to post them here.

    -Heikki

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From hlapp at gmx.net  Wed Sep 10 09:44:27 2008
From: hlapp at gmx.net (Hilmar Lapp)
Date: Wed, 10 Sep 2008 07:44:27 -0600
Subject: [Bioperl-l] phylogeny-trait association methods into BioPerl
In-Reply-To: <200809101332.07137.heikki@sanbi.ac.za>
References: <200809101332.07137.heikki@sanbi.ac.za>
Message-ID: <0FA6C4A1-9D83-4850-BC0A-4A55ED528C65@gmx.net>

Sounds great Heikki!

Just FYI, there is a considerable amount of code and packages for  
comparative analysis in R. You might want to look into the resources  
linked to from the http://r-phylo.org page. There is also a R-SIG- 
Phylo special interest group mailing list (should be linked from the  
aforementioned site).

	-hilmar

On Sep 10, 2008, at 5:32 AM, Heikki Lehvaslaiho wrote:

> FYI,
>
> I've been recently writing code to analyse phylogeny-trait  
> associations. These
> traits are typically geographical location of the sequence but they  
> can be any
> phenotypic characters associated with the sequences.
>
> This involves trees, i.e. Bio::Tree::Tree and Bio::Tree::Node  
> objects and
> strings describing the traits. I've been using tags to store trait  
> values
> within nodes. The tag methods are:
>
> Bio::Tree::Node::add_tag_value
> Bio::Tree::Node::get_all_tags
> Bio::Tree::Node::get_tag_values
> Bio::Tree::Node::has_tag
> Bio::Tree::Node::remove_all_tags
> Bio::Tree::Node::remove_tag
>
> Question: Is  there any particular reason why there is no
> set_tag_value(scalar|@array) method?
>
> I am getting tired of writing:
>  $node->remove_tag($key);
>  map {$node->add_tag_value($key)} @values ;
> so I am going to implement that unless there is are strong objections.
>
> Otherwise it has been smooth sailing. I am going to add
> Bio::Tree::TreeFunctions::is_binary() and start populating
> Bio::Tree::Statistics soon with these methods:
>
> ps() - Parsimony Score (PS) from Fitch 1971
> ai() - Association index (AI) of Whang et al. 2001
> mc() - Monophyletic Clade (MC) size statistics by Salemi at al. 2005
> cherries() - number of leaf node pairs
>
> If you have any comments, please feel free to post them here.
>
>    -Heikki
>
> -- 
> ______ _/      _/_____________________________________________________
>      _/      _/
>     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
>    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
>   _/  _/  _/  SANBI, South African National Bioinformatics Institute
>  _/  _/  _/  University of Western Cape, South Africa
>     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
> ___ _/_/_/_/_/________________________________________________________
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================





From Caroline.Johnston at iop.kcl.ac.uk  Wed Sep 10 11:43:26 2008
From: Caroline.Johnston at iop.kcl.ac.uk (Johnston, Caroline)
Date: Wed, 10 Sep 2008 16:43:26 +0100
Subject: [Bioperl-l] seqs, seqfeatures, locations etc
Message-ID: <5626ED9CB91C814197079FB9940312E506445F81@MAIL.bc.iop.kcl.ac.uk>

Hello,

I'm trying to get my head around the various classes for storing sequences, features and locations and was hoping someone could give me some implementation advice:

I've got a Bio::EnsEMBL::Slice and I want to turn it into a Bio::Seq or SeqFeature object, with Bio::SeqFeature;:Gene::GeneStructure/Transcript/Exon info attached. I can create a Bio::Seq fine, but I also need to keep track of the chromosomal co-ordinates (chr, start, end, species, strand, genome release, database name) and I can't figure out how to store this in Bioperl. I was thinking that what I needed was some extension of a standard Bio::Seq to have genome-coordinate data attached and associated methods to translate the SeqFeature positions (relative to the Bio::Seq) to genome positions. I guess it's probably already possible to store this type of info in some collection of Bioperl objects, but between Bioperl and the EnsEMBL API I'm getting lost in perl modules. Can someone point me in the right direction?

Thanks,
Cass
 



From bosborne11 at verizon.net  Wed Sep 10 13:34:35 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Wed, 10 Sep 2008 13:34:35 -0400
Subject: [Bioperl-l] seqs, seqfeatures, locations etc
In-Reply-To: <5626ED9CB91C814197079FB9940312E506445F81@MAIL.bc.iop.kcl.ac.uk>
References: <5626ED9CB91C814197079FB9940312E506445F81@MAIL.bc.iop.kcl.ac.uk>
Message-ID: <FBBD6379-A984-4F8F-81A5-8EF5E18CC3C7@verizon.net>

Cass,

There is a HOWTO about these Bioperl objects:

http://www.bioperl.org/wiki/HOWTO:Feature-Annotation

I think it addresses your questions.


Brian O.



On Sep 10, 2008, at 11:43 AM, Johnston, Caroline wrote:

> Hello,
>
> I'm trying to get my head around the various classes for storing  
> sequences, features and locations and was hoping someone could give  
> me some implementation advice:
>
> I've got a Bio::EnsEMBL::Slice and I want to turn it into a Bio::Seq  
> or SeqFeature object, with Bio::SeqFeature;:Gene::GeneStructure/ 
> Transcript/Exon info attached. I can create a Bio::Seq fine, but I  
> also need to keep track of the chromosomal co-ordinates (chr, start,  
> end, species, strand, genome release, database name) and I can't  
> figure out how to store this in Bioperl. I was thinking that what I  
> needed was some extension of a standard Bio::Seq to have genome- 
> coordinate data attached and associated methods to translate the  
> SeqFeature positions (relative to the Bio::Seq) to genome positions.  
> I guess it's probably already possible to store this type of info in  
> some collection of Bioperl objects, but between Bioperl and the  
> EnsEMBL API I'm getting lost in perl modules. Can someone point me  
> in the right direction?
>
> Thanks,
> Cass
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From jason at bioperl.org  Wed Sep 10 13:44:25 2008
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 10 Sep 2008 10:44:25 -0700
Subject: [Bioperl-l] phylogeny-trait association methods into BioPerl
In-Reply-To: <200809101332.07137.heikki@sanbi.ac.za>
References: <200809101332.07137.heikki@sanbi.ac.za>
Message-ID: <24F25525-0394-45BE-859F-A5735DE610DF@bioperl.org>

Those are just take from Bio::SeqFeature::Generic tag manipulation  
methods so please feel free to add a better one - maybe can propagate  
that new method to Bio::SeqFeature::Generic as well?

Would be nice to see those other methods add as well so am glad to see  
them.

-jason
On Sep 10, 2008, at 4:32 AM, Heikki Lehvaslaiho wrote:

> FYI,
>
> I've been recently writing code to analyse phylogeny-trait  
> associations. These
> traits are typically geographical location of the sequence but they  
> can be any
> phenotypic characters associated with the sequences.
>
> This involves trees, i.e. Bio::Tree::Tree and Bio::Tree::Node  
> objects and
> strings describing the traits. I've been using tags to store trait  
> values
> within nodes. The tag methods are:
>
> Bio::Tree::Node::add_tag_value
> Bio::Tree::Node::get_all_tags
> Bio::Tree::Node::get_tag_values
> Bio::Tree::Node::has_tag
> Bio::Tree::Node::remove_all_tags
> Bio::Tree::Node::remove_tag
>
> Question: Is  there any particular reason why there is no
> set_tag_value(scalar|@array) method?
>
> I am getting tired of writing:
>  $node->remove_tag($key);
>  map {$node->add_tag_value($key)} @values ;
> so I am going to implement that unless there is are strong objections.
>
> Otherwise it has been smooth sailing. I am going to add
> Bio::Tree::TreeFunctions::is_binary() and start populating
> Bio::Tree::Statistics soon with these methods:
>
> ps() - Parsimony Score (PS) from Fitch 1971
> ai() - Association index (AI) of Whang et al. 2001
> mc() - Monophyletic Clade (MC) size statistics by Salemi at al. 2005
> cherries() - number of leaf node pairs
>
> If you have any comments, please feel free to post them here.
>
>    -Heikki
>
> -- 
> ______ _/      _/_____________________________________________________
>      _/      _/
>     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
>    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
>   _/  _/  _/  SANBI, South African National Bioinformatics Institute
>  _/  _/  _/  University of Western Cape, South Africa
>     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
> ___ _/_/_/_/_/________________________________________________________
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From philsf79 at gmail.com  Thu Sep 11 04:40:26 2008
From: philsf79 at gmail.com (Felipe Figueiredo)
Date: Thu, 11 Sep 2008 05:40:26 -0300
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
Message-ID: <1221122426.8059.49.camel@localhost>

I'm not sure if this is related to bioperl (Bio::AlignIO) or if it's a
general perl error on my part, but I find strange that the following
code gives differente results depending on how I input the alignment:

--- test.pl ---
#!/usr/bin/perl

use warnings;
use strict;

use Bio::AlignIO;

my $file;
if (@ARGV) {
    $file = shift @ARGV;
}
else {
    $file = "-";
}

my $align = Bio::AlignIO->new(-file=>$file)->next_aln;

printf "Sequences: %s\n",$align->no_sequences;
--- test.pl ---

If I run this using a file containing 4 sequences, the following
hapens: 

--- run tests ---
$ ./test.pl  exemplo-alinhamento.fasta
Sequences: 4

$ ./test.pl < exemplo-alinhamento.fasta
Sequences: 3

$ cat exemplo-alinhamento.fasta | ./test.pl 
Sequences: 3
--- run tests ---

The missing sequence is always the first one. Am I missing something, or
my code for reading stdin is mistaken or is it a bug in Bio::AlignIO?

I'm using bioperl 1.5.2.102-1ubuntu1, in Ubuntu 8.04 Hardy.

best regards
FF



From David.Messina at sbc.su.se  Thu Sep 11 07:21:51 2008
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 11 Sep 2008 13:21:51 +0200
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <1221122426.8059.49.camel@localhost>
References: <1221122426.8059.49.camel@localhost>
Message-ID: <628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>

Hi Felipe,

Specifying STDIN via a '-' argument to the -file parameter is not valid.
While that is a convention with some UNIX tools, it's not, as far as I know,
something you should be able to count on.

In BioPerl, one can specify STDIN by passing the \*STDIN filehandle glob to
the -fh parameter (NOT to -file).

In other words,

my $align = Bio::AlignIO->new(-fh => \*STDIN)->next_aln;

That is a convention in BioPerl, so the -file and -fh parameters should work
the same way in AlignIO, SearchIO, SeqIO, etc.

Take a look at the beginners' HOWTO for some examples.
http://www.bioperl.org/wiki/HOWTO:Beginners


Dave


From bosborne11 at verizon.net  Thu Sep 11 11:01:32 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Thu, 11 Sep 2008 11:01:32 -0400
Subject: [Bioperl-l] SeqHound
Message-ID: <0E295726-33FE-4083-98A1-9035E37455BD@verizon.net>

Raul,

Good question about BIND, I don't know if the public version is up-to- 
date. For the latest protein-protein interaction data I look at public  
databases like IntAct.

If you use bioperl-network you should be able to read IntAct data into  
a graph, then find the interactions that you're interested in in that  
graph. There are a few qualifications to this statement though, like  
do you have the "right" identifiers or names. So you're right, bioperl- 
network constructs graphs from the XML files but the interactions you  
want are in those graphs. Something like:

  my $graphio = Bio::Network::IO->new(-file   => 'human.xml',
                                      -format => 'psi25');
  my $graph = $graphio->next_network();
  my $node = $graph->get_nodes_by_id('UniProt:P12345');
  my @neighbors = $graph->neighbors($node);



Brian O.

On Sep 11, 2008, at 7:32 AM, Raul Mendez Giraldez wrote:

> Hi Brian,
>
> Actually I realized later that SeqHound is a part of Bioperl itself,  
> and
> that regarding BIND (at least the public database) is reachable trough
> BIND SOAP protocol, that can be implemented in perl through the module
> SOAP::Lite. I still don't know whether the public BIND database is out
> of date, or which part of the BOND database it covers.
>
> Regarding the Bio::Network packages, at the Bioperl suite, I guess it
> rather for representing protein - protein interaction graphs, isn't  
> it?
> That could be interesting to me, but in a second step. I am more
> concerned now in getting this protein - protein interaction data,  
> for a
> set of proteins some biologists gave me. I don't know anything about
> Cytoscape, normally I'm trying to exploit perl data management
> capabilities.
>
> Thanks for the info.
>
> Cheers,
>
> Raul
>


From MEC at stowers-institute.org  Thu Sep 11 14:01:01 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Thu, 11 Sep 2008 13:01:01 -0500
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
References: <1221122426.8059.49.camel@localhost>
	<628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>

Filipe and Dave,

I find that the following works generically for SeqIO and AlignIO (at least)...

#after processing all options using GetOpt,
#any remaining options should name files to process...
@ARGV = ('-') unless @ARGV;     # Default to standard input
my %inopt;
$inopt{-fh} ||=  \*ARGV;
my $AlignIO =  Bio::AlignIO->new(
                         %inopt
                        )  or die "calling Bio::AlignIO->new on %inopt" ;



--Malcolm

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Dave Messina
Sent: Thursday, September 11, 2008 6:22 AM
To: Felipe Figueiredo
Cc: bioperl-l at lists.open-bio.org
Subject: Re: [Bioperl-l] difference in opening file from @ARGV and STDIN?

Hi Felipe,

Specifying STDIN via a '-' argument to the -file parameter is not valid.
While that is a convention with some UNIX tools, it's not, as far as I know, something you should be able to count on.

In BioPerl, one can specify STDIN by passing the \*STDIN filehandle glob to the -fh parameter (NOT to -file).

In other words,

my $align = Bio::AlignIO->new(-fh => \*STDIN)->next_aln;

That is a convention in BioPerl, so the -file and -fh parameters should work the same way in AlignIO, SearchIO, SeqIO, etc.

Take a look at the beginners' HOWTO for some examples.
http://www.bioperl.org/wiki/HOWTO:Beginners


Dave
_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l



From David.Messina at sbc.su.se  Thu Sep 11 14:47:04 2008
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 11 Sep 2008 20:47:04 +0200
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>
References: <1221122426.8059.49.camel@localhost>
	<628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>
Message-ID: <628aabb70809111147y7d99e1bdh414a4ab1037c0990@mail.gmail.com>

Thanks, Malcolm.
So then, '-' as STDIN does work?

D


From MEC at stowers-institute.org  Thu Sep 11 16:19:25 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Thu, 11 Sep 2008 15:19:25 -0500
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <628aabb70809111147y7d99e1bdh414a4ab1037c0990@mail.gmail.com>
References: <1221122426.8059.49.camel@localhost>
	<628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>
	<628aabb70809111147y7d99e1bdh414a4ab1037c0990@mail.gmail.com>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD559C@exchmb-02.stowers-institute.org>

Note exactly the way I would put it.


Look at the difference between the first command and the second is the following transcript:

> echo -e ">asdf\natgc\n" | perl -MBio::SeqIO -e 'my $s = Bio::SeqIO->new(-format => qw{fasta}, -fh => \*ARGV); print $ARGV[0] . qq{ has } . $s->next_seq()->seq . qq{\n}' -- '-'
- has atgc
> echo -e ">asdf\natgc\n" | perl -MBio::SeqIO -e 'my $s = Bio::SeqIO->new(-format => qw{fasta}, -fh => \*ARGV); print $ARGV[0] . qq{ has } . $s->next_seq()->seq . qq{\n}' -- 'NoSuchFile'
Can't open NoSuchFile: No such file or directory at /home/mec/cvs/bioperl-live/Bio/Root/IO.pm line 458.
Can't call method "seq" on an undefined value at -e line 1.

THe only difference is that @ARG is the singleton list composed of '-' in the first call, and is the singlton list composed of 'NoSuchFile' in the second.

If you passed in a list of multiple files that actually do exist, it should work fine.

It is really a matter of ARGV processing magic.

from http://perldoc.perl.org/perlop.html

The null filehandle <> is special: it can be used to emulate the behavior of sed and awk. Input from <> comes either from standard input, or from each file listed on the command line. Here's how it works: the first time <> is evaluated, the @ARGV array is checked, and if it is empty, $ARGV[0] is set to "-", which when opened gives you standard input. The @ARGV array is then processed as a list of filenames. The loop

    while (<>) {
        ...                     # code for each line
    }

is equivalent to the following Perl-like pseudo code:

    unshift<http://perldoc.perl.org/functions/unshift.html>(@ARGV, '-') unless @ARGV;
    while ($ARGV = shift<http://perldoc.perl.org/functions/shift.html>) {
        open<http://perldoc.perl.org/functions/open.html>(ARGV, $ARGV);
        while (<ARGV>) {
            ...         # code for each line
        }
    }





Malcolm Cook
Database Applications Manager - Bioinformatics
Stowers Institute for Medical Research - Kansas City, Missouri




________________________________
From: dave at davemessina.com [mailto:dave at davemessina.com] On Behalf Of Dave Messina
Sent: Thursday, September 11, 2008 1:47 PM
To: Cook, Malcolm
Cc: Felipe Figueiredo; bioperl-l at lists.open-bio.org
Subject: Re: [Bioperl-l] difference in opening file from @ARGV and STDIN?

Thanks, Malcolm.

So then, '-' as STDIN does work?

D




From David.Messina at sbc.su.se  Thu Sep 11 17:15:44 2008
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 11 Sep 2008 23:15:44 +0200
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC129FFD559C@exchmb-02.stowers-institute.org>
References: <1221122426.8059.49.camel@localhost>
	<628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>
	<628aabb70809111147y7d99e1bdh414a4ab1037c0990@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD559C@exchmb-02.stowers-institute.org>
Message-ID: <628aabb70809111415w27044d57jd3121adb40900e45@mail.gmail.com>

Cool, thanks for the explanation Malcolm!

At the risk of belaboring this point and your patience, one thing still
confuses me, though:

and if [@ARGV] is empty, $ARGV[0] is set to "-"
>

If $ARGV[0] is set (by Perl's ARGV processing magic) to '-', then why in
your earlier example do you manually set $ARGV[0] to '-' instead of simply
leaving @ARGV empty?

@ARGV = ('-') unless @ARGV;




If I run your example and omit '-' as an argument, it still works:

> echo -e ">asdf\natgc\n" | perl -MBio::SeqIO -e 'my $s =
Bio::SeqIO->new(-format => qw{fasta}, -fh => \*ARGV); print $ARGV[0] . qq{
has } . $s->next_seq()->seq . qq{\n}'
 has atgc



Dave


From acouperthwaite at gmail.com  Fri Sep 12 17:17:53 2008
From: acouperthwaite at gmail.com (Andrew Couperthwaite)
Date: Fri, 12 Sep 2008 15:17:53 -0600
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
Message-ID: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>

Hi,

I'm having difficulty using  the Bio::DB::Query::GenBank module.  The  
sample script on the page http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/DB/Query/GenBank.html 
  doesn't seem to work.

I'm trying to use this and the Bio::DB::GenBank module to find and  
download a set of sequences from GenBank...
I'm rather new to bioperl, can anyone point me in the right direction?

Thanks,
-Andrew


From jason at bioperl.org  Sat Sep 13 02:42:28 2008
From: jason at bioperl.org (Jason Stajich)
Date: Fri, 12 Sep 2008 23:42:28 -0700
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
In-Reply-To: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
References: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
Message-ID: <2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>

Hi Andrew -

a) what is the exact script code you are trying, what are the error  
messages?
b) what version of bioperl?

The first thing we'll suggest is: did you get the latest code from SVN  
yet or a nightly build?

-jason
On Sep 12, 2008, at 2:17 PM, Andrew Couperthwaite wrote:

> Hi,
>
> I'm having difficulty using  the Bio::DB::Query::GenBank module.   
> The sample script on the page http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/DB/Query/GenBank.html 
>  doesn't seem to work.
>
> I'm trying to use this and the Bio::DB::GenBank module to find and  
> download a set of sequences from GenBank...
> I'm rather new to bioperl, can anyone point me in the right direction?
>
> Thanks,
> -Andrew
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From cjfields at illinois.edu  Mon Sep 15 00:13:57 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Sun, 14 Sep 2008 23:13:57 -0500
Subject: [Bioperl-l] significant bug with Bio::LocatableSeq
Message-ID: <98938314-4AF1-44C2-8867-B383A44E542E@illinois.edu>

While debugging some tests in bioperl, I noticed a fairly significant  
issue with Bio::LocatableSeq which is probably due to some  
inconsistencies with start/end coordinates.  For some reason this  
started popping up with error messages recently when running AlignIO  
tests on bioperl-live (i.e. something changed which exposed the bug,  
maybe the verbosity level):

1..295
ok 1 - use Bio::AlignIO;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5
ok 6 - The object isa Bio::AlignIO

--------------------- WARNING ---------------------
MSG: In sequence 02 residue count gives end value 399.
Overriding value [355] with value 399 for Bio::LocatableSeq::end().
STACK Bio::LocatableSeq::end /Users/cjfields/bioperl/bioperl-live/blib/ 
lib/Bio/LocatableSeq.pm:150
STACK Bio::LocatableSeq::new /Users/cjfields/bioperl/bioperl-live/blib/ 
lib/Bio/LocatableSeq.pm:103
STACK Bio::AlignIO::arp::next_aln /Users/cjfields/bioperl/bioperl-live/ 
blib/lib/Bio/AlignIO/arp.pm:106
STACK toplevel t/AlignIO.t:34
---------------------------------------------------
.... followed by tons of similar errors.

The problem is, no change is ever made.  This is demonstrated by the  
following:

-----------------------------
#!/usr/bin/perl -w

use strict;
use warnings;
use Bio::LocatableSeq;

my $seq = Bio::LocatableSeq->new(
     -id => 'foo',
     -seq => 'A----TGCGCTTCCTCGCTTCCG',
     -start => 10,
     -end => 100, # intentially bad
     -strand => -1);

print $seq->end."\n";

-----------------------------

Results:

--------------------- WARNING ---------------------
MSG: In sequence foo residue count gives end value 28.
Overriding value [100] with value 28 for Bio::LocatableSeq::end().
STACK Bio::LocatableSeq::end /Users/cjfields/bioperl/bioperl-live/Bio/ 
LocatableSeq.pm:150
STACK Bio::LocatableSeq::new /Users/cjfields/bioperl/bioperl-live/Bio/ 
LocatableSeq.pm:103
STACK toplevel seq.pl:7
---------------------------------------------------
100

The warning pops up when -end is passed to LocatableSeq::new and  
indicates that the passed coordinate doesn't match up with the one  
calculated from the sequence (minus gaps).  I've isolated the bug down  
to the end() method and am working on fixing it.  Note that this  
affects LocatableSeq::length as well.  This appears to affect arp,  
nexus, stockholm, and a few other AlignIO parsers as well.

chris


From acouperthwaite at gmail.com  Mon Sep 15 15:05:13 2008
From: acouperthwaite at gmail.com (Andrew Couperthwaite)
Date: Mon, 15 Sep 2008 13:05:13 -0600
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
In-Reply-To: <2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>
References: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
	<2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>
Message-ID: <2BA47AC9-5A04-460D-BA56-64B152AFFF16@gmail.com>

the code i'm starting with is this:
=====
use Bio::DB::Query::GenBank;
use Bio::DB::GenBank

my $query_string = 'Oryza[Organism] AND EST[Keyword]';
    my $query = Bio::DB::Query::GenBank->new(-query =>  
'Oryza[Organism] AND EST[Keyword]',
    											-db=>'nucleotide');
    my $count = $query->count;
    my @ids   = $query->ids;
    # get a genbank database handle
    my $gb = Bio::DB::GenBank->new();
    my $stream = $gb->get_Stream_by_query($query);

    while (my $seq = $stream->next_seq) {
       # do something with the sequence object
       print "hello";
    }
=====
It doesn't produce any error messages, it simply doesn't enter the  
while loop.  It seems as though it isn't getting any results from  
genbank?/isn't contacting genbank?

We are running version 1.5.2.  Haven't updated since late May.

-Andrew

On 13-Sep-08, at 12:42 AM, Jason Stajich wrote:

> Hi Andrew -
>
> a) what is the exact script code you are trying, what are the error  
> messages?
> b) what version of bioperl?
>
> The first thing we'll suggest is: did you get the latest code from  
> SVN yet or a nightly build?
>
> -jason
> On Sep 12, 2008, at 2:17 PM, Andrew Couperthwaite wrote:
>
>> Hi,
>>
>> I'm having difficulty using  the Bio::DB::Query::GenBank module.   
>> The sample script on the page http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/DB/Query/GenBank.html 
>>  doesn't seem to work.
>>
>> I'm trying to use this and the Bio::DB::GenBank module to find and  
>> download a set of sequences from GenBank...
>> I'm rather new to bioperl, can anyone point me in the right  
>> direction?
>>
>> Thanks,
>> -Andrew
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Jason Stajich
> jason at bioperl.org
>
>
>



From jason at bioperl.org  Mon Sep 15 15:25:49 2008
From: jason at bioperl.org (Jason Stajich)
Date: Mon, 15 Sep 2008 12:25:49 -0700
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
In-Reply-To: <2BA47AC9-5A04-460D-BA56-64B152AFFF16@gmail.com>
References: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
	<2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>
	<2BA47AC9-5A04-460D-BA56-64B152AFFF16@gmail.com>
Message-ID: <25A13987-7306-42E8-BE4E-E50A70538E7D@bioperl.org>

Try removing the line
my @ids = $query->ids;

I don't think GenBank supports this part of the query API now or you  
have to execute the query first before you can ask for the number of  
IDs from that object.  I don't remember exactly what changed  
specifically, but I actually get an error with that line:
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Id list has been truncated even after maxids requested
STACK: Error::throw
STACK: Bio::Root::Root::throw /usr/local/lib/perl5/Bio/Root/Root.pm:357
STACK: Bio::DB::Query::WebQuery::_fetch_ids /usr/local/lib/perl5/Bio/ 
DB/Query/WebQuery.pm:237
STACK: Bio::DB::Query::WebQuery::ids /usr/local/lib/perl5/Bio/DB/Query/ 
WebQuery.pm:201
STACK: query.pl:9
-----------------------------------------------------------


This is the query script I use that works fine for me for my downloads.

http://fungalgenomes.org/~stajich/scripts/download_query_genbank.pl


I'm using SVN code so it is possible things are changed since 1.5.2.

-jason
On Sep 15, 2008, at 12:05 PM, Andrew Couperthwaite wrote:

> the code i'm starting with is this:
> =====
> use Bio::DB::Query::GenBank;
> use Bio::DB::GenBank
>
> my $query_string = 'Oryza[Organism] AND EST[Keyword]';
>   my $query = Bio::DB::Query::GenBank->new(-query =>  
> 'Oryza[Organism] AND EST[Keyword]',
>   											-db=>'nucleotide');
>   my $count = $query->count;
>   my @ids   = $query->ids;
>   # get a genbank database handle
>   my $gb = Bio::DB::GenBank->new();
>   my $stream = $gb->get_Stream_by_query($query);
>
>   while (my $seq = $stream->next_seq) {
>      # do something with the sequence object
>      print "hello";
>   }
> =====
> It doesn't produce any error messages, it simply doesn't enter the  
> while loop.  It seems as though it isn't getting any results from  
> genbank?/isn't contacting genbank?
>
> We are running version 1.5.2.  Haven't updated since late May.
>
> -Andrew
>
> On 13-Sep-08, at 12:42 AM, Jason Stajich wrote:
>
>> Hi Andrew -
>>
>> a) what is the exact script code you are trying, what are the error  
>> messages?
>> b) what version of bioperl?
>>
>> The first thing we'll suggest is: did you get the latest code from  
>> SVN yet or a nightly build?
>>
>> -jason
>> On Sep 12, 2008, at 2:17 PM, Andrew Couperthwaite wrote:
>>
>>> Hi,
>>>
>>> I'm having difficulty using  the Bio::DB::Query::GenBank module.   
>>> The sample script on the page http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/DB/Query/GenBank.html 
>>>  doesn't seem to work.
>>>
>>> I'm trying to use this and the Bio::DB::GenBank module to find and  
>>> download a set of sequences from GenBank...
>>> I'm rather new to bioperl, can anyone point me in the right  
>>> direction?
>>>
>>> Thanks,
>>> -Andrew
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Jason Stajich
>> jason at bioperl.org
>>
>>
>>
>

Jason Stajich
jason at bioperl.org





From biology0046 at hotmail.com  Mon Sep 15 16:00:02 2008
From: biology0046 at hotmail.com (=?gb2312?B?va3OxOL9?=)
Date: Mon, 15 Sep 2008 20:00:02 +0000
Subject: [Bioperl-l] HSP tiling problem
In-Reply-To: <mailman.7944.1221254286.2673.bioperl-l@lists.open-bio.org>
References: <mailman.7944.1221254286.2673.bioperl-l@lists.open-bio.org>
Message-ID: <BLU108-W14DD76360E5100AC535214B4520@phx.gbl>


Dear all:
I try to use bioperl's SearhIO module to parse the blast output, 
the output of blast contain many HSPs from the same hit, each HSP come out with an count of identity residues and alignment length, but what i want to get is the global identiy and alignment length of the query sequence and hit sequence, which may be done by tiling the HSPs and build a HSP contig, 
 
the bioperl BLASTutil module contain "hsp_tiling and length_aln, frac_identical" method fullfill my purpose, but i read through the mailing list, some user said the method used by bioperl were not precise in many cases, they sugguest to use WUBLAST.
 
but i don't know which WUBLAST opinion should i use, i use "links" opinion, but the output still give me lots of HSPs, are these HSPs created from some small HSPs?best regards!wenkaichinese academy of sciences
_________________________________________________________________
????????????????????????????????????????????????????
http://im.live.cn/Share/18.htm


From jason at bioperl.org  Mon Sep 15 16:27:02 2008
From: jason at bioperl.org (Jason Stajich)
Date: Mon, 15 Sep 2008 13:27:02 -0700
Subject: [Bioperl-l] HSP tiling problem
In-Reply-To: <BLU108-W14DD76360E5100AC535214B4520@phx.gbl>
References: <mailman.7944.1221254286.2673.bioperl-l@lists.open-bio.org>
	<BLU108-W14DD76360E5100AC535214B4520@phx.gbl>
Message-ID: <90A30B97-1618-4AAF-86D9-B51929697CDE@bioperl.org>

The -links option gives you a logical ordering of non-overlapping HSPs  
so it is the tiling you desire. You just process each HSP from the  
list provided by -links. There may be several alternative paths so you  
can compute a %id for all of them or just take the longest one, etc.

You need to just decide how you want to compute global identity - an  
average of the HSP identities or just sum up the number of identical  
bases across them all divided by the total length of sequence that is  
aligned.  All those pieces of information are available and described  
in the SearchIO HOWTO on the website.

Or, requiring less coding, re-align the sequences with an aligner like  
SSEARCH to get a single alignment and a single %id/%sim number for the  
sequence pair.

-jason

On Sep 15, 2008, at 1:00 PM, ?????? wrote:

>
> Dear all:
> I try to use bioperl's SearhIO module to parse the blast output,
> the output of blast contain many HSPs from the same hit, each HSP  
> come out with an count of identity residues and alignment length,  
> but what i want to get is the global identiy and alignment length of  
> the query sequence and hit sequence, which may be done by tiling the  
> HSPs and build a HSP contig,
>
> the bioperl BLASTutil module contain "hsp_tiling and length_aln,  
> frac_identical" method fullfill my purpose, but i read through the  
> mailing list, some user said the method used by bioperl were not  
> precise in many cases, they sugguest to use WUBLAST.
>
> but i don't know which WUBLAST opinion should i use, i use "links"  
> opinion, but the output still give me lots of HSPs, are these HSPs  
> created from some small HSPs?best regards!wenkaichinese academy of  
> sciences
> _________________________________________________________________
> ????????????????????????????????????????????????????
> http://im.live.cn/Share/18.htm
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org






From bosborne11 at verizon.net  Mon Sep 15 22:22:54 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Mon, 15 Sep 2008 22:22:54 -0400
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
In-Reply-To: <25A13987-7306-42E8-BE4E-E50A70538E7D@bioperl.org>
References: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
	<2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>
	<2BA47AC9-5A04-460D-BA56-64B152AFFF16@gmail.com>
	<25A13987-7306-42E8-BE4E-E50A70538E7D@bioperl.org>
Message-ID: <583390B6-1075-4EB0-A22A-E1D07D2EDFA8@verizon.net>

Jason,

I added that script to scripts/, hope you don't mind!

Brian O.



On Sep 15, 2008, at 3:25 PM, Jason Stajich wrote:

> This is the query script I use that works fine for me for my  
> downloads.



From mirhan at indiana.edu  Tue Sep 16 01:18:47 2008
From: mirhan at indiana.edu (Han, Mira)
Date: Tue, 16 Sep 2008 01:18:47 -0400
Subject: [Bioperl-l] [Wg-phyloinformatics] Summer of Code: project
	summaries
In-Reply-To: <2033D247-5E34-4BDE-A98E-BE08D9910951@duke.edu>
Message-ID: <C4F4B9F7.5500%mirhan@indiana.edu>


Hi,
Just writing to summarize the final product of this summer. (even though it's overdue)
The phyloXML support in BioPerl project is finished officially,
I've created three new modules,
Bio::TreeIO::phyloxml,
Bio::Tree::AnnotatableNode,
and Bio::Annotation::Relation.
The parsing is done for all elements except for <ProteinDomain>
And the validation step is still missing.
I'm planning to add those in in the future.

I was contemplating to make a Bio::Annotation::XML till the end,
But decided not to since there was already a new module Bio::Annotation::TagTree, that looked like the same thing.
Currently, the module does not use TagTree, it uses nested AnnotationCollections instead, because TagTree was a temporary stub at the time.
There are methods in phyloxml that seem out of place there,
For example, the print_annotation and print_attr functions that print the annotations in phyloXML format.
Or the read_annotation function that reads the value of the annotation for a certain object.
I feel like these functions should go with the Annotation object,
But since there were no Annotation object that is phyloXML specific,
I just put them in the TreeIO::phyloxml.
This may change too in the future.

The documentations are all finished and can be seen in
http://www.bioperl.org/wiki/Module:Bio::TreeIO::phyloxml
http://www.bioperl.org/wiki/Module:Bio::Tree::AnnotatableNode
http://www.bioperl.org/wiki/Module:Bio::Annotation::Relation

The detailed progress of the project is documented in
http://www.bioperl.org/wiki/PhyloXML_support_in_BioPerl

and there is also a demo page that describes the use in
http://www.bioperl.org/wiki/Phyloxml_Project_Demo


Finally I'd like to thank Chris Fields and Hilmar Lapp,
for the constant support during the summer.
And the people on the list for providing helpful suggestions when I came with a question.
See you around.

Mira Han




On 9/14/08 1:15 PM, "Hilmar Lapp" <hlapp at duke.edu> wrote:

Hi all,

the 2008 Google Summer of Code program is officially over now. First
off, I'd like to congratulate all of our students: you all passed your
end-of-term evaluation, and you all passed solidly. Thanks for all
your hard work, beginning with writing and refining your project
applications and finally wrapping it up with documentation and a
demonstration project.

Based on what I can see, the students have all uploaded the code you
produced over the summer to the Google Code repository, as requested
by Google, so I'm not going to bore you with repeating the
instructions for how to do this. If you are still having trouble with
this process or have other questions regarding this though, don't
hesitate to let me know and ask any question you have.

For our imminently due Annual Report to NSF, we will need to document
your projects, and I am asking you for your help in this. Essentially,
we will need to produce similar information to what we composed for
the 2007 fall NESCent newsletter: for each project we need a short
summary of the project and the benefits of the results, written for a
scientific but otherwise general audience, a headshot of you (the
student), and a visual of the results. See

http://www.nescent.org/news/newsletter_10_07.php#google

for the example from last year as to what we have in mind. Kistin
Jenkins or Jory Weintraub from NESCent's Education and Outreach group
(both copied) will be in touch with you to possibly edit the summaries
and fine-tune the other material, but if the students could please
send your draft summary text, headshot, and visual as soon as you can
to eog at nescent.org that would be great. If you are not sure what to
use for the visual, I'd encourage you to speak with your mentor;
however, feel free to ask me as well.

Thanks again for working with us, and on your projects, and I hope you
all not only had a most enjoyable summer but also will keep involved
in your project as much as possible. I will also arrange for an end-of-
term teleconference with the students shortly, and one of the things
that I'd like to talk about is how we can best facilitate you
remaining involved beyond the official end of the program.

Cheers,

        -hilmar

--
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:- hlapp at duke dot edu :
===========================================================




_______________________________________________
Wg-phyloinformatics mailing list
Wg-phyloinformatics at nescent.org
https://lists.nescent.org/mailman/listinfo/wg-phyloinformatics





From hartzell at alerce.com  Wed Sep 17 00:21:36 2008
From: hartzell at alerce.com (George Hartzell)
Date: Tue, 16 Sep 2008 21:21:36 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18640.34256.305270.924007@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > George,
 > 
 > This is an error from my side. Great that you have a fix already.
 > 
 > My only worry is the number of external dependencies in BioPerl. To limit 
 > these we have recoded number of functionalities into BioPerl-specific modules. 
 > Before you commit the fix, could you see if Bio::RangeI could be used or easily 
 > extended to be used instead of Set::IntSpan?
 > 
 > Thanks,
 > 
 >    -Heikki
 > 
 > On Friday 05 September 2008 21:01:35 George Hartzell wrote:
 > > Hi all,
 > >
 > > Bio::Coordinate::Collection surprised me a bit.  At first I thought
 > > there was a bug, but it's clearly doing what it's supposed to.  Now
 > > I'm wondering if what it's supposed to be doing makes sense in some
 > > context, or if what I expected would be better functionality.
 > >
 > > t/CoordinateMapper.t sets up the following scenario:
 > >
 > > #
 > > # Collection
 > > #
 > > #         1   5     6   10
 > > #         |---|     |---|
 > > #-----|-----------------------
 > > #     1   5   9     15  19
 > > #         pair1     pair2
 > >
 > > Then goes on to do the following query:
 > >
 > >   # match more than two
 > >   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
 > >   ok $res = $transcribe->map($pos);
 > >   is $res->each_gap, 2;
 > >   is $res->each_match, 2;
 > >
 > > I was surprised to see that there were two gaps, one gene:10-19 and
 > > one from gene:5-14.  Looking at the code, what's really happening is
 > > that, for the exon1 mapper there's match with gene:5-9 and a gap with
 > > gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
 > > match with gene:15-19.  All four Result's just get tossed into the
 > > return value.
 > >
 > > The result my intuition wants is that there are two matches (gene:5-9
 > > with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
 > >
 > > Yes, I guess that I could just synthesize these myself from the result
 > > in my app.
 > >
 > > It still seems that the current result is a bug though, since there's
 > > no way of knowing when you're walking through $res->each_Location that
 > > the first "gap" is with respect to the exon1 mapper and that the
 > > second "gap" is with respect to the exon2 mapper.  The gaps are
 > > meaningless.
 > >
 > > I "fixed" it to work the way I think it should (two matches, one
 > > gap).  I actually extended the test case a bit so that there's a
 > > multi-base gap, a match, another multibase-gap, another match, then a
 > > single base gap (just to make sure I got that right...).  I had to
 > > touch up the test file a bit to account for my new test.
 > >
 > > The gaps that I return have a strand of 'undef', which seems to be The
 > > Right Thing.  There's also a bit of funny business where I hang onto
 > > the seq_id of the gapped sequence.  It assumes that the "in" sequence
 > > is the same for all of the mappers.  This seems safe since otherwise
 > > the entire query is kind of weird....
 > >
 > > There's a patch to todays svn head at:
 > >
 > >   http://shrimp.alerce.com/bioperl/collection-diffs.txt
 > >
 > > The patch changes Build.PL to include a dependency on Set::IntSpan,
 > > CoordinateMapper.t to update the tests, and
 > > Bio/CoordinateMapper/Collection.pm for the new code.
 > >
 > > Who's code would this break.
 > >
 > > If anyone's relying on the current behaviour re: gaps, what's the
 > > situation in which you find it useful?
 > >
 > > Thanks!
 > >
 > > g.

I suspect that I can redo it w/ RangeI's.  It'll be a good project.
I'm pushing on a project at the moment but will get to it this weekend
or next week.

thanks,

g.


From hartzell at alerce.com  Wed Sep 17 00:21:36 2008
From: hartzell at alerce.com (George Hartzell)
Date: Tue, 16 Sep 2008 21:21:36 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18640.34256.305270.924007@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > George,
 > 
 > This is an error from my side. Great that you have a fix already.
 > 
 > My only worry is the number of external dependencies in BioPerl. To limit 
 > these we have recoded number of functionalities into BioPerl-specific modules. 
 > Before you commit the fix, could you see if Bio::RangeI could be used or easily 
 > extended to be used instead of Set::IntSpan?
 > 
 > Thanks,
 > 
 >    -Heikki
 > 
 > On Friday 05 September 2008 21:01:35 George Hartzell wrote:
 > > Hi all,
 > >
 > > Bio::Coordinate::Collection surprised me a bit.  At first I thought
 > > there was a bug, but it's clearly doing what it's supposed to.  Now
 > > I'm wondering if what it's supposed to be doing makes sense in some
 > > context, or if what I expected would be better functionality.
 > >
 > > t/CoordinateMapper.t sets up the following scenario:
 > >
 > > #
 > > # Collection
 > > #
 > > #         1   5     6   10
 > > #         |---|     |---|
 > > #-----|-----------------------
 > > #     1   5   9     15  19
 > > #         pair1     pair2
 > >
 > > Then goes on to do the following query:
 > >
 > >   # match more than two
 > >   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
 > >   ok $res = $transcribe->map($pos);
 > >   is $res->each_gap, 2;
 > >   is $res->each_match, 2;
 > >
 > > I was surprised to see that there were two gaps, one gene:10-19 and
 > > one from gene:5-14.  Looking at the code, what's really happening is
 > > that, for the exon1 mapper there's match with gene:5-9 and a gap with
 > > gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
 > > match with gene:15-19.  All four Result's just get tossed into the
 > > return value.
 > >
 > > The result my intuition wants is that there are two matches (gene:5-9
 > > with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
 > >
 > > Yes, I guess that I could just synthesize these myself from the result
 > > in my app.
 > >
 > > It still seems that the current result is a bug though, since there's
 > > no way of knowing when you're walking through $res->each_Location that
 > > the first "gap" is with respect to the exon1 mapper and that the
 > > second "gap" is with respect to the exon2 mapper.  The gaps are
 > > meaningless.
 > >
 > > I "fixed" it to work the way I think it should (two matches, one
 > > gap).  I actually extended the test case a bit so that there's a
 > > multi-base gap, a match, another multibase-gap, another match, then a
 > > single base gap (just to make sure I got that right...).  I had to
 > > touch up the test file a bit to account for my new test.
 > >
 > > The gaps that I return have a strand of 'undef', which seems to be The
 > > Right Thing.  There's also a bit of funny business where I hang onto
 > > the seq_id of the gapped sequence.  It assumes that the "in" sequence
 > > is the same for all of the mappers.  This seems safe since otherwise
 > > the entire query is kind of weird....
 > >
 > > There's a patch to todays svn head at:
 > >
 > >   http://shrimp.alerce.com/bioperl/collection-diffs.txt
 > >
 > > The patch changes Build.PL to include a dependency on Set::IntSpan,
 > > CoordinateMapper.t to update the tests, and
 > > Bio/CoordinateMapper/Collection.pm for the new code.
 > >
 > > Who's code would this break.
 > >
 > > If anyone's relying on the current behaviour re: gaps, what's the
 > > situation in which you find it useful?
 > >
 > > Thanks!
 > >
 > > g.

I suspect that I can redo it w/ RangeI's.  It'll be a good project.
I'm pushing on a project at the moment but will get to it this weekend
or next week.

thanks,

g.


From cjfields at illinois.edu  Wed Sep 17 12:41:52 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 17 Sep 2008 11:41:52 -0500
Subject: [Bioperl-l] [Wg-phyloinformatics] Summer of Code: project
	summaries
In-Reply-To: <C4F4B9F7.5500%mirhan@indiana.edu>
References: <C4F4B9F7.5500%mirhan@indiana.edu>
Message-ID: <25D73268-25A1-4780-A2D2-F27D47081D83@illinois.edu>


On Sep 16, 2008, at 12:18 AM, Han, Mira wrote:

> Hi,
> Just writing to summarize the final product of this summer. (even  
> though it's overdue)

BLTN

> The phyloXML support in BioPerl project is finished officially,
> I've created three new modules,
> Bio::TreeIO::phyloxml,
> Bio::Tree::AnnotatableNode,
> and Bio::Annotation::Relation.
> The parsing is done for all elements except for <ProteinDomain>
> And the validation step is still missing.
> I'm planning to add those in in the future.

Great work!  One issue that will come up: have you tested round- 
tripping?

(i.e. where object data read in from the original phlyoxml data is the  
same as object data read in from bioperl-derived phyloxml output)

> I was contemplating to make a Bio::Annotation::XML till the end,
> But decided not to since there was already a new module  
> Bio::Annotation::TagTree, that looked like the same thing.
> Currently, the module does not use TagTree, it uses nested  
> AnnotationCollections instead, because TagTree was a temporary stub  
> at the time.

I would consider it no longer temporary (just changed it in svn).  The  
'stub' part was left over from the initial commit; it has now been  
tested with bioperl-db (via swissprot tests).  It may need more  
rigorous testing via bioperl-db but it appears to work just fine  
(famous last words...).

There was one issue with Data::Stag (repeated 'Use of undefined  
variable' errors that popped up with Annotation.t tests), but Chris M.  
released a new Data::Stag to CPAN just recently which fixes that.  It  
wasn't a bioperl bug and was relatively harmless.

> There are methods in phyloxml that seem out of place there,
> For example, the print_annotation and print_attr functions that  
> print the annotations in phyloXML format.
> Or the read_annotation function that reads the value of the  
> annotation for a certain object.
> I feel like these functions should go with the Annotation object,
> But since there were no Annotation object that is phyloXML specific,
> I just put them in the TreeIO::phyloxml.
> This may change too in the future.

I don't see a problem with this; if you look at the various IO parsers  
there are several helper methods present (see Bio::SeqIO::genbank for  
an example).

If you were to go that route, I would add a method to the (generic)  
Annotation class that accepts some customization via a callback, maybe  
using a default callback if one isn't supplied.  See the various  
Bio::AnnotationI display_text methods, which were added in as a more  
explicit replacement for operator overloading.

> The documentations are all finished and can be seen in
> http://www.bioperl.org/wiki/Module:Bio::TreeIO::phyloxml
> http://www.bioperl.org/wiki/Module:Bio::Tree::AnnotatableNode
> http://www.bioperl.org/wiki/Module:Bio::Annotation::Relation
>
> The detailed progress of the project is documented in
> http://www.bioperl.org/wiki/PhyloXML_support_in_BioPerl
>
> and there is also a demo page that describes the use in
> http://www.bioperl.org/wiki/Phyloxml_Project_Demo

I'll give them a look over, but that's a great start!

> Finally I'd like to thank Chris Fields and Hilmar Lapp,
> for the constant support during the summer.
> And the people on the list for providing helpful suggestions when I  
> came with a question.
> See you around.
>
> Mira Han

Thanks, and congrats on completeing the summer of code!  Hope you  
stick around a bit longer; we need all the hands we can get.

chris


From gundalav at gmail.com  Thu Sep 18 04:51:54 2008
From: gundalav at gmail.com (Gundala Viswanath)
Date: Thu, 18 Sep 2008 17:51:54 +0900
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with
	Bioperl
Message-ID: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>

Dear all,

Is there a way I can convert such EnSeMBL
probe names into Gene Symbol with BioPerl?

ENSG00000000003_at
ENSG00000000005_at
ENSG00000000419_at
ENSG00000000457_at
ENSG00000000460_at
ENSG00000000938_at
ENSG00000000971_at
ENSG00000001036_at
ENSG00000001084_at
ENSG00000001167_at
ENSG00000001461_at
ENSG00000001497_at
ENSG00000001561_at
... etc ...

Or perhaps there is a flat file for conversion?



- Gundala Viswanath
Jakarta - Indonesia


From cjfields at illinois.edu  Thu Sep 18 08:07:52 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 18 Sep 2008 07:07:52 -0500
Subject: [Bioperl-l] Species.t tests failing with bioperl-live
Message-ID: <C67B2790-EC0C-4F3A-A026-20CFBAE92B74@illinois.edu>

I'm getting a couple of failed tests with

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From cjfields at illinois.edu  Thu Sep 18 08:15:03 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 18 Sep 2008 07:15:03 -0500
Subject: [Bioperl-l] Species.t tests failing with bioperl-live
In-Reply-To: <C67B2790-EC0C-4F3A-A026-20CFBAE92B74@illinois.edu>
References: <C67B2790-EC0C-4F3A-A026-20CFBAE92B74@illinois.edu>
Message-ID: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>


On Sep 18, 2008, at 7:07 AM, Chris Fields wrote:

> I'm getting a couple of failed tests with


Um, that was supposed to be:

I'm getting a couple of failed tests with Species.t; I think these are  
due to the last commit to Bio::Species:

http://code.open-bio.org/svnweb/index.cgi/bioperl/revision/?rev=14793

Tests pass after commenting out that line.

chris


From bernd.web at gmail.com  Thu Sep 18 13:34:49 2008
From: bernd.web at gmail.com (Bernd Web)
Date: Thu, 18 Sep 2008 19:34:49 +0200
Subject: [Bioperl-l] SimpleAlign/AlignIO
Message-ID: <716af09c0809181034w2f9cc44do6b2a02502ea81fea@mail.gmail.com>

Hi,

Possibly I overlooked this, but is it not possible to supply an
alphabet to SimpleAlign?
When SimpleAlign starts making sequence objects _guess_alphabet is
executed and in case the sequence (slice) only contains gaps a warning
is raised as the alphabet cannot be guessed.
As all sequences in the alignment (generally) would be of the same
type, it could be good to set the alpabet for the alignment; this also
would prevent the executing of _guess_alphabet for all sequences. Is
this possible?


Regards,
Bernd


From cjfields at illinois.edu  Thu Sep 18 13:56:56 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 18 Sep 2008 12:56:56 -0500
Subject: [Bioperl-l] SimpleAlign/AlignIO
In-Reply-To: <716af09c0809181034w2f9cc44do6b2a02502ea81fea@mail.gmail.com>
References: <716af09c0809181034w2f9cc44do6b2a02502ea81fea@mail.gmail.com>
Message-ID: <9012F474-5762-4ABA-ADAB-7F0ECB38ACC3@illinois.edu>

Bernd,

I'm not sure it's a good idea to constrain the entire alignment (and  
all sequences contained within) to a single alphabet.  For instance,  
what if I wanted to align a translated (protein) sequence, possibly as  
3- or 6-frame, to a DNA sequence of interest?  Or if I wanted to align  
a Meta sequence w/o an alphabet (i.e. a structural consensus sequence)  
with a DNA/RNA/protein sequence?  The former example is fairly common  
and may not be entirely possible with SimpleAlign (I haven't tried it  
to tell the truth), but the latter is what I do with the Stockholm  
parser.

chris

On Sep 18, 2008, at 12:34 PM, Bernd Web wrote:

> Hi,
>
> Possibly I overlooked this, but is it not possible to supply an
> alphabet to SimpleAlign?
> When SimpleAlign starts making sequence objects _guess_alphabet is
> executed and in case the sequence (slice) only contains gaps a warning
> is raised as the alphabet cannot be guessed.
> As all sequences in the alignment (generally) would be of the same
> type, it could be good to set the alpabet for the alignment; this also
> would prevent the executing of _guess_alphabet for all sequences. Is
> this possible?
>
>
> Regards,
> Bernd
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From MEC at stowers-institute.org  Thu Sep 18 17:20:02 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Thu, 18 Sep 2008 16:20:02 -0500
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
	with	Bioperl
In-Reply-To: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>

Gundala,

Here is an option - if you want a script...

http://research.stowers-institute.org/mec/software/scripts/affyprobeset2ensg/

It is not bioperl.   It is perl.  It uses DBI to query the ensembl MySQL database using SQL.  It may be outdated due to changes in Ensembl schema.

Good luck,

Malcolm Cook
Stowers Institute for Medical Research - Kansas City, Missouri

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Gundala Viswanath
Sent: Thursday, September 18, 2008 3:52 AM
To: bioperl-l at lists.open-bio.org
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with Bioperl

Dear all,

Is there a way I can convert such EnSeMBL probe names into Gene Symbol with BioPerl?

ENSG00000000003_at
ENSG00000000005_at
ENSG00000000419_at
ENSG00000000457_at
ENSG00000000460_at
ENSG00000000938_at
ENSG00000000971_at
ENSG00000001036_at
ENSG00000001084_at
ENSG00000001167_at
ENSG00000001461_at
ENSG00000001497_at
ENSG00000001561_at
... etc ...

Or perhaps there is a flat file for conversion?



- Gundala Viswanath
Jakarta - Indonesia
_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l



From anjan.purkayastha at gmail.com  Thu Sep 18 17:27:06 2008
From: anjan.purkayastha at gmail.com (ANJAN PURKAYASTHA)
Date: Thu, 18 Sep 2008 17:27:06 -0400
Subject: [Bioperl-l] Retrieving taxonomy information from a GenBank file
Message-ID: <f03f40920809181427k168bfc3cu535c023949735cd9@mail.gmail.com>

Hi,
I'm using the following code to access the "ORGANISM" tag value for the
record NC_002526.
I get a value of 0 even though the ORGANISM tag  has a value.  Any idea how
this might be corrected?
Thanks.
Anjan


my $gb= new Bio::DB::GenBank;

my $seq = $gb->get_Seq_by_acc('NC_002526');

my $des= $seq->get_tag_values("ORGANISM");

-- 
=============================
anjan purkayastha, phd
bioinformatics analyst
whitehead institute for biomedical research
nine cambridge center
cambridge, ma 02142

purkayas [at] wi [dot] mit [dot] edu
703.740.6939


From jason at bioperl.org  Thu Sep 18 17:51:54 2008
From: jason at bioperl.org (Jason Stajich)
Date: Thu, 18 Sep 2008 14:51:54 -0700
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with
	Bioperl
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
Message-ID: <F1CAA89B-D7E9-40B3-9965-9636B4F5F852@bioperl.org>

seems like something that biomart was designed for? There is a  
scripting interface too.
http://biomart.org/

On Sep 18, 2008, at 2:20 PM, Cook, Malcolm wrote:

> Gundala,
>
> Here is an option - if you want a script...
>
> http://research.stowers-institute.org/mec/software/scripts/affyprobeset2ensg/
>
> It is not bioperl.   It is perl.  It uses DBI to query the ensembl  
> MySQL database using SQL.  It may be outdated due to changes in  
> Ensembl schema.
>
> Good luck,
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org 
> ] On Behalf Of Gundala Viswanath
> Sent: Thursday, September 18, 2008 3:52 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol  
> with Bioperl
>
> Dear all,
>
> Is there a way I can convert such EnSeMBL probe names into Gene  
> Symbol with BioPerl?
>
> ENSG00000000003_at
> ENSG00000000005_at
> ENSG00000000419_at
> ENSG00000000457_at
> ENSG00000000460_at
> ENSG00000000938_at
> ENSG00000000971_at
> ENSG00000001036_at
> ENSG00000001084_at
> ENSG00000001167_at
> ENSG00000001461_at
> ENSG00000001497_at
> ENSG00000001561_at
> ... etc ...
>
> Or perhaps there is a flat file for conversion?
>
>
>
> - Gundala Viswanath
> Jakarta - Indonesia
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From jason at bioperl.org  Thu Sep 18 17:56:18 2008
From: jason at bioperl.org (Jason Stajich)
Date: Thu, 18 Sep 2008 14:56:18 -0700
Subject: [Bioperl-l] Retrieving taxonomy information from a GenBank file
In-Reply-To: <f03f40920809181427k168bfc3cu535c023949735cd9@mail.gmail.com>
References: <f03f40920809181427k168bfc3cu535c023949735cd9@mail.gmail.com>
Message-ID: <E078758D-D451-4973-A66D-2D6D829FCA53@bioperl.org>

You want the species object ($seq->species)  -- see the Seq HOWTO,  
much of the Seq API is explained.
  http://bioperl.org/wiki/HOWTO:Feature-Annotation#The_Species_Object

-jason
On Sep 18, 2008, at 2:27 PM, ANJAN PURKAYASTHA wrote:

> Hi,
> I'm using the following code to access the "ORGANISM" tag value for  
> the
> record NC_002526.
> I get a value of 0 even though the ORGANISM tag  has a value.  Any  
> idea how
> this might be corrected?
> Thanks.
> Anjan
>
>
> my $gb= new Bio::DB::GenBank;
>
> my $seq = $gb->get_Seq_by_acc('NC_002526');
>
> my $des= $seq->get_tag_values("ORGANISM");
>
> -- 
> =============================
> anjan purkayastha, phd
> bioinformatics analyst
> whitehead institute for biomedical research
> nine cambridge center
> cambridge, ma 02142
>
> purkayas [at] wi [dot] mit [dot] edu
> 703.740.6939
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From cjfields at illinois.edu  Thu Sep 18 17:48:26 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 18 Sep 2008 16:48:26 -0500
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
	with	Bioperl
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
Message-ID: <0F56A0A4-AE10-4930-B479-C4D0818EAC7A@illinois.edu>

You can probably use the Ensembl perl API alone or in combination with  
bioperl.  I'm not sure it is working with the latest code (bioperl- 
live), but it's worth a try:

http://www.ensembl.org/info/using/api/core/core_tutorial.html
http://www.bioperl.org/wiki/HOWTO:Getting_Genomic_Sequences#Using_the_Perl_API_at_ENSEMBL

chris

On Sep 18, 2008, at 4:20 PM, Cook, Malcolm wrote:

> Gundala,
>
> Here is an option - if you want a script...
>
> http://research.stowers-institute.org/mec/software/scripts/affyprobeset2ensg/
>
> It is not bioperl.   It is perl.  It uses DBI to query the ensembl  
> MySQL database using SQL.  It may be outdated due to changes in  
> Ensembl schema.
>
> Good luck,
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org 
> ] On Behalf Of Gundala Viswanath
> Sent: Thursday, September 18, 2008 3:52 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol  
> with Bioperl
>
> Dear all,
>
> Is there a way I can convert such EnSeMBL probe names into Gene  
> Symbol with BioPerl?
>
> ENSG00000000003_at
> ENSG00000000005_at
> ENSG00000000419_at
> ENSG00000000457_at
> ENSG00000000460_at
> ENSG00000000938_at
> ENSG00000000971_at
> ENSG00000001036_at
> ENSG00000001084_at
> ENSG00000001167_at
> ENSG00000001461_at
> ENSG00000001497_at
> ENSG00000001561_at
> ... etc ...
>
> Or perhaps there is a flat file for conversion?
>
>
>
> - Gundala Viswanath
> Jakarta - Indonesia
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From spiros at lokku.com  Fri Sep 19 06:17:52 2008
From: spiros at lokku.com (Spiros Denaxas)
Date: Fri, 19 Sep 2008 11:17:52 +0100
Subject: [Bioperl-l] code coverage metrics
Message-ID: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>

Hello,

I recently sent Chris an email about an idea I had, quantifying (and
improving) the test coverage that we currently have on the bioperl
core. I know there's a list on the wiki [1] with a list of tests that
have low coverage and/or complete lack of tests. My idea was to
somehow standardize and automate the generation of this list,
preferably on a weekly basis initially. We can then more easily see
where help is needed and possible assign individual tasks to tackle
the most-suffering modules.

There are currently several very good CPAN modules that do this, like
Devel::Cover [2]. Is there any objection if I kick this off and start
doing some work, aiming into creating a more detailed report on code
coverage using the current HEAD and test suite?

Spiros

[1] http://www.bioperl.org/wiki/Untested_Modules_in_BioPerl
[2] http://search.cpan.org/dist/Devel-Cover/lib/Devel/Cover.pm


From spiros at lokku.com  Fri Sep 19 07:51:29 2008
From: spiros at lokku.com (Spiros Denaxas)
Date: Fri, 19 Sep 2008 12:51:29 +0100
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <48D391BD.5010105@sendu.me.uk>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
	<48D391BD.5010105@sendu.me.uk>
Message-ID: <bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>

On Fri, Sep 19, 2008 at 12:49 PM, Sendu Bala <bix at sendu.me.uk> wrote:
> Spiros Denaxas wrote:
>>
>> There are currently several very good CPAN modules that do this, like
>> Devel::Cover [2]. Is there any objection if I kick this off and start
>> doing some work, aiming into creating a more detailed report on code
>> coverage using the current HEAD and test suite?
>
> You should read our previous discussion here:
> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/14586/focus=14588
>
> Basically I think we have it all in place now; someone just needs to take
> that last step and run a cron job that runs the Build commands. We also need
> the website side of things sorted out I think.
>
> If you could make those things happen and take care of any issues that crop
> up, that would be great.
>

Enlightening, thank you for pointing that out. I will have a look, I
don't see a problem with the plan.

Spiros


From spiros at lokku.com  Fri Sep 19 08:01:15 2008
From: spiros at lokku.com (Spiros Denaxas)
Date: Fri, 19 Sep 2008 13:01:15 +0100
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
	<48D391BD.5010105@sendu.me.uk>
	<bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
Message-ID: <bba689ec0809190501v56cb4eedx159410c2ebf76c7a@mail.gmail.com>

>
> Enlightening, thank you for pointing that out. I will have a look, I
> don't see a problem with the plan.
>
> Spiros
>

I have also updated the wiki to make sure we avoid duplicate effort on
this, http://www.bioperl.org/wiki/Project_priority_list

Spiros


From bix at sendu.me.uk  Fri Sep 19 07:49:17 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 19 Sep 2008 12:49:17 +0100
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
Message-ID: <48D391BD.5010105@sendu.me.uk>

Spiros Denaxas wrote:
> There are currently several very good CPAN modules that do this, like
> Devel::Cover [2]. Is there any objection if I kick this off and start
> doing some work, aiming into creating a more detailed report on code
> coverage using the current HEAD and test suite?

You should read our previous discussion here:
http://thread.gmane.org/gmane.comp.lang.perl.bio.general/14586/focus=14588

Basically I think we have it all in place now; someone just needs to 
take that last step and run a cron job that runs the Build commands. We 
also need the website side of things sorted out I think.

If you could make those things happen and take care of any issues that 
crop up, that would be great.


From cjfields at illinois.edu  Fri Sep 19 08:22:02 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 19 Sep 2008 07:22:02 -0500
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
	<48D391BD.5010105@sendu.me.uk>
	<bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
Message-ID: <0C6AAAEE-5D80-4102-B03D-FE0C045492AA@illinois.edu>


On Sep 19, 2008, at 6:51 AM, Spiros Denaxas wrote:

> On Fri, Sep 19, 2008 at 12:49 PM, Sendu Bala <bix at sendu.me.uk> wrote:
>> Spiros Denaxas wrote:
>>>
>>> There are currently several very good CPAN modules that do this,  
>>> like
>>> Devel::Cover [2]. Is there any objection if I kick this off and  
>>> start
>>> doing some work, aiming into creating a more detailed report on code
>>> coverage using the current HEAD and test suite?
>>
>> You should read our previous discussion here:
>> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/14586/focus=14588
>>
>> Basically I think we have it all in place now; someone just needs  
>> to take
>> that last step and run a cron job that runs the Build commands. We  
>> also need
>> the website side of things sorted out I think.
>>
>> If you could make those things happen and take care of any issues  
>> that crop
>> up, that would be great.
>>
>
> Enlightening, thank you for pointing that out. I will have a look, I
> don't see a problem with the plan.
>
> Spiros

Didn't know it was that far along!  Any help pushing this along would  
be wonderful.

chris


From MEC at stowers-institute.org  Fri Sep 19 09:06:08 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Fri, 19 Sep 2008 08:06:08 -0500
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with
 Bioperl
In-Reply-To: <F1CAA89B-D7E9-40B3-9965-9636B4F5F852@bioperl.org>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
	<F1CAA89B-D7E9-40B3-9965-9636B4F5F852@bioperl.org>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD5867@exchmb-02.stowers-institute.org>

Jason,

Yes .... Biomart .... If I remember correctly, at the time I wrote the script, the problem with using biomart interactively for this task was that though you could query for genes or transcripts by affy id, the results would not include the term you queried with, so, you just get a list of genes that match any of your affyids without knowing which goes with which.

But perhaps I was wrong.  Certainly I see now that it is possible interactively to return the affyid for any gene for many standard probesets.

Cheers,

Malcolm Cook

-----Original Message-----
From: Jason Stajich [mailto:jason.stajich at gmail.com] On Behalf Of Jason Stajich
Sent: Thursday, September 18, 2008 4:52 PM
To: Cook, Malcolm
Cc: 'Gundala Viswanath'; 'bioperl-l at lists.open-bio.org'
Subject: Re: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with Bioperl

seems like something that biomart was designed for? There is a scripting interface too.
http://biomart.org/

On Sep 18, 2008, at 2:20 PM, Cook, Malcolm wrote:

> Gundala,
>
> Here is an option - if you want a script...
>
> http://research.stowers-institute.org/mec/software/scripts/affyprobese
> t2ensg/
>
> It is not bioperl.   It is perl.  It uses DBI to query the ensembl
> MySQL database using SQL.  It may be outdated due to changes in
> Ensembl schema.
>
> Good luck,
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org
> ] On Behalf Of Gundala Viswanath
> Sent: Thursday, September 18, 2008 3:52 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
> with Bioperl
>
> Dear all,
>
> Is there a way I can convert such EnSeMBL probe names into Gene Symbol
> with BioPerl?
>
> ENSG00000000003_at
> ENSG00000000005_at
> ENSG00000000419_at
> ENSG00000000457_at
> ENSG00000000460_at
> ENSG00000000938_at
> ENSG00000000971_at
> ENSG00000001036_at
> ENSG00000001084_at
> ENSG00000001167_at
> ENSG00000001461_at
> ENSG00000001497_at
> ENSG00000001561_at
> ... etc ...
>
> Or perhaps there is a flat file for conversion?
>
>
>
> - Gundala Viswanath
> Jakarta - Indonesia
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org






From MEC at stowers-institute.org  Fri Sep 19 09:09:00 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Fri, 19 Sep 2008 08:09:00 -0500
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
	with	Bioperl
In-Reply-To: <0F56A0A4-AE10-4930-B479-C4D0818EAC7A@illinois.edu>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
	<0F56A0A4-AE10-4930-B479-C4D0818EAC7A@illinois.edu>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD5868@exchmb-02.stowers-institute.org>


Chris is right- the Ensembl perl API works fine. If you care to go this route and want to crib the code, you will see that my script has a commented out implementation using Ensembl perl API - it suffered from being MUCH TOO SLOOOOOOOOOO - accessing the tables directly was MUCH faster (unpublished correspondance with self)

However, the API is much more likely to be backwards compatible in the face of database schema changes at Ensembl....

Malcolm Cook

-----Original Message-----
From: Chris Fields [mailto:cjfields at illinois.edu]
Sent: Thursday, September 18, 2008 4:48 PM
To: Cook, Malcolm
Cc: 'Gundala Viswanath'; 'bioperl-l at lists.open-bio.org'
Subject: Re: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with Bioperl

You can probably use the Ensembl perl API alone or in combination with bioperl.  I'm not sure it is working with the latest code (bioperl- live), but it's worth a try:

http://www.ensembl.org/info/using/api/core/core_tutorial.html
http://www.bioperl.org/wiki/HOWTO:Getting_Genomic_Sequences#Using_the_Perl_API_at_ENSEMBL

chris

On Sep 18, 2008, at 4:20 PM, Cook, Malcolm wrote:

> Gundala,
>
> Here is an option - if you want a script...
>
> http://research.stowers-institute.org/mec/softyware/scripts/affyprobese
> t2ensg/
>
> It is not bioperl.   It is perl.  It uses DBI to query the ensembl
> MySQL database using SQL.  It may be outdated due to changes in
> Ensembl schema.
>
> Good luck,
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org
> ] On Behalf Of Gundala Viswanath
> Sent: Thursday, September 18, 2008 3:52 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
> with Bioperl
>
> Dear all,
>
> Is there a way I can convert such EnSeMBL probe names into Gene Symbol
> with BioPerl?
>
> ENSG00000000003_at
> ENSG00000000005_at
> ENSG00000000419_at
> ENSG00000000457_at
> ENSG00000000460_at
> ENSG00000000938_at
> ENSG00000000971_at
> ENSG00000001036_at
> ENSG00000001084_at
> ENSG00000001167_at
> ENSG00000001461_at
> ENSG00000001497_at
> ENSG00000001561_at
> ... etc ...
>
> Or perhaps there is a flat file for conversion?
>
>
>
> - Gundala Viswanath
> Jakarta - Indonesia
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign







From mauricio at open-bio.org  Fri Sep 19 10:06:22 2008
From: mauricio at open-bio.org (Mauricio Herrera Cuadra)
Date: Fri, 19 Sep 2008 09:06:22 -0500
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <0C6AAAEE-5D80-4102-B03D-FE0C045492AA@illinois.edu>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>	<48D391BD.5010105@sendu.me.uk>	<bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
	<0C6AAAEE-5D80-4102-B03D-FE0C045492AA@illinois.edu>
Message-ID: <48D3B1DE.7070505@open-bio.org>

Sorry guys, this has been my fault due to lack of time. I have a very 
old ticket waiting for me at the OBF Helpdesk to get the website side of 
things done. Spiros, I have some spare time today to try setting it up, 
assign it to me in the wiki list if you want, I'll send an update in a 
couple of days.

Thanks,
Mauricio.


Chris Fields wrote:
> 
> On Sep 19, 2008, at 6:51 AM, Spiros Denaxas wrote:
> 
>> On Fri, Sep 19, 2008 at 12:49 PM, Sendu Bala <bix at sendu.me.uk> wrote:
>>> Spiros Denaxas wrote:
>>>>
>>>> There are currently several very good CPAN modules that do this, like
>>>> Devel::Cover [2]. Is there any objection if I kick this off and start
>>>> doing some work, aiming into creating a more detailed report on code
>>>> coverage using the current HEAD and test suite?
>>>
>>> You should read our previous discussion here:
>>> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/14586/focus=14588 
>>>
>>>
>>> Basically I think we have it all in place now; someone just needs to 
>>> take
>>> that last step and run a cron job that runs the Build commands. We 
>>> also need
>>> the website side of things sorted out I think.
>>>
>>> If you could make those things happen and take care of any issues 
>>> that crop
>>> up, that would be great.
>>>
>>
>> Enlightening, thank you for pointing that out. I will have a look, I
>> don't see a problem with the plan.
>>
>> Spiros
> 
> Didn't know it was that far along!  Any help pushing this along would be 
> wonderful.
> 
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 


From heikki at sanbi.ac.za  Fri Sep 19 12:22:23 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Fri, 19 Sep 2008 18:22:23 +0200
Subject: [Bioperl-l] phylogeny-trait association methods into BioPerl
In-Reply-To: <200809101332.07137.heikki@sanbi.ac.za>
References: <200809101332.07137.heikki@sanbi.ac.za>
Message-ID: <200809191822.23503.heikki@sanbi.ac.za>

The code is now in SVN. Bio::Tree::TreeFunctionsI::add_trait() can be used to 
set trait values in a tree.

Enjoy,

   -Heikki

On Wednesday 10 September 2008 13:32:06 Heikki Lehvaslaiho wrote:
> FYI,
>
> I've been recently writing code to analyse phylogeny-trait associations.
> These traits are typically geographical location of the sequence but they
> can be any phenotypic characters associated with the sequences.
>
> This involves trees, i.e. Bio::Tree::Tree and Bio::Tree::Node objects and
> strings describing the traits. I've been using tags to store trait values
> within nodes. The tag methods are:
>
> Bio::Tree::Node::add_tag_value
> Bio::Tree::Node::get_all_tags
> Bio::Tree::Node::get_tag_values
> Bio::Tree::Node::has_tag
> Bio::Tree::Node::remove_all_tags
> Bio::Tree::Node::remove_tag
>
> Question: Is  there any particular reason why there is no
> set_tag_value(scalar|@array) method?
>
> I am getting tired of writing:
>   $node->remove_tag($key);
>   map {$node->add_tag_value($key)} @values ;
> so I am going to implement that unless there is are strong objections.
>
> Otherwise it has been smooth sailing. I am going to add
> Bio::Tree::TreeFunctions::is_binary() and start populating
> Bio::Tree::Statistics soon with these methods:
>
> ps() - Parsimony Score (PS) from Fitch 1971
> ai() - Association index (AI) of Whang et al. 2001
> mc() - Monophyletic Clade (MC) size statistics by Salemi at al. 2005
> cherries() - number of leaf node pairs
>
> If you have any comments, please feel free to post them here.
>
>     -Heikki

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From hartzell at alerce.com  Tue Sep 23 17:16:48 2008
From: hartzell at alerce.com (George Hartzell)
Date: Tue, 23 Sep 2008 14:16:48 -0700
Subject: [Bioperl-l] confused about version numbers.
Message-ID: <18649.23744.832478.551299@almost.alerce.com>


I recently realized that I needed a feature from
Bio::Search::Hit::GenericHit that exists in the svn trunk but isn't in
the CPAN's version bioperl-1.5.2_102.

I thought I'd just specify a version number in my Build.PL and that
way I could sleep soundly.

But, it looks like $Version in CPAN's Bio::Root::Version is
1.005002_102 while in the trunk it's 1.005002_100.

What's the proper way for a Build.PL to be sure that it has a current
bioperl?

g.


From sac at bioperl.org  Tue Sep 23 18:05:15 2008
From: sac at bioperl.org (Steve Chervitz)
Date: Tue, 23 Sep 2008 15:05:15 -0700
Subject: [Bioperl-l] confused about version numbers.
In-Reply-To: <18649.23744.832478.551299@almost.alerce.com>
References: <18649.23744.832478.551299@almost.alerce.com>
Message-ID: <8f200b4c0809231505p6b3f9e77i278f52bcc355489@mail.gmail.com>

Here's the general recommendation from the FAQ:

http://bio.perl.org/wiki/FAQ#How_can_I_tell_what_version_of_BioPerl_is_installed.3F

Not sure the recommended way to do this from a Build.PL. You could so such
checking within a BEGIN block in your Build.PL, perhaps.

Steve

On Tue, Sep 23, 2008 at 2:16 PM, George Hartzell <hartzell at alerce.com>wrote:

>
> I recently realized that I needed a feature from
> Bio::Search::Hit::GenericHit that exists in the svn trunk but isn't in
> the CPAN's version bioperl-1.5.2_102.
>
> I thought I'd just specify a version number in my Build.PL and that
> way I could sleep soundly.
>
> But, it looks like $Version in CPAN's Bio::Root::Version is
> 1.005002_102 while in the trunk it's 1.005002_100.
>
> What's the proper way for a Build.PL to be sure that it has a current
> bioperl?
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From bix at sendu.me.uk  Tue Sep 23 17:51:57 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 23 Sep 2008 22:51:57 +0100
Subject: [Bioperl-l] confused about version numbers.
In-Reply-To: <18649.23744.832478.551299@almost.alerce.com>
References: <18649.23744.832478.551299@almost.alerce.com>
Message-ID: <48D964FD.7060007@sendu.me.uk>

George Hartzell wrote:
> I recently realized that I needed a feature from
> Bio::Search::Hit::GenericHit that exists in the svn trunk but isn't in
> the CPAN's version bioperl-1.5.2_102.
> 
> I thought I'd just specify a version number in my Build.PL and that
> way I could sleep soundly.
> 
> But, it looks like $Version in CPAN's Bio::Root::Version is
> 1.005002_102 while in the trunk it's 1.005002_100.

Fixed. It's now 1.005002_103.


> What's the proper way for a Build.PL to be sure that it has a current
> bioperl?

Your method was sound, I think.


From cjfields at illinois.edu  Tue Sep 23 21:23:25 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 23 Sep 2008 20:23:25 -0500
Subject: [Bioperl-l] Bio::Species bug,
	was  Species.t tests failing with bioperl-live
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
Message-ID: <CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>

I'm reposting this in case it was lost (or forgotten).  I'll file it  
as a bug if it's not addressed fairly soonish, but I would consider  
this a serious blocker for a 1.6 release.  Any help would be   
appreciated.

The last commit to Bio::Species, which was an effort to fix a memory  
leak, has unfortunately broken Species.t tests.  The relevant commit  
used weaken(); my guess is something is being garbage collected way  
too early.  Any ideas?

chris

Begin forwarded message:

> From: Chris Fields <cjfields at illinois.edu>
> Date: September 18, 2008 7:15:03 AM CDT
> To: Chris Fields <cjfields at illinois.edu>
> Cc: BioPerl List <bioperl-l at lists.open-bio.org>
> Subject: Re: [Bioperl-l] Species.t tests failing with bioperl-live
>
>
> On Sep 18, 2008, at 7:07 AM, Chris Fields wrote:
>
>> I'm getting a couple of failed tests with
>
>
> Um, that was supposed to be:
>
> I'm getting a couple of failed tests with Species.t; I think these  
> are due to the last commit to Bio::Species:
>
> http://code.open-bio.org/svnweb/index.cgi/bioperl/revision/?rev=14793
>
> Tests pass after commenting out that line.
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




From Caroline.Johnston at iop.kcl.ac.uk  Wed Sep 24 10:19:05 2008
From: Caroline.Johnston at iop.kcl.ac.uk (Johnston, Caroline)
Date: Wed, 24 Sep 2008 15:19:05 +0100
Subject: [Bioperl-l] Using Storable with SeqFeatures
Message-ID: <5626ED9CB91C814197079FB9940312E506445F9B@MAIL.bc.iop.kcl.ac.uk>

Hello.

I'm trying to use Storable to save a Bio::Seq object and Storable seems to be having a weird problem dealing with freezing and thawing the code ref to Bio::SeqFeature::Generic cleanup_generic. If I change one line (931) in that function from

    foreach my $t ( keys %{$self->{'_gsf_tag_hash'} || {} } ) {
                                                    ------
 to

    foreach my $t ( keys %{$self->{'_gsf_tag_hash'} } ) {

it works fine. I've pasted an example script at http://sial.org/pbot/32320.

Any ideas why this syntax would break Storable? Would wrapping the foreach in an if(defined $self->{'_gsf_tag_hash'}) serve to replace the || {} ?

I get the same problem using Bio::Root::Storable.

Cxx 



From cain.cshl at gmail.com  Wed Sep 24 18:00:35 2008
From: cain.cshl at gmail.com (Scott Cain)
Date: Wed, 24 Sep 2008 18:00:35 -0400
Subject: [Bioperl-l] genbank2gff.pl choking on CONTIG sections
Message-ID: <536f21b00809241500x5414289ayea143c7124758f5e@mail.gmail.com>

Hi all,

The BioPerl script bp_genbank2gff.pl, which will either convert a
Genbank record to GFF or load it directly to a Bio::DB::GFF database,
is choking on GenBank records with CONTIG sections.  Since I don't
think these would ever be useful for generating GFF or loading into a
database (ie, the user will want to get all of the features on the
parts, not know what the parts are), is there a way to force a
Bio::DB::WebDBSeqI/Bio::DB::BioFetch to get the full record (like
specifying view=gbwithparts in the url at ncbi)?

Thanks,
Scott


-- 
------------------------------------------------------------------------
Scott Cain, Ph. D. cain.cshl at gmail.com
GMOD Coordinator (http://gmod.org/) 216-392-3087
Cold Spring Harbor Laboratory


From jason at bioperl.org  Wed Sep 24 19:05:18 2008
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 24 Sep 2008 16:05:18 -0700
Subject: [Bioperl-l] genbank2gff.pl choking on CONTIG sections
In-Reply-To: <536f21b00809241500x5414289ayea143c7124758f5e@mail.gmail.com>
References: <536f21b00809241500x5414289ayea143c7124758f5e@mail.gmail.com>
Message-ID: <5D6FEF22-76B7-4770-B749-A643AFF99169@bioperl.org>

It should already if it is using Bio::DB::GenBank -- do you have  
example of a fail?  There seems to be some defaulting to EMBL for the  
source in the biofetch code so it might be worth twiddling.

from Bio::DB::GenBank

Note that when querying for GenBank accessions starting with 'NT_' you
will need to call $gb->request_format('fasta') beforehand, because
in GenBank format (the default) the sequence part will be left out
(the reason is that NT contigs are rather annotation with references
to clones).

Some work has been done to automatically detect and retrieve whole NT_  
clones
when the data is in that format (NCBI RefSeq clones). The former  
behavior prior
to bioperl 1.6 was to retrieve these from EBI, but now these are  
retrieved
directly from NCBI. The older behavior can be regained by setting the
'redirect_refseq' flag to a value evaluating to TRUE.


On Sep 24, 2008, at 3:00 PM, Scott Cain wrote:

> Hi all,
>
> The BioPerl script bp_genbank2gff.pl, which will either convert a
> Genbank record to GFF or load it directly to a Bio::DB::GFF database,
> is choking on GenBank records with CONTIG sections.  Since I don't
> think these would ever be useful for generating GFF or loading into a
> database (ie, the user will want to get all of the features on the
> parts, not know what the parts are), is there a way to force a
> Bio::DB::WebDBSeqI/Bio::DB::BioFetch to get the full record (like
> specifying view=gbwithparts in the url at ncbi)?
>
> Thanks,
> Scott
>
>
> -- 
> ------------------------------------------------------------------------
> Scott Cain, Ph. D. cain.cshl at gmail.com
> GMOD Coordinator (http://gmod.org/) 216-392-3087
> Cold Spring Harbor Laboratory
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From hartzell at alerce.com  Thu Sep 25 01:17:54 2008
From: hartzell at alerce.com (George Hartzell)
Date: Wed, 24 Sep 2008 22:17:54 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18651.7938.496813.710345@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > George,
 > 
 > This is an error from my side. Great that you have a fix already.
 > 
 > My only worry is the number of external dependencies in BioPerl. To limit 
 > these we have recoded number of functionalities into BioPerl-specific modules. 
 > Before you commit the fix, could you see if Bio::RangeI could be used or easily 
 > extended to be used instead of Set::IntSpan?
 > 
 > Thanks,
 > 
 >    -Heikki
 > 
 > On Friday 05 September 2008 21:01:35 George Hartzell wrote:
 > > Hi all,
 > >
 > > Bio::Coordinate::Collection surprised me a bit.  At first I thought
 > > there was a bug, but it's clearly doing what it's supposed to.  Now
 > > I'm wondering if what it's supposed to be doing makes sense in some
 > > context, or if what I expected would be better functionality.
 > >
 > > t/CoordinateMapper.t sets up the following scenario:
 > >
 > > #
 > > # Collection
 > > #
 > > #         1   5     6   10
 > > #         |---|     |---|
 > > #-----|-----------------------
 > > #     1   5   9     15  19
 > > #         pair1     pair2
 > >
 > > Then goes on to do the following query:
 > >
 > >   # match more than two
 > >   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
 > >   ok $res = $transcribe->map($pos);
 > >   is $res->each_gap, 2;
 > >   is $res->each_match, 2;
 > >
 > > I was surprised to see that there were two gaps, one gene:10-19 and
 > > one from gene:5-14.  Looking at the code, what's really happening is
 > > that, for the exon1 mapper there's match with gene:5-9 and a gap with
 > > gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
 > > match with gene:15-19.  All four Result's just get tossed into the
 > > return value.
 > >
 > > The result my intuition wants is that there are two matches (gene:5-9
 > > with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
 > >
 > > Yes, I guess that I could just synthesize these myself from the result
 > > in my app.
 > >
 > > It still seems that the current result is a bug though, since there's
 > > no way of knowing when you're walking through $res->each_Location that
 > > the first "gap" is with respect to the exon1 mapper and that the
 > > second "gap" is with respect to the exon2 mapper.  The gaps are
 > > meaningless.
 > >
 > > I "fixed" it to work the way I think it should (two matches, one
 > > gap).  I actually extended the test case a bit so that there's a
 > > multi-base gap, a match, another multibase-gap, another match, then a
 > > single base gap (just to make sure I got that right...).  I had to
 > > touch up the test file a bit to account for my new test.
 > >
 > > The gaps that I return have a strand of 'undef', which seems to be The
 > > Right Thing.  There's also a bit of funny business where I hang onto
 > > the seq_id of the gapped sequence.  It assumes that the "in" sequence
 > > is the same for all of the mappers.  This seems safe since otherwise
 > > the entire query is kind of weird....
 > >
 > > There's a patch to todays svn head at:
 > >
 > >   http://shrimp.alerce.com/bioperl/collection-diffs.txt
 > >
 > > The patch changes Build.PL to include a dependency on Set::IntSpan,
 > > CoordinateMapper.t to update the tests, and
 > > Bio/CoordinateMapper/Collection.pm for the new code.
 > >
 > > Who's code would this break.
 > >
 > > If anyone's relying on the current behaviour re: gaps, what's the
 > > situation in which you find it useful?
 > >
 > > Thanks!
 > >
 > > g.
 > [...]

So, I'm out of round 'tuit's trying to think of an _easy_ way to do
this using Range/RangeI.  I might just not be thinking clearly, and
I've definitely trained myself to solve these kinds of problems with
Set::IntSpan problems so I may just be waving my favorite hammer
around.

There may also be a BioPerl native way to do it using some fancier
object than a RangeI (split locations?).

It's easy to get the set of gaps for each pair, but is there already
something that takes the intersection of a set of non-intersecting
Range's?

g.


From hartzell at alerce.com  Thu Sep 25 01:17:54 2008
From: hartzell at alerce.com (George Hartzell)
Date: Wed, 24 Sep 2008 22:17:54 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18651.7938.496813.710345@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > George,
 > 
 > This is an error from my side. Great that you have a fix already.
 > 
 > My only worry is the number of external dependencies in BioPerl. To limit 
 > these we have recoded number of functionalities into BioPerl-specific modules. 
 > Before you commit the fix, could you see if Bio::RangeI could be used or easily 
 > extended to be used instead of Set::IntSpan?
 > 
 > Thanks,
 > 
 >    -Heikki
 > 
 > On Friday 05 September 2008 21:01:35 George Hartzell wrote:
 > > Hi all,
 > >
 > > Bio::Coordinate::Collection surprised me a bit.  At first I thought
 > > there was a bug, but it's clearly doing what it's supposed to.  Now
 > > I'm wondering if what it's supposed to be doing makes sense in some
 > > context, or if what I expected would be better functionality.
 > >
 > > t/CoordinateMapper.t sets up the following scenario:
 > >
 > > #
 > > # Collection
 > > #
 > > #         1   5     6   10
 > > #         |---|     |---|
 > > #-----|-----------------------
 > > #     1   5   9     15  19
 > > #         pair1     pair2
 > >
 > > Then goes on to do the following query:
 > >
 > >   # match more than two
 > >   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
 > >   ok $res = $transcribe->map($pos);
 > >   is $res->each_gap, 2;
 > >   is $res->each_match, 2;
 > >
 > > I was surprised to see that there were two gaps, one gene:10-19 and
 > > one from gene:5-14.  Looking at the code, what's really happening is
 > > that, for the exon1 mapper there's match with gene:5-9 and a gap with
 > > gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
 > > match with gene:15-19.  All four Result's just get tossed into the
 > > return value.
 > >
 > > The result my intuition wants is that there are two matches (gene:5-9
 > > with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
 > >
 > > Yes, I guess that I could just synthesize these myself from the result
 > > in my app.
 > >
 > > It still seems that the current result is a bug though, since there's
 > > no way of knowing when you're walking through $res->each_Location that
 > > the first "gap" is with respect to the exon1 mapper and that the
 > > second "gap" is with respect to the exon2 mapper.  The gaps are
 > > meaningless.
 > >
 > > I "fixed" it to work the way I think it should (two matches, one
 > > gap).  I actually extended the test case a bit so that there's a
 > > multi-base gap, a match, another multibase-gap, another match, then a
 > > single base gap (just to make sure I got that right...).  I had to
 > > touch up the test file a bit to account for my new test.
 > >
 > > The gaps that I return have a strand of 'undef', which seems to be The
 > > Right Thing.  There's also a bit of funny business where I hang onto
 > > the seq_id of the gapped sequence.  It assumes that the "in" sequence
 > > is the same for all of the mappers.  This seems safe since otherwise
 > > the entire query is kind of weird....
 > >
 > > There's a patch to todays svn head at:
 > >
 > >   http://shrimp.alerce.com/bioperl/collection-diffs.txt
 > >
 > > The patch changes Build.PL to include a dependency on Set::IntSpan,
 > > CoordinateMapper.t to update the tests, and
 > > Bio/CoordinateMapper/Collection.pm for the new code.
 > >
 > > Who's code would this break.
 > >
 > > If anyone's relying on the current behaviour re: gaps, what's the
 > > situation in which you find it useful?
 > >
 > > Thanks!
 > >
 > > g.
 > [...]

So, I'm out of round 'tuit's trying to think of an _easy_ way to do
this using Range/RangeI.  I might just not be thinking clearly, and
I've definitely trained myself to solve these kinds of problems with
Set::IntSpan problems so I may just be waving my favorite hammer
around.

There may also be a BioPerl native way to do it using some fancier
object than a RangeI (split locations?).

It's easy to get the set of gaps for each pair, but is there already
something that takes the intersection of a set of non-intersecting
Range's?

g.


From tatedger at googlemail.com  Thu Sep 25 11:23:46 2008
From: tatedger at googlemail.com (john paul)
Date: Thu, 25 Sep 2008 16:23:46 +0100
Subject: [Bioperl-l] Can't locate object method "get_dbxrefs"
Message-ID: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>

Hello guys,

I need to pick your brain on this. I was trying to load some sequences in a
fresh RH build using bioperl-db and got the following error:

[tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
--dbuser root --dbname biosql --namespace swissprot --format swiss
/home/tatedger/tmp/uniprot_sprot.dat  --testonly
Loading /home/tatedger/tmp/uniprot_sprot.dat ...
Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via package
"Bio::Ontology::Term" at
/usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
552, <GEN0> line 70.


I have seen some posts on this regard (
http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but it wasn't
clear to me what the solution would be.


My configuration:
- mysql version 4.1.7
- Red Hat Enterprise Linux ES release 4 (Nahant)

to install bioperl and bioperl-db I used the help found on the website
following
- cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
- svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
- biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.

bioperl-db  test 04 shows the same error.

[tatedger at localhost bioperl-db]$ perl t/04swiss.t
1..52
ok 1
ok 2
ok 3
ok 4
ok 5
Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
552, <GEN0> line 78.


my @INC file looks like
/usr/lib/perl5/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/5.8.5
/usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.5
/usr/lib/perl5/site_perl/5.8.4
/usr/lib/perl5/site_perl/5.8.3
/usr/lib/perl5/site_perl/5.8.2
/usr/lib/perl5/site_perl/5.8.1
/usr/lib/perl5/site_perl/5.8.0
/usr/lib/perl5/site_perl
/usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.5
/usr/lib/perl5/vendor_perl/5.8.4
/usr/lib/perl5/vendor_perl/5.8.3
/usr/lib/perl5/vendor_perl/5.8.2
/usr/lib/perl5/vendor_perl/5.8.1
/usr/lib/perl5/vendor_perl/5.8.0
/usr/lib/perl5/vendor_perl

What am I doing wrong? Could you help?

Thanks in advance for your help
Tom


From bosborne11 at verizon.net  Thu Sep 25 11:40:45 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Thu, 25 Sep 2008 11:40:45 -0400
Subject: [Bioperl-l] Can't locate object method "get_dbxrefs"
In-Reply-To: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
References: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
Message-ID: <2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>

John,

What does:

 >locate Bio/Ontology/Term.pm

Say?


Brian O.


On Sep 25, 2008, at 11:23 AM, john paul wrote:

> Hello guys,
>
> I need to pick your brain on this. I was trying to load some  
> sequences in a
> fresh RH build using bioperl-db and got the following error:
>
> [tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
> --dbuser root --dbname biosql --namespace swissprot --format swiss
> /home/tatedger/tmp/uniprot_sprot.dat  --testonly
> Loading /home/tatedger/tmp/uniprot_sprot.dat ...
> Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via  
> package
> "Bio::Ontology::Term" at
> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm  
> line
> 552, <GEN0> line 70.
>
>
> I have seen some posts on this regard (
> http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but  
> it wasn't
> clear to me what the solution would be.
>
>
> My configuration:
> - mysql version 4.1.7
> - Red Hat Enterprise Linux ES release 4 (Nahant)
>
> to install bioperl and bioperl-db I used the help found on the website
> following
> - cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
> - svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
> - biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.
>
> bioperl-db  test 04 shows the same error.
>
> [tatedger at localhost bioperl-db]$ perl t/04swiss.t
> 1..52
> ok 1
> ok 2
> ok 3
> ok 4
> ok 5
> Can't locate object method "get_dbxrefs" via package  
> "Bio::Ontology::Term"
> at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/ 
> PersistentObject.pm line
> 552, <GEN0> line 78.
>
>
> my @INC file looks like
> /usr/lib/perl5/5.8.5/i386-linux-thread-multi
> /usr/lib/perl5/5.8.5
> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.5
> /usr/lib/perl5/site_perl/5.8.4
> /usr/lib/perl5/site_perl/5.8.3
> /usr/lib/perl5/site_perl/5.8.2
> /usr/lib/perl5/site_perl/5.8.1
> /usr/lib/perl5/site_perl/5.8.0
> /usr/lib/perl5/site_perl
> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.5
> /usr/lib/perl5/vendor_perl/5.8.4
> /usr/lib/perl5/vendor_perl/5.8.3
> /usr/lib/perl5/vendor_perl/5.8.2
> /usr/lib/perl5/vendor_perl/5.8.1
> /usr/lib/perl5/vendor_perl/5.8.0
> /usr/lib/perl5/vendor_perl
>
> What am I doing wrong? Could you help?
>
> Thanks in advance for your help
> Tom
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From reece at harts.net  Thu Sep 25 12:15:23 2008
From: reece at harts.net (Reece Hart)
Date: Thu, 25 Sep 2008 09:15:23 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could
	DoWhatIMean	better	(w/ patch)
In-Reply-To: <18651.7938.496813.710345@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
	<18651.7938.496813.710345@almost.alerce.com>
Message-ID: <1222359323.15677.4.camel@snafu>

An embedded and charset-unspecified text was scrubbed...
Name: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20080925/ad977fb3/attachment-0002.pl>

From tatedger at googlemail.com  Thu Sep 25 12:27:29 2008
From: tatedger at googlemail.com (john paul)
Date: Thu, 25 Sep 2008 17:27:29 +0100
Subject: [Bioperl-l] Can't locate object method "get_dbxrefs"
In-Reply-To: <2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>
References: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
	<2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>
Message-ID: <efc5e9750809250927h741c083cl60dca40fee89280@mail.gmail.com>

On Thu, Sep 25, 2008 at 4:40 PM, Brian Osborne <bosborne11 at verizon.net>wrote:

> John,
>
> What does:
>
> >locate Bio/Ontology/Term.pm
>
> Say?
>

Silly me.

$ locate  Bio/Ontology/Term.pm
/usr/lib/perl5/site_perl/5.8.5/Bio/Ontology/Term.pm

and

 $ cat /usr/lib/perl5/site_perl/5.8.5/Bio/Ontology/Term.pm|grep get_dbxrefs
produced no answer

the latest version posted by Sendu on cpan says for that module

# $Id: Term.pm,v 1.31.4.1 2006/10/02 23:10:22 sendu Exp $
#
# BioPerl module for Bio::Ontology::Term
and the live version at (
http://code.open-bio.org/svnweb/index.cgi/bioperl/view/bioperl-live/trunk/Bio/Ontology/Term.pm
)

says
# $Id: Term.pm 14708 2008-06-10 00:08:17Z heikki $
#
# BioPerl module for Bio::Ontology::Term
#
I was using an old distribution from CPAN.

reinstalling from the main trunk

svn co svn://code.open-bio.org/bioperl/bioperl-live/trunk bioperl-live

solved the problem.

Thanks again

Tom


>
> Brian O.
>
>
>
> On Sep 25, 2008, at 11:23 AM, john paul wrote:
>
>   Hello guys,
>>
>> I need to pick your brain on this. I was trying to load some sequences in
>> a
>> fresh RH build using bioperl-db and got the following error:
>>
>> [tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
>> --dbuser root --dbname biosql --namespace swissprot --format swiss
>> /home/tatedger/tmp/uniprot_sprot.dat  --testonly
>> Loading /home/tatedger/tmp/uniprot_sprot.dat ...
>> Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via
>> package
>> "Bio::Ontology::Term" at
>> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
>> 552, <GEN0> line 70.
>>
>>
>> I have seen some posts on this regard (
>> http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but it
>> wasn't
>> clear to me what the solution would be.
>>
>>
>> My configuration:
>> - mysql version 4.1.7
>> - Red Hat Enterprise Linux ES release 4 (Nahant)
>>
>> to install bioperl and bioperl-db I used the help found on the website
>> following
>> - cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
>> - svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
>> - biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.
>>
>> bioperl-db  test 04 shows the same error.
>>
>> [tatedger at localhost bioperl-db]$ perl t/04swiss.t
>> 1..52
>> ok 1
>> ok 2
>> ok 3
>> ok 4
>> ok 5
>> Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
>> at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm
>> line
>> 552, <GEN0> line 78.
>>
>>
>> my @INC file looks like
>> /usr/lib/perl5/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/5.8.5
>> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.5
>> /usr/lib/perl5/site_perl/5.8.4
>> /usr/lib/perl5/site_perl/5.8.3
>> /usr/lib/perl5/site_perl/5.8.2
>> /usr/lib/perl5/site_perl/5.8.1
>> /usr/lib/perl5/site_perl/5.8.0
>> /usr/lib/perl5/site_perl
>> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.5
>> /usr/lib/perl5/vendor_perl/5.8.4
>> /usr/lib/perl5/vendor_perl/5.8.3
>> /usr/lib/perl5/vendor_perl/5.8.2
>> /usr/lib/perl5/vendor_perl/5.8.1
>> /usr/lib/perl5/vendor_perl/5.8.0
>> /usr/lib/perl5/vendor_perl
>>
>> What am I doing wrong? Could you help?
>>
>> Thanks in advance for your help
>> Tom
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>


From bix at sendu.me.uk  Thu Sep 25 13:12:22 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 25 Sep 2008 18:12:22 +0100
Subject: [Bioperl-l] Can't locate object method "get_dbxrefs"
In-Reply-To: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
References: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
Message-ID: <48DBC676.7090704@sendu.me.uk>

john paul wrote:
> - cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
> - svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
[...]
> Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
[...]
> What am I doing wrong? Could you help?

You're using the svb versuib bioperl-db but the release version of core 
(aka live). Don't mix and match; use the same version of both. So either 
install bioperl-live from svn as well, or get rid of you svn bioperl-db 
and install bioperl-db 1.5.2: 
http://bioperl.org/DIST/bioperl-db-1.5.2_100.tar.gz

I'd recommend using svn for both.


From hlapp at gmx.net  Thu Sep 25 18:24:37 2008
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu, 25 Sep 2008 18:24:37 -0400
Subject: [Bioperl-l] Using Storable with SeqFeatures
In-Reply-To: <5626ED9CB91C814197079FB9940312E506445F9B@MAIL.bc.iop.kcl.ac.uk>
References: <5626ED9CB91C814197079FB9940312E506445F9B@MAIL.bc.iop.kcl.ac.uk>
Message-ID: <517FAB85-BC7F-4135-B510-A2087267A314@gmx.net>


On Sep 24, 2008, at 10:19 AM, Johnston, Caroline wrote:

> Hello.
>
> I'm trying to use Storable to save a Bio::Seq object and Storable  
> seems to be having a weird problem dealing with freezing and thawing  
> the code ref to Bio::SeqFeature::Generic cleanup_generic. If I  
> change one line (931) in that function from
>
>    foreach my $t ( keys %{$self->{'_gsf_tag_hash'} || {} } ) {
>                                                    ------
> to
>
>    foreach my $t ( keys %{$self->{'_gsf_tag_hash'} } ) {
>
> it works fine. I've pasted an example script at http://sial.org/pbot/32320 
> .
>
> Any ideas why this syntax would break Storable? Would wrapping the  
> foreach in an if(defined $self->{'_gsf_tag_hash'}) serve to replace  
> the || {} ?

This should have exactly the same behavior as far as I can see.

Would you mind filing this as a bug repot with patch?

	-hilmar

>
>
> I get the same problem using Bio::Root::Storable.
>
> Cxx
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================





From mdschultz at ucdavis.edu  Thu Sep 25 18:06:02 2008
From: mdschultz at ucdavis.edu (Matthew Schultz)
Date: Thu, 25 Sep 2008 15:06:02 -0700 (PDT)
Subject: [Bioperl-l] BioPerl Installation Help
Message-ID: <200809252206.m8PM62Se004142@phaenicia.ucdavis.edu>


Hi Bioperl,

I've been trying to install bioperl on my Ubuntu machine I'm new to Bioperl
and don't have much experience in unix so I'm at a loss for what to do
next.  I tried to follow the instructions on using CPAN to install Bioperl,
but the installation failed.  At first I thought it was because of the few
warnings I received, but after trying the "force install" command without
success either I'm not so sure.  I was about to try the alternate option
using Build.pl, but am not sure where the Bioperl installation should go
(or will the Build.pl script place it in the right folder?).  Any help or
advice you could give would be appreciated.  Thanks for your time.

-Matt Schultz

P.S.  Here are the failed test results:

Failed Test        Stat Wstat Total Fail  Failed  List of Failed
-------------------------------------------------------------------------------
t/BioFetch_DB.t                  27    4  14.81%  8 20-21 27
t/DB.t                           78    2   2.56%  30-31
t/EMBL_DB.t                      15    3  20.00%  6 13-14
t/GuessSeqFormat.t               46    1   2.17%  11
t/InterProParser.t    2   512    47    1   2.13%  2
t/tutorial.t          2   512    21    6  28.57%  19-21
18 subtests skipped.
Failed 6/179 test scripts, 96.65% okay. 14/8122 subtests failed, 99.83% okay.
make: *** [test_dynamic] Error 255
  /usr/bin/make test -- NOT OK
Running make install
  make test had returned bad status, won't install without force



From caroline.johnston at iop.kcl.ac.uk  Thu Sep 25 23:19:38 2008
From: caroline.johnston at iop.kcl.ac.uk (Caroline)
Date: Fri, 26 Sep 2008 04:19:38 +0100
Subject: [Bioperl-l] Using Storable with SeqFeatures
In-Reply-To: <517FAB85-BC7F-4135-B510-A2087267A314@gmx.net>
References: <5626ED9CB91C814197079FB9940312E506445F9B@MAIL.bc.iop.kcl.ac.uk>
	<517FAB85-BC7F-4135-B510-A2087267A314@gmx.net>
Message-ID: <1222399178.18153.0.camel@clive>

On Thu, 2008-09-25 at 18:24 -0400, Hilmar Lapp wrote:

> Would you mind filing this as a bug repot with patch?
> 
> 	-hilmar
> 

Done, I think. I haven't used Bugzilla before, so give me a shout if I
haven't submitted it properly.

Cxx


From hartzell at alerce.com  Fri Sep 26 00:25:08 2008
From: hartzell at alerce.com (George Hartzell)
Date: Thu, 25 Sep 2008 21:25:08 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18652.25636.694188.904749@almost.alerce.com>


What would people think about a Bio::Range::Set (and/or SetI) which
behaves like Set::Intspan (which alone would be a waste of effort) but
also embraces RangeI's concepts of stranded-ness and
strong/weak/unspecified comparisons?

g. (who's sometimes thinks that 'tuits grow on trees...)



From hartzell at alerce.com  Fri Sep 26 00:25:08 2008
From: hartzell at alerce.com (George Hartzell)
Date: Thu, 25 Sep 2008 21:25:08 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18652.25636.694188.904749@almost.alerce.com>


What would people think about a Bio::Range::Set (and/or SetI) which
behaves like Set::Intspan (which alone would be a waste of effort) but
also embraces RangeI's concepts of stranded-ness and
strong/weak/unspecified comparisons?

g. (who's sometimes thinks that 'tuits grow on trees...)



From heikki at sanbi.ac.za  Fri Sep 26 02:25:54 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Fri, 26 Sep 2008 08:25:54 +0200
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better (w/ patch)
In-Reply-To: <18652.25636.694188.904749@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
	<18652.25636.694188.904749@almost.alerce.com>
Message-ID: <200809260825.54638.heikki@sanbi.ac.za>

George,

Bio::Range::Set sounds like great idea.

Sorry to put you in a tight spot with the request for keeping external 
dependencies to the minimum. I should have stressed that follow it only if it 
can be done easily. If you look at the actual dependencies of BioPerl at the 
moment, you'll realize not many have to patience to follow that guideline.

The main thing is the get working code in. If you then have the energy to code 
a module that gets rid of the dependency, that's an added bonus.

Thanks for your effort,

 Yours,
    -Heikki



On Friday 26 September 2008 06:25:08 George Hartzell wrote:
> What would people think about a Bio::Range::Set (and/or SetI) which
> behaves like Set::Intspan (which alone would be a waste of effort) but
> also embraces RangeI's concepts of stranded-ness and
> strong/weak/unspecified comparisons?
>
> g. (who's sometimes thinks that 'tuits grow on trees...)

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From tatedger at googlemail.com  Thu Sep 25 12:27:29 2008
From: tatedger at googlemail.com (john paul)
Date: Thu, 25 Sep 2008 17:27:29 +0100
Subject: [Bioperl-l] [BioSQL-l] Can't locate object method "get_dbxrefs"
In-Reply-To: <2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>
References: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
	<2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>
Message-ID: <efc5e9750809250927h741c083cl60dca40fee89280@mail.gmail.com>

On Thu, Sep 25, 2008 at 4:40 PM, Brian Osborne <bosborne11 at verizon.net>wrote:

> John,
>
> What does:
>
> >locate Bio/Ontology/Term.pm
>
> Say?
>

Silly me.

$ locate  Bio/Ontology/Term.pm
/usr/lib/perl5/site_perl/5.8.5/Bio/Ontology/Term.pm

and

 $ cat /usr/lib/perl5/site_perl/5.8.5/Bio/Ontology/Term.pm|grep get_dbxrefs
produced no answer

the latest version posted by Sendu on cpan says for that module

# $Id: Term.pm,v 1.31.4.1 2006/10/02 23:10:22 sendu Exp $
#
# BioPerl module for Bio::Ontology::Term
and the live version at (
http://code.open-bio.org/svnweb/index.cgi/bioperl/view/bioperl-live/trunk/Bio/Ontology/Term.pm
)

says
# $Id: Term.pm 14708 2008-06-10 00:08:17Z heikki $
#
# BioPerl module for Bio::Ontology::Term
#
I was using an old distribution from CPAN.

reinstalling from the main trunk

svn co svn://code.open-bio.org/bioperl/bioperl-live/trunk bioperl-live

solved the problem.

Thanks again

Tom


>
> Brian O.
>
>
>
> On Sep 25, 2008, at 11:23 AM, john paul wrote:
>
>   Hello guys,
>>
>> I need to pick your brain on this. I was trying to load some sequences in
>> a
>> fresh RH build using bioperl-db and got the following error:
>>
>> [tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
>> --dbuser root --dbname biosql --namespace swissprot --format swiss
>> /home/tatedger/tmp/uniprot_sprot.dat  --testonly
>> Loading /home/tatedger/tmp/uniprot_sprot.dat ...
>> Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via
>> package
>> "Bio::Ontology::Term" at
>> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
>> 552, <GEN0> line 70.
>>
>>
>> I have seen some posts on this regard (
>> http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but it
>> wasn't
>> clear to me what the solution would be.
>>
>>
>> My configuration:
>> - mysql version 4.1.7
>> - Red Hat Enterprise Linux ES release 4 (Nahant)
>>
>> to install bioperl and bioperl-db I used the help found on the website
>> following
>> - cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
>> - svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
>> - biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.
>>
>> bioperl-db  test 04 shows the same error.
>>
>> [tatedger at localhost bioperl-db]$ perl t/04swiss.t
>> 1..52
>> ok 1
>> ok 2
>> ok 3
>> ok 4
>> ok 5
>> Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
>> at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm
>> line
>> 552, <GEN0> line 78.
>>
>>
>> my @INC file looks like
>> /usr/lib/perl5/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/5.8.5
>> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.5
>> /usr/lib/perl5/site_perl/5.8.4
>> /usr/lib/perl5/site_perl/5.8.3
>> /usr/lib/perl5/site_perl/5.8.2
>> /usr/lib/perl5/site_perl/5.8.1
>> /usr/lib/perl5/site_perl/5.8.0
>> /usr/lib/perl5/site_perl
>> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.5
>> /usr/lib/perl5/vendor_perl/5.8.4
>> /usr/lib/perl5/vendor_perl/5.8.3
>> /usr/lib/perl5/vendor_perl/5.8.2
>> /usr/lib/perl5/vendor_perl/5.8.1
>> /usr/lib/perl5/vendor_perl/5.8.0
>> /usr/lib/perl5/vendor_perl
>>
>> What am I doing wrong? Could you help?
>>
>> Thanks in advance for your help
>> Tom
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>
_______________________________________________
BioSQL-l mailing list
BioSQL-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/biosql-l





From bix at sendu.me.uk  Fri Sep 26 04:26:36 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 26 Sep 2008 09:26:36 +0100
Subject: [Bioperl-l] Bio::Species bug,
 was  Species.t tests failing with bioperl-live
In-Reply-To: <CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
Message-ID: <48DC9CBC.1090909@sendu.me.uk>

Chris Fields wrote:
> The last commit to Bio::Species, which was an effort to fix a memory 
> leak, has unfortunately broken Species.t tests.  The relevant commit 
> used weaken(); my guess is something is being garbage collected way too 
> early.  Any ideas?

Was that last commit motivated by a bug report, and/or is there an 
associated test? If not, perhaps it can just be reverted?


From tatedger at googlemail.com  Thu Sep 25 11:23:46 2008
From: tatedger at googlemail.com (john paul)
Date: Thu, 25 Sep 2008 16:23:46 +0100
Subject: [Bioperl-l] [BioSQL-l] Can't locate object method "get_dbxrefs"
Message-ID: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>

Hello guys,

I need to pick your brain on this. I was trying to load some sequences in a
fresh RH build using bioperl-db and got the following error:

[tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
--dbuser root --dbname biosql --namespace swissprot --format swiss
/home/tatedger/tmp/uniprot_sprot.dat  --testonly
Loading /home/tatedger/tmp/uniprot_sprot.dat ...
Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via package
"Bio::Ontology::Term" at
/usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
552, <GEN0> line 70.


I have seen some posts on this regard (
http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but it wasn't
clear to me what the solution would be.


My configuration:
- mysql version 4.1.7
- Red Hat Enterprise Linux ES release 4 (Nahant)

to install bioperl and bioperl-db I used the help found on the website
following
- cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
- svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
- biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.

bioperl-db  test 04 shows the same error.

[tatedger at localhost bioperl-db]$ perl t/04swiss.t
1..52
ok 1
ok 2
ok 3
ok 4
ok 5
Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
552, <GEN0> line 78.


my @INC file looks like
/usr/lib/perl5/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/5.8.5
/usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.5
/usr/lib/perl5/site_perl/5.8.4
/usr/lib/perl5/site_perl/5.8.3
/usr/lib/perl5/site_perl/5.8.2
/usr/lib/perl5/site_perl/5.8.1
/usr/lib/perl5/site_perl/5.8.0
/usr/lib/perl5/site_perl
/usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.5
/usr/lib/perl5/vendor_perl/5.8.4
/usr/lib/perl5/vendor_perl/5.8.3
/usr/lib/perl5/vendor_perl/5.8.2
/usr/lib/perl5/vendor_perl/5.8.1
/usr/lib/perl5/vendor_perl/5.8.0
/usr/lib/perl5/vendor_perl

What am I doing wrong? Could you help?

Thanks in advance for your help
Tom
_______________________________________________
BioSQL-l mailing list
BioSQL-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/biosql-l





From cjfields at illinois.edu  Fri Sep 26 08:20:45 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 26 Sep 2008 07:20:45 -0500
Subject: [Bioperl-l] Bio::Species bug,
	was  Species.t tests failing with bioperl-live
In-Reply-To: <48DC9CBC.1090909@sendu.me.uk>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
	<48DC9CBC.1090909@sendu.me.uk>
Message-ID: <F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>


On Sep 26, 2008, at 3:26 AM, Sendu Bala wrote:

> Chris Fields wrote:
>> The last commit to Bio::Species, which was an effort to fix a  
>> memory leak, has unfortunately broken Species.t tests.  The  
>> relevant commit used weaken(); my guess is something is being  
>> garbage collected way too early.  Any ideas?
>
> Was that last commit motivated by a bug report, and/or is there an  
> associated test? If not, perhaps it can just be reverted?


Here's the relevant list thread:

http://thread.gmane.org/gmane.comp.lang.perl.bio.general/17541/focus=17550

The proposed patch was George's, which gets rid of the leak but causes  
the Species.t failures.  I say we revert the patch, but we'll still  
need to address the original problem addressed by Rutger Vos, i.e.  
that there is a significant memory leak in Bio::Species.

chris


From bix at sendu.me.uk  Fri Sep 26 09:45:21 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 26 Sep 2008 14:45:21 +0100
Subject: [Bioperl-l] Bio::Species bug,
 was  Species.t tests failing with bioperl-live
In-Reply-To: <F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
	<48DC9CBC.1090909@sendu.me.uk>
	<F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>
Message-ID: <48DCE771.8050001@sendu.me.uk>

Chris Fields wrote:
> 
> On Sep 26, 2008, at 3:26 AM, Sendu Bala wrote:
> 
>> Chris Fields wrote:
>>> The last commit to Bio::Species, which was an effort to fix a memory 
>>> leak, has unfortunately broken Species.t tests.  The relevant commit 
>>> used weaken(); my guess is something is being garbage collected way 
>>> too early.  Any ideas?
>>
>> Was that last commit motivated by a bug report, and/or is there an 
>> associated test? If not, perhaps it can just be reverted?
> 
> Here's the relevant list thread:
> 
> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/17541/focus=17550
> 
> The proposed patch was George's, which gets rid of the leak but causes 
> the Species.t failures.  I say we revert the patch, but we'll still need 
> to address the original problem addressed by Rutger Vos, i.e. that there 
> is a significant memory leak in Bio::Species.

Thanks. Rather than revert I've kludged it for now. Everything should be 
fine, it's just that I fear my solution isn't 'correct' and could mess 
things up we don't happen to have tests for.

See http://bugzilla.open-bio.org/show_bug.cgi?id=2594


From cjfields at illinois.edu  Fri Sep 26 10:54:55 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 26 Sep 2008 09:54:55 -0500
Subject: [Bioperl-l] Bio::Species bug,
	was  Species.t tests failing with bioperl-live
In-Reply-To: <48DCE771.8050001@sendu.me.uk>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
	<48DC9CBC.1090909@sendu.me.uk>
	<F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>
	<48DCE771.8050001@sendu.me.uk>
Message-ID: <9C49A138-CC07-4716-AFD6-FFB2F217C825@illinois.edu>


On Sep 26, 2008, at 8:45 AM, Sendu Bala wrote:

> Chris Fields wrote:
>> On Sep 26, 2008, at 3:26 AM, Sendu Bala wrote:
>>> Chris Fields wrote:
>>>> The last commit to Bio::Species, which was an effort to fix a  
>>>> memory leak, has unfortunately broken Species.t tests.  The  
>>>> relevant commit used weaken(); my guess is something is being  
>>>> garbage collected way too early.  Any ideas?
>>>
>>> Was that last commit motivated by a bug report, and/or is there an  
>>> associated test? If not, perhaps it can just be reverted?
>> Here's the relevant list thread:
>> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/17541/focus=17550
>> The proposed patch was George's, which gets rid of the leak but  
>> causes the Species.t failures.  I say we revert the patch, but  
>> we'll still need to address the original problem addressed by  
>> Rutger Vos, i.e. that there is a significant memory leak in  
>> Bio::Species.
>
> Thanks. Rather than revert I've kludged it for now. Everything  
> should be fine, it's just that I fear my solution isn't 'correct'  
> and could mess things up we don't happen to have tests for.
>
> See http://bugzilla.open-bio.org/show_bug.cgi?id=2594

Probably something that will go away when we quit using Bio::Species  
altogether (in favor of Bio::Taxon) after 1.6.   I'm not sure whether  
it will be worth the trouble, but it's worth discussing.

Anyway, I'm still a bit unfamiliar with some aspects of Bio::Species  
(and I'm pretty busy ATM) so it make take a few days.

chris


From hartzell at alerce.com  Fri Sep 26 20:21:41 2008
From: hartzell at alerce.com (George Hartzell)
Date: Fri, 26 Sep 2008 17:21:41 -0700
Subject: [Bioperl-l] Bio::Species bug,
	was  Species.t tests failing with bioperl-live
In-Reply-To: <9C49A138-CC07-4716-AFD6-FFB2F217C825@illinois.edu>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
	<48DC9CBC.1090909@sendu.me.uk>
	<F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>
	<48DCE771.8050001@sendu.me.uk>
	<9C49A138-CC07-4716-AFD6-FFB2F217C825@illinois.edu>
Message-ID: <18653.31893.762357.718899@almost.alerce.com>

Chris Fields writes:
 > 
 > On Sep 26, 2008, at 8:45 AM, Sendu Bala wrote:
 > 
 > > Chris Fields wrote:
 > >> On Sep 26, 2008, at 3:26 AM, Sendu Bala wrote:
 > >>> Chris Fields wrote:
 > >>>> The last commit to Bio::Species, which was an effort to fix a  
 > >>>> memory leak, has unfortunately broken Species.t tests.  The  
 > >>>> relevant commit used weaken(); my guess is something is being  
 > >>>> garbage collected way too early.  Any ideas?
 > >>>
 > >>> Was that last commit motivated by a bug report, and/or is there an  
 > >>> associated test? If not, perhaps it can just be reverted?
 > >> Here's the relevant list thread:
 > >> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/17541/focus=17550
 > >> The proposed patch was George's, which gets rid of the leak but  
 > >> causes the Species.t failures.  I say we revert the patch, but  
 > >> we'll still need to address the original problem addressed by  
 > >> Rutger Vos, i.e. that there is a significant memory leak in  
 > >> Bio::Species.
 > >
 > > Thanks. Rather than revert I've kludged it for now. Everything  
 > > should be fine, it's just that I fear my solution isn't 'correct'  
 > > and could mess things up we don't happen to have tests for.
 > >
 > > See http://bugzilla.open-bio.org/show_bug.cgi?id=2594
 > 
 > Probably something that will go away when we quit using Bio::Species  
 > altogether (in favor of Bio::Taxon) after 1.6.   I'm not sure whether  
 > it will be worth the trouble, but it's worth discussing.
 > 
 > Anyway, I'm still a bit unfamiliar with some aspects of Bio::Species  
 > (and I'm pretty busy ATM) so it make take a few days.

I can try to take a look at it again and see if there's a way to make
it work [more] correctly.

g.


From torsten.seemann at infotech.monash.edu.au  Sun Sep 28 21:46:06 2008
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Mon, 29 Sep 2008 11:46:06 +1000
Subject: [Bioperl-l] Retrieving taxonomy information from a GenBank file
In-Reply-To: <E078758D-D451-4973-A66D-2D6D829FCA53@bioperl.org>
References: <f03f40920809181427k168bfc3cu535c023949735cd9@mail.gmail.com>
	<E078758D-D451-4973-A66D-2D6D829FCA53@bioperl.org>
Message-ID: <a79f6a4b0809281846q380b8f77ha445f2112a2dae83@mail.gmail.com>

Anjan,

>> I'm using the following code to access the "ORGANISM" tag value for the
>> record NC_002526.
>> I get a value of 0 even though the ORGANISM tag  has a value.  Any idea
>> how
>> this might be corrected?
>> my $des= $seq->get_tag_values("ORGANISM");

> You want the species object ($seq->species)  -- see the Seq HOWTO, much of
> the Seq API is explained.
>  http://bioperl.org/wiki/HOWTO:Feature-Annotation#The_Species_Object

Of course Jason is correct here but there was still a semantic bug in
your code anyway which you should probably be aware of.
$seq->get_tag_values() returns an ARRAY which you are trying to store
in a SCALAR ($des). An array, in a scalar context, returns the SIZE of
the array, which in your case was zero (0) as there were no ORGANISM
tags. What you probably meant was:

my($des) = $seq->get_tag_values("ORGANISM");
# or
my $des = ($seq->get_tag_values("ORGANISM")) [ 0 ];

-- 
--Torsten Seemann
--Victorian Bioinformatics Consortium, Dept. Microbiology, Monash University
--Tel: 9905 9010 / 0422 923 024


From schwarz at tenaya.caltech.edu  Mon Sep 29 01:57:43 2008
From: schwarz at tenaya.caltech.edu (Erich Schwarz)
Date: Sun, 28 Sep 2008 22:57:43 -0700 (PDT)
Subject: [Bioperl-l] exporting contigs with CDSes, stored via Bio::DB::GFF,
 into individual GenBank records?
Message-ID: <Pine.LNX.4.64.0809282239110.26085@tenaya.caltech.edu>

Hi all,

    I have newly sequenced contigs, with CDS predictions, loaded 
into a Bio::DB::GFF-readable format (i.e., loaded into a MySQL 
database via Bio::DB::GFF).  I'd like to export each contig, with 
its annotated CDSes, into a single GenBank-formatted record for each 
contig (in order to be able submit this stuff to GenBank, without 
having to waste time with Sequin).  Is there some straightforward 
way of getting Bio::DB::GFF to do that?

    Some time ago, when I last had to decipher BioPerl, I came up 
with code that would let me export protein translations of the 
contigs' CDSes in GenBank format:

-------------------------------------------------------------------

#!/usr/bin/env perl

use strict;
use warnings;
use Bio::Seq;
use Bio::SeqIO;
use Bio::DB::GFF;

my $query_database = $ARGV[0];
my $dna = q{};
my $db = Bio::DB::GFF->new( -dsn => $query_database);

my $gb_file = 'example.gb';
my $seq_out = Bio::SeqIO->new( -file => ">$gb_file", -format => 'genbank', );

my @contigs = sort 
              map { $_->display_id }
              $db->features( -types => 'contig:assembly' );

foreach my $contig (@contigs) { 
    my $segment1 = $db->segment($contig);
    my @p_txs = $segment1->features('processed_transcript');
    foreach my $p_t (sort @p_txs) {
        $dna = q{};
        my @CDSes = $p_t->CDS;
        my $cds_name = $CDSes[0]->display_id();
        foreach my $cds (@CDSes) { 
            # $cds->seq == Bio::PrimarySeq, *not* plain nt seq.!
            $dna = $dna . $cds->seq->seq;
        }
        my $full_cds = Bio::Seq->new( -display_id => $cds_name, 
                                      -seq => $dna, );
        my $prot = $full_cds->translate;
        $seq_out->write_seq($prot);
    }
}

--------------------------------------------------------------------

    Returning to this, I tried using

    $db->get_Seq_by_id($contig)

to give me a Bio::Seq object for each contig (which I could then 
output into GenBank form), but that proved futile.

    I'm willing to work this out on my own if I have to, but if 
somebody can answer this in 30 seconds, it will save me a lot of 
time -- and be very appreciated!


--Erich 



From jason at bioperl.org  Tue Sep 30 12:48:17 2008
From: jason at bioperl.org (Jason Stajich)
Date: Tue, 30 Sep 2008 09:48:17 -0700
Subject: [Bioperl-l] exporting contigs with CDSes,
	stored via Bio::DB::GFF, into individual GenBank records?
In-Reply-To: <Pine.LNX.4.64.0809282239110.26085@tenaya.caltech.edu>
References: <Pine.LNX.4.64.0809282239110.26085@tenaya.caltech.edu>
Message-ID: <9880E773-812C-4F16-806F-7DB854346330@bioperl.org>

Eric.
CC-ing Gbrowse since this is regarding Gbrowse data-store.

I've definitely done exactly this although I remember I had to tweak  
the features a bit to make sure i had some some of the necessary stuff  
to sequin.


If you want to get a specific segment you just do what you already  
have in your code:
my $segment = $db->segment($contig_name);

Or you can iterate through all the features - depends on how you named  
your segments/contigs/chromsomes, I named mine "contig:scaffold" for  
type:source
  my $iterator = $dbh->get_seq_stream(-type=>'scaffold');
   while (my $s = $iterator->next_seq) {
   }

Now You *should* be able to pass this segment object to $seqio- 
 >write_seq($segment);
However Bio::DB::GFF::Feature doesn't implement the whole SeqI APi so  
you probably have to create your own sequence and move the features  
over:

y $iterator = $dbh->get_seq_stream(-type=>'scaffold');
   while (my $s = $iterator->next_seq) {
	my $seq = Bio::Seq->new();
	$seq->primary_seq($s->seq);
	for my $feature ( $s->features('processed_transcript') ) {
		my $f = Bio::SeqFeature::Generic->new(-location => $feature->location,
						      -primary_tag => $feature->primary_tag,
						      -source_tag  => $feature->primary_tag,
						      -score => $feature->score,
						      -seq_id => $feature->seq_id);
		$f->add_tag_value('locus_tag',$feature->name);
		# might also add all other tag/value pairs from this feature like  
DBXREF, etc.
		# derive a CDS feature from this feature as well.
		# perhaps derive a gene feature that only has start/end for the  
feature
		# might add a translation tag/value pair for CDS features
		$seq->add_SeqFeature($f);
	}
	$out->write_seq($seq);
  }

I suspect you'll have to edit the feature objects some to
a) remove the ones you don't want to output
b) add additional info like translation frame -- I think there is a  
slightly different way that NCBI wants things labeled wrt translation  
frame
c) add in other annotation information that may or may not be encoded  
as tag/values that

It is also possible I am missing some things in here, but hopefully it  
gets you started.  I think it would be quite useful for us to try and  
write a generic script for this but maybe focus on Bio::DB::SeqFeature  
dbs since it will be easier to assume that all the 3-level gene->mRNA- 
 >CDS/exon relationships will be explicitly specified.


-jason
On Sep 28, 2008, at 10:57 PM, Erich Schwarz wrote:

> Hi all,
>
>    I have newly sequenced contigs, with CDS predictions, loaded
> into a Bio::DB::GFF-readable format (i.e., loaded into a MySQL
> database via Bio::DB::GFF).  I'd like to export each contig, with
> its annotated CDSes, into a single GenBank-formatted record for each
> contig (in order to be able submit this stuff to GenBank, without
> having to waste time with Sequin).  Is there some straightforward
> way of getting Bio::DB::GFF to do that?
>
>    Some time ago, when I last had to decipher BioPerl, I came up
> with code that would let me export protein translations of the
> contigs' CDSes in GenBank format:
>
> -------------------------------------------------------------------
>
> #!/usr/bin/env perl
>
> use strict;
> use warnings;
> use Bio::Seq;
> use Bio::SeqIO;
> use Bio::DB::GFF;
>
> my $query_database = $ARGV[0];
> my $dna = q{};
> my $db = Bio::DB::GFF->new( -dsn => $query_database);
>
> my $gb_file = 'example.gb';
> my $seq_out = Bio::SeqIO->new( -file => ">$gb_file", -format =>  
> 'genbank', );
>
> my @contigs = sort
>              map { $_->display_id }
>              $db->features( -types => 'contig:assembly' );
>
> foreach my $contig (@contigs) {
>    my $segment1 = $db->segment($contig);
>    my @p_txs = $segment1->features('processed_transcript');
>    foreach my $p_t (sort @p_txs) {
>        $dna = q{};
>        my @CDSes = $p_t->CDS;
>        my $cds_name = $CDSes[0]->display_id();
>        foreach my $cds (@CDSes) {
>            # $cds->seq == Bio::PrimarySeq, *not* plain nt seq.!
>            $dna = $dna . $cds->seq->seq;
>        }
>        my $full_cds = Bio::Seq->new( -display_id => $cds_name,
>                                      -seq => $dna, );
>        my $prot = $full_cds->translate;
>        $seq_out->write_seq($prot);
>    }
> }
>
> --------------------------------------------------------------------
>
>    Returning to this, I tried using
>
>    $db->get_Seq_by_id($contig)
>
> to give me a Bio::Seq object for each contig (which I could then
> output into GenBank form), but that proved futile.
>
>    I'm willing to work this out on my own if I have to, but if
> somebody can answer this in 30 seconds, it will save me a lot of
> time -- and be very appreciated!
>
>
> --Erich
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From gilbertd at cricket.bio.indiana.edu  Tue Sep 30 13:23:56 2008
From: gilbertd at cricket.bio.indiana.edu (Don Gilbert)
Date: Tue, 30 Sep 2008 12:23:56 -0500 (EST)
Subject: [Bioperl-l] [Gmod-gbrowse]  exporting contigs with CDSes,
	stored via Bio::DB::GFF, into individual GenBank records?
Message-ID: <200809301723.m8UHNuc04293@cricket.bio.indiana.edu>


Eric,

If the Bio::DB::GFF database to Genbank submission route doesn't get you
where you want, you can also look at storing your data in a GMOD Chado
database, then using Bulkfiles to produce the Genbank Submission file set.

- Don Gilbert

Find a GenBank Submit output from Chado dbs in this tool release
http://eugenes.org/gmod/GMODTools/
  GMODTools-1.2b.zip      20-Jun-2008 

- adding (in progress) Genbank Submission table writer, 
  'bulkfiles -format=genbanktbl', with output suited
  to submit to NCBI as per these specifications
  http://www.ncbi.nlm.nih.gov/Genbank/eukaryotic_genome_submission.html

see also http://gmod.org/wiki/GMODTools
and this test case with genbank-submit output
 http://gmod.org/wiki/GMODTools_TestCase



From mauricio at open-bio.org  Tue Sep 30 17:56:04 2008
From: mauricio at open-bio.org (Mauricio Herrera Cuadra)
Date: Tue, 30 Sep 2008 16:56:04 -0500
Subject: [Bioperl-l] Test coverage for BioPerl now available
Message-ID: <48E2A074.5060305@open-bio.org>

Hi all,

Daily-updated test coverage reports are now available for those BioPerl 
packages which make use of the Build.PL mechanism (except bioperl-db):

http://bioperl.org/test-coverage/bioperl-live/
http://bioperl.org/test-coverage/bioperl-network/
http://bioperl.org/test-coverage/bioperl-run/

These reports will help us to know the current 'quality' of the code in 
SVN for most of the BioPerl modules. This idea was started by Nathan 
Haigh and Sendu a long time ago and it was my fault to not implement on 
time the necessary script to run the process on a daily basis, so 
apologies for that.

There are still a few things to be done in order to have this working as 
it should:

- Nathan, current Devel::Cover module from CPAN doesn't include the JS 
modifications to make table columns sortable. Do you know what happened 
to the code you contributed to the author for that?

- Reports could be generated for the rest of the BioPerl packages as 
soon as they're migrated to the Build.PL infrastructure. Anyone up for that?

- bioperl-db tests require BioSQL to be setup in the webserver machine, 
and the same goes for bioperl-run's tests with ALL of its dependencies. 
The bioperl.org site is co-hosted with all of the other OBF projects and 
that machine also takes care of other things (mailing lists, etc), so I 
would like your feedback on possible workarounds to not overload the 
server if we want to setup such test reports.

Thanks & regards,
Mauricio.


From jason at bioperl.org  Mon Sep  1 07:42:26 2008
From: jason at bioperl.org (Jason Stajich)
Date: Mon, 1 Sep 2008 00:42:26 -0700
Subject: [Bioperl-l] Bio::Tools::dpAlign feature request
In-Reply-To: <868888.19741.qm@web30406.mail.mud.yahoo.com>
References: <868888.19741.qm@web30406.mail.mud.yahoo.com>
Message-ID: <99A57523-94B3-4A56-A617-22675FA10AB8@bioperl.org>

Safe to ignore the tests.  Those that are failing aren't even test for  
Bio::Align::dpAlign - but were written to test a bug that has not been  
fixed in the EVD module if I remember correctly that is why they are  
marked in a TODO block, but I can't tell if the Test.pm is actually  
skipping these tests or not.

I think we probably need to deprecate some of these modules as there  
is no maintainer of Ewan's code in here.

At a minimum we need to modularlize the tests for these modules into  
separate t dir and fix the need for multiple Makefile.PL in here and  
probably move to Build.PL

-jason
On Aug 28, 2008, at 11:00 AM, Yee Man Chan wrote:

>
> Hi Alexie
>
> My understanding is that you can ignore these failures.
>
> I believe test cases 17-20 were added by Jason Stajich before I  
> added the feature you requested. I am not sure what he was doing  
> there.
>
> I suppose he can give you the definite answer to whether this is  
> something important or not.
>
> By the way, did you try out the new feature? Does it work?
>
> Thanks
> Yee Man
>
> --- On Thu, 8/28/08, Alexie Papanicolaou <apapanicolaou at ice.mpg.de>  
> wrote:
>
>> From: Alexie Papanicolaou <apapanicolaou at ice.mpg.de>
>> Subject: Re: Bio::Tools::dpAlign feature request
>> To: "Yee Man Chan" <ymc at yahoo.com>
>> Date: Thursday, August 28, 2008, 6:15 AM
>> hi
>>
>> is the version you emailed me newer or older than the
>> subversion one?
>>
>> i'm testing the subversion version for bioperl-ext and
>>
>> not ok 17 # TODO evalues vary based on platform, needs
>> fixing
>> #   Failed (TODO) test at test.pl line 156.
>> #          got: '2027805538'
>> #     expected: '1764904'
>> not ok 18 # TODO evalues vary based on platform, needs
>> fixing
>> #   Failed (TODO) test at test.pl line 157.
>> #          got: '-1375488148'
>> #     expected: '1764872'
>> not ok 19 # TODO evalues vary based on platform, needs
>> fixing
>> #   Failed (TODO) test at test.pl line 158.
>> #          got: '-808808307'
>> #     expected: '1764872'
>> not ok 20 # TODO evalues vary based on platform, needs
>> fixing
>> #   Failed (TODO) test at test.pl line 159.
>> #          got: '-2118162890'
>> #     expected: '1764872'
>>
>> you think these are ok to ignore?
>>
>>
>> On Fri, 2008-08-01 at 21:03 -0700, Yee Man Chan wrote:
>>
>>> Hi Alexie
>>>
>>>   Attached are the files that contains the feature
>> you requested. linspc.c is the one that does the work and
>> test.pl has a test case for it. The scoring scheme is as
>> described before. Please let me know if it works.
>>>
>>> Yee Man
>>>
>>> --- On Wed, 7/30/08, Alexie Papanicolaou
>> <apapanicolaou at ice.mpg.de> wrote:
>>>
>>>> From: Alexie Papanicolaou
>> <apapanicolaou at ice.mpg.de>
>>>> Subject: Re: Bio::Tools::dpAlign feature request
>>>> To: ymc at yahoo.com
>>>> Date: Wednesday, July 30, 2008, 2:44 PM
>>>> Oh sorry
>>>>
>>>> Say match=3 and mismatch=-1, gopen= -10, gext=-5
>>>> for aligning
>>>> seq1: ATG
>>>> seq2: ATT
>>>> match: 3,3,-1
>>>>
>>>> seq1: AT-G
>>>> seq2: ATTG
>>>> match: 3,3,-1,-10,3
>>>>
>>>> is that possible? or am I missing something? I
>> was only
>>>> today wondering
>>>> if it is even possible...
>>>>
>>>> a
>>>>
>>>>
>>>> Yee Man Chan wrote:
>>>>> Sorry, I don't quite get it. Can you
>> give me an
>>>> example of the output you want?
>>>>>
>>>>> Yee Man
>>>>>
>>>>> --- On Wed, 7/30/08, Alexie Papanicolaou
>>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>>
>>>>>
>>>>>> From: Alexie Papanicolaou
>>>> <apapanicolaou at ice.mpg.de>
>>>>>> Subject: Re: Bio::Tools::dpAlign feature
>> request
>>>>>> To: ymc at yahoo.com
>>>>>> Date: Wednesday, July 30, 2008, 9:50 AM
>>>>>> Dear Yee Man,
>>>>>>
>>>>>> Do you think it is possible to code a
>> method for
>>>> creating a
>>>>>> delimited
>>>>>> (space or comma) "score-line"?
>>>>>>
>>>>>> I'd like to parse it into an array
>> and have
>>>> the
>>>>>> individual score for
>>>>>> each alignment position. Is it easy to
>> do?
>>>>>>
>>>>>> a
>>>>>>
>>>>>> Yee Man Chan wrote:
>>>>>>
>>>>>>> Hi Alexie
>>>>>>>
>>>>>>>   How about I implement the simple
>> case?
>>>>>>>
>>>>>>> So for match = +3, mismatch = -1,
>>>>>>>
>>>>>>> A and R = +3
>>>>>>> A and Y = -1
>>>>>>> A and B = -1
>>>>>>> A and D = +3
>>>>>>> A and N = +3
>>>>>>> A and X = -1
>>>>>>>
>>>>>>> What do you think?
>>>>>>> Yee Man
>>>>>>>
>>>>>>>
>>>>>>> --- On Tue, 7/29/08, Alexie
>> Papanicolaou
>>>>>>>
>>>>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>>>
>>>>>>>
>>>>>>>
>>>>>>>> From: Alexie Papanicolaou
>>>>>>>>
>>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>
>>>>>>>> Subject: Re: Bio::Tools::dpAlign
>> feature
>>>> request
>>>>>>>> To: ymc at yahoo.com
>>>>>>>> Date: Tuesday, July 29, 2008,
>> 10:58 AM
>>>>>>>> Dear Yee Man,
>>>>>>>> hello, I was wondering how is
>> this
>>>> progressing and
>>>>>>>>
>>>>>> if you
>>>>>>
>>>>>>>> need help?
>>>>>>>>
>>>>>>>> many thanks
>>>>>>>> alexie
>>>>>>>>
>>>>>>>> Yee Man Chan wrote:
>>>>>>>>
>>>>>>>>
>>>>>>>>> Hi Alexie
>>>>>>>>>
>>>>>>>>>   There are two ways to
>> compute the
>>>> score for
>>>>>>>>>
>>>>>> each
>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>> aligned basepair in dpAlign
>> module. One is
>>>>>>>>
>>>>>> match/mismatch
>>>>>>
>>>>>>>> if you specify your sequence as
>> DNA and
>>>> the other
>>>>>>>>
>>>>>> is a
>>>>>>
>>>>>>>> scoring matrix if you specify
>> your
>>>> sequence as
>>>>>>>>
>>>>>> protein.
>>>>>>
>>>>>>>> Obviously, the latter can
>> completely
>>>> dominate the
>>>>>>>>
>>>>>> former.
>>>>>>
>>>>>>>> If you take the time to type the
>> scoring
>>>> matrix
>>>>>>>>
>>>>>> file, then
>>>>>>
>>>>>>>> you can handle those IUPAC code
>> by
>>>> specifying the
>>>>>>>>
>>>>>> sequence
>>>>>>
>>>>>>>> as proteins.
>>>>>>>>
>>>>>>>>
>>>>>>>>>   If you think this is too
>>>> troublesome, then
>>>>>>>>>
>>>>>> I might
>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>> be able to extend the
>> match/mismatch route
>>>> to
>>>>>>>>
>>>>>> handle IUPAC
>>>>>>
>>>>>>>> codes. But the problem here is,
>> how should
>>>> I score
>>>>>>>>
>>>>>> a match
>>>>>>
>>>>>>>> of A and W when match is +3 and
>> mismatch
>>>> is -1?
>>>>>>>>
>>>>>> Should it
>>>>>>
>>>>>>>> have a score of +3/3 = +1 for
>> match or
>>>> +3/3-1*2/3
>>>>>>>>
>>>>>> = +1/3?
>>>>>>
>>>>>>>> Do you know what the convention
>> is? If
>>>> not, maybe
>>>>>>>>
>>>>>> you can
>>>>>>
>>>>>>>> tell me what you think the score
>> will be?
>>>>>>>>
>>>>>>>>
>>>>>>>>> Yee Man
>>>>>>>>>
>>>>>>>>> --- On Thu, 6/26/08, Alexie
>>>> Papanicolaou
>>>>>>>>>
>>>>>>>>>
>>>>>>>> <apapanicolaou at ice.mpg.de>
>> wrote:
>>>>>>>>
>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>> From: Alexie
>> Papanicolaou
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>>>
>>>>>>>>
>>>>>>>>>> Subject:
>> Bio::Tools::dpAlign
>>>> feature
>>>>>>>>>>
>>>>>> request
>>>>>>
>>>>>>>>>> To: ymc at yahoo.com
>>>>>>>>>> Date: Thursday, June 26,
>> 2008,
>>>> 4:15 AM
>>>>>>>>>> Dear Yee Man Chan,
>>>>>>>>>>
>>>>>>>>>> Many thank you for this
>> module. I
>>>> like it
>>>>>>>>>>
>>>>>> very
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> much. I was
>>>>>>>>
>>>>>>>>
>>>>>>>>>> wondering if
>>>>>>>>>> it would be possible for
>> you to
>>>> allow for
>>>>>>>>>>
>>>>>> IUPAC
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> DNA codes.
>>>>>>>>
>>>>>>>>
>>>>>>>>>> I see it is in your TODO
>> list and
>>>> I hoped
>>>>>>>>>>
>>>>>> to
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> inspire you
>>>>>>>>
>>>>>>>>
>>>>>>>>>> :-)
>>>>>>>>>>
>>>>>>>>>> Even a simple measure
>> with the
>>>> degenerate
>>>>>>>>>>
>>>>>> base
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> containing
>>>>>>>>
>>>>>>>>
>>>>>>>>>> the aligned
>>>>>>>>>> base count as a
>> (perfect) match
>>>> would be
>>>>>>>>>>
>>>>>> very
>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>> useful to me
>>>>>>>>
>>>>>>>>
>>>>>>>>>> (i'm sorry, i
>>>>>>>>>> 'm not a good coder
>> to do it
>>>> myself).
>>>>>>>>>>
>>>>>>>>>> many thanks for your
>> work so far.
>>>>>>>>>> alexie
>>>>>>>>>>
>>>>>>>>>> -- 
>>>>>>>>>> --
>>>>>>>>>> "Eppur si
>> evolve"
>>>> ("And yet
>>>>>>>>>>
>>>>>> it
>>>>>>
>>>>>>>>>> evolves")
>>>>>>>>>> -Galileo Jr (ca 21st
>> century)
>>>>>>>>>>
>>>>>>>>>> --
>>>>>>>>>> Alexie Papanicolaou
>>>>>>>>>> Entomology
>>>>>>>>>> Max Planck Institute for
>> Chemical
>>>> Ecology
>>>>>>>>>> Hans Knoell Str 8
>>>>>>>>>> Jena 07745
>>>>>>>>>> Germany
>>>>>>>>>> Email
>> apapanicolaou at ice.mpg.de
>>>>>>>>>> Tel +493641571561
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>> -- 
>>>>>>>> --
>>>>>>>> "Eppur si evolve"
>> ("And yet
>>>> it
>>>>>>>> evolves")
>>>>>>>> -Galileo Jr (ca 21st century)
>>>>>>>>
>>>>>>>> "One Galileo in two
>> thousand years is
>>>>>>>>
>>>>>> enough."
>>>>>>
>>>>>>>> -Pope Pius XII
>>>>>>>> --
>>>>>>>> Alexie Papanicolaou
>>>>>>>> Entomology
>>>>>>>> Max Planck Institute for
>> Chemical Ecology
>>>>>>>> Hans Knoell Str 8
>>>>>>>> Jena 07745
>>>>>>>> Germany
>>>>>>>> Email apapanicolaou at ice.mpg.de
>>>>>>>> Tel +493641571561
>>>>>>>>
>>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>> -- 
>>>>>> --
>>>>>> "Eppur si evolve" ("And
>> yet it
>>>>>> evolves")
>>>>>> -Galileo Jr (ca 21st century)
>>>>>>
>>>>>> "One Galileo in two thousand years
>> is
>>>> enough."
>>>>>> -Pope Pius XII
>>>>>> --
>>>>>> Alexie Papanicolaou
>>>>>> Entomology
>>>>>> Max Planck Institute for Chemical
>> Ecology
>>>>>> Hans Knoell Str 8
>>>>>> Jena 07745
>>>>>> Germany
>>>>>> Email apapanicolaou at ice.mpg.de
>>>>>> Tel +493641571561
>>>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>
>>>> -- 
>>>> --
>>>> "Eppur si evolve" ("And yet it
>>>> evolves")
>>>> -Galileo Jr (ca 21st century)
>>>>
>>>> "One Galileo in two thousand years is
>> enough."
>>>> -Pope Pius XII
>>>> --
>>>> Alexie Papanicolaou
>>>> Entomology
>>>> Max Planck Institute for Chemical Ecology
>>>> Hans Knoell Str 8
>>>> Jena 07745
>>>> Germany
>>>> Email apapanicolaou at ice.mpg.de
>>>> Tel +493641571561
>>>
>>>
>>>
>>
>> -- 
>> -- 
>> "Eppur si evolve" ("And yet it
>> evolves")
>> -Galileo Jr (ca 21st century)
>>
>> "One Galileo in two thousand years is enough."
>> -Pope Pius XII
>> -- 
>> Alexie Papanicolaou
>> Entomology
>> Max Planck Institute for Chemical Ecology
>> Hans Knoell Str 8
>> Jena 07745
>> Germany
>> Email apapanicolaou at ice.mpg.de
>> Tel +493641571561
>
>
>

Jason Stajich
jason at bioperl.org





From cjfields at illinois.edu  Mon Sep  1 17:49:56 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Mon, 1 Sep 2008 12:49:56 -0500
Subject: [Bioperl-l] Bio::Tools::dpAlign feature request
In-Reply-To: <99A57523-94B3-4A56-A617-22675FA10AB8@bioperl.org>
References: <868888.19741.qm@web30406.mail.mud.yahoo.com>
	<99A57523-94B3-4A56-A617-22675FA10AB8@bioperl.org>
Message-ID: <44D25826-BE42-4539-8567-468FE74571B4@illinois.edu>

On pSW: I agree, I don't think it is worth maintaining it considering  
there are actively supported C/C++-based toolkits with similar  
functionality (SeqAn) and Petr's BioLib initiative will likely be a  
more maintainable effort.

chris

On Sep 1, 2008, at 2:42 AM, Jason Stajich wrote:

> Safe to ignore the tests.  Those that are failing aren't even test  
> for Bio::Align::dpAlign - but were written to test a bug that has  
> not been fixed in the EVD module if I remember correctly that is why  
> they are marked in a TODO block, but I can't tell if the Test.pm is  
> actually skipping these tests or not.
>
> I think we probably need to deprecate some of these modules as there  
> is no maintainer of Ewan's code in here.
>
> At a minimum we need to modularlize the tests for these modules into  
> separate t dir and fix the need for multiple Makefile.PL in here and  
> probably move to Build.PL
>
> -jason
> On Aug 28, 2008, at 11:00 AM, Yee Man Chan wrote:
>
>>
>> Hi Alexie
>>
>> My understanding is that you can ignore these failures.
>>
>> I believe test cases 17-20 were added by Jason Stajich before I  
>> added the feature you requested. I am not sure what he was doing  
>> there.
>>
>> I suppose he can give you the definite answer to whether this is  
>> something important or not.
>>
>> By the way, did you try out the new feature? Does it work?
>>
>> Thanks
>> Yee Man
>>
>> --- On Thu, 8/28/08, Alexie Papanicolaou <apapanicolaou at ice.mpg.de>  
>> wrote:
>>
>>> From: Alexie Papanicolaou <apapanicolaou at ice.mpg.de>
>>> Subject: Re: Bio::Tools::dpAlign feature request
>>> To: "Yee Man Chan" <ymc at yahoo.com>
>>> Date: Thursday, August 28, 2008, 6:15 AM
>>> hi
>>>
>>> is the version you emailed me newer or older than the
>>> subversion one?
>>>
>>> i'm testing the subversion version for bioperl-ext and
>>>
>>> not ok 17 # TODO evalues vary based on platform, needs
>>> fixing
>>> #   Failed (TODO) test at test.pl line 156.
>>> #          got: '2027805538'
>>> #     expected: '1764904'
>>> not ok 18 # TODO evalues vary based on platform, needs
>>> fixing
>>> #   Failed (TODO) test at test.pl line 157.
>>> #          got: '-1375488148'
>>> #     expected: '1764872'
>>> not ok 19 # TODO evalues vary based on platform, needs
>>> fixing
>>> #   Failed (TODO) test at test.pl line 158.
>>> #          got: '-808808307'
>>> #     expected: '1764872'
>>> not ok 20 # TODO evalues vary based on platform, needs
>>> fixing
>>> #   Failed (TODO) test at test.pl line 159.
>>> #          got: '-2118162890'
>>> #     expected: '1764872'
>>>
>>> you think these are ok to ignore?
>>>
>>>
>>> On Fri, 2008-08-01 at 21:03 -0700, Yee Man Chan wrote:
>>>
>>>> Hi Alexie
>>>>
>>>>  Attached are the files that contains the feature
>>> you requested. linspc.c is the one that does the work and
>>> test.pl has a test case for it. The scoring scheme is as
>>> described before. Please let me know if it works.
>>>>
>>>> Yee Man
>>>>
>>>> --- On Wed, 7/30/08, Alexie Papanicolaou
>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>
>>>>> From: Alexie Papanicolaou
>>> <apapanicolaou at ice.mpg.de>
>>>>> Subject: Re: Bio::Tools::dpAlign feature request
>>>>> To: ymc at yahoo.com
>>>>> Date: Wednesday, July 30, 2008, 2:44 PM
>>>>> Oh sorry
>>>>>
>>>>> Say match=3 and mismatch=-1, gopen= -10, gext=-5
>>>>> for aligning
>>>>> seq1: ATG
>>>>> seq2: ATT
>>>>> match: 3,3,-1
>>>>>
>>>>> seq1: AT-G
>>>>> seq2: ATTG
>>>>> match: 3,3,-1,-10,3
>>>>>
>>>>> is that possible? or am I missing something? I
>>> was only
>>>>> today wondering
>>>>> if it is even possible...
>>>>>
>>>>> a
>>>>>
>>>>>
>>>>> Yee Man Chan wrote:
>>>>>> Sorry, I don't quite get it. Can you
>>> give me an
>>>>> example of the output you want?
>>>>>>
>>>>>> Yee Man
>>>>>>
>>>>>> --- On Wed, 7/30/08, Alexie Papanicolaou
>>>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>>>
>>>>>>
>>>>>>> From: Alexie Papanicolaou
>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>> Subject: Re: Bio::Tools::dpAlign feature
>>> request
>>>>>>> To: ymc at yahoo.com
>>>>>>> Date: Wednesday, July 30, 2008, 9:50 AM
>>>>>>> Dear Yee Man,
>>>>>>>
>>>>>>> Do you think it is possible to code a
>>> method for
>>>>> creating a
>>>>>>> delimited
>>>>>>> (space or comma) "score-line"?
>>>>>>>
>>>>>>> I'd like to parse it into an array
>>> and have
>>>>> the
>>>>>>> individual score for
>>>>>>> each alignment position. Is it easy to
>>> do?
>>>>>>>
>>>>>>> a
>>>>>>>
>>>>>>> Yee Man Chan wrote:
>>>>>>>
>>>>>>>> Hi Alexie
>>>>>>>>
>>>>>>>>  How about I implement the simple
>>> case?
>>>>>>>>
>>>>>>>> So for match = +3, mismatch = -1,
>>>>>>>>
>>>>>>>> A and R = +3
>>>>>>>> A and Y = -1
>>>>>>>> A and B = -1
>>>>>>>> A and D = +3
>>>>>>>> A and N = +3
>>>>>>>> A and X = -1
>>>>>>>>
>>>>>>>> What do you think?
>>>>>>>> Yee Man
>>>>>>>>
>>>>>>>>
>>>>>>>> --- On Tue, 7/29/08, Alexie
>>> Papanicolaou
>>>>>>>>
>>>>>>> <apapanicolaou at ice.mpg.de> wrote:
>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>>> From: Alexie Papanicolaou
>>>>>>>>>
>>>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>>
>>>>>>>>> Subject: Re: Bio::Tools::dpAlign
>>> feature
>>>>> request
>>>>>>>>> To: ymc at yahoo.com
>>>>>>>>> Date: Tuesday, July 29, 2008,
>>> 10:58 AM
>>>>>>>>> Dear Yee Man,
>>>>>>>>> hello, I was wondering how is
>>> this
>>>>> progressing and
>>>>>>>>>
>>>>>>> if you
>>>>>>>
>>>>>>>>> need help?
>>>>>>>>>
>>>>>>>>> many thanks
>>>>>>>>> alexie
>>>>>>>>>
>>>>>>>>> Yee Man Chan wrote:
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>> Hi Alexie
>>>>>>>>>>
>>>>>>>>>>  There are two ways to
>>> compute the
>>>>> score for
>>>>>>>>>>
>>>>>>> each
>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>> aligned basepair in dpAlign
>>> module. One is
>>>>>>>>>
>>>>>>> match/mismatch
>>>>>>>
>>>>>>>>> if you specify your sequence as
>>> DNA and
>>>>> the other
>>>>>>>>>
>>>>>>> is a
>>>>>>>
>>>>>>>>> scoring matrix if you specify
>>> your
>>>>> sequence as
>>>>>>>>>
>>>>>>> protein.
>>>>>>>
>>>>>>>>> Obviously, the latter can
>>> completely
>>>>> dominate the
>>>>>>>>>
>>>>>>> former.
>>>>>>>
>>>>>>>>> If you take the time to type the
>>> scoring
>>>>> matrix
>>>>>>>>>
>>>>>>> file, then
>>>>>>>
>>>>>>>>> you can handle those IUPAC code
>>> by
>>>>> specifying the
>>>>>>>>>
>>>>>>> sequence
>>>>>>>
>>>>>>>>> as proteins.
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>  If you think this is too
>>>>> troublesome, then
>>>>>>>>>>
>>>>>>> I might
>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>> be able to extend the
>>> match/mismatch route
>>>>> to
>>>>>>>>>
>>>>>>> handle IUPAC
>>>>>>>
>>>>>>>>> codes. But the problem here is,
>>> how should
>>>>> I score
>>>>>>>>>
>>>>>>> a match
>>>>>>>
>>>>>>>>> of A and W when match is +3 and
>>> mismatch
>>>>> is -1?
>>>>>>>>>
>>>>>>> Should it
>>>>>>>
>>>>>>>>> have a score of +3/3 = +1 for
>>> match or
>>>>> +3/3-1*2/3
>>>>>>>>>
>>>>>>> = +1/3?
>>>>>>>
>>>>>>>>> Do you know what the convention
>>> is? If
>>>>> not, maybe
>>>>>>>>>
>>>>>>> you can
>>>>>>>
>>>>>>>>> tell me what you think the score
>>> will be?
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>> Yee Man
>>>>>>>>>>
>>>>>>>>>> --- On Thu, 6/26/08, Alexie
>>>>> Papanicolaou
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>> <apapanicolaou at ice.mpg.de>
>>> wrote:
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>> From: Alexie
>>> Papanicolaou
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> <apapanicolaou at ice.mpg.de>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> Subject:
>>> Bio::Tools::dpAlign
>>>>> feature
>>>>>>>>>>>
>>>>>>> request
>>>>>>>
>>>>>>>>>>> To: ymc at yahoo.com
>>>>>>>>>>> Date: Thursday, June 26,
>>> 2008,
>>>>> 4:15 AM
>>>>>>>>>>> Dear Yee Man Chan,
>>>>>>>>>>>
>>>>>>>>>>> Many thank you for this
>>> module. I
>>>>> like it
>>>>>>>>>>>
>>>>>>> very
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> much. I was
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> wondering if
>>>>>>>>>>> it would be possible for
>>> you to
>>>>> allow for
>>>>>>>>>>>
>>>>>>> IUPAC
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> DNA codes.
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> I see it is in your TODO
>>> list and
>>>>> I hoped
>>>>>>>>>>>
>>>>>>> to
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> inspire you
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> :-)
>>>>>>>>>>>
>>>>>>>>>>> Even a simple measure
>>> with the
>>>>> degenerate
>>>>>>>>>>>
>>>>>>> base
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> containing
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> the aligned
>>>>>>>>>>> base count as a
>>> (perfect) match
>>>>> would be
>>>>>>>>>>>
>>>>>>> very
>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> useful to me
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>>> (i'm sorry, i
>>>>>>>>>>> 'm not a good coder
>>> to do it
>>>>> myself).
>>>>>>>>>>>
>>>>>>>>>>> many thanks for your
>>> work so far.
>>>>>>>>>>> alexie
>>>>>>>>>>>
>>>>>>>>>>> -- 
>>>>>>>>>>> --
>>>>>>>>>>> "Eppur si
>>> evolve"
>>>>> ("And yet
>>>>>>>>>>>
>>>>>>> it
>>>>>>>
>>>>>>>>>>> evolves")
>>>>>>>>>>> -Galileo Jr (ca 21st
>>> century)
>>>>>>>>>>>
>>>>>>>>>>> --
>>>>>>>>>>> Alexie Papanicolaou
>>>>>>>>>>> Entomology
>>>>>>>>>>> Max Planck Institute for
>>> Chemical
>>>>> Ecology
>>>>>>>>>>> Hans Knoell Str 8
>>>>>>>>>>> Jena 07745
>>>>>>>>>>> Germany
>>>>>>>>>>> Email
>>> apapanicolaou at ice.mpg.de
>>>>>>>>>>> Tel +493641571561
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>> -- 
>>>>>>>>> --
>>>>>>>>> "Eppur si evolve"
>>> ("And yet
>>>>> it
>>>>>>>>> evolves")
>>>>>>>>> -Galileo Jr (ca 21st century)
>>>>>>>>>
>>>>>>>>> "One Galileo in two
>>> thousand years is
>>>>>>>>>
>>>>>>> enough."
>>>>>>>
>>>>>>>>> -Pope Pius XII
>>>>>>>>> --
>>>>>>>>> Alexie Papanicolaou
>>>>>>>>> Entomology
>>>>>>>>> Max Planck Institute for
>>> Chemical Ecology
>>>>>>>>> Hans Knoell Str 8
>>>>>>>>> Jena 07745
>>>>>>>>> Germany
>>>>>>>>> Email apapanicolaou at ice.mpg.de
>>>>>>>>> Tel +493641571561
>>>>>>>>>
>>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>> -- 
>>>>>>> --
>>>>>>> "Eppur si evolve" ("And
>>> yet it
>>>>>>> evolves")
>>>>>>> -Galileo Jr (ca 21st century)
>>>>>>>
>>>>>>> "One Galileo in two thousand years
>>> is
>>>>> enough."
>>>>>>> -Pope Pius XII
>>>>>>> --
>>>>>>> Alexie Papanicolaou
>>>>>>> Entomology
>>>>>>> Max Planck Institute for Chemical
>>> Ecology
>>>>>>> Hans Knoell Str 8
>>>>>>> Jena 07745
>>>>>>> Germany
>>>>>>> Email apapanicolaou at ice.mpg.de
>>>>>>> Tel +493641571561
>>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>
>>>>> -- 
>>>>> --
>>>>> "Eppur si evolve" ("And yet it
>>>>> evolves")
>>>>> -Galileo Jr (ca 21st century)
>>>>>
>>>>> "One Galileo in two thousand years is
>>> enough."
>>>>> -Pope Pius XII
>>>>> --
>>>>> Alexie Papanicolaou
>>>>> Entomology
>>>>> Max Planck Institute for Chemical Ecology
>>>>> Hans Knoell Str 8
>>>>> Jena 07745
>>>>> Germany
>>>>> Email apapanicolaou at ice.mpg.de
>>>>> Tel +493641571561
>>>>
>>>>
>>>>
>>>
>>> -- 
>>> -- 
>>> "Eppur si evolve" ("And yet it
>>> evolves")
>>> -Galileo Jr (ca 21st century)
>>>
>>> "One Galileo in two thousand years is enough."
>>> -Pope Pius XII
>>> -- 
>>> Alexie Papanicolaou
>>> Entomology
>>> Max Planck Institute for Chemical Ecology
>>> Hans Knoell Str 8
>>> Jena 07745
>>> Germany
>>> Email apapanicolaou at ice.mpg.de
>>> Tel +493641571561
>>
>>
>>
>
> Jason Stajich
> jason at bioperl.org
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From lmanchon at univ-montp2.fr  Wed Sep  3 13:04:14 2008
From: lmanchon at univ-montp2.fr (Laurent Manchon)
Date: Wed, 03 Sep 2008 15:04:14 +0200
Subject: [Bioperl-l] parsing result of CAP3 (ACE file)
Message-ID: <5.0.2.1.2.20080903150203.00c0db18@pop.univ-montp2.fr>

-- Hi,

Is somebody have a piece of code to parse result of CAP3 assembly program which
format is ACE ?
I need to retrieve the alignment from this file.

thank you,
Laurent --




+---------------------------------------------+
  Laurent Manchon
  Email: lmanchon at univ-montp2.fr
+---------------------------------------------+


From osborne6 at gmail.com  Wed Sep  3 14:33:15 2008
From: osborne6 at gmail.com (John Osborne)
Date: Wed, 3 Sep 2008 09:33:15 -0500
Subject: [Bioperl-l] interpro parsing enhancement?
Message-ID: <324fccf0809030733y5c5e8592t5f0617d0ff4d2203@mail.gmail.com>

Hi -
I'm wondering if anyone is working on adding functionality to
Bio::SeqIO::interpro to grab the Gene Ontology/GO classifications out
of the interpro xml output?

I've started working on that myself, but wanted to check if anyone
else is doing the same.

Thanks!
-- 
John Osborne
osborne6 at ieee.org/osborne6 at gmail.com/jro at freeshell.org


From gundalav at gmail.com  Wed Sep  3 14:48:07 2008
From: gundalav at gmail.com (Gundala Viswanath)
Date: Wed, 3 Sep 2008 23:48:07 +0900
Subject: [Bioperl-l] Fitch's Parsimony Algorithm with Perl
Message-ID: <73f827b50809030748o725d3772m681af9da3c0c26c0@mail.gmail.com>

Hi,

What's a correct way to implement Fitch's parsimony algorithm?
Especially to compute minimum substitiution rate per column
in the aligned sequence.

Is there a Bioperl module to do it?

For example
CGGCGGAAAACTGTCCTCCGTGC   mouse
CGACGGAACATTCTCCTCCGCGC   rat
CGACGGAATATTCCCCTCCGTGC   human
CGACGGAAGACTCTCCTCCGTGC   chimp

00100000302011000000100   -> number of subst per site (max parsimony)

My code below doesn't seem to do the job.

__BEGIN__
use Data::Dumper;
use List::MoreUtils qw(uniq);

# The related phylogenetic in Newick format tree is:
my $tree = ' (mouse,rat,(human,chimp))';

my $sites = [
    'CGGCGGAAAACTGTCCTCCGTGC', # mouse
    'CGACGGAACATTCTCCTCCGCGC', # rat
    'CGACGGAATATTCCCCTCCGTGC', # human
    'CGACGGAAGACTCTCCTCCGTGC', # chimp
];

my @val = my_parsimony($sites);
print Dumper \@val;

sub my_parsimony {

    my  $tfbs   = shift;
    my $mlen = length($tfbs->[0]);

    my $sum_min = 0;
    my @mincol;

    foreach my $pos ( 0 .. $mlen-1 ) {

        my @colbp = ();
        foreach my $site ( @{$tfbs} ) {
            my $bp = substr($site,$pos,1);
            push @colbp, $bp;

        }

       # this heuristic seems to be faulty
       # Column 11 it predicts 1 instead of 2

       # Not sure how can I make use of the tree

        my $min_mm = scalar( uniq(@colbp) ) - 1;
        push @mincol, $min_mm;
    }

    return @mincol;
}

__END__

- Gundala Viswanath
Jakarta - Indonesia


From raulmendez at cbm.uam.es  Wed Sep  3 14:33:46 2008
From: raulmendez at cbm.uam.es (Raul Mendez Giraldez)
Date: Wed, 03 Sep 2008 16:33:46 +0200
Subject: [Bioperl-l] SeqHound
In-Reply-To: <111DD141-75F8-4437-9EAD-E049BBADB515@uiuc.edu>
Message-ID: <1220452426.31595.92.camel@pepa.cbm.uam.es>

Hi Chris,

I'm trying to set up and run bioperl Seqhound donwloaded from:

http://bond.unleashedinformatics.com/downloads/api//seqhound-bioperl-4.0.tar.gz

and I always get connection error messages. Do you know which version of
SeqHound should I use and how can I configure to make it work? I've
tried several possibilities for server1 at .shoundremrc as

[remote]
server1 = bond.unleashedinformatics.com
CGI = /cgi-bin/seqrem
port=8080

Also, I would like to get all the possible protein-protein interaction
for a set of protein sequences. Would this be possible using SeqHound?

Thanks,
Ra?l




-- 
Ra?l M?ndez Gir?ldez, Ph.D.
Bioinformatics Unit
Centre for Molecular Biology "Severo Ochoa"
Universidad Aut?noma de Madrid
C/ Nicol?s Cabrera, 1
Cantoblanco 28049, Madrid
SPAIN

Phone: +34 91 196 4633




From jaudall at gmail.com  Wed Sep  3 15:38:08 2008
From: jaudall at gmail.com (Joshua Udall)
Date: Wed, 3 Sep 2008 09:38:08 -0600
Subject: [Bioperl-l] parsing result of CAP3 (ACE file)
In-Reply-To: <5.0.2.1.2.20080903150203.00c0db18@pop.univ-montp2.fr>
References: <5.0.2.1.2.20080903150203.00c0db18@pop.univ-montp2.fr>
Message-ID: <52cea20c0809030838k6fb1498btc15b8e76d98f9d70@mail.gmail.com>

Laurent -

I have modified modules that will do it as I recently ran into problems with
the DB_FILE module in Assembly::IO.  In addition, the current version of
cap3 seems to put a contig length where a pad length is expected (based on
the Ace format description).  The modules I have will parse the ace file
contig-by-contig rather than having the entire assembly slurped into memory
(or a tied hash) all at once.  You are welcome to them if you are interested
and I'd like to get them in Bioperl at some point.  Bascially, there are
three files - a modified Contig.pm, ContigIO.pm, and a modified ace.pm (in a
ContigIO directory).

Josh

On Wed, Sep 3, 2008 at 7:04 AM, Laurent Manchon <lmanchon at univ-montp2.fr>wrote:

> -- Hi,
>
> Is somebody have a piece of code to parse result of CAP3 assembly program
> which
> format is ACE ?
> I need to retrieve the alignment from this file.
>
> thank you,
> Laurent --
>
>
>
>
> +---------------------------------------------+
>  Laurent Manchon
>  Email: lmanchon at univ-montp2.fr
> +---------------------------------------------+
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Joshua Udall
Assistant Professor
295 WIDB
Plant and Wildlife Science Dept.
Brigham Young University
Provo, UT 84602
801-422-9307
Fax: 801-422-0008
USA


From hartzell at alerce.com  Wed Sep  3 23:19:45 2008
From: hartzell at alerce.com (George Hartzell)
Date: Wed, 3 Sep 2008 16:19:45 -0700
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
Message-ID: <18623.7057.95449.99461@almost.alerce.com>


Ok, confess.  None of you know what's up with line 248 of
Bio::Coordinate::Pair, do you?  You probably don't even know what's
*on* that line.  Wonder how many will go look.

Now that I either have your attention or have pissed you off (or
both...), I think that creating a new Bio::Location::Split object in
Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
quite sure enough to excise it and commit the change.

Anyone up for it?

g.


From cjfields at illinois.edu  Thu Sep  4 01:29:49 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 3 Sep 2008 20:29:49 -0500
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
In-Reply-To: <18623.7057.95449.99461@almost.alerce.com>
References: <18623.7057.95449.99461@almost.alerce.com>
Message-ID: <C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>

Well, it doesn't look like the SplitLocation is even used, so I think  
it is safe to remove.

chris

On Sep 3, 2008, at 6:19 PM, George Hartzell wrote:

>
> Ok, confess.  None of you know what's up with line 248 of
> Bio::Coordinate::Pair, do you?  You probably don't even know what's
> *on* that line.  Wonder how many will go look.
>
> Now that I either have your attention or have pissed you off (or
> both...), I think that creating a new Bio::Location::Split object in
> Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
> quite sure enough to excise it and commit the change.
>
> Anyone up for it?
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From jason at bioperl.org  Thu Sep  4 04:40:38 2008
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 3 Sep 2008 21:40:38 -0700
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
In-Reply-To: <C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>
References: <18623.7057.95449.99461@almost.alerce.com>
	<C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>
Message-ID: <222DB5D8-BCCB-448E-BDEE-068A4A432660@bioperl.org>

Agreed - I don't know if that was something was changed mid-stream,  
but removing it should cause no pain...
-j
On Sep 3, 2008, at 6:29 PM, Chris Fields wrote:

> Well, it doesn't look like the SplitLocation is even used, so I  
> think it is safe to remove.
>
> chris
>
> On Sep 3, 2008, at 6:19 PM, George Hartzell wrote:
>
>>
>> Ok, confess.  None of you know what's up with line 248 of
>> Bio::Coordinate::Pair, do you?  You probably don't even know what's
>> *on* that line.  Wonder how many will go look.
>>
>> Now that I either have your attention or have pissed you off (or
>> both...), I think that creating a new Bio::Location::Split object in
>> Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
>> quite sure enough to excise it and commit the change.
>>
>> Anyone up for it?
>>
>> g.
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Marie-Claude Hofmann
> College of Veterinary Medicine
> University of Illinois Urbana-Champaign
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From heikki at sanbi.ac.za  Thu Sep  4 06:17:31 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Thu, 4 Sep 2008 08:17:31 +0200
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
In-Reply-To: <222DB5D8-BCCB-448E-BDEE-068A4A432660@bioperl.org>
References: <18623.7057.95449.99461@almost.alerce.com>
	<C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>
	<222DB5D8-BCCB-448E-BDEE-068A4A432660@bioperl.org>
Message-ID: <200809040817.31916.heikki@sanbi.ac.za>

Quilty. So I removed the line.

George, please do not try to piss us off. You can get all the attention you 
want from us. :)

What are you planning to do to Bio::Coordinate classes?

   -Heikki


On Thursday 04 September 2008 06:40:38 Jason Stajich wrote:
> Agreed - I don't know if that was something was changed mid-stream,
> but removing it should cause no pain...
> -j
>
> On Sep 3, 2008, at 6:29 PM, Chris Fields wrote:
> > Well, it doesn't look like the SplitLocation is even used, so I
> > think it is safe to remove.
> >
> > chris
> >
> > On Sep 3, 2008, at 6:19 PM, George Hartzell wrote:
> >> Ok, confess.  None of you know what's up with line 248 of
> >> Bio::Coordinate::Pair, do you?  You probably don't even know what's
> >> *on* that line.  Wonder how many will go look.
> >>
> >> Now that I either have your attention or have pissed you off (or
> >> both...), I think that creating a new Bio::Location::Split object in
> >> Bio::Coordinate::Pair::map() is a leftover or something, but I'm not
> >> quite sure enough to excise it and commit the change.
> >>
> >> Anyone up for it?
> >>
> >> g.
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> > Christopher Fields
> > Postdoctoral Researcher
> > Lab of Dr. Marie-Claude Hofmann
> > College of Veterinary Medicine
> > University of Illinois Urbana-Champaign
> >
> >
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Jason Stajich
> jason at bioperl.org
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From hartzell at alerce.com  Thu Sep  4 16:00:21 2008
From: hartzell at alerce.com (George Hartzell)
Date: Thu, 4 Sep 2008 09:00:21 -0700
Subject: [Bioperl-l] What's up with line 248 of Bio::Coordinate::Pair?
In-Reply-To: <200809040817.31916.heikki@sanbi.ac.za>
References: <18623.7057.95449.99461@almost.alerce.com>
	<C8F6E94D-B70B-485B-81FB-187915624DCF@illinois.edu>
	<222DB5D8-BCCB-448E-BDEE-068A4A432660@bioperl.org>
	<200809040817.31916.heikki@sanbi.ac.za>
Message-ID: <18624.1557.758033.258065@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > Quilty. So I removed the line.
 > 
 > George, please do not try to piss us off. You can get all the attention you 
 > want from us. :)

Try not. Do... or do not. There is no try.

 > What are you planning to do to Bio::Coordinate classes?

It's a project for a paying customer (yikes...).  Pretty much exactly
what GeneMapper does, though I'll probably end up dangling a couple
more named coordinate spaces off of it.  Nothing earth shattering.
The classes look *great*.

g.


From hartzell at alerce.com  Fri Sep  5 19:01:35 2008
From: hartzell at alerce.com (George Hartzell)
Date: Fri, 05 Sep 2008 12:01:35 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean better
	(w/ patch)
Message-ID: <m263pabenk.fsf@almost.alerce.com>


Hi all,

Bio::Coordinate::Collection surprised me a bit.  At first I thought
there was a bug, but it's clearly doing what it's supposed to.  Now
I'm wondering if what it's supposed to be doing makes sense in some
context, or if what I expected would be better functionality.

t/CoordinateMapper.t sets up the following scenario:

#
# Collection
#
#         1   5     6   10
#         |---|     |---|
#-----|-----------------------
#     1   5   9     15  19
#         pair1     pair2

Then goes on to do the following query:

  # match more than two
  $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
  ok $res = $transcribe->map($pos);
  is $res->each_gap, 2;
  is $res->each_match, 2;

I was surprised to see that there were two gaps, one gene:10-19 and
one from gene:5-14.  Looking at the code, what's really happening is
that, for the exon1 mapper there's match with gene:5-9 and a gap with
gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
match with gene:15-19.  All four Result's just get tossed into the
return value.

The result my intuition wants is that there are two matches (gene:5-9
with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).

Yes, I guess that I could just synthesize these myself from the result
in my app.

It still seems that the current result is a bug though, since there's
no way of knowing when you're walking through $res->each_Location that
the first "gap" is with respect to the exon1 mapper and that the
second "gap" is with respect to the exon2 mapper.  The gaps are
meaningless.

I "fixed" it to work the way I think it should (two matches, one
gap).  I actually extended the test case a bit so that there's a
multi-base gap, a match, another multibase-gap, another match, then a
single base gap (just to make sure I got that right...).  I had to
touch up the test file a bit to account for my new test.

The gaps that I return have a strand of 'undef', which seems to be The
Right Thing.  There's also a bit of funny business where I hang onto
the seq_id of the gapped sequence.  It assumes that the "in" sequence
is the same for all of the mappers.  This seems safe since otherwise
the entire query is kind of weird....

There's a patch to todays svn head at:

  http://shrimp.alerce.com/bioperl/collection-diffs.txt

The patch changes Build.PL to include a dependency on Set::IntSpan,
CoordinateMapper.t to update the tests, and
Bio/CoordinateMapper/Collection.pm for the new code.

Who's code would this break.

If anyone's relying on the current behaviour re: gaps, what's the
situation in which you find it useful?

Thanks!

g.


From ajmackey at gmail.com  Fri Sep  5 20:54:56 2008
From: ajmackey at gmail.com (Aaron Mackey)
Date: Fri, 5 Sep 2008 16:54:56 -0400
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better (w/ patch)
In-Reply-To: <m263pabenk.fsf@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
Message-ID: <24c96eca0809051354h5b7218edtaa720140901d023f@mail.gmail.com>

There are two uses for Collection:

1) all the "in" seq_id's are the same, and George's patch makes sense to me
(i.e. agrees with my intuition)

2) all the "in" seq_id's are *not* the same (i.e. the collection is just a
hash of indivual pairs), in which case my query would only match the subset
of pairs having identical seq_id's to that specified by the query ... and
then you're back to case #1

So overall, it looks like this was a bug, but I'd of course want to hear
Heikki's opinion.

Thanks for raising this,

-Aaron

On Fri, Sep 5, 2008 at 3:01 PM, George Hartzell <hartzell at alerce.com> wrote:

>
> Hi all,
>
> Bio::Coordinate::Collection surprised me a bit.  At first I thought
> there was a bug, but it's clearly doing what it's supposed to.  Now
> I'm wondering if what it's supposed to be doing makes sense in some
> context, or if what I expected would be better functionality.
>
> t/CoordinateMapper.t sets up the following scenario:
>
> #
> # Collection
> #
> #         1   5     6   10
> #         |---|     |---|
> #-----|-----------------------
> #     1   5   9     15  19
> #         pair1     pair2
>
> Then goes on to do the following query:
>
>  # match more than two
>  $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
>  ok $res = $transcribe->map($pos);
>  is $res->each_gap, 2;
>  is $res->each_match, 2;
>
> I was surprised to see that there were two gaps, one gene:10-19 and
> one from gene:5-14.  Looking at the code, what's really happening is
> that, for the exon1 mapper there's match with gene:5-9 and a gap with
> gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
> match with gene:15-19.  All four Result's just get tossed into the
> return value.
>
> The result my intuition wants is that there are two matches (gene:5-9
> with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
>
> Yes, I guess that I could just synthesize these myself from the result
> in my app.
>
> It still seems that the current result is a bug though, since there's
> no way of knowing when you're walking through $res->each_Location that
> the first "gap" is with respect to the exon1 mapper and that the
> second "gap" is with respect to the exon2 mapper.  The gaps are
> meaningless.
>
> I "fixed" it to work the way I think it should (two matches, one
> gap).  I actually extended the test case a bit so that there's a
> multi-base gap, a match, another multibase-gap, another match, then a
> single base gap (just to make sure I got that right...).  I had to
> touch up the test file a bit to account for my new test.
>
> The gaps that I return have a strand of 'undef', which seems to be The
> Right Thing.  There's also a bit of funny business where I hang onto
> the seq_id of the gapped sequence.  It assumes that the "in" sequence
> is the same for all of the mappers.  This seems safe since otherwise
> the entire query is kind of weird....
>
> There's a patch to todays svn head at:
>
>  http://shrimp.alerce.com/bioperl/collection-diffs.txt
>
> The patch changes Build.PL to include a dependency on Set::IntSpan,
> CoordinateMapper.t to update the tests, and
> Bio/CoordinateMapper/Collection.pm for the new code.
>
> Who's code would this break.
>
> If anyone's relying on the current behaviour re: gaps, what's the
> situation in which you find it useful?
>
> Thanks!
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From jimhu at tamu.edu  Mon Sep  8 18:44:22 2008
From: jimhu at tamu.edu (Jim Hu)
Date: Mon, 8 Sep 2008 13:44:22 -0500
Subject: [Bioperl-l] Circular genomes in Chado/BioPerl
Message-ID: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>

In discussions with GMOD about Gbrowse, we've come up with a proposal  
for handling circular genomes and features that cross the origin in  
such genomes.  This applies to lots of prokaryotic and viral genomes,  
and might be valuable for some ways of representing terminally  
redundant linear genomes.

1) Keep the requirement that start < end
2) allow end > parent feature length
3) parent feature gets an is_circular boolean
4) use modular arithmetic to calculate the real position of end on the  
parent feature.

We'd like to do this in a way that will be consistent with Chado and  
BioPerl representation of features as much as possible (realizing that  
there is the usual interbase or not coordinate issue).  What do people  
think?  Lincoln is on board for modifying the GFF3 spec.

Thanks!

Jim Hu

=====================================
Jim Hu
Associate Professor
Dept. of Biochemistry and Biophysics
2128 TAMU
Texas A&M Univ.
College Station, TX 77843-2128
979-862-4054




From ajmackey at gmail.com  Mon Sep  8 19:57:50 2008
From: ajmackey at gmail.com (Aaron Mackey)
Date: Mon, 8 Sep 2008 15:57:50 -0400
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
Message-ID: <24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>

How can you handle features that may cross the origin more than once?
The modulus, though simple, seems to be only half the solution.  It
also makes it difficult to place features in the genome "by eye"
(having to do the modulus subtraction in my head), or in
sorting/filtering operations.

I have an alternative that I wondered if you considered: allow the
start/end to have an additional "circular revolution" prefix:

a typical range tuple like: 100 200 -
is thus shorthand for: 0:100 0:200 -
(i.e. both the 100 and 200 are in the same "revolution" around the genome)

and is then distinguishable from an "around the genome + 100" feature of:
1:100 0:200 -

Just an alternative to consider (if you haven't already).  I'm not
wedded to the syntax, but I wouldn't want to see new columns in GFF
just for this.  Essentially, what you want is some form of compound
polar coordinates, it seems.

-Aaron

On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
> In discussions with GMOD about Gbrowse, we've come up with a proposal for
> handling circular genomes and features that cross the origin in such
> genomes.  This applies to lots of prokaryotic and viral genomes, and might
> be valuable for some ways of representing terminally redundant linear
> genomes.
> 1) Keep the requirement that start < end
> 2) allow end > parent feature length
> 3) parent feature gets an is_circular boolean
> 4) use modular arithmetic to calculate the real position of end on the
> parent feature.
> We'd like to do this in a way that will be consistent with Chado and BioPerl
> representation of features as much as possible (realizing that there is the
> usual interbase or not coordinate issue).  What do people think?  Lincoln is
> on board for modifying the GFF3 spec.
> Thanks!
> Jim Hu
>
> =====================================
>
> Jim Hu
>
> Associate Professor
>
> Dept. of Biochemistry and Biophysics
>
> 2128 TAMU
>
> Texas A&M Univ.
>
> College Station, TX 77843-2128
>
> 979-862-4054
>
>
> -------------------------------------------------------------------------
> This SF.Net email is sponsored by the Moblin Your Move Developer's challenge
> Build the coolest Linux based applications with Moblin SDK & win great
> prizes
> Grand prize is a trip for two to an Open Source event anywhere in the world
> http://moblin-contest.org/redirect.php?banner_id=100&url=/
> _______________________________________________
> Gmod-schema mailing list
> Gmod-schema at lists.sourceforge.net
> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>
>


From js5 at sanger.ac.uk  Mon Sep  8 20:13:12 2008
From: js5 at sanger.ac.uk (James Smith)
Date: Mon, 8 Sep 2008 21:13:12 +0100 (BST)
Subject: [Bioperl-l] Circular genomes in Chado/BioPerl
In-Reply-To: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
Message-ID: <Pine.LNX.4.64.0809082111280.23303@cbi4g.internal.sanger.ac.uk>



On Mon, 8 Sep 2008, Jim Hu wrote:

> In discussions with GMOD about Gbrowse, we've come up with a proposal for 
> handling circular genomes and features that cross the origin in such genomes. 
> This applies to lots of prokaryotic and viral genomes, and might be valuable 
> for some ways of representing terminally redundant linear genomes.
>
> 1) Keep the requirement that start < end
> 2) allow end > parent feature length
> 3) parent feature gets an is_circular boolean
> 4) use modular arithmetic to calculate the real position of end on the parent 
> feature.

This is how we are considering handling features in Ensembl as well (the 
Ensembl genomes project will be setting up websites for bacterial and 
viral genomes)


>
> We'd like to do this in a way that will be consistent with Chado and BioPerl 
> representation of features as much as possible (realizing that there is the 
> usual interbase or not coordinate issue).  What do people think?  Lincoln is 
> on board for modifying the GFF3 spec.
>
> Thanks!
>
> Jim Hu
>
> =====================================
> Jim Hu
> Associate Professor
> Dept. of Biochemistry and Biophysics
> 2128 TAMU
> Texas A&M Univ.
> College Station, TX 77843-2128
> 979-862-4054
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 


From heikki at sanbi.ac.za  Tue Sep  9 07:50:11 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Tue, 9 Sep 2008 09:50:11 +0200
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better (w/ patch)
In-Reply-To: <m263pabenk.fsf@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
Message-ID: <200809090950.11821.heikki@sanbi.ac.za>

George,

This is an error from my side. Great that you have a fix already.

My only worry is the number of external dependencies in BioPerl. To limit 
these we have recoded number of functionalities into BioPerl-specific modules. 
Before you commit the fix, could you see if Bio::RangeI could be used or easily 
extended to be used instead of Set::IntSpan?

Thanks,

   -Heikki

On Friday 05 September 2008 21:01:35 George Hartzell wrote:
> Hi all,
>
> Bio::Coordinate::Collection surprised me a bit.  At first I thought
> there was a bug, but it's clearly doing what it's supposed to.  Now
> I'm wondering if what it's supposed to be doing makes sense in some
> context, or if what I expected would be better functionality.
>
> t/CoordinateMapper.t sets up the following scenario:
>
> #
> # Collection
> #
> #         1   5     6   10
> #         |---|     |---|
> #-----|-----------------------
> #     1   5   9     15  19
> #         pair1     pair2
>
> Then goes on to do the following query:
>
>   # match more than two
>   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
>   ok $res = $transcribe->map($pos);
>   is $res->each_gap, 2;
>   is $res->each_match, 2;
>
> I was surprised to see that there were two gaps, one gene:10-19 and
> one from gene:5-14.  Looking at the code, what's really happening is
> that, for the exon1 mapper there's match with gene:5-9 and a gap with
> gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
> match with gene:15-19.  All four Result's just get tossed into the
> return value.
>
> The result my intuition wants is that there are two matches (gene:5-9
> with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
>
> Yes, I guess that I could just synthesize these myself from the result
> in my app.
>
> It still seems that the current result is a bug though, since there's
> no way of knowing when you're walking through $res->each_Location that
> the first "gap" is with respect to the exon1 mapper and that the
> second "gap" is with respect to the exon2 mapper.  The gaps are
> meaningless.
>
> I "fixed" it to work the way I think it should (two matches, one
> gap).  I actually extended the test case a bit so that there's a
> multi-base gap, a match, another multibase-gap, another match, then a
> single base gap (just to make sure I got that right...).  I had to
> touch up the test file a bit to account for my new test.
>
> The gaps that I return have a strand of 'undef', which seems to be The
> Right Thing.  There's also a bit of funny business where I hang onto
> the seq_id of the gapped sequence.  It assumes that the "in" sequence
> is the same for all of the mappers.  This seems safe since otherwise
> the entire query is kind of weird....
>
> There's a patch to todays svn head at:
>
>   http://shrimp.alerce.com/bioperl/collection-diffs.txt
>
> The patch changes Build.PL to include a dependency on Set::IntSpan,
> CoordinateMapper.t to update the tests, and
> Bio/CoordinateMapper/Collection.pm for the new code.
>
> Who's code would this break.
>
> If anyone's relying on the current behaviour re: gaps, what's the
> situation in which you find it useful?
>
> Thanks!
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From heikki at sanbi.ac.za  Tue Sep  9 07:50:11 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Tue, 9 Sep 2008 09:50:11 +0200
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better (w/ patch)
In-Reply-To: <m263pabenk.fsf@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
Message-ID: <200809090950.11821.heikki@sanbi.ac.za>

George,

This is an error from my side. Great that you have a fix already.

My only worry is the number of external dependencies in BioPerl. To limit 
these we have recoded number of functionalities into BioPerl-specific modules. 
Before you commit the fix, could you see if Bio::RangeI could be used or easily 
extended to be used instead of Set::IntSpan?

Thanks,

   -Heikki

On Friday 05 September 2008 21:01:35 George Hartzell wrote:
> Hi all,
>
> Bio::Coordinate::Collection surprised me a bit.  At first I thought
> there was a bug, but it's clearly doing what it's supposed to.  Now
> I'm wondering if what it's supposed to be doing makes sense in some
> context, or if what I expected would be better functionality.
>
> t/CoordinateMapper.t sets up the following scenario:
>
> #
> # Collection
> #
> #         1   5     6   10
> #         |---|     |---|
> #-----|-----------------------
> #     1   5   9     15  19
> #         pair1     pair2
>
> Then goes on to do the following query:
>
>   # match more than two
>   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
>   ok $res = $transcribe->map($pos);
>   is $res->each_gap, 2;
>   is $res->each_match, 2;
>
> I was surprised to see that there were two gaps, one gene:10-19 and
> one from gene:5-14.  Looking at the code, what's really happening is
> that, for the exon1 mapper there's match with gene:5-9 and a gap with
> gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
> match with gene:15-19.  All four Result's just get tossed into the
> return value.
>
> The result my intuition wants is that there are two matches (gene:5-9
> with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
>
> Yes, I guess that I could just synthesize these myself from the result
> in my app.
>
> It still seems that the current result is a bug though, since there's
> no way of knowing when you're walking through $res->each_Location that
> the first "gap" is with respect to the exon1 mapper and that the
> second "gap" is with respect to the exon2 mapper.  The gaps are
> meaningless.
>
> I "fixed" it to work the way I think it should (two matches, one
> gap).  I actually extended the test case a bit so that there's a
> multi-base gap, a match, another multibase-gap, another match, then a
> single base gap (just to make sure I got that right...).  I had to
> touch up the test file a bit to account for my new test.
>
> The gaps that I return have a strand of 'undef', which seems to be The
> Right Thing.  There's also a bit of funny business where I hang onto
> the seq_id of the gapped sequence.  It assumes that the "in" sequence
> is the same for all of the mappers.  This seems safe since otherwise
> the entire query is kind of weird....
>
> There's a patch to todays svn head at:
>
>   http://shrimp.alerce.com/bioperl/collection-diffs.txt
>
> The patch changes Build.PL to include a dependency on Set::IntSpan,
> CoordinateMapper.t to update the tests, and
> Bio/CoordinateMapper/Collection.pm for the new code.
>
> Who's code would this break.
>
> If anyone's relying on the current behaviour re: gaps, what's the
> situation in which you find it useful?
>
> Thanks!
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From Frigerio at pierroton.inra.fr  Tue Sep  9 08:45:19 2008
From: Frigerio at pierroton.inra.fr (Jean-Marc FRIGERIO)
Date: Tue, 9 Sep 2008 10:45:19 +0200
Subject: [Bioperl-l] parsing result of CAP3 (ACE file)
Message-ID: <200809091045.19249.Frigerio@pierroton.inra.fr>

> > -- Hi,
> >
> > Is somebody have a piece of code to parse result of CAP3 assembly program
> > which
> > format is ACE ?
> > I need to retrieve the alignment from this file.
> >
> > thank you,
> > Laurent --
> >
> >
> >
> >
> > +---------------------------------------------+
> >  Laurent Manchon
> >  Email: lmanchon at univ-montp2.fr
> > +---------------------------------------------+
>
> Laurent -
>
> I have modified modules that will do it as I recently ran into problems
> with the DB_FILE module in Assembly::IO.  In addition, the current version
> of cap3 seems to put a contig length where a pad length is expected (based
> on the Ace format description).  The modules I have will parse the ace file
> contig-by-contig rather than having the entire assembly slurped into memory
> (or a tied hash) all at once.  You are welcome to them if you are
> interested and I'd like to get them in Bioperl at some point.  Bascially,
> there are three files - a modified Contig.pm, ContigIO.pm, and a modified
> ace.pm (in a ContigIO directory).
>
> Josh

Hi,
Here are a 2 pieces of code running on an ace file (output of phrap is that 
the same as cap3 ?)
----------------------------- 1 -----------------------------------------
my $assembly = Bio::Assembly::IO->new('-file'    => $file,
                                 '-format'  => 'ace')->next_assembly;

for my $contig ($assembly->all_contigs)
{
    my $ct_seq  = $contig->get_consensus_sequence;
    (my $ref_seq = uc $ct_seq->seq) =~ s/-//g;

    my $debut  = $pos - 100 > 0 ? $pos - 100 : 1;
    my $fin    = $pos + 100 <= length $ref_seq ?
                 $pos + 100 :  length $ref_seq;

    my $coll = $contig->get_features_collection;
    my @coll = $coll->features_in_range('-start' => $debut, '-end' => $fin);
    for my $tag (@coll)
    {
        next unless  $tag->primary_tag eq 'comment';
#print "TAG: ",$tag->start,"\n";
        my $tag_pos = $contig->change_coord('gapped consensus','ungapped 
consensus',$tag->start);
#print "TAG POS: $tag_pos\n";
        next if $pos == $tag_pos;

        substr($ref_seq,$tag_pos-1,1,'N');

    }
}



------------------------------------ 2 -------------------
 my $assembly = Bio::Assembly::IO->new(
    '-file'    => $file,
    '-format'  => 'ace')->next_assembly;
  for my $contig ($assembly->all_contigs)
  {
    for my $seq ($contig->each_seq)
    {
      my $id = $seq->id;
      my $s = $seq->seq;
      my ($start,$end) =
        ($contig->change_coord("aligned $id","ungapped consensus",
$seq->start),
         $contig->change_coord("aligned $id","ungapped consensus",$seq->end));
      my $dir = $seq->strand < 0 ? 'R' : 'F';
 ......
}
	-- Jean-Marc


From zheboyang at gmail.com  Tue Sep  9 11:05:15 2008
From: zheboyang at gmail.com (boyang zhe)
Date: Tue, 9 Sep 2008 19:05:15 +0800
Subject: [Bioperl-l] help:HMM parsing error
Message-ID: <127e75f60809090405h644e51eftcab073e8bf179720@mail.gmail.com>

  I write a script to parse the HMMER report ,it is as follows:
   #!/usr/bin/perl -w
   #TODO: Parse the HMMER report
   use strict;
   use Bio::SearchIO;
   my $directory="./HMM/";
   opendir(HMMDIR, $directory), or die "Can't open the directory!";
   my @filelist=readdir(HMMDIR);
   foreach my $filename(@filelist)
   {
   if ($filename !~/^\./)
   {
   my $infile="$directory"."$filename";
   my $outfile="$infile"."HMMParse";
   my $in = new Bio::SearchIO(-format => 'hmmer',-file =>"$infile");

- Ignored:
   while (my  $result= $in->next_result )
   {
   # get a Bio::Search::Result::HMMERResult object
   # get hits numbers
   my $hitnumber=$result->num_hits;
   if ($hitnumber != 0)
   {
   open(OUT, ">$outfile"), or die "can't open the output file!!!!";
   while (my $hits= $result->next_hit )
   {
   my $value=$hits->significance;
   if ($value <=0.01)
   {
         print OUT
   $hits->name,"\t",$hits->description,"\t",$hits->significance,"\n";
   }
   }
   close OUT;
   }
   }
   }
   }
   closedir(HMMDIR);
   ##############################################################

   When it run, you will see that:

   -------------------- WARNING ---------------------
   MSG: unrecognized line:                      +E +L i T eek+ e+  ++ +l++H
   Y+   I+ +

   ---------------------------------------------------

   why? I hope to get your help, hanks very much!

- Done.


From bix at sendu.me.uk  Tue Sep  9 11:46:39 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 09 Sep 2008 12:46:39 +0100
Subject: [Bioperl-l] help:HMM parsing error
In-Reply-To: <127e75f60809090405h644e51eftcab073e8bf179720@mail.gmail.com>
References: <127e75f60809090405h644e51eftcab073e8bf179720@mail.gmail.com>
Message-ID: <48C6621F.8040304@sendu.me.uk>

boyang zhe wrote:
>   I write a script to parse the HMMER report ,it is as follows:
[...]
>    my $in = new Bio::SearchIO(-format => 'hmmer',-file =>"$infile");
[...]
>    -------------------- WARNING ---------------------
>    MSG: unrecognized line:                      +E +L i T eek+ e+  ++ +l++H
>    Y+   I+ +
> 
>    ---------------------------------------------------
> 
>    why? I hope to get your help, hanks very much!

I didn't check your code, but the easiest thing to try would be to use 
-format => 'hmmer_pull' to use an alternate parser that may be able to 
recognise that line. You might need to install the latest Bioperl from 
SVN (or at least 1.5.2) to get access to the hmmer_pull parser.


From bosborne11 at verizon.net  Tue Sep  9 14:50:38 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Tue, 9 Sep 2008 10:50:38 -0400
Subject: [Bioperl-l] SeqHound
In-Reply-To: <1220452426.31595.92.camel@pepa.cbm.uam.es>
References: <1220452426.31595.92.camel@pepa.cbm.uam.es>
Message-ID: <55655D67-352A-4E0D-B402-7FC30628C1B1@verizon.net>

Raul,

After spending a few minutes at bond.unleashedinformatics.com I have  
to admit that it's not clear how one accesses their free version of  
BOND. There are no examples that I can see in their packages.

If you are interested in looking at protein-protein networks in the  
Bioperl context you can also check out the bioperl-network package:

http://www.bioperl.org/wiki/Network_package

If you don't care what language you're using then you should consider  
Cytoscape, it's probably the package with the most capability.


Brian O.


On Sep 3, 2008, at 10:33 AM, Raul Mendez Giraldez wrote:

> Hi Chris,
>
> I'm trying to set up and run bioperl Seqhound donwloaded from:
>
> http://bond.unleashedinformatics.com/downloads/api//seqhound-bioperl-4.0.tar.gz
>
> and I always get connection error messages. Do you know which  
> version of
> SeqHound should I use and how can I configure to make it work? I've
> tried several possibilities for server1 at .shoundremrc as
>
> [remote]
> server1 = bond.unleashedinformatics.com
> CGI = /cgi-bin/seqrem
> port=8080
>
> Also, I would like to get all the possible protein-protein interaction
> for a set of protein sequences. Would this be possible using SeqHound?
>
> Thanks,
> Ra?l
>
>
>
>
> -- 
> Ra?l M?ndez Gir?ldez, Ph.D.
> Bioinformatics Unit
> Centre for Molecular Biology "Severo Ochoa"
> Universidad Aut?noma de Madrid
> C/ Nicol?s Cabrera, 1
> Cantoblanco 28049, Madrid
> SPAIN
>
> Phone: +34 91 196 4633
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




From jimhu at tamu.edu  Tue Sep  9 16:05:59 2008
From: jimhu at tamu.edu (Jim Hu)
Date: Tue, 9 Sep 2008 11:05:59 -0500
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
Message-ID: <AFDAB313-524D-441B-8723-027484D15142@tamu.edu>

Hi Aaron,

I was thinking this would be handled by making the end=parent feature  
length x 2 + end coord.  end/parent length = number of times crosses  
origin.

Jim

On Sep 8, 2008, at 2:57 PM, Aaron Mackey wrote:

> How can you handle features that may cross the origin more than once?
> The modulus, though simple, seems to be only half the solution.  It
> also makes it difficult to place features in the genome "by eye"
> (having to do the modulus subtraction in my head), or in
> sorting/filtering operations.
>
> I have an alternative that I wondered if you considered: allow the
> start/end to have an additional "circular revolution" prefix:
>
> a typical range tuple like: 100 200 -
> is thus shorthand for: 0:100 0:200 -
> (i.e. both the 100 and 200 are in the same "revolution" around the  
> genome)
>
> and is then distinguishable from an "around the genome + 100"  
> feature of:
> 1:100 0:200 -
>
> Just an alternative to consider (if you haven't already).  I'm not
> wedded to the syntax, but I wouldn't want to see new columns in GFF
> just for this.  Essentially, what you want is some form of compound
> polar coordinates, it seems.
>
> -Aaron
>
> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>> In discussions with GMOD about Gbrowse, we've come up with a  
>> proposal for
>> handling circular genomes and features that cross the origin in such
>> genomes.  This applies to lots of prokaryotic and viral genomes,  
>> and might
>> be valuable for some ways of representing terminally redundant linear
>> genomes.
>> 1) Keep the requirement that start < end
>> 2) allow end > parent feature length
>> 3) parent feature gets an is_circular boolean
>> 4) use modular arithmetic to calculate the real position of end on  
>> the
>> parent feature.
>> We'd like to do this in a way that will be consistent with Chado  
>> and BioPerl
>> representation of features as much as possible (realizing that  
>> there is the
>> usual interbase or not coordinate issue).  What do people think?   
>> Lincoln is
>> on board for modifying the GFF3 spec.
>> Thanks!
>> Jim Hu
>>
>> =====================================
>>
>> Jim Hu
>>
>> Associate Professor
>>
>> Dept. of Biochemistry and Biophysics
>>
>> 2128 TAMU
>>
>> Texas A&M Univ.
>>
>> College Station, TX 77843-2128
>>
>> 979-862-4054
>>
>>
>> -------------------------------------------------------------------------
>> This SF.Net email is sponsored by the Moblin Your Move Developer's  
>> challenge
>> Build the coolest Linux based applications with Moblin SDK & win  
>> great
>> prizes
>> Grand prize is a trip for two to an Open Source event anywhere in  
>> the world
>> http://moblin-contest.org/redirect.php?banner_id=100&url=/
>> _______________________________________________
>> Gmod-schema mailing list
>> Gmod-schema at lists.sourceforge.net
>> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>>
>>

=====================================
Jim Hu
Associate Professor
Dept. of Biochemistry and Biophysics
2128 TAMU
Texas A&M Univ.
College Station, TX 77843-2128
979-862-4054




From jason at bioperl.org  Tue Sep  9 16:07:45 2008
From: jason at bioperl.org (Jason Stajich)
Date: Tue, 9 Sep 2008 09:07:45 -0700
Subject: [Bioperl-l] help:HMM parsing error
In-Reply-To: <48C6621F.8040304@sendu.me.uk>
References: <127e75f60809090405h644e51eftcab073e8bf179720@mail.gmail.com>
	<48C6621F.8040304@sendu.me.uk>
Message-ID: <DE35F9B2-20FE-4554-9F53-6F838849B0C6@bioperl.org>

Although it would be good to fix the parser as well --  best solution  
is to submit that report as a bug to bugzilla
http://bugzilla.open-bio.org/

-jason

On Sep 9, 2008, at 4:46 AM, Sendu Bala wrote:

> boyang zhe wrote:
>>  I write a script to parse the HMMER report ,it is as follows:
> [...]
>>   my $in = new Bio::SearchIO(-format => 'hmmer',-file =>"$infile");
> [...]
>>   -------------------- WARNING ---------------------
>>   MSG: unrecognized line:                      +E +L i T eek+ e+  + 
>> + +l++H
>>   Y+   I+ +
>>   ---------------------------------------------------
>>   why? I hope to get your help, hanks very much!
>
> I didn't check your code, but the easiest thing to try would be to  
> use -format => 'hmmer_pull' to use an alternate parser that may be  
> able to recognise that line. You might need to install the latest  
> Bioperl from SVN (or at least 1.5.2) to get access to the hmmer_pull  
> parser.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From cain.cshl at gmail.com  Tue Sep  9 17:33:12 2008
From: cain.cshl at gmail.com (Scott Cain)
Date: Tue, 9 Sep 2008 13:33:12 -0400
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
Message-ID: <536f21b00809091033v1e412f4ft54d8e139c347a20a@mail.gmail.com>

Hi Jim and All,

While I agree with Aaron's point that it is not easy to place features
by visual inspection, this seems like a fairly minor point.  The vast
majority of GFF3 manipulation will be done in software, so as long as
the API handles everything correctly, life is good.  If we discount
that objection, there doesn't seem to be much advantage of using
Aaron's suggested method over Jim's.

(As a side note--I have the same complaint about anything in XML--it
is awful for a human to read.  I still live with XML when I have to
though :-)

Additionally, the fact that Ensembl is using the same method as what
Jim describes is a fairly powerful argument for doing the same.
Hopefully there can be some code reuse.

Scott


On Tue, Sep 9, 2008 at 12:05 PM, Jim Hu <jimhu at tamu.edu> wrote:
> Hi Aaron,
> I was thinking this would be handled by making the end=parent feature length
> x 2 + end coord.  end/parent length = number of times crosses origin.
> Jim
> On Sep 8, 2008, at 2:57 PM, Aaron Mackey wrote:
>
> How can you handle features that may cross the origin more than once?
> The modulus, though simple, seems to be only half the solution.  It
> also makes it difficult to place features in the genome "by eye"
> (having to do the modulus subtraction in my head), or in
> sorting/filtering operations.
>
> I have an alternative that I wondered if you considered: allow the
> start/end to have an additional "circular revolution" prefix:
>
> a typical range tuple like: 100 200 -
> is thus shorthand for: 0:100 0:200 -
> (i.e. both the 100 and 200 are in the same "revolution" around the genome)
>
> and is then distinguishable from an "around the genome + 100" feature of:
> 1:100 0:200 -
>
> Just an alternative to consider (if you haven't already).  I'm not
> wedded to the syntax, but I wouldn't want to see new columns in GFF
> just for this.  Essentially, what you want is some form of compound
> polar coordinates, it seems.
>
> -Aaron
>
> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>
> In discussions with GMOD about Gbrowse, we've come up with a proposal for
>
> handling circular genomes and features that cross the origin in such
>
> genomes.  This applies to lots of prokaryotic and viral genomes, and might
>
> be valuable for some ways of representing terminally redundant linear
>
> genomes.
>
> 1) Keep the requirement that start < end
>
> 2) allow end > parent feature length
>
> 3) parent feature gets an is_circular boolean
>
> 4) use modular arithmetic to calculate the real position of end on the
>
> parent feature.
>
> We'd like to do this in a way that will be consistent with Chado and BioPerl
>
> representation of features as much as possible (realizing that there is the
>
> usual interbase or not coordinate issue).  What do people think?  Lincoln is
>
> on board for modifying the GFF3 spec.
>
> Thanks!
>
> Jim Hu
>
> =====================================
>
> Jim Hu
>
> Associate Professor
>
> Dept. of Biochemistry and Biophysics
>
> 2128 TAMU
>
> Texas A&M Univ.
>
> College Station, TX 77843-2128
>
> 979-862-4054
>
>
> -------------------------------------------------------------------------
>
> This SF.Net email is sponsored by the Moblin Your Move Developer's challenge
>
> Build the coolest Linux based applications with Moblin SDK & win great
>
> prizes
>
> Grand prize is a trip for two to an Open Source event anywhere in the world
>
> http://moblin-contest.org/redirect.php?banner_id=100&url=/
>
> _______________________________________________
>
> Gmod-schema mailing list
>
> Gmod-schema at lists.sourceforge.net
>
> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>
>
>
> =====================================
>
> Jim Hu
>
> Associate Professor
>
> Dept. of Biochemistry and Biophysics
>
> 2128 TAMU
>
> Texas A&M Univ.
>
> College Station, TX 77843-2128
>
> 979-862-4054
>
>
> -------------------------------------------------------------------------
> This SF.Net email is sponsored by the Moblin Your Move Developer's challenge
> Build the coolest Linux based applications with Moblin SDK & win great
> prizes
> Grand prize is a trip for two to an Open Source event anywhere in the world
> http://moblin-contest.org/redirect.php?banner_id=100&url=/
> _______________________________________________
> Gmod-schema mailing list
> Gmod-schema at lists.sourceforge.net
> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>
>



-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   cain.cshl at gmail.com
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory


From lincoln.stein at gmail.com  Tue Sep  9 17:52:36 2008
From: lincoln.stein at gmail.com (Lincoln Stein)
Date: Tue, 9 Sep 2008 13:52:36 -0400
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
Message-ID: <6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>

It seems to me that the proposed modulus syntax handles multiple
revolutions. Consider a 100 bp genome (to make it simple) and a feature that
starts at 50, goes around twice, and ends at position 60:

  start = 50
  end  = 260

length = end - start + 1
revolutions = int (length/genome)
stop position = length % genome + 1

Lincoln

On Mon, Sep 8, 2008 at 3:57 PM, Aaron Mackey <ajmackey at gmail.com> wrote:

> How can you handle features that may cross the origin more than once?
> The modulus, though simple, seems to be only half the solution.  It
> also makes it difficult to place features in the genome "by eye"
> (having to do the modulus subtraction in my head), or in
> sorting/filtering operations.
>
> I have an alternative that I wondered if you considered: allow the
> start/end to have an additional "circular revolution" prefix:
>
> a typical range tuple like: 100 200 -
> is thus shorthand for: 0:100 0:200 -
> (i.e. both the 100 and 200 are in the same "revolution" around the genome)
>
> and is then distinguishable from an "around the genome + 100" feature of:
> 1:100 0:200 -
>
> Just an alternative to consider (if you haven't already).  I'm not
> wedded to the syntax, but I wouldn't want to see new columns in GFF
> just for this.  Essentially, what you want is some form of compound
> polar coordinates, it seems.
>
> -Aaron
>
> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
> > In discussions with GMOD about Gbrowse, we've come up with a proposal for
> > handling circular genomes and features that cross the origin in such
> > genomes.  This applies to lots of prokaryotic and viral genomes, and
> might
> > be valuable for some ways of representing terminally redundant linear
> > genomes.
> > 1) Keep the requirement that start < end
> > 2) allow end > parent feature length
> > 3) parent feature gets an is_circular boolean
> > 4) use modular arithmetic to calculate the real position of end on the
> > parent feature.
> > We'd like to do this in a way that will be consistent with Chado and
> BioPerl
> > representation of features as much as possible (realizing that there is
> the
> > usual interbase or not coordinate issue).  What do people think?  Lincoln
> is
> > on board for modifying the GFF3 spec.
> > Thanks!
> > Jim Hu
> >
> > =====================================
> >
> > Jim Hu
> >
> > Associate Professor
> >
> > Dept. of Biochemistry and Biophysics
> >
> > 2128 TAMU
> >
> > Texas A&M Univ.
> >
> > College Station, TX 77843-2128
> >
> > 979-862-4054
> >
> >
> > -------------------------------------------------------------------------
> > This SF.Net email is sponsored by the Moblin Your Move Developer's
> challenge
> > Build the coolest Linux based applications with Moblin SDK & win great
> > prizes
> > Grand prize is a trip for two to an Open Source event anywhere in the
> world
> > http://moblin-contest.org/redirect.php?banner_id=100&url=/
> > _______________________________________________
> > Gmod-schema mailing list
> > Gmod-schema at lists.sourceforge.net
> > https://lists.sourceforge.net/lists/listinfo/gmod-schema
> >
> >
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Lincoln D. Stein

Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Stacey Quinn <Stacey.Quinn at oicr.on.ca>

Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724 USA
(516) 367-8380
Assistant: Sandra Michelsen <michelse at cshl.edu>


From cjfields at illinois.edu  Tue Sep  9 18:24:49 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 9 Sep 2008 13:24:49 -0500
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
Message-ID: <ACC71DEA-378C-4FB3-8C09-A85EC0858924@illinois.edu>

Is there any particular reason we don't treat this similarly to the  
way BioPerl does, which is to simply treat the origin-overlapping  
feature as a split location?  GenBank treats this similarly.  For an  
faux example, the bug I just fixed for bugzilla has one:

http://bugzilla.open-bio.org/show_bug.cgi?id=2579

An actual GenBank case is the Sulfolobus solfataricus genome  
(NC_002754), and I'm sure Jim could come up with more.  The only  
caveat is whether we should represent this

As for multiple revolutions, I'm not sure the hand-wringing about  
specifics is worth it unless we have explicit workable examples to  
test against (preferably examples which would potentially pop up), but  
Lincoln's proposal sounds fine.

chris

On Sep 9, 2008, at 11:05 AM, Jim Hu wrote:

> Hi Aaron,
>
> I was thinking this would be handled by making the end=parent  
> feature length x 2 + end coord.  end/parent length = number of times  
> crosses origin.
>
> Jim
>
> On Sep 8, 2008, at 2:57 PM, Aaron Mackey wrote:
>
>> How can you handle features that may cross the origin more than once?
>> The modulus, though simple, seems to be only half the solution.  It
>> also makes it difficult to place features in the genome "by eye"
>> (having to do the modulus subtraction in my head), or in
>> sorting/filtering operations.
>>
>> I have an alternative that I wondered if you considered: allow the
>> start/end to have an additional "circular revolution" prefix:
>>
>> a typical range tuple like: 100 200 -
>> is thus shorthand for: 0:100 0:200 -
>> (i.e. both the 100 and 200 are in the same "revolution" around the  
>> genome)
>>
>> and is then distinguishable from an "around the genome + 100"  
>> feature of:
>> 1:100 0:200 -
>>
>> Just an alternative to consider (if you haven't already).  I'm not
>> wedded to the syntax, but I wouldn't want to see new columns in GFF
>> just for this.  Essentially, what you want is some form of compound
>> polar coordinates, it seems.
>>
>> -Aaron
>>
>> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>>> In discussions with GMOD about Gbrowse, we've come up with a  
>>> proposal for
>>> handling circular genomes and features that cross the origin in such
>>> genomes.  This applies to lots of prokaryotic and viral genomes,  
>>> and might
>>> be valuable for some ways of representing terminally redundant  
>>> linear
>>> genomes.
>>> 1) Keep the requirement that start < end
>>> 2) allow end > parent feature length
>>> 3) parent feature gets an is_circular boolean
>>> 4) use modular arithmetic to calculate the real position of end on  
>>> the
>>> parent feature.
>>> We'd like to do this in a way that will be consistent with Chado  
>>> and BioPerl
>>> representation of features as much as possible (realizing that  
>>> there is the
>>> usual interbase or not coordinate issue).  What do people think?   
>>> Lincoln is
>>> on board for modifying the GFF3 spec.
>>> Thanks!
>>> Jim Hu
>>>
>>> =====================================
>>>
>>> Jim Hu
>>>
>>> Associate Professor
>>>
>>> Dept. of Biochemistry and Biophysics
>>>
>>> 2128 TAMU
>>>
>>> Texas A&M Univ.
>>>
>>> College Station, TX 77843-2128
>>>
>>> 979-862-4054
>>>
>>>
>>> -------------------------------------------------------------------------
>>> This SF.Net email is sponsored by the Moblin Your Move Developer's  
>>> challenge
>>> Build the coolest Linux based applications with Moblin SDK & win  
>>> great
>>> prizes
>>> Grand prize is a trip for two to an Open Source event anywhere in  
>>> the world
>>> http://moblin-contest.org/redirect.php?banner_id=100&url=/
>>> _______________________________________________
>>> Gmod-schema mailing list
>>> Gmod-schema at lists.sourceforge.net
>>> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>>>
>>>
>
> =====================================
> Jim Hu
> Associate Professor
> Dept. of Biochemistry and Biophysics
> 2128 TAMU
> Texas A&M Univ.
> College Station, TX 77843-2128
> 979-862-4054
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From ajmackey at gmail.com  Tue Sep  9 18:48:12 2008
From: ajmackey at gmail.com (Aaron Mackey)
Date: Tue, 9 Sep 2008 14:48:12 -0400
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
Message-ID: <24c96eca0809091148l738604a7q13fba54ac05de01c@mail.gmail.com>

Right, the modulus calculation continues to work, but for instance,
what'll happen when I now ask Gbrowse (or Ensembl) to show me
positions 50..260?  Will it show me 50 .. 60, 1:100, or "unroll" the
genome twice from 50..260 (that'd be a pretty cute trick, by the way!)

You're (re)using simple arithmetic to compress a compound coordinate
into a single-valued coordinate (which I realize can be trivially
packed and unpacked by software), but I worry about the downstream
consequences of software having to always remember that the
coordinates given may have to be unpacked or not, and not being able
to immediately identify whether "260" is a real or compound
coordinate.

To say it another way, I'm happy (that is, don't care much) whether
Chado or any other underlying data storage uses such compound
coordinates, because only Chado-reliant tools will need to care; but I
do worry about GFF3 as a (relatively) simple exchange format having
that kind of silent bug-causing complexity.  I'd much rather see GFF
be syntactically explicit, and not quite so cleverly implicit.

Just one GFF user's two cents, thanks for listening,

-Aaron

On Tue, Sep 9, 2008 at 1:52 PM, Lincoln Stein <lincoln.stein at gmail.com> wrote:
> It seems to me that the proposed modulus syntax handles multiple
> revolutions. Consider a 100 bp genome (to make it simple) and a feature that
> starts at 50, goes around twice, and ends at position 60:
>
>   start = 50
>   end  = 260
>
> length = end - start + 1
> revolutions = int (length/genome)
> stop position = length % genome + 1
>
> Lincoln
>
> On Mon, Sep 8, 2008 at 3:57 PM, Aaron Mackey <ajmackey at gmail.com> wrote:
>>
>> How can you handle features that may cross the origin more than once?
>> The modulus, though simple, seems to be only half the solution.  It
>> also makes it difficult to place features in the genome "by eye"
>> (having to do the modulus subtraction in my head), or in
>> sorting/filtering operations.
>>
>> I have an alternative that I wondered if you considered: allow the
>> start/end to have an additional "circular revolution" prefix:
>>
>> a typical range tuple like: 100 200 -
>> is thus shorthand for: 0:100 0:200 -
>> (i.e. both the 100 and 200 are in the same "revolution" around the genome)
>>
>> and is then distinguishable from an "around the genome + 100" feature of:
>> 1:100 0:200 -
>>
>> Just an alternative to consider (if you haven't already).  I'm not
>> wedded to the syntax, but I wouldn't want to see new columns in GFF
>> just for this.  Essentially, what you want is some form of compound
>> polar coordinates, it seems.
>>
>> -Aaron
>>
>> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>> > In discussions with GMOD about Gbrowse, we've come up with a proposal
>> > for
>> > handling circular genomes and features that cross the origin in such
>> > genomes.  This applies to lots of prokaryotic and viral genomes, and
>> > might
>> > be valuable for some ways of representing terminally redundant linear
>> > genomes.
>> > 1) Keep the requirement that start < end
>> > 2) allow end > parent feature length
>> > 3) parent feature gets an is_circular boolean
>> > 4) use modular arithmetic to calculate the real position of end on the
>> > parent feature.
>> > We'd like to do this in a way that will be consistent with Chado and
>> > BioPerl
>> > representation of features as much as possible (realizing that there is
>> > the
>> > usual interbase or not coordinate issue).  What do people think?
>> >  Lincoln is
>> > on board for modifying the GFF3 spec.
>> > Thanks!
>> > Jim Hu
>> >
>> > =====================================
>> >
>> > Jim Hu
>> >
>> > Associate Professor
>> >
>> > Dept. of Biochemistry and Biophysics
>> >
>> > 2128 TAMU
>> >
>> > Texas A&M Univ.
>> >
>> > College Station, TX 77843-2128
>> >
>> > 979-862-4054
>> >
>> >
>> >
>> > -------------------------------------------------------------------------
>> > This SF.Net email is sponsored by the Moblin Your Move Developer's
>> > challenge
>> > Build the coolest Linux based applications with Moblin SDK & win great
>> > prizes
>> > Grand prize is a trip for two to an Open Source event anywhere in the
>> > world
>> > http://moblin-contest.org/redirect.php?banner_id=100&url=/
>> > _______________________________________________
>> > Gmod-schema mailing list
>> > Gmod-schema at lists.sourceforge.net
>> > https://lists.sourceforge.net/lists/listinfo/gmod-schema
>> >
>> >
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> --
> Lincoln D. Stein
>
> Ontario Institute for Cancer Research
> 101 College St., Suite 800
> Toronto, ON, Canada M5G0A3
> 416 673-8514
> Assistant: Stacey Quinn <Stacey.Quinn at oicr.on.ca>
>
> Cold Spring Harbor Laboratory
> 1 Bungtown Road
> Cold Spring Harbor, NY 11724 USA
> (516) 367-8380
> Assistant: Sandra Michelsen <michelse at cshl.edu>
>


From cjfields at illinois.edu  Tue Sep  9 18:49:13 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 9 Sep 2008 13:49:13 -0500
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <ACC71DEA-378C-4FB3-8C09-A85EC0858924@illinois.edu>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<AFDAB313-524D-441B-8723-027484D15142@tamu.edu>
	<ACC71DEA-378C-4FB3-8C09-A85EC0858924@illinois.edu>
Message-ID: <8C6E5EBC-25B1-41E3-BB89-FD3C228A6B70@illinois.edu>

Sent just a bit too early!

On Sep 9, 2008, at 1:24 PM, Chris Fields wrote:

> Is there any particular reason we don't treat this similarly to the  
> way BioPerl does, which is to simply treat the origin-overlapping  
> feature as a split location?  GenBank treats this similarly.  For an  
> faux example, the bug I just fixed for bugzilla has one:
>
> http://bugzilla.open-bio.org/show_bug.cgi?id=2579
>
> An actual GenBank case is the Sulfolobus solfataricus genome  
> (NC_002754), and I'm sure Jim could come up with more.  The only  
> caveat is whether we should represent this

... as a 'special case' for features overlapping the origin in a  
circular sequence.

> As for multiple revolutions, I'm not sure the hand-wringing about  
> specifics is worth it unless we have explicit workable examples to  
> test against (preferably examples which would potentially pop up),  
> but Lincoln's proposal sounds fine.
>
> chris




From Russell.Smithies at agresearch.co.nz  Tue Sep  9 20:46:26 2008
From: Russell.Smithies at agresearch.co.nz (Smithies, Russell)
Date: Wed, 10 Sep 2008 08:46:26 +1200
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu><24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
Message-ID: <D5DBA313349A4B458528BE63B387F36C077822B4@imail.agresearch.co.nz>

Excuse my ignorance (I'm not a biologist) but is it biologically possible/likely for a gene or feature to wrap more than once around a genome?
Anyone got an example?


Russell Smithies 

Bioinformatics Applications Developer 

Invermay? Research Centre 
Puddle Alley, 
Mosgiel, 
New Zealand 





> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-
> bio.org] On Behalf Of Lincoln Stein
> Sent: Wednesday, 10 September 2008 5:53 a.m.
> To: Aaron Mackey
> Cc: GMOD Schema List; Jim Hu; Roy Welch; bioperl-l at bioperl.org; Mike Gribskov
> Subject: Re: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
> 
> It seems to me that the proposed modulus syntax handles multiple
> revolutions. Consider a 100 bp genome (to make it simple) and a feature that
> starts at 50, goes around twice, and ends at position 60:
> 
>   start = 50
>   end  = 260
> 
> length = end - start + 1
> revolutions = int (length/genome)
> stop position = length % genome + 1
> 
> Lincoln
> 
> On Mon, Sep 8, 2008 at 3:57 PM, Aaron Mackey <ajmackey at gmail.com> wrote:
> 
> > How can you handle features that may cross the origin more than once?
> > The modulus, though simple, seems to be only half the solution.  It
> > also makes it difficult to place features in the genome "by eye"
> > (having to do the modulus subtraction in my head), or in
> > sorting/filtering operations.
> >
> > I have an alternative that I wondered if you considered: allow the
> > start/end to have an additional "circular revolution" prefix:
> >
> > a typical range tuple like: 100 200 -
> > is thus shorthand for: 0:100 0:200 -
> > (i.e. both the 100 and 200 are in the same "revolution" around the genome)
> >
> > and is then distinguishable from an "around the genome + 100" feature of:
> > 1:100 0:200 -
> >
> > Just an alternative to consider (if you haven't already).  I'm not
> > wedded to the syntax, but I wouldn't want to see new columns in GFF
> > just for this.  Essentially, what you want is some form of compound
> > polar coordinates, it seems.
> >
> > -Aaron
> >
> > On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
> > > In discussions with GMOD about Gbrowse, we've come up with a proposal for
> > > handling circular genomes and features that cross the origin in such
> > > genomes.  This applies to lots of prokaryotic and viral genomes, and
> > might
> > > be valuable for some ways of representing terminally redundant linear
> > > genomes.
> > > 1) Keep the requirement that start < end
> > > 2) allow end > parent feature length
> > > 3) parent feature gets an is_circular boolean
> > > 4) use modular arithmetic to calculate the real position of end on the
> > > parent feature.
> > > We'd like to do this in a way that will be consistent with Chado and
> > BioPerl
> > > representation of features as much as possible (realizing that there is
> > the
> > > usual interbase or not coordinate issue).  What do people think?  Lincoln
> > is
> > > on board for modifying the GFF3 spec.
> > > Thanks!
> > > Jim Hu
> > >
> > > =====================================
> > >
> > > Jim Hu
> > >
> > > Associate Professor
> > >
> > > Dept. of Biochemistry and Biophysics
> > >
> > > 2128 TAMU
> > >
> > > Texas A&M Univ.
> > >
> > > College Station, TX 77843-2128
> > >
> > > 979-862-4054
> > >
> > >
> > > -------------------------------------------------------------------------
> > > This SF.Net email is sponsored by the Moblin Your Move Developer's
> > challenge
> > > Build the coolest Linux based applications with Moblin SDK & win great
> > > prizes
> > > Grand prize is a trip for two to an Open Source event anywhere in the
> > world
> > > http://moblin-contest.org/redirect.php?banner_id=100&url=/
> > > _______________________________________________
> > > Gmod-schema mailing list
> > > Gmod-schema at lists.sourceforge.net
> > > https://lists.sourceforge.net/lists/listinfo/gmod-schema
> > >
> > >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> 
> 
> 
> --
> Lincoln D. Stein
> 
> Ontario Institute for Cancer Research
> 101 College St., Suite 800
> Toronto, ON, Canada M5G0A3
> 416 673-8514
> Assistant: Stacey Quinn <Stacey.Quinn at oicr.on.ca>
> 
> Cold Spring Harbor Laboratory
> 1 Bungtown Road
> Cold Spring Harbor, NY 11724 USA
> (516) 367-8380
> Assistant: Sandra Michelsen <michelse at cshl.edu>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
=======================================================================
Attention: The information contained in this message and/or attachments
from AgResearch Limited is intended only for the persons or entities
to which it is addressed and may contain confidential and/or privileged
material. Any review, retransmission, dissemination or other use of, or
taking of any action in reliance upon, this information by persons or
entities other than the intended recipients is prohibited by AgResearch
Limited. If you have received this message in error, please notify the
sender immediately.
=======================================================================



From cjm at berkeleybop.org  Tue Sep  9 22:56:55 2008
From: cjm at berkeleybop.org (Chris Mungall)
Date: Tue, 9 Sep 2008 15:56:55 -0700
Subject: [Bioperl-l] [Gmod-schema] Circular genomes in Chado/BioPerl
In-Reply-To: <6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
References: <87B87004-A586-44A0-BB10-D4AA3FE9E669@tamu.edu>
	<24c96eca0809081257l16461b23uaefe8154ed038bea@mail.gmail.com>
	<6dce9a0b0809091052g1c398a84tfe8f89d1bf9132c8@mail.gmail.com>
Message-ID: <18A0C3BE-ED04-4494-9231-B945158D6CE4@berkeleybop.org>


I think I am happy with the modulo approach.

Though I believe we first of all need for a formal specification of  
genome interval semantics that is independent of any particular syntax  
or implementation. This can be a fairly short specification - along  
the lines of what Lincoln has written below (although I would  
naturally prefer the normative version to be interbase - this doesn't  
preclude derived axioms in GFF coordinates).

This spec should also define and standardize the terminology used:  
Lincoln draws a distinction between 'stop' and 'end'. I'm relatively  
happy with these terms - however, the choice we makes need to become  
enshrined otherwise we'll end up with confusion and mismatches between  
software and specification.

One clarification:

> revolutions = int (length/genome)


This axiom is presumaby contextual on the genome being circular, which  
will have to be indicated using a new flag, as Jim suggest, yep?

So the context independent axiom would be:

> revolutions = IF src_is_circular THEN int (length/genome) ELSE 0


On Sep 9, 2008, at 10:52 AM, Lincoln Stein wrote:

> It seems to me that the proposed modulus syntax handles multiple
> revolutions. Consider a 100 bp genome (to make it simple) and a  
> feature that
> starts at 50, goes around twice, and ends at position 60:
>
>  start = 50
>  end  = 260
>
> length = end - start + 1
> revolutions = int (length/genome)
> stop position = length % genome + 1
>
> Lincoln
>
> On Mon, Sep 8, 2008 at 3:57 PM, Aaron Mackey <ajmackey at gmail.com>  
> wrote:
>
>> How can you handle features that may cross the origin more than once?
>> The modulus, though simple, seems to be only half the solution.  It
>> also makes it difficult to place features in the genome "by eye"
>> (having to do the modulus subtraction in my head), or in
>> sorting/filtering operations.
>>
>> I have an alternative that I wondered if you considered: allow the
>> start/end to have an additional "circular revolution" prefix:
>>
>> a typical range tuple like: 100 200 -
>> is thus shorthand for: 0:100 0:200 -
>> (i.e. both the 100 and 200 are in the same "revolution" around the  
>> genome)
>>
>> and is then distinguishable from an "around the genome + 100"  
>> feature of:
>> 1:100 0:200 -
>>
>> Just an alternative to consider (if you haven't already).  I'm not
>> wedded to the syntax, but I wouldn't want to see new columns in GFF
>> just for this.  Essentially, what you want is some form of compound
>> polar coordinates, it seems.
>>
>> -Aaron
>>
>> On Mon, Sep 8, 2008 at 2:44 PM, Jim Hu <jimhu at tamu.edu> wrote:
>>> In discussions with GMOD about Gbrowse, we've come up with a  
>>> proposal for
>>> handling circular genomes and features that cross the origin in such
>>> genomes.  This applies to lots of prokaryotic and viral genomes, and
>> might
>>> be valuable for some ways of representing terminally redundant  
>>> linear
>>> genomes.
>>> 1) Keep the requirement that start < end
>>> 2) allow end > parent feature length
>>> 3) parent feature gets an is_circular boolean
>>> 4) use modular arithmetic to calculate the real position of end on  
>>> the
>>> parent feature.
>>> We'd like to do this in a way that will be consistent with Chado and
>> BioPerl
>>> representation of features as much as possible (realizing that  
>>> there is
>> the
>>> usual interbase or not coordinate issue).  What do people think?   
>>> Lincoln
>> is
>>> on board for modifying the GFF3 spec.
>>> Thanks!
>>> Jim Hu
>>>
>>> =====================================
>>>
>>> Jim Hu
>>>
>>> Associate Professor
>>>
>>> Dept. of Biochemistry and Biophysics
>>>
>>> 2128 TAMU
>>>
>>> Texas A&M Univ.
>>>
>>> College Station, TX 77843-2128
>>>
>>> 979-862-4054
>>>
>>>
>>> -------------------------------------------------------------------------
>>> This SF.Net email is sponsored by the Moblin Your Move Developer's
>> challenge
>>> Build the coolest Linux based applications with Moblin SDK & win  
>>> great
>>> prizes
>>> Grand prize is a trip for two to an Open Source event anywhere in  
>>> the
>> world
>>> http://moblin-contest.org/redirect.php?banner_id=100&url=/
>>> _______________________________________________
>>> Gmod-schema mailing list
>>> Gmod-schema at lists.sourceforge.net
>>> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>>>
>>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>
>
> -- 
> Lincoln D. Stein
>
> Ontario Institute for Cancer Research
> 101 College St., Suite 800
> Toronto, ON, Canada M5G0A3
> 416 673-8514
> Assistant: Stacey Quinn <Stacey.Quinn at oicr.on.ca>
>
> Cold Spring Harbor Laboratory
> 1 Bungtown Road
> Cold Spring Harbor, NY 11724 USA
> (516) 367-8380
> Assistant: Sandra Michelsen <michelse at cshl.edu>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



From heikki at sanbi.ac.za  Wed Sep 10 11:32:06 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Wed, 10 Sep 2008 13:32:06 +0200
Subject: [Bioperl-l] phylogeny-trait association methods into BioPerl
Message-ID: <200809101332.07137.heikki@sanbi.ac.za>

FYI,

I've been recently writing code to analyse phylogeny-trait associations. These 
traits are typically geographical location of the sequence but they can be any 
phenotypic characters associated with the sequences.

This involves trees, i.e. Bio::Tree::Tree and Bio::Tree::Node objects and 
strings describing the traits. I've been using tags to store trait values 
within nodes. The tag methods are:

Bio::Tree::Node::add_tag_value
Bio::Tree::Node::get_all_tags
Bio::Tree::Node::get_tag_values
Bio::Tree::Node::has_tag
Bio::Tree::Node::remove_all_tags
Bio::Tree::Node::remove_tag

Question: Is  there any particular reason why there is no 
set_tag_value(scalar|@array) method? 

I am getting tired of writing:
  $node->remove_tag($key);
  map {$node->add_tag_value($key)} @values ;
so I am going to implement that unless there is are strong objections.

Otherwise it has been smooth sailing. I am going to add 
Bio::Tree::TreeFunctions::is_binary() and start populating 
Bio::Tree::Statistics soon with these methods:

ps() - Parsimony Score (PS) from Fitch 1971 
ai() - Association index (AI) of Whang et al. 2001
mc() - Monophyletic Clade (MC) size statistics by Salemi at al. 2005
cherries() - number of leaf node pairs

If you have any comments, please feel free to post them here.

    -Heikki

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From hlapp at gmx.net  Wed Sep 10 13:44:27 2008
From: hlapp at gmx.net (Hilmar Lapp)
Date: Wed, 10 Sep 2008 07:44:27 -0600
Subject: [Bioperl-l] phylogeny-trait association methods into BioPerl
In-Reply-To: <200809101332.07137.heikki@sanbi.ac.za>
References: <200809101332.07137.heikki@sanbi.ac.za>
Message-ID: <0FA6C4A1-9D83-4850-BC0A-4A55ED528C65@gmx.net>

Sounds great Heikki!

Just FYI, there is a considerable amount of code and packages for  
comparative analysis in R. You might want to look into the resources  
linked to from the http://r-phylo.org page. There is also a R-SIG- 
Phylo special interest group mailing list (should be linked from the  
aforementioned site).

	-hilmar

On Sep 10, 2008, at 5:32 AM, Heikki Lehvaslaiho wrote:

> FYI,
>
> I've been recently writing code to analyse phylogeny-trait  
> associations. These
> traits are typically geographical location of the sequence but they  
> can be any
> phenotypic characters associated with the sequences.
>
> This involves trees, i.e. Bio::Tree::Tree and Bio::Tree::Node  
> objects and
> strings describing the traits. I've been using tags to store trait  
> values
> within nodes. The tag methods are:
>
> Bio::Tree::Node::add_tag_value
> Bio::Tree::Node::get_all_tags
> Bio::Tree::Node::get_tag_values
> Bio::Tree::Node::has_tag
> Bio::Tree::Node::remove_all_tags
> Bio::Tree::Node::remove_tag
>
> Question: Is  there any particular reason why there is no
> set_tag_value(scalar|@array) method?
>
> I am getting tired of writing:
>  $node->remove_tag($key);
>  map {$node->add_tag_value($key)} @values ;
> so I am going to implement that unless there is are strong objections.
>
> Otherwise it has been smooth sailing. I am going to add
> Bio::Tree::TreeFunctions::is_binary() and start populating
> Bio::Tree::Statistics soon with these methods:
>
> ps() - Parsimony Score (PS) from Fitch 1971
> ai() - Association index (AI) of Whang et al. 2001
> mc() - Monophyletic Clade (MC) size statistics by Salemi at al. 2005
> cherries() - number of leaf node pairs
>
> If you have any comments, please feel free to post them here.
>
>    -Heikki
>
> -- 
> ______ _/      _/_____________________________________________________
>      _/      _/
>     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
>    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
>   _/  _/  _/  SANBI, South African National Bioinformatics Institute
>  _/  _/  _/  University of Western Cape, South Africa
>     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
> ___ _/_/_/_/_/________________________________________________________
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================





From Caroline.Johnston at iop.kcl.ac.uk  Wed Sep 10 15:43:26 2008
From: Caroline.Johnston at iop.kcl.ac.uk (Johnston, Caroline)
Date: Wed, 10 Sep 2008 16:43:26 +0100
Subject: [Bioperl-l] seqs, seqfeatures, locations etc
Message-ID: <5626ED9CB91C814197079FB9940312E506445F81@MAIL.bc.iop.kcl.ac.uk>

Hello,

I'm trying to get my head around the various classes for storing sequences, features and locations and was hoping someone could give me some implementation advice:

I've got a Bio::EnsEMBL::Slice and I want to turn it into a Bio::Seq or SeqFeature object, with Bio::SeqFeature;:Gene::GeneStructure/Transcript/Exon info attached. I can create a Bio::Seq fine, but I also need to keep track of the chromosomal co-ordinates (chr, start, end, species, strand, genome release, database name) and I can't figure out how to store this in Bioperl. I was thinking that what I needed was some extension of a standard Bio::Seq to have genome-coordinate data attached and associated methods to translate the SeqFeature positions (relative to the Bio::Seq) to genome positions. I guess it's probably already possible to store this type of info in some collection of Bioperl objects, but between Bioperl and the EnsEMBL API I'm getting lost in perl modules. Can someone point me in the right direction?

Thanks,
Cass
 



From bosborne11 at verizon.net  Wed Sep 10 17:34:35 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Wed, 10 Sep 2008 13:34:35 -0400
Subject: [Bioperl-l] seqs, seqfeatures, locations etc
In-Reply-To: <5626ED9CB91C814197079FB9940312E506445F81@MAIL.bc.iop.kcl.ac.uk>
References: <5626ED9CB91C814197079FB9940312E506445F81@MAIL.bc.iop.kcl.ac.uk>
Message-ID: <FBBD6379-A984-4F8F-81A5-8EF5E18CC3C7@verizon.net>

Cass,

There is a HOWTO about these Bioperl objects:

http://www.bioperl.org/wiki/HOWTO:Feature-Annotation

I think it addresses your questions.


Brian O.



On Sep 10, 2008, at 11:43 AM, Johnston, Caroline wrote:

> Hello,
>
> I'm trying to get my head around the various classes for storing  
> sequences, features and locations and was hoping someone could give  
> me some implementation advice:
>
> I've got a Bio::EnsEMBL::Slice and I want to turn it into a Bio::Seq  
> or SeqFeature object, with Bio::SeqFeature;:Gene::GeneStructure/ 
> Transcript/Exon info attached. I can create a Bio::Seq fine, but I  
> also need to keep track of the chromosomal co-ordinates (chr, start,  
> end, species, strand, genome release, database name) and I can't  
> figure out how to store this in Bioperl. I was thinking that what I  
> needed was some extension of a standard Bio::Seq to have genome- 
> coordinate data attached and associated methods to translate the  
> SeqFeature positions (relative to the Bio::Seq) to genome positions.  
> I guess it's probably already possible to store this type of info in  
> some collection of Bioperl objects, but between Bioperl and the  
> EnsEMBL API I'm getting lost in perl modules. Can someone point me  
> in the right direction?
>
> Thanks,
> Cass
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From jason at bioperl.org  Wed Sep 10 17:44:25 2008
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 10 Sep 2008 10:44:25 -0700
Subject: [Bioperl-l] phylogeny-trait association methods into BioPerl
In-Reply-To: <200809101332.07137.heikki@sanbi.ac.za>
References: <200809101332.07137.heikki@sanbi.ac.za>
Message-ID: <24F25525-0394-45BE-859F-A5735DE610DF@bioperl.org>

Those are just take from Bio::SeqFeature::Generic tag manipulation  
methods so please feel free to add a better one - maybe can propagate  
that new method to Bio::SeqFeature::Generic as well?

Would be nice to see those other methods add as well so am glad to see  
them.

-jason
On Sep 10, 2008, at 4:32 AM, Heikki Lehvaslaiho wrote:

> FYI,
>
> I've been recently writing code to analyse phylogeny-trait  
> associations. These
> traits are typically geographical location of the sequence but they  
> can be any
> phenotypic characters associated with the sequences.
>
> This involves trees, i.e. Bio::Tree::Tree and Bio::Tree::Node  
> objects and
> strings describing the traits. I've been using tags to store trait  
> values
> within nodes. The tag methods are:
>
> Bio::Tree::Node::add_tag_value
> Bio::Tree::Node::get_all_tags
> Bio::Tree::Node::get_tag_values
> Bio::Tree::Node::has_tag
> Bio::Tree::Node::remove_all_tags
> Bio::Tree::Node::remove_tag
>
> Question: Is  there any particular reason why there is no
> set_tag_value(scalar|@array) method?
>
> I am getting tired of writing:
>  $node->remove_tag($key);
>  map {$node->add_tag_value($key)} @values ;
> so I am going to implement that unless there is are strong objections.
>
> Otherwise it has been smooth sailing. I am going to add
> Bio::Tree::TreeFunctions::is_binary() and start populating
> Bio::Tree::Statistics soon with these methods:
>
> ps() - Parsimony Score (PS) from Fitch 1971
> ai() - Association index (AI) of Whang et al. 2001
> mc() - Monophyletic Clade (MC) size statistics by Salemi at al. 2005
> cherries() - number of leaf node pairs
>
> If you have any comments, please feel free to post them here.
>
>    -Heikki
>
> -- 
> ______ _/      _/_____________________________________________________
>      _/      _/
>     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
>    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
>   _/  _/  _/  SANBI, South African National Bioinformatics Institute
>  _/  _/  _/  University of Western Cape, South Africa
>     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
> ___ _/_/_/_/_/________________________________________________________
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From philsf79 at gmail.com  Thu Sep 11 08:40:26 2008
From: philsf79 at gmail.com (Felipe Figueiredo)
Date: Thu, 11 Sep 2008 05:40:26 -0300
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
Message-ID: <1221122426.8059.49.camel@localhost>

I'm not sure if this is related to bioperl (Bio::AlignIO) or if it's a
general perl error on my part, but I find strange that the following
code gives differente results depending on how I input the alignment:

--- test.pl ---
#!/usr/bin/perl

use warnings;
use strict;

use Bio::AlignIO;

my $file;
if (@ARGV) {
    $file = shift @ARGV;
}
else {
    $file = "-";
}

my $align = Bio::AlignIO->new(-file=>$file)->next_aln;

printf "Sequences: %s\n",$align->no_sequences;
--- test.pl ---

If I run this using a file containing 4 sequences, the following
hapens: 

--- run tests ---
$ ./test.pl  exemplo-alinhamento.fasta
Sequences: 4

$ ./test.pl < exemplo-alinhamento.fasta
Sequences: 3

$ cat exemplo-alinhamento.fasta | ./test.pl 
Sequences: 3
--- run tests ---

The missing sequence is always the first one. Am I missing something, or
my code for reading stdin is mistaken or is it a bug in Bio::AlignIO?

I'm using bioperl 1.5.2.102-1ubuntu1, in Ubuntu 8.04 Hardy.

best regards
FF



From David.Messina at sbc.su.se  Thu Sep 11 11:21:51 2008
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 11 Sep 2008 13:21:51 +0200
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <1221122426.8059.49.camel@localhost>
References: <1221122426.8059.49.camel@localhost>
Message-ID: <628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>

Hi Felipe,

Specifying STDIN via a '-' argument to the -file parameter is not valid.
While that is a convention with some UNIX tools, it's not, as far as I know,
something you should be able to count on.

In BioPerl, one can specify STDIN by passing the \*STDIN filehandle glob to
the -fh parameter (NOT to -file).

In other words,

my $align = Bio::AlignIO->new(-fh => \*STDIN)->next_aln;

That is a convention in BioPerl, so the -file and -fh parameters should work
the same way in AlignIO, SearchIO, SeqIO, etc.

Take a look at the beginners' HOWTO for some examples.
http://www.bioperl.org/wiki/HOWTO:Beginners


Dave


From bosborne11 at verizon.net  Thu Sep 11 15:01:32 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Thu, 11 Sep 2008 11:01:32 -0400
Subject: [Bioperl-l] SeqHound
Message-ID: <0E295726-33FE-4083-98A1-9035E37455BD@verizon.net>

Raul,

Good question about BIND, I don't know if the public version is up-to- 
date. For the latest protein-protein interaction data I look at public  
databases like IntAct.

If you use bioperl-network you should be able to read IntAct data into  
a graph, then find the interactions that you're interested in in that  
graph. There are a few qualifications to this statement though, like  
do you have the "right" identifiers or names. So you're right, bioperl- 
network constructs graphs from the XML files but the interactions you  
want are in those graphs. Something like:

  my $graphio = Bio::Network::IO->new(-file   => 'human.xml',
                                      -format => 'psi25');
  my $graph = $graphio->next_network();
  my $node = $graph->get_nodes_by_id('UniProt:P12345');
  my @neighbors = $graph->neighbors($node);



Brian O.

On Sep 11, 2008, at 7:32 AM, Raul Mendez Giraldez wrote:

> Hi Brian,
>
> Actually I realized later that SeqHound is a part of Bioperl itself,  
> and
> that regarding BIND (at least the public database) is reachable trough
> BIND SOAP protocol, that can be implemented in perl through the module
> SOAP::Lite. I still don't know whether the public BIND database is out
> of date, or which part of the BOND database it covers.
>
> Regarding the Bio::Network packages, at the Bioperl suite, I guess it
> rather for representing protein - protein interaction graphs, isn't  
> it?
> That could be interesting to me, but in a second step. I am more
> concerned now in getting this protein - protein interaction data,  
> for a
> set of proteins some biologists gave me. I don't know anything about
> Cytoscape, normally I'm trying to exploit perl data management
> capabilities.
>
> Thanks for the info.
>
> Cheers,
>
> Raul
>


From MEC at stowers-institute.org  Thu Sep 11 18:01:01 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Thu, 11 Sep 2008 13:01:01 -0500
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
References: <1221122426.8059.49.camel@localhost>
	<628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>

Filipe and Dave,

I find that the following works generically for SeqIO and AlignIO (at least)...

#after processing all options using GetOpt,
#any remaining options should name files to process...
@ARGV = ('-') unless @ARGV;     # Default to standard input
my %inopt;
$inopt{-fh} ||=  \*ARGV;
my $AlignIO =  Bio::AlignIO->new(
                         %inopt
                        )  or die "calling Bio::AlignIO->new on %inopt" ;



--Malcolm

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Dave Messina
Sent: Thursday, September 11, 2008 6:22 AM
To: Felipe Figueiredo
Cc: bioperl-l at lists.open-bio.org
Subject: Re: [Bioperl-l] difference in opening file from @ARGV and STDIN?

Hi Felipe,

Specifying STDIN via a '-' argument to the -file parameter is not valid.
While that is a convention with some UNIX tools, it's not, as far as I know, something you should be able to count on.

In BioPerl, one can specify STDIN by passing the \*STDIN filehandle glob to the -fh parameter (NOT to -file).

In other words,

my $align = Bio::AlignIO->new(-fh => \*STDIN)->next_aln;

That is a convention in BioPerl, so the -file and -fh parameters should work the same way in AlignIO, SearchIO, SeqIO, etc.

Take a look at the beginners' HOWTO for some examples.
http://www.bioperl.org/wiki/HOWTO:Beginners


Dave
_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l



From David.Messina at sbc.su.se  Thu Sep 11 18:47:04 2008
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 11 Sep 2008 20:47:04 +0200
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>
References: <1221122426.8059.49.camel@localhost>
	<628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>
Message-ID: <628aabb70809111147y7d99e1bdh414a4ab1037c0990@mail.gmail.com>

Thanks, Malcolm.
So then, '-' as STDIN does work?

D


From MEC at stowers-institute.org  Thu Sep 11 20:19:25 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Thu, 11 Sep 2008 15:19:25 -0500
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <628aabb70809111147y7d99e1bdh414a4ab1037c0990@mail.gmail.com>
References: <1221122426.8059.49.camel@localhost>
	<628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>
	<628aabb70809111147y7d99e1bdh414a4ab1037c0990@mail.gmail.com>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD559C@exchmb-02.stowers-institute.org>

Note exactly the way I would put it.


Look at the difference between the first command and the second is the following transcript:

> echo -e ">asdf\natgc\n" | perl -MBio::SeqIO -e 'my $s = Bio::SeqIO->new(-format => qw{fasta}, -fh => \*ARGV); print $ARGV[0] . qq{ has } . $s->next_seq()->seq . qq{\n}' -- '-'
- has atgc
> echo -e ">asdf\natgc\n" | perl -MBio::SeqIO -e 'my $s = Bio::SeqIO->new(-format => qw{fasta}, -fh => \*ARGV); print $ARGV[0] . qq{ has } . $s->next_seq()->seq . qq{\n}' -- 'NoSuchFile'
Can't open NoSuchFile: No such file or directory at /home/mec/cvs/bioperl-live/Bio/Root/IO.pm line 458.
Can't call method "seq" on an undefined value at -e line 1.

THe only difference is that @ARG is the singleton list composed of '-' in the first call, and is the singlton list composed of 'NoSuchFile' in the second.

If you passed in a list of multiple files that actually do exist, it should work fine.

It is really a matter of ARGV processing magic.

from http://perldoc.perl.org/perlop.html

The null filehandle <> is special: it can be used to emulate the behavior of sed and awk. Input from <> comes either from standard input, or from each file listed on the command line. Here's how it works: the first time <> is evaluated, the @ARGV array is checked, and if it is empty, $ARGV[0] is set to "-", which when opened gives you standard input. The @ARGV array is then processed as a list of filenames. The loop

    while (<>) {
        ...                     # code for each line
    }

is equivalent to the following Perl-like pseudo code:

    unshift<http://perldoc.perl.org/functions/unshift.html>(@ARGV, '-') unless @ARGV;
    while ($ARGV = shift<http://perldoc.perl.org/functions/shift.html>) {
        open<http://perldoc.perl.org/functions/open.html>(ARGV, $ARGV);
        while (<ARGV>) {
            ...         # code for each line
        }
    }





Malcolm Cook
Database Applications Manager - Bioinformatics
Stowers Institute for Medical Research - Kansas City, Missouri




________________________________
From: dave at davemessina.com [mailto:dave at davemessina.com] On Behalf Of Dave Messina
Sent: Thursday, September 11, 2008 1:47 PM
To: Cook, Malcolm
Cc: Felipe Figueiredo; bioperl-l at lists.open-bio.org
Subject: Re: [Bioperl-l] difference in opening file from @ARGV and STDIN?

Thanks, Malcolm.

So then, '-' as STDIN does work?

D




From David.Messina at sbc.su.se  Thu Sep 11 21:15:44 2008
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 11 Sep 2008 23:15:44 +0200
Subject: [Bioperl-l] difference in opening file from @ARGV and STDIN?
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC129FFD559C@exchmb-02.stowers-institute.org>
References: <1221122426.8059.49.camel@localhost>
	<628aabb70809110421x3668606dx4a64a203ab0ff9d2@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD5577@exchmb-02.stowers-institute.org>
	<628aabb70809111147y7d99e1bdh414a4ab1037c0990@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD559C@exchmb-02.stowers-institute.org>
Message-ID: <628aabb70809111415w27044d57jd3121adb40900e45@mail.gmail.com>

Cool, thanks for the explanation Malcolm!

At the risk of belaboring this point and your patience, one thing still
confuses me, though:

and if [@ARGV] is empty, $ARGV[0] is set to "-"
>

If $ARGV[0] is set (by Perl's ARGV processing magic) to '-', then why in
your earlier example do you manually set $ARGV[0] to '-' instead of simply
leaving @ARGV empty?

@ARGV = ('-') unless @ARGV;




If I run your example and omit '-' as an argument, it still works:

> echo -e ">asdf\natgc\n" | perl -MBio::SeqIO -e 'my $s =
Bio::SeqIO->new(-format => qw{fasta}, -fh => \*ARGV); print $ARGV[0] . qq{
has } . $s->next_seq()->seq . qq{\n}'
 has atgc



Dave


From acouperthwaite at gmail.com  Fri Sep 12 21:17:53 2008
From: acouperthwaite at gmail.com (Andrew Couperthwaite)
Date: Fri, 12 Sep 2008 15:17:53 -0600
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
Message-ID: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>

Hi,

I'm having difficulty using  the Bio::DB::Query::GenBank module.  The  
sample script on the page http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/DB/Query/GenBank.html 
  doesn't seem to work.

I'm trying to use this and the Bio::DB::GenBank module to find and  
download a set of sequences from GenBank...
I'm rather new to bioperl, can anyone point me in the right direction?

Thanks,
-Andrew


From jason at bioperl.org  Sat Sep 13 06:42:28 2008
From: jason at bioperl.org (Jason Stajich)
Date: Fri, 12 Sep 2008 23:42:28 -0700
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
In-Reply-To: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
References: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
Message-ID: <2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>

Hi Andrew -

a) what is the exact script code you are trying, what are the error  
messages?
b) what version of bioperl?

The first thing we'll suggest is: did you get the latest code from SVN  
yet or a nightly build?

-jason
On Sep 12, 2008, at 2:17 PM, Andrew Couperthwaite wrote:

> Hi,
>
> I'm having difficulty using  the Bio::DB::Query::GenBank module.   
> The sample script on the page http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/DB/Query/GenBank.html 
>  doesn't seem to work.
>
> I'm trying to use this and the Bio::DB::GenBank module to find and  
> download a set of sequences from GenBank...
> I'm rather new to bioperl, can anyone point me in the right direction?
>
> Thanks,
> -Andrew
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From cjfields at illinois.edu  Mon Sep 15 04:13:57 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Sun, 14 Sep 2008 23:13:57 -0500
Subject: [Bioperl-l] significant bug with Bio::LocatableSeq
Message-ID: <98938314-4AF1-44C2-8867-B383A44E542E@illinois.edu>

While debugging some tests in bioperl, I noticed a fairly significant  
issue with Bio::LocatableSeq which is probably due to some  
inconsistencies with start/end coordinates.  For some reason this  
started popping up with error messages recently when running AlignIO  
tests on bioperl-live (i.e. something changed which exposed the bug,  
maybe the verbosity level):

1..295
ok 1 - use Bio::AlignIO;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5
ok 6 - The object isa Bio::AlignIO

--------------------- WARNING ---------------------
MSG: In sequence 02 residue count gives end value 399.
Overriding value [355] with value 399 for Bio::LocatableSeq::end().
STACK Bio::LocatableSeq::end /Users/cjfields/bioperl/bioperl-live/blib/ 
lib/Bio/LocatableSeq.pm:150
STACK Bio::LocatableSeq::new /Users/cjfields/bioperl/bioperl-live/blib/ 
lib/Bio/LocatableSeq.pm:103
STACK Bio::AlignIO::arp::next_aln /Users/cjfields/bioperl/bioperl-live/ 
blib/lib/Bio/AlignIO/arp.pm:106
STACK toplevel t/AlignIO.t:34
---------------------------------------------------
.... followed by tons of similar errors.

The problem is, no change is ever made.  This is demonstrated by the  
following:

-----------------------------
#!/usr/bin/perl -w

use strict;
use warnings;
use Bio::LocatableSeq;

my $seq = Bio::LocatableSeq->new(
     -id => 'foo',
     -seq => 'A----TGCGCTTCCTCGCTTCCG',
     -start => 10,
     -end => 100, # intentially bad
     -strand => -1);

print $seq->end."\n";

-----------------------------

Results:

--------------------- WARNING ---------------------
MSG: In sequence foo residue count gives end value 28.
Overriding value [100] with value 28 for Bio::LocatableSeq::end().
STACK Bio::LocatableSeq::end /Users/cjfields/bioperl/bioperl-live/Bio/ 
LocatableSeq.pm:150
STACK Bio::LocatableSeq::new /Users/cjfields/bioperl/bioperl-live/Bio/ 
LocatableSeq.pm:103
STACK toplevel seq.pl:7
---------------------------------------------------
100

The warning pops up when -end is passed to LocatableSeq::new and  
indicates that the passed coordinate doesn't match up with the one  
calculated from the sequence (minus gaps).  I've isolated the bug down  
to the end() method and am working on fixing it.  Note that this  
affects LocatableSeq::length as well.  This appears to affect arp,  
nexus, stockholm, and a few other AlignIO parsers as well.

chris


From acouperthwaite at gmail.com  Mon Sep 15 19:05:13 2008
From: acouperthwaite at gmail.com (Andrew Couperthwaite)
Date: Mon, 15 Sep 2008 13:05:13 -0600
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
In-Reply-To: <2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>
References: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
	<2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>
Message-ID: <2BA47AC9-5A04-460D-BA56-64B152AFFF16@gmail.com>

the code i'm starting with is this:
=====
use Bio::DB::Query::GenBank;
use Bio::DB::GenBank

my $query_string = 'Oryza[Organism] AND EST[Keyword]';
    my $query = Bio::DB::Query::GenBank->new(-query =>  
'Oryza[Organism] AND EST[Keyword]',
    											-db=>'nucleotide');
    my $count = $query->count;
    my @ids   = $query->ids;
    # get a genbank database handle
    my $gb = Bio::DB::GenBank->new();
    my $stream = $gb->get_Stream_by_query($query);

    while (my $seq = $stream->next_seq) {
       # do something with the sequence object
       print "hello";
    }
=====
It doesn't produce any error messages, it simply doesn't enter the  
while loop.  It seems as though it isn't getting any results from  
genbank?/isn't contacting genbank?

We are running version 1.5.2.  Haven't updated since late May.

-Andrew

On 13-Sep-08, at 12:42 AM, Jason Stajich wrote:

> Hi Andrew -
>
> a) what is the exact script code you are trying, what are the error  
> messages?
> b) what version of bioperl?
>
> The first thing we'll suggest is: did you get the latest code from  
> SVN yet or a nightly build?
>
> -jason
> On Sep 12, 2008, at 2:17 PM, Andrew Couperthwaite wrote:
>
>> Hi,
>>
>> I'm having difficulty using  the Bio::DB::Query::GenBank module.   
>> The sample script on the page http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/DB/Query/GenBank.html 
>>  doesn't seem to work.
>>
>> I'm trying to use this and the Bio::DB::GenBank module to find and  
>> download a set of sequences from GenBank...
>> I'm rather new to bioperl, can anyone point me in the right  
>> direction?
>>
>> Thanks,
>> -Andrew
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Jason Stajich
> jason at bioperl.org
>
>
>



From jason at bioperl.org  Mon Sep 15 19:25:49 2008
From: jason at bioperl.org (Jason Stajich)
Date: Mon, 15 Sep 2008 12:25:49 -0700
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
In-Reply-To: <2BA47AC9-5A04-460D-BA56-64B152AFFF16@gmail.com>
References: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
	<2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>
	<2BA47AC9-5A04-460D-BA56-64B152AFFF16@gmail.com>
Message-ID: <25A13987-7306-42E8-BE4E-E50A70538E7D@bioperl.org>

Try removing the line
my @ids = $query->ids;

I don't think GenBank supports this part of the query API now or you  
have to execute the query first before you can ask for the number of  
IDs from that object.  I don't remember exactly what changed  
specifically, but I actually get an error with that line:
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Id list has been truncated even after maxids requested
STACK: Error::throw
STACK: Bio::Root::Root::throw /usr/local/lib/perl5/Bio/Root/Root.pm:357
STACK: Bio::DB::Query::WebQuery::_fetch_ids /usr/local/lib/perl5/Bio/ 
DB/Query/WebQuery.pm:237
STACK: Bio::DB::Query::WebQuery::ids /usr/local/lib/perl5/Bio/DB/Query/ 
WebQuery.pm:201
STACK: query.pl:9
-----------------------------------------------------------


This is the query script I use that works fine for me for my downloads.

http://fungalgenomes.org/~stajich/scripts/download_query_genbank.pl


I'm using SVN code so it is possible things are changed since 1.5.2.

-jason
On Sep 15, 2008, at 12:05 PM, Andrew Couperthwaite wrote:

> the code i'm starting with is this:
> =====
> use Bio::DB::Query::GenBank;
> use Bio::DB::GenBank
>
> my $query_string = 'Oryza[Organism] AND EST[Keyword]';
>   my $query = Bio::DB::Query::GenBank->new(-query =>  
> 'Oryza[Organism] AND EST[Keyword]',
>   											-db=>'nucleotide');
>   my $count = $query->count;
>   my @ids   = $query->ids;
>   # get a genbank database handle
>   my $gb = Bio::DB::GenBank->new();
>   my $stream = $gb->get_Stream_by_query($query);
>
>   while (my $seq = $stream->next_seq) {
>      # do something with the sequence object
>      print "hello";
>   }
> =====
> It doesn't produce any error messages, it simply doesn't enter the  
> while loop.  It seems as though it isn't getting any results from  
> genbank?/isn't contacting genbank?
>
> We are running version 1.5.2.  Haven't updated since late May.
>
> -Andrew
>
> On 13-Sep-08, at 12:42 AM, Jason Stajich wrote:
>
>> Hi Andrew -
>>
>> a) what is the exact script code you are trying, what are the error  
>> messages?
>> b) what version of bioperl?
>>
>> The first thing we'll suggest is: did you get the latest code from  
>> SVN yet or a nightly build?
>>
>> -jason
>> On Sep 12, 2008, at 2:17 PM, Andrew Couperthwaite wrote:
>>
>>> Hi,
>>>
>>> I'm having difficulty using  the Bio::DB::Query::GenBank module.   
>>> The sample script on the page http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/DB/Query/GenBank.html 
>>>  doesn't seem to work.
>>>
>>> I'm trying to use this and the Bio::DB::GenBank module to find and  
>>> download a set of sequences from GenBank...
>>> I'm rather new to bioperl, can anyone point me in the right  
>>> direction?
>>>
>>> Thanks,
>>> -Andrew
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Jason Stajich
>> jason at bioperl.org
>>
>>
>>
>

Jason Stajich
jason at bioperl.org





From biology0046 at hotmail.com  Mon Sep 15 20:00:02 2008
From: biology0046 at hotmail.com (=?gb2312?B?va3OxOL9?=)
Date: Mon, 15 Sep 2008 20:00:02 +0000
Subject: [Bioperl-l] HSP tiling problem
In-Reply-To: <mailman.7944.1221254286.2673.bioperl-l@lists.open-bio.org>
References: <mailman.7944.1221254286.2673.bioperl-l@lists.open-bio.org>
Message-ID: <BLU108-W14DD76360E5100AC535214B4520@phx.gbl>


Dear all:
I try to use bioperl's SearhIO module to parse the blast output, 
the output of blast contain many HSPs from the same hit, each HSP come out with an count of identity residues and alignment length, but what i want to get is the global identiy and alignment length of the query sequence and hit sequence, which may be done by tiling the HSPs and build a HSP contig, 
 
the bioperl BLASTutil module contain "hsp_tiling and length_aln, frac_identical" method fullfill my purpose, but i read through the mailing list, some user said the method used by bioperl were not precise in many cases, they sugguest to use WUBLAST.
 
but i don't know which WUBLAST opinion should i use, i use "links" opinion, but the output still give me lots of HSPs, are these HSPs created from some small HSPs?best regards!wenkaichinese academy of sciences
_________________________________________________________________
??????????????????????????
http://im.live.cn/Share/18.htm


From jason at bioperl.org  Mon Sep 15 20:27:02 2008
From: jason at bioperl.org (Jason Stajich)
Date: Mon, 15 Sep 2008 13:27:02 -0700
Subject: [Bioperl-l] HSP tiling problem
In-Reply-To: <BLU108-W14DD76360E5100AC535214B4520@phx.gbl>
References: <mailman.7944.1221254286.2673.bioperl-l@lists.open-bio.org>
	<BLU108-W14DD76360E5100AC535214B4520@phx.gbl>
Message-ID: <90A30B97-1618-4AAF-86D9-B51929697CDE@bioperl.org>

The -links option gives you a logical ordering of non-overlapping HSPs  
so it is the tiling you desire. You just process each HSP from the  
list provided by -links. There may be several alternative paths so you  
can compute a %id for all of them or just take the longest one, etc.

You need to just decide how you want to compute global identity - an  
average of the HSP identities or just sum up the number of identical  
bases across them all divided by the total length of sequence that is  
aligned.  All those pieces of information are available and described  
in the SearchIO HOWTO on the website.

Or, requiring less coding, re-align the sequences with an aligner like  
SSEARCH to get a single alignment and a single %id/%sim number for the  
sequence pair.

-jason

On Sep 15, 2008, at 1:00 PM, ??? wrote:

>
> Dear all:
> I try to use bioperl's SearhIO module to parse the blast output,
> the output of blast contain many HSPs from the same hit, each HSP  
> come out with an count of identity residues and alignment length,  
> but what i want to get is the global identiy and alignment length of  
> the query sequence and hit sequence, which may be done by tiling the  
> HSPs and build a HSP contig,
>
> the bioperl BLASTutil module contain "hsp_tiling and length_aln,  
> frac_identical" method fullfill my purpose, but i read through the  
> mailing list, some user said the method used by bioperl were not  
> precise in many cases, they sugguest to use WUBLAST.
>
> but i don't know which WUBLAST opinion should i use, i use "links"  
> opinion, but the output still give me lots of HSPs, are these HSPs  
> created from some small HSPs?best regards!wenkaichinese academy of  
> sciences
> _________________________________________________________________
> ??????????????????????????
> http://im.live.cn/Share/18.htm
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org






From bosborne11 at verizon.net  Tue Sep 16 02:22:54 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Mon, 15 Sep 2008 22:22:54 -0400
Subject: [Bioperl-l] Bio::DB::Query::GenBank question
In-Reply-To: <25A13987-7306-42E8-BE4E-E50A70538E7D@bioperl.org>
References: <E98EBA66-465B-4B6C-93DD-335EFF4105C3@gmail.com>
	<2CCFFD09-B7B0-4172-A10F-224875A6E968@bioperl.org>
	<2BA47AC9-5A04-460D-BA56-64B152AFFF16@gmail.com>
	<25A13987-7306-42E8-BE4E-E50A70538E7D@bioperl.org>
Message-ID: <583390B6-1075-4EB0-A22A-E1D07D2EDFA8@verizon.net>

Jason,

I added that script to scripts/, hope you don't mind!

Brian O.



On Sep 15, 2008, at 3:25 PM, Jason Stajich wrote:

> This is the query script I use that works fine for me for my  
> downloads.



From mirhan at indiana.edu  Tue Sep 16 05:18:47 2008
From: mirhan at indiana.edu (Han, Mira)
Date: Tue, 16 Sep 2008 01:18:47 -0400
Subject: [Bioperl-l] [Wg-phyloinformatics] Summer of Code: project
	summaries
In-Reply-To: <2033D247-5E34-4BDE-A98E-BE08D9910951@duke.edu>
Message-ID: <C4F4B9F7.5500%mirhan@indiana.edu>


Hi,
Just writing to summarize the final product of this summer. (even though it's overdue)
The phyloXML support in BioPerl project is finished officially,
I've created three new modules,
Bio::TreeIO::phyloxml,
Bio::Tree::AnnotatableNode,
and Bio::Annotation::Relation.
The parsing is done for all elements except for <ProteinDomain>
And the validation step is still missing.
I'm planning to add those in in the future.

I was contemplating to make a Bio::Annotation::XML till the end,
But decided not to since there was already a new module Bio::Annotation::TagTree, that looked like the same thing.
Currently, the module does not use TagTree, it uses nested AnnotationCollections instead, because TagTree was a temporary stub at the time.
There are methods in phyloxml that seem out of place there,
For example, the print_annotation and print_attr functions that print the annotations in phyloXML format.
Or the read_annotation function that reads the value of the annotation for a certain object.
I feel like these functions should go with the Annotation object,
But since there were no Annotation object that is phyloXML specific,
I just put them in the TreeIO::phyloxml.
This may change too in the future.

The documentations are all finished and can be seen in
http://www.bioperl.org/wiki/Module:Bio::TreeIO::phyloxml
http://www.bioperl.org/wiki/Module:Bio::Tree::AnnotatableNode
http://www.bioperl.org/wiki/Module:Bio::Annotation::Relation

The detailed progress of the project is documented in
http://www.bioperl.org/wiki/PhyloXML_support_in_BioPerl

and there is also a demo page that describes the use in
http://www.bioperl.org/wiki/Phyloxml_Project_Demo


Finally I'd like to thank Chris Fields and Hilmar Lapp,
for the constant support during the summer.
And the people on the list for providing helpful suggestions when I came with a question.
See you around.

Mira Han




On 9/14/08 1:15 PM, "Hilmar Lapp" <hlapp at duke.edu> wrote:

Hi all,

the 2008 Google Summer of Code program is officially over now. First
off, I'd like to congratulate all of our students: you all passed your
end-of-term evaluation, and you all passed solidly. Thanks for all
your hard work, beginning with writing and refining your project
applications and finally wrapping it up with documentation and a
demonstration project.

Based on what I can see, the students have all uploaded the code you
produced over the summer to the Google Code repository, as requested
by Google, so I'm not going to bore you with repeating the
instructions for how to do this. If you are still having trouble with
this process or have other questions regarding this though, don't
hesitate to let me know and ask any question you have.

For our imminently due Annual Report to NSF, we will need to document
your projects, and I am asking you for your help in this. Essentially,
we will need to produce similar information to what we composed for
the 2007 fall NESCent newsletter: for each project we need a short
summary of the project and the benefits of the results, written for a
scientific but otherwise general audience, a headshot of you (the
student), and a visual of the results. See

http://www.nescent.org/news/newsletter_10_07.php#google

for the example from last year as to what we have in mind. Kistin
Jenkins or Jory Weintraub from NESCent's Education and Outreach group
(both copied) will be in touch with you to possibly edit the summaries
and fine-tune the other material, but if the students could please
send your draft summary text, headshot, and visual as soon as you can
to eog at nescent.org that would be great. If you are not sure what to
use for the visual, I'd encourage you to speak with your mentor;
however, feel free to ask me as well.

Thanks again for working with us, and on your projects, and I hope you
all not only had a most enjoyable summer but also will keep involved
in your project as much as possible. I will also arrange for an end-of-
term teleconference with the students shortly, and one of the things
that I'd like to talk about is how we can best facilitate you
remaining involved beyond the official end of the program.

Cheers,

        -hilmar

--
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:- hlapp at duke dot edu :
===========================================================




_______________________________________________
Wg-phyloinformatics mailing list
Wg-phyloinformatics at nescent.org
https://lists.nescent.org/mailman/listinfo/wg-phyloinformatics





From hartzell at alerce.com  Wed Sep 17 04:21:36 2008
From: hartzell at alerce.com (George Hartzell)
Date: Tue, 16 Sep 2008 21:21:36 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18640.34256.305270.924007@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > George,
 > 
 > This is an error from my side. Great that you have a fix already.
 > 
 > My only worry is the number of external dependencies in BioPerl. To limit 
 > these we have recoded number of functionalities into BioPerl-specific modules. 
 > Before you commit the fix, could you see if Bio::RangeI could be used or easily 
 > extended to be used instead of Set::IntSpan?
 > 
 > Thanks,
 > 
 >    -Heikki
 > 
 > On Friday 05 September 2008 21:01:35 George Hartzell wrote:
 > > Hi all,
 > >
 > > Bio::Coordinate::Collection surprised me a bit.  At first I thought
 > > there was a bug, but it's clearly doing what it's supposed to.  Now
 > > I'm wondering if what it's supposed to be doing makes sense in some
 > > context, or if what I expected would be better functionality.
 > >
 > > t/CoordinateMapper.t sets up the following scenario:
 > >
 > > #
 > > # Collection
 > > #
 > > #         1   5     6   10
 > > #         |---|     |---|
 > > #-----|-----------------------
 > > #     1   5   9     15  19
 > > #         pair1     pair2
 > >
 > > Then goes on to do the following query:
 > >
 > >   # match more than two
 > >   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
 > >   ok $res = $transcribe->map($pos);
 > >   is $res->each_gap, 2;
 > >   is $res->each_match, 2;
 > >
 > > I was surprised to see that there were two gaps, one gene:10-19 and
 > > one from gene:5-14.  Looking at the code, what's really happening is
 > > that, for the exon1 mapper there's match with gene:5-9 and a gap with
 > > gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
 > > match with gene:15-19.  All four Result's just get tossed into the
 > > return value.
 > >
 > > The result my intuition wants is that there are two matches (gene:5-9
 > > with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
 > >
 > > Yes, I guess that I could just synthesize these myself from the result
 > > in my app.
 > >
 > > It still seems that the current result is a bug though, since there's
 > > no way of knowing when you're walking through $res->each_Location that
 > > the first "gap" is with respect to the exon1 mapper and that the
 > > second "gap" is with respect to the exon2 mapper.  The gaps are
 > > meaningless.
 > >
 > > I "fixed" it to work the way I think it should (two matches, one
 > > gap).  I actually extended the test case a bit so that there's a
 > > multi-base gap, a match, another multibase-gap, another match, then a
 > > single base gap (just to make sure I got that right...).  I had to
 > > touch up the test file a bit to account for my new test.
 > >
 > > The gaps that I return have a strand of 'undef', which seems to be The
 > > Right Thing.  There's also a bit of funny business where I hang onto
 > > the seq_id of the gapped sequence.  It assumes that the "in" sequence
 > > is the same for all of the mappers.  This seems safe since otherwise
 > > the entire query is kind of weird....
 > >
 > > There's a patch to todays svn head at:
 > >
 > >   http://shrimp.alerce.com/bioperl/collection-diffs.txt
 > >
 > > The patch changes Build.PL to include a dependency on Set::IntSpan,
 > > CoordinateMapper.t to update the tests, and
 > > Bio/CoordinateMapper/Collection.pm for the new code.
 > >
 > > Who's code would this break.
 > >
 > > If anyone's relying on the current behaviour re: gaps, what's the
 > > situation in which you find it useful?
 > >
 > > Thanks!
 > >
 > > g.

I suspect that I can redo it w/ RangeI's.  It'll be a good project.
I'm pushing on a project at the moment but will get to it this weekend
or next week.

thanks,

g.


From hartzell at alerce.com  Wed Sep 17 04:21:36 2008
From: hartzell at alerce.com (George Hartzell)
Date: Tue, 16 Sep 2008 21:21:36 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18640.34256.305270.924007@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > George,
 > 
 > This is an error from my side. Great that you have a fix already.
 > 
 > My only worry is the number of external dependencies in BioPerl. To limit 
 > these we have recoded number of functionalities into BioPerl-specific modules. 
 > Before you commit the fix, could you see if Bio::RangeI could be used or easily 
 > extended to be used instead of Set::IntSpan?
 > 
 > Thanks,
 > 
 >    -Heikki
 > 
 > On Friday 05 September 2008 21:01:35 George Hartzell wrote:
 > > Hi all,
 > >
 > > Bio::Coordinate::Collection surprised me a bit.  At first I thought
 > > there was a bug, but it's clearly doing what it's supposed to.  Now
 > > I'm wondering if what it's supposed to be doing makes sense in some
 > > context, or if what I expected would be better functionality.
 > >
 > > t/CoordinateMapper.t sets up the following scenario:
 > >
 > > #
 > > # Collection
 > > #
 > > #         1   5     6   10
 > > #         |---|     |---|
 > > #-----|-----------------------
 > > #     1   5   9     15  19
 > > #         pair1     pair2
 > >
 > > Then goes on to do the following query:
 > >
 > >   # match more than two
 > >   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
 > >   ok $res = $transcribe->map($pos);
 > >   is $res->each_gap, 2;
 > >   is $res->each_match, 2;
 > >
 > > I was surprised to see that there were two gaps, one gene:10-19 and
 > > one from gene:5-14.  Looking at the code, what's really happening is
 > > that, for the exon1 mapper there's match with gene:5-9 and a gap with
 > > gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
 > > match with gene:15-19.  All four Result's just get tossed into the
 > > return value.
 > >
 > > The result my intuition wants is that there are two matches (gene:5-9
 > > with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
 > >
 > > Yes, I guess that I could just synthesize these myself from the result
 > > in my app.
 > >
 > > It still seems that the current result is a bug though, since there's
 > > no way of knowing when you're walking through $res->each_Location that
 > > the first "gap" is with respect to the exon1 mapper and that the
 > > second "gap" is with respect to the exon2 mapper.  The gaps are
 > > meaningless.
 > >
 > > I "fixed" it to work the way I think it should (two matches, one
 > > gap).  I actually extended the test case a bit so that there's a
 > > multi-base gap, a match, another multibase-gap, another match, then a
 > > single base gap (just to make sure I got that right...).  I had to
 > > touch up the test file a bit to account for my new test.
 > >
 > > The gaps that I return have a strand of 'undef', which seems to be The
 > > Right Thing.  There's also a bit of funny business where I hang onto
 > > the seq_id of the gapped sequence.  It assumes that the "in" sequence
 > > is the same for all of the mappers.  This seems safe since otherwise
 > > the entire query is kind of weird....
 > >
 > > There's a patch to todays svn head at:
 > >
 > >   http://shrimp.alerce.com/bioperl/collection-diffs.txt
 > >
 > > The patch changes Build.PL to include a dependency on Set::IntSpan,
 > > CoordinateMapper.t to update the tests, and
 > > Bio/CoordinateMapper/Collection.pm for the new code.
 > >
 > > Who's code would this break.
 > >
 > > If anyone's relying on the current behaviour re: gaps, what's the
 > > situation in which you find it useful?
 > >
 > > Thanks!
 > >
 > > g.

I suspect that I can redo it w/ RangeI's.  It'll be a good project.
I'm pushing on a project at the moment but will get to it this weekend
or next week.

thanks,

g.


From cjfields at illinois.edu  Wed Sep 17 16:41:52 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 17 Sep 2008 11:41:52 -0500
Subject: [Bioperl-l] [Wg-phyloinformatics] Summer of Code: project
	summaries
In-Reply-To: <C4F4B9F7.5500%mirhan@indiana.edu>
References: <C4F4B9F7.5500%mirhan@indiana.edu>
Message-ID: <25D73268-25A1-4780-A2D2-F27D47081D83@illinois.edu>


On Sep 16, 2008, at 12:18 AM, Han, Mira wrote:

> Hi,
> Just writing to summarize the final product of this summer. (even  
> though it's overdue)

BLTN

> The phyloXML support in BioPerl project is finished officially,
> I've created three new modules,
> Bio::TreeIO::phyloxml,
> Bio::Tree::AnnotatableNode,
> and Bio::Annotation::Relation.
> The parsing is done for all elements except for <ProteinDomain>
> And the validation step is still missing.
> I'm planning to add those in in the future.

Great work!  One issue that will come up: have you tested round- 
tripping?

(i.e. where object data read in from the original phlyoxml data is the  
same as object data read in from bioperl-derived phyloxml output)

> I was contemplating to make a Bio::Annotation::XML till the end,
> But decided not to since there was already a new module  
> Bio::Annotation::TagTree, that looked like the same thing.
> Currently, the module does not use TagTree, it uses nested  
> AnnotationCollections instead, because TagTree was a temporary stub  
> at the time.

I would consider it no longer temporary (just changed it in svn).  The  
'stub' part was left over from the initial commit; it has now been  
tested with bioperl-db (via swissprot tests).  It may need more  
rigorous testing via bioperl-db but it appears to work just fine  
(famous last words...).

There was one issue with Data::Stag (repeated 'Use of undefined  
variable' errors that popped up with Annotation.t tests), but Chris M.  
released a new Data::Stag to CPAN just recently which fixes that.  It  
wasn't a bioperl bug and was relatively harmless.

> There are methods in phyloxml that seem out of place there,
> For example, the print_annotation and print_attr functions that  
> print the annotations in phyloXML format.
> Or the read_annotation function that reads the value of the  
> annotation for a certain object.
> I feel like these functions should go with the Annotation object,
> But since there were no Annotation object that is phyloXML specific,
> I just put them in the TreeIO::phyloxml.
> This may change too in the future.

I don't see a problem with this; if you look at the various IO parsers  
there are several helper methods present (see Bio::SeqIO::genbank for  
an example).

If you were to go that route, I would add a method to the (generic)  
Annotation class that accepts some customization via a callback, maybe  
using a default callback if one isn't supplied.  See the various  
Bio::AnnotationI display_text methods, which were added in as a more  
explicit replacement for operator overloading.

> The documentations are all finished and can be seen in
> http://www.bioperl.org/wiki/Module:Bio::TreeIO::phyloxml
> http://www.bioperl.org/wiki/Module:Bio::Tree::AnnotatableNode
> http://www.bioperl.org/wiki/Module:Bio::Annotation::Relation
>
> The detailed progress of the project is documented in
> http://www.bioperl.org/wiki/PhyloXML_support_in_BioPerl
>
> and there is also a demo page that describes the use in
> http://www.bioperl.org/wiki/Phyloxml_Project_Demo

I'll give them a look over, but that's a great start!

> Finally I'd like to thank Chris Fields and Hilmar Lapp,
> for the constant support during the summer.
> And the people on the list for providing helpful suggestions when I  
> came with a question.
> See you around.
>
> Mira Han

Thanks, and congrats on completeing the summer of code!  Hope you  
stick around a bit longer; we need all the hands we can get.

chris


From gundalav at gmail.com  Thu Sep 18 08:51:54 2008
From: gundalav at gmail.com (Gundala Viswanath)
Date: Thu, 18 Sep 2008 17:51:54 +0900
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with
	Bioperl
Message-ID: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>

Dear all,

Is there a way I can convert such EnSeMBL
probe names into Gene Symbol with BioPerl?

ENSG00000000003_at
ENSG00000000005_at
ENSG00000000419_at
ENSG00000000457_at
ENSG00000000460_at
ENSG00000000938_at
ENSG00000000971_at
ENSG00000001036_at
ENSG00000001084_at
ENSG00000001167_at
ENSG00000001461_at
ENSG00000001497_at
ENSG00000001561_at
... etc ...

Or perhaps there is a flat file for conversion?



- Gundala Viswanath
Jakarta - Indonesia


From cjfields at illinois.edu  Thu Sep 18 12:07:52 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 18 Sep 2008 07:07:52 -0500
Subject: [Bioperl-l] Species.t tests failing with bioperl-live
Message-ID: <C67B2790-EC0C-4F3A-A026-20CFBAE92B74@illinois.edu>

I'm getting a couple of failed tests with

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From cjfields at illinois.edu  Thu Sep 18 12:15:03 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 18 Sep 2008 07:15:03 -0500
Subject: [Bioperl-l] Species.t tests failing with bioperl-live
In-Reply-To: <C67B2790-EC0C-4F3A-A026-20CFBAE92B74@illinois.edu>
References: <C67B2790-EC0C-4F3A-A026-20CFBAE92B74@illinois.edu>
Message-ID: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>


On Sep 18, 2008, at 7:07 AM, Chris Fields wrote:

> I'm getting a couple of failed tests with


Um, that was supposed to be:

I'm getting a couple of failed tests with Species.t; I think these are  
due to the last commit to Bio::Species:

http://code.open-bio.org/svnweb/index.cgi/bioperl/revision/?rev=14793

Tests pass after commenting out that line.

chris


From bernd.web at gmail.com  Thu Sep 18 17:34:49 2008
From: bernd.web at gmail.com (Bernd Web)
Date: Thu, 18 Sep 2008 19:34:49 +0200
Subject: [Bioperl-l] SimpleAlign/AlignIO
Message-ID: <716af09c0809181034w2f9cc44do6b2a02502ea81fea@mail.gmail.com>

Hi,

Possibly I overlooked this, but is it not possible to supply an
alphabet to SimpleAlign?
When SimpleAlign starts making sequence objects _guess_alphabet is
executed and in case the sequence (slice) only contains gaps a warning
is raised as the alphabet cannot be guessed.
As all sequences in the alignment (generally) would be of the same
type, it could be good to set the alpabet for the alignment; this also
would prevent the executing of _guess_alphabet for all sequences. Is
this possible?


Regards,
Bernd


From cjfields at illinois.edu  Thu Sep 18 17:56:56 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 18 Sep 2008 12:56:56 -0500
Subject: [Bioperl-l] SimpleAlign/AlignIO
In-Reply-To: <716af09c0809181034w2f9cc44do6b2a02502ea81fea@mail.gmail.com>
References: <716af09c0809181034w2f9cc44do6b2a02502ea81fea@mail.gmail.com>
Message-ID: <9012F474-5762-4ABA-ADAB-7F0ECB38ACC3@illinois.edu>

Bernd,

I'm not sure it's a good idea to constrain the entire alignment (and  
all sequences contained within) to a single alphabet.  For instance,  
what if I wanted to align a translated (protein) sequence, possibly as  
3- or 6-frame, to a DNA sequence of interest?  Or if I wanted to align  
a Meta sequence w/o an alphabet (i.e. a structural consensus sequence)  
with a DNA/RNA/protein sequence?  The former example is fairly common  
and may not be entirely possible with SimpleAlign (I haven't tried it  
to tell the truth), but the latter is what I do with the Stockholm  
parser.

chris

On Sep 18, 2008, at 12:34 PM, Bernd Web wrote:

> Hi,
>
> Possibly I overlooked this, but is it not possible to supply an
> alphabet to SimpleAlign?
> When SimpleAlign starts making sequence objects _guess_alphabet is
> executed and in case the sequence (slice) only contains gaps a warning
> is raised as the alphabet cannot be guessed.
> As all sequences in the alignment (generally) would be of the same
> type, it could be good to set the alpabet for the alignment; this also
> would prevent the executing of _guess_alphabet for all sequences. Is
> this possible?
>
>
> Regards,
> Bernd
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From MEC at stowers-institute.org  Thu Sep 18 21:20:02 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Thu, 18 Sep 2008 16:20:02 -0500
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
	with	Bioperl
In-Reply-To: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>

Gundala,

Here is an option - if you want a script...

http://research.stowers-institute.org/mec/software/scripts/affyprobeset2ensg/

It is not bioperl.   It is perl.  It uses DBI to query the ensembl MySQL database using SQL.  It may be outdated due to changes in Ensembl schema.

Good luck,

Malcolm Cook
Stowers Institute for Medical Research - Kansas City, Missouri

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Gundala Viswanath
Sent: Thursday, September 18, 2008 3:52 AM
To: bioperl-l at lists.open-bio.org
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with Bioperl

Dear all,

Is there a way I can convert such EnSeMBL probe names into Gene Symbol with BioPerl?

ENSG00000000003_at
ENSG00000000005_at
ENSG00000000419_at
ENSG00000000457_at
ENSG00000000460_at
ENSG00000000938_at
ENSG00000000971_at
ENSG00000001036_at
ENSG00000001084_at
ENSG00000001167_at
ENSG00000001461_at
ENSG00000001497_at
ENSG00000001561_at
... etc ...

Or perhaps there is a flat file for conversion?



- Gundala Viswanath
Jakarta - Indonesia
_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l



From anjan.purkayastha at gmail.com  Thu Sep 18 21:27:06 2008
From: anjan.purkayastha at gmail.com (ANJAN PURKAYASTHA)
Date: Thu, 18 Sep 2008 17:27:06 -0400
Subject: [Bioperl-l] Retrieving taxonomy information from a GenBank file
Message-ID: <f03f40920809181427k168bfc3cu535c023949735cd9@mail.gmail.com>

Hi,
I'm using the following code to access the "ORGANISM" tag value for the
record NC_002526.
I get a value of 0 even though the ORGANISM tag  has a value.  Any idea how
this might be corrected?
Thanks.
Anjan


my $gb= new Bio::DB::GenBank;

my $seq = $gb->get_Seq_by_acc('NC_002526');

my $des= $seq->get_tag_values("ORGANISM");

-- 
=============================
anjan purkayastha, phd
bioinformatics analyst
whitehead institute for biomedical research
nine cambridge center
cambridge, ma 02142

purkayas [at] wi [dot] mit [dot] edu
703.740.6939


From jason at bioperl.org  Thu Sep 18 21:51:54 2008
From: jason at bioperl.org (Jason Stajich)
Date: Thu, 18 Sep 2008 14:51:54 -0700
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with
	Bioperl
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
Message-ID: <F1CAA89B-D7E9-40B3-9965-9636B4F5F852@bioperl.org>

seems like something that biomart was designed for? There is a  
scripting interface too.
http://biomart.org/

On Sep 18, 2008, at 2:20 PM, Cook, Malcolm wrote:

> Gundala,
>
> Here is an option - if you want a script...
>
> http://research.stowers-institute.org/mec/software/scripts/affyprobeset2ensg/
>
> It is not bioperl.   It is perl.  It uses DBI to query the ensembl  
> MySQL database using SQL.  It may be outdated due to changes in  
> Ensembl schema.
>
> Good luck,
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org 
> ] On Behalf Of Gundala Viswanath
> Sent: Thursday, September 18, 2008 3:52 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol  
> with Bioperl
>
> Dear all,
>
> Is there a way I can convert such EnSeMBL probe names into Gene  
> Symbol with BioPerl?
>
> ENSG00000000003_at
> ENSG00000000005_at
> ENSG00000000419_at
> ENSG00000000457_at
> ENSG00000000460_at
> ENSG00000000938_at
> ENSG00000000971_at
> ENSG00000001036_at
> ENSG00000001084_at
> ENSG00000001167_at
> ENSG00000001461_at
> ENSG00000001497_at
> ENSG00000001561_at
> ... etc ...
>
> Or perhaps there is a flat file for conversion?
>
>
>
> - Gundala Viswanath
> Jakarta - Indonesia
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From jason at bioperl.org  Thu Sep 18 21:56:18 2008
From: jason at bioperl.org (Jason Stajich)
Date: Thu, 18 Sep 2008 14:56:18 -0700
Subject: [Bioperl-l] Retrieving taxonomy information from a GenBank file
In-Reply-To: <f03f40920809181427k168bfc3cu535c023949735cd9@mail.gmail.com>
References: <f03f40920809181427k168bfc3cu535c023949735cd9@mail.gmail.com>
Message-ID: <E078758D-D451-4973-A66D-2D6D829FCA53@bioperl.org>

You want the species object ($seq->species)  -- see the Seq HOWTO,  
much of the Seq API is explained.
  http://bioperl.org/wiki/HOWTO:Feature-Annotation#The_Species_Object

-jason
On Sep 18, 2008, at 2:27 PM, ANJAN PURKAYASTHA wrote:

> Hi,
> I'm using the following code to access the "ORGANISM" tag value for  
> the
> record NC_002526.
> I get a value of 0 even though the ORGANISM tag  has a value.  Any  
> idea how
> this might be corrected?
> Thanks.
> Anjan
>
>
> my $gb= new Bio::DB::GenBank;
>
> my $seq = $gb->get_Seq_by_acc('NC_002526');
>
> my $des= $seq->get_tag_values("ORGANISM");
>
> -- 
> =============================
> anjan purkayastha, phd
> bioinformatics analyst
> whitehead institute for biomedical research
> nine cambridge center
> cambridge, ma 02142
>
> purkayas [at] wi [dot] mit [dot] edu
> 703.740.6939
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From cjfields at illinois.edu  Thu Sep 18 21:48:26 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 18 Sep 2008 16:48:26 -0500
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
	with	Bioperl
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
Message-ID: <0F56A0A4-AE10-4930-B479-C4D0818EAC7A@illinois.edu>

You can probably use the Ensembl perl API alone or in combination with  
bioperl.  I'm not sure it is working with the latest code (bioperl- 
live), but it's worth a try:

http://www.ensembl.org/info/using/api/core/core_tutorial.html
http://www.bioperl.org/wiki/HOWTO:Getting_Genomic_Sequences#Using_the_Perl_API_at_ENSEMBL

chris

On Sep 18, 2008, at 4:20 PM, Cook, Malcolm wrote:

> Gundala,
>
> Here is an option - if you want a script...
>
> http://research.stowers-institute.org/mec/software/scripts/affyprobeset2ensg/
>
> It is not bioperl.   It is perl.  It uses DBI to query the ensembl  
> MySQL database using SQL.  It may be outdated due to changes in  
> Ensembl schema.
>
> Good luck,
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org 
> ] On Behalf Of Gundala Viswanath
> Sent: Thursday, September 18, 2008 3:52 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol  
> with Bioperl
>
> Dear all,
>
> Is there a way I can convert such EnSeMBL probe names into Gene  
> Symbol with BioPerl?
>
> ENSG00000000003_at
> ENSG00000000005_at
> ENSG00000000419_at
> ENSG00000000457_at
> ENSG00000000460_at
> ENSG00000000938_at
> ENSG00000000971_at
> ENSG00000001036_at
> ENSG00000001084_at
> ENSG00000001167_at
> ENSG00000001461_at
> ENSG00000001497_at
> ENSG00000001561_at
> ... etc ...
>
> Or perhaps there is a flat file for conversion?
>
>
>
> - Gundala Viswanath
> Jakarta - Indonesia
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign






From spiros at lokku.com  Fri Sep 19 10:17:52 2008
From: spiros at lokku.com (Spiros Denaxas)
Date: Fri, 19 Sep 2008 11:17:52 +0100
Subject: [Bioperl-l] code coverage metrics
Message-ID: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>

Hello,

I recently sent Chris an email about an idea I had, quantifying (and
improving) the test coverage that we currently have on the bioperl
core. I know there's a list on the wiki [1] with a list of tests that
have low coverage and/or complete lack of tests. My idea was to
somehow standardize and automate the generation of this list,
preferably on a weekly basis initially. We can then more easily see
where help is needed and possible assign individual tasks to tackle
the most-suffering modules.

There are currently several very good CPAN modules that do this, like
Devel::Cover [2]. Is there any objection if I kick this off and start
doing some work, aiming into creating a more detailed report on code
coverage using the current HEAD and test suite?

Spiros

[1] http://www.bioperl.org/wiki/Untested_Modules_in_BioPerl
[2] http://search.cpan.org/dist/Devel-Cover/lib/Devel/Cover.pm


From spiros at lokku.com  Fri Sep 19 11:51:29 2008
From: spiros at lokku.com (Spiros Denaxas)
Date: Fri, 19 Sep 2008 12:51:29 +0100
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <48D391BD.5010105@sendu.me.uk>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
	<48D391BD.5010105@sendu.me.uk>
Message-ID: <bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>

On Fri, Sep 19, 2008 at 12:49 PM, Sendu Bala <bix at sendu.me.uk> wrote:
> Spiros Denaxas wrote:
>>
>> There are currently several very good CPAN modules that do this, like
>> Devel::Cover [2]. Is there any objection if I kick this off and start
>> doing some work, aiming into creating a more detailed report on code
>> coverage using the current HEAD and test suite?
>
> You should read our previous discussion here:
> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/14586/focus=14588
>
> Basically I think we have it all in place now; someone just needs to take
> that last step and run a cron job that runs the Build commands. We also need
> the website side of things sorted out I think.
>
> If you could make those things happen and take care of any issues that crop
> up, that would be great.
>

Enlightening, thank you for pointing that out. I will have a look, I
don't see a problem with the plan.

Spiros


From spiros at lokku.com  Fri Sep 19 12:01:15 2008
From: spiros at lokku.com (Spiros Denaxas)
Date: Fri, 19 Sep 2008 13:01:15 +0100
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
	<48D391BD.5010105@sendu.me.uk>
	<bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
Message-ID: <bba689ec0809190501v56cb4eedx159410c2ebf76c7a@mail.gmail.com>

>
> Enlightening, thank you for pointing that out. I will have a look, I
> don't see a problem with the plan.
>
> Spiros
>

I have also updated the wiki to make sure we avoid duplicate effort on
this, http://www.bioperl.org/wiki/Project_priority_list

Spiros


From bix at sendu.me.uk  Fri Sep 19 11:49:17 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 19 Sep 2008 12:49:17 +0100
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
Message-ID: <48D391BD.5010105@sendu.me.uk>

Spiros Denaxas wrote:
> There are currently several very good CPAN modules that do this, like
> Devel::Cover [2]. Is there any objection if I kick this off and start
> doing some work, aiming into creating a more detailed report on code
> coverage using the current HEAD and test suite?

You should read our previous discussion here:
http://thread.gmane.org/gmane.comp.lang.perl.bio.general/14586/focus=14588

Basically I think we have it all in place now; someone just needs to 
take that last step and run a cron job that runs the Build commands. We 
also need the website side of things sorted out I think.

If you could make those things happen and take care of any issues that 
crop up, that would be great.


From cjfields at illinois.edu  Fri Sep 19 12:22:02 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 19 Sep 2008 07:22:02 -0500
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>
	<48D391BD.5010105@sendu.me.uk>
	<bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
Message-ID: <0C6AAAEE-5D80-4102-B03D-FE0C045492AA@illinois.edu>


On Sep 19, 2008, at 6:51 AM, Spiros Denaxas wrote:

> On Fri, Sep 19, 2008 at 12:49 PM, Sendu Bala <bix at sendu.me.uk> wrote:
>> Spiros Denaxas wrote:
>>>
>>> There are currently several very good CPAN modules that do this,  
>>> like
>>> Devel::Cover [2]. Is there any objection if I kick this off and  
>>> start
>>> doing some work, aiming into creating a more detailed report on code
>>> coverage using the current HEAD and test suite?
>>
>> You should read our previous discussion here:
>> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/14586/focus=14588
>>
>> Basically I think we have it all in place now; someone just needs  
>> to take
>> that last step and run a cron job that runs the Build commands. We  
>> also need
>> the website side of things sorted out I think.
>>
>> If you could make those things happen and take care of any issues  
>> that crop
>> up, that would be great.
>>
>
> Enlightening, thank you for pointing that out. I will have a look, I
> don't see a problem with the plan.
>
> Spiros

Didn't know it was that far along!  Any help pushing this along would  
be wonderful.

chris


From MEC at stowers-institute.org  Fri Sep 19 13:06:08 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Fri, 19 Sep 2008 08:06:08 -0500
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with
 Bioperl
In-Reply-To: <F1CAA89B-D7E9-40B3-9965-9636B4F5F852@bioperl.org>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
	<F1CAA89B-D7E9-40B3-9965-9636B4F5F852@bioperl.org>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD5867@exchmb-02.stowers-institute.org>

Jason,

Yes .... Biomart .... If I remember correctly, at the time I wrote the script, the problem with using biomart interactively for this task was that though you could query for genes or transcripts by affy id, the results would not include the term you queried with, so, you just get a list of genes that match any of your affyids without knowing which goes with which.

But perhaps I was wrong.  Certainly I see now that it is possible interactively to return the affyid for any gene for many standard probesets.

Cheers,

Malcolm Cook

-----Original Message-----
From: Jason Stajich [mailto:jason.stajich at gmail.com] On Behalf Of Jason Stajich
Sent: Thursday, September 18, 2008 4:52 PM
To: Cook, Malcolm
Cc: 'Gundala Viswanath'; 'bioperl-l at lists.open-bio.org'
Subject: Re: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with Bioperl

seems like something that biomart was designed for? There is a scripting interface too.
http://biomart.org/

On Sep 18, 2008, at 2:20 PM, Cook, Malcolm wrote:

> Gundala,
>
> Here is an option - if you want a script...
>
> http://research.stowers-institute.org/mec/software/scripts/affyprobese
> t2ensg/
>
> It is not bioperl.   It is perl.  It uses DBI to query the ensembl
> MySQL database using SQL.  It may be outdated due to changes in
> Ensembl schema.
>
> Good luck,
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org
> ] On Behalf Of Gundala Viswanath
> Sent: Thursday, September 18, 2008 3:52 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
> with Bioperl
>
> Dear all,
>
> Is there a way I can convert such EnSeMBL probe names into Gene Symbol
> with BioPerl?
>
> ENSG00000000003_at
> ENSG00000000005_at
> ENSG00000000419_at
> ENSG00000000457_at
> ENSG00000000460_at
> ENSG00000000938_at
> ENSG00000000971_at
> ENSG00000001036_at
> ENSG00000001084_at
> ENSG00000001167_at
> ENSG00000001461_at
> ENSG00000001497_at
> ENSG00000001561_at
> ... etc ...
>
> Or perhaps there is a flat file for conversion?
>
>
>
> - Gundala Viswanath
> Jakarta - Indonesia
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org






From MEC at stowers-institute.org  Fri Sep 19 13:09:00 2008
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Fri, 19 Sep 2008 08:09:00 -0500
Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
	with	Bioperl
In-Reply-To: <0F56A0A4-AE10-4930-B479-C4D0818EAC7A@illinois.edu>
References: <73f827b50809180151u3ef0fad8k74623036072dfba6@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC129FFD584D@exchmb-02.stowers-institute.org>
	<0F56A0A4-AE10-4930-B479-C4D0818EAC7A@illinois.edu>
Message-ID: <BD62CBAC4395B94096109020651BE2EC129FFD5868@exchmb-02.stowers-institute.org>


Chris is right- the Ensembl perl API works fine. If you care to go this route and want to crib the code, you will see that my script has a commented out implementation using Ensembl perl API - it suffered from being MUCH TOO SLOOOOOOOOOO - accessing the tables directly was MUCH faster (unpublished correspondance with self)

However, the API is much more likely to be backwards compatible in the face of database schema changes at Ensembl....

Malcolm Cook

-----Original Message-----
From: Chris Fields [mailto:cjfields at illinois.edu]
Sent: Thursday, September 18, 2008 4:48 PM
To: Cook, Malcolm
Cc: 'Gundala Viswanath'; 'bioperl-l at lists.open-bio.org'
Subject: Re: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol with Bioperl

You can probably use the Ensembl perl API alone or in combination with bioperl.  I'm not sure it is working with the latest code (bioperl- live), but it's worth a try:

http://www.ensembl.org/info/using/api/core/core_tutorial.html
http://www.bioperl.org/wiki/HOWTO:Getting_Genomic_Sequences#Using_the_Perl_API_at_ENSEMBL

chris

On Sep 18, 2008, at 4:20 PM, Cook, Malcolm wrote:

> Gundala,
>
> Here is an option - if you want a script...
>
> http://research.stowers-institute.org/mec/softyware/scripts/affyprobese
> t2ensg/
>
> It is not bioperl.   It is perl.  It uses DBI to query the ensembl
> MySQL database using SQL.  It may be outdated due to changes in
> Ensembl schema.
>
> Good luck,
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org
> ] On Behalf Of Gundala Viswanath
> Sent: Thursday, September 18, 2008 3:52 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Converting EnSeMBL Probe names to Gene Symbol
> with Bioperl
>
> Dear all,
>
> Is there a way I can convert such EnSeMBL probe names into Gene Symbol
> with BioPerl?
>
> ENSG00000000003_at
> ENSG00000000005_at
> ENSG00000000419_at
> ENSG00000000457_at
> ENSG00000000460_at
> ENSG00000000938_at
> ENSG00000000971_at
> ENSG00000001036_at
> ENSG00000001084_at
> ENSG00000001167_at
> ENSG00000001461_at
> ENSG00000001497_at
> ENSG00000001561_at
> ... etc ...
>
> Or perhaps there is a flat file for conversion?
>
>
>
> - Gundala Viswanath
> Jakarta - Indonesia
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Marie-Claude Hofmann
College of Veterinary Medicine
University of Illinois Urbana-Champaign







From mauricio at open-bio.org  Fri Sep 19 14:06:22 2008
From: mauricio at open-bio.org (Mauricio Herrera Cuadra)
Date: Fri, 19 Sep 2008 09:06:22 -0500
Subject: [Bioperl-l] code coverage metrics
In-Reply-To: <0C6AAAEE-5D80-4102-B03D-FE0C045492AA@illinois.edu>
References: <bba689ec0809190317t53a5beeaga704e20cc30484f7@mail.gmail.com>	<48D391BD.5010105@sendu.me.uk>	<bba689ec0809190451y25c1c807ke06e5ee0003d81bb@mail.gmail.com>
	<0C6AAAEE-5D80-4102-B03D-FE0C045492AA@illinois.edu>
Message-ID: <48D3B1DE.7070505@open-bio.org>

Sorry guys, this has been my fault due to lack of time. I have a very 
old ticket waiting for me at the OBF Helpdesk to get the website side of 
things done. Spiros, I have some spare time today to try setting it up, 
assign it to me in the wiki list if you want, I'll send an update in a 
couple of days.

Thanks,
Mauricio.


Chris Fields wrote:
> 
> On Sep 19, 2008, at 6:51 AM, Spiros Denaxas wrote:
> 
>> On Fri, Sep 19, 2008 at 12:49 PM, Sendu Bala <bix at sendu.me.uk> wrote:
>>> Spiros Denaxas wrote:
>>>>
>>>> There are currently several very good CPAN modules that do this, like
>>>> Devel::Cover [2]. Is there any objection if I kick this off and start
>>>> doing some work, aiming into creating a more detailed report on code
>>>> coverage using the current HEAD and test suite?
>>>
>>> You should read our previous discussion here:
>>> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/14586/focus=14588 
>>>
>>>
>>> Basically I think we have it all in place now; someone just needs to 
>>> take
>>> that last step and run a cron job that runs the Build commands. We 
>>> also need
>>> the website side of things sorted out I think.
>>>
>>> If you could make those things happen and take care of any issues 
>>> that crop
>>> up, that would be great.
>>>
>>
>> Enlightening, thank you for pointing that out. I will have a look, I
>> don't see a problem with the plan.
>>
>> Spiros
> 
> Didn't know it was that far along!  Any help pushing this along would be 
> wonderful.
> 
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 


From heikki at sanbi.ac.za  Fri Sep 19 16:22:23 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Fri, 19 Sep 2008 18:22:23 +0200
Subject: [Bioperl-l] phylogeny-trait association methods into BioPerl
In-Reply-To: <200809101332.07137.heikki@sanbi.ac.za>
References: <200809101332.07137.heikki@sanbi.ac.za>
Message-ID: <200809191822.23503.heikki@sanbi.ac.za>

The code is now in SVN. Bio::Tree::TreeFunctionsI::add_trait() can be used to 
set trait values in a tree.

Enjoy,

   -Heikki

On Wednesday 10 September 2008 13:32:06 Heikki Lehvaslaiho wrote:
> FYI,
>
> I've been recently writing code to analyse phylogeny-trait associations.
> These traits are typically geographical location of the sequence but they
> can be any phenotypic characters associated with the sequences.
>
> This involves trees, i.e. Bio::Tree::Tree and Bio::Tree::Node objects and
> strings describing the traits. I've been using tags to store trait values
> within nodes. The tag methods are:
>
> Bio::Tree::Node::add_tag_value
> Bio::Tree::Node::get_all_tags
> Bio::Tree::Node::get_tag_values
> Bio::Tree::Node::has_tag
> Bio::Tree::Node::remove_all_tags
> Bio::Tree::Node::remove_tag
>
> Question: Is  there any particular reason why there is no
> set_tag_value(scalar|@array) method?
>
> I am getting tired of writing:
>   $node->remove_tag($key);
>   map {$node->add_tag_value($key)} @values ;
> so I am going to implement that unless there is are strong objections.
>
> Otherwise it has been smooth sailing. I am going to add
> Bio::Tree::TreeFunctions::is_binary() and start populating
> Bio::Tree::Statistics soon with these methods:
>
> ps() - Parsimony Score (PS) from Fitch 1971
> ai() - Association index (AI) of Whang et al. 2001
> mc() - Monophyletic Clade (MC) size statistics by Salemi at al. 2005
> cherries() - number of leaf node pairs
>
> If you have any comments, please feel free to post them here.
>
>     -Heikki

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From hartzell at alerce.com  Tue Sep 23 21:16:48 2008
From: hartzell at alerce.com (George Hartzell)
Date: Tue, 23 Sep 2008 14:16:48 -0700
Subject: [Bioperl-l] confused about version numbers.
Message-ID: <18649.23744.832478.551299@almost.alerce.com>


I recently realized that I needed a feature from
Bio::Search::Hit::GenericHit that exists in the svn trunk but isn't in
the CPAN's version bioperl-1.5.2_102.

I thought I'd just specify a version number in my Build.PL and that
way I could sleep soundly.

But, it looks like $Version in CPAN's Bio::Root::Version is
1.005002_102 while in the trunk it's 1.005002_100.

What's the proper way for a Build.PL to be sure that it has a current
bioperl?

g.


From sac at bioperl.org  Tue Sep 23 22:05:15 2008
From: sac at bioperl.org (Steve Chervitz)
Date: Tue, 23 Sep 2008 15:05:15 -0700
Subject: [Bioperl-l] confused about version numbers.
In-Reply-To: <18649.23744.832478.551299@almost.alerce.com>
References: <18649.23744.832478.551299@almost.alerce.com>
Message-ID: <8f200b4c0809231505p6b3f9e77i278f52bcc355489@mail.gmail.com>

Here's the general recommendation from the FAQ:

http://bio.perl.org/wiki/FAQ#How_can_I_tell_what_version_of_BioPerl_is_installed.3F

Not sure the recommended way to do this from a Build.PL. You could so such
checking within a BEGIN block in your Build.PL, perhaps.

Steve

On Tue, Sep 23, 2008 at 2:16 PM, George Hartzell <hartzell at alerce.com>wrote:

>
> I recently realized that I needed a feature from
> Bio::Search::Hit::GenericHit that exists in the svn trunk but isn't in
> the CPAN's version bioperl-1.5.2_102.
>
> I thought I'd just specify a version number in my Build.PL and that
> way I could sleep soundly.
>
> But, it looks like $Version in CPAN's Bio::Root::Version is
> 1.005002_102 while in the trunk it's 1.005002_100.
>
> What's the proper way for a Build.PL to be sure that it has a current
> bioperl?
>
> g.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From bix at sendu.me.uk  Tue Sep 23 21:51:57 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 23 Sep 2008 22:51:57 +0100
Subject: [Bioperl-l] confused about version numbers.
In-Reply-To: <18649.23744.832478.551299@almost.alerce.com>
References: <18649.23744.832478.551299@almost.alerce.com>
Message-ID: <48D964FD.7060007@sendu.me.uk>

George Hartzell wrote:
> I recently realized that I needed a feature from
> Bio::Search::Hit::GenericHit that exists in the svn trunk but isn't in
> the CPAN's version bioperl-1.5.2_102.
> 
> I thought I'd just specify a version number in my Build.PL and that
> way I could sleep soundly.
> 
> But, it looks like $Version in CPAN's Bio::Root::Version is
> 1.005002_102 while in the trunk it's 1.005002_100.

Fixed. It's now 1.005002_103.


> What's the proper way for a Build.PL to be sure that it has a current
> bioperl?

Your method was sound, I think.


From cjfields at illinois.edu  Wed Sep 24 01:23:25 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 23 Sep 2008 20:23:25 -0500
Subject: [Bioperl-l] Bio::Species bug,
	was  Species.t tests failing with bioperl-live
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
Message-ID: <CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>

I'm reposting this in case it was lost (or forgotten).  I'll file it  
as a bug if it's not addressed fairly soonish, but I would consider  
this a serious blocker for a 1.6 release.  Any help would be   
appreciated.

The last commit to Bio::Species, which was an effort to fix a memory  
leak, has unfortunately broken Species.t tests.  The relevant commit  
used weaken(); my guess is something is being garbage collected way  
too early.  Any ideas?

chris

Begin forwarded message:

> From: Chris Fields <cjfields at illinois.edu>
> Date: September 18, 2008 7:15:03 AM CDT
> To: Chris Fields <cjfields at illinois.edu>
> Cc: BioPerl List <bioperl-l at lists.open-bio.org>
> Subject: Re: [Bioperl-l] Species.t tests failing with bioperl-live
>
>
> On Sep 18, 2008, at 7:07 AM, Chris Fields wrote:
>
>> I'm getting a couple of failed tests with
>
>
> Um, that was supposed to be:
>
> I'm getting a couple of failed tests with Species.t; I think these  
> are due to the last commit to Bio::Species:
>
> http://code.open-bio.org/svnweb/index.cgi/bioperl/revision/?rev=14793
>
> Tests pass after commenting out that line.
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




From Caroline.Johnston at iop.kcl.ac.uk  Wed Sep 24 14:19:05 2008
From: Caroline.Johnston at iop.kcl.ac.uk (Johnston, Caroline)
Date: Wed, 24 Sep 2008 15:19:05 +0100
Subject: [Bioperl-l] Using Storable with SeqFeatures
Message-ID: <5626ED9CB91C814197079FB9940312E506445F9B@MAIL.bc.iop.kcl.ac.uk>

Hello.

I'm trying to use Storable to save a Bio::Seq object and Storable seems to be having a weird problem dealing with freezing and thawing the code ref to Bio::SeqFeature::Generic cleanup_generic. If I change one line (931) in that function from

    foreach my $t ( keys %{$self->{'_gsf_tag_hash'} || {} } ) {
                                                    ------
 to

    foreach my $t ( keys %{$self->{'_gsf_tag_hash'} } ) {

it works fine. I've pasted an example script at http://sial.org/pbot/32320.

Any ideas why this syntax would break Storable? Would wrapping the foreach in an if(defined $self->{'_gsf_tag_hash'}) serve to replace the || {} ?

I get the same problem using Bio::Root::Storable.

Cxx 



From cain.cshl at gmail.com  Wed Sep 24 22:00:35 2008
From: cain.cshl at gmail.com (Scott Cain)
Date: Wed, 24 Sep 2008 18:00:35 -0400
Subject: [Bioperl-l] genbank2gff.pl choking on CONTIG sections
Message-ID: <536f21b00809241500x5414289ayea143c7124758f5e@mail.gmail.com>

Hi all,

The BioPerl script bp_genbank2gff.pl, which will either convert a
Genbank record to GFF or load it directly to a Bio::DB::GFF database,
is choking on GenBank records with CONTIG sections.  Since I don't
think these would ever be useful for generating GFF or loading into a
database (ie, the user will want to get all of the features on the
parts, not know what the parts are), is there a way to force a
Bio::DB::WebDBSeqI/Bio::DB::BioFetch to get the full record (like
specifying view=gbwithparts in the url at ncbi)?

Thanks,
Scott


-- 
------------------------------------------------------------------------
Scott Cain, Ph. D. cain.cshl at gmail.com
GMOD Coordinator (http://gmod.org/) 216-392-3087
Cold Spring Harbor Laboratory


From jason at bioperl.org  Wed Sep 24 23:05:18 2008
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 24 Sep 2008 16:05:18 -0700
Subject: [Bioperl-l] genbank2gff.pl choking on CONTIG sections
In-Reply-To: <536f21b00809241500x5414289ayea143c7124758f5e@mail.gmail.com>
References: <536f21b00809241500x5414289ayea143c7124758f5e@mail.gmail.com>
Message-ID: <5D6FEF22-76B7-4770-B749-A643AFF99169@bioperl.org>

It should already if it is using Bio::DB::GenBank -- do you have  
example of a fail?  There seems to be some defaulting to EMBL for the  
source in the biofetch code so it might be worth twiddling.

from Bio::DB::GenBank

Note that when querying for GenBank accessions starting with 'NT_' you
will need to call $gb->request_format('fasta') beforehand, because
in GenBank format (the default) the sequence part will be left out
(the reason is that NT contigs are rather annotation with references
to clones).

Some work has been done to automatically detect and retrieve whole NT_  
clones
when the data is in that format (NCBI RefSeq clones). The former  
behavior prior
to bioperl 1.6 was to retrieve these from EBI, but now these are  
retrieved
directly from NCBI. The older behavior can be regained by setting the
'redirect_refseq' flag to a value evaluating to TRUE.


On Sep 24, 2008, at 3:00 PM, Scott Cain wrote:

> Hi all,
>
> The BioPerl script bp_genbank2gff.pl, which will either convert a
> Genbank record to GFF or load it directly to a Bio::DB::GFF database,
> is choking on GenBank records with CONTIG sections.  Since I don't
> think these would ever be useful for generating GFF or loading into a
> database (ie, the user will want to get all of the features on the
> parts, not know what the parts are), is there a way to force a
> Bio::DB::WebDBSeqI/Bio::DB::BioFetch to get the full record (like
> specifying view=gbwithparts in the url at ncbi)?
>
> Thanks,
> Scott
>
>
> -- 
> ------------------------------------------------------------------------
> Scott Cain, Ph. D. cain.cshl at gmail.com
> GMOD Coordinator (http://gmod.org/) 216-392-3087
> Cold Spring Harbor Laboratory
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From hartzell at alerce.com  Thu Sep 25 05:17:54 2008
From: hartzell at alerce.com (George Hartzell)
Date: Wed, 24 Sep 2008 22:17:54 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18651.7938.496813.710345@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > George,
 > 
 > This is an error from my side. Great that you have a fix already.
 > 
 > My only worry is the number of external dependencies in BioPerl. To limit 
 > these we have recoded number of functionalities into BioPerl-specific modules. 
 > Before you commit the fix, could you see if Bio::RangeI could be used or easily 
 > extended to be used instead of Set::IntSpan?
 > 
 > Thanks,
 > 
 >    -Heikki
 > 
 > On Friday 05 September 2008 21:01:35 George Hartzell wrote:
 > > Hi all,
 > >
 > > Bio::Coordinate::Collection surprised me a bit.  At first I thought
 > > there was a bug, but it's clearly doing what it's supposed to.  Now
 > > I'm wondering if what it's supposed to be doing makes sense in some
 > > context, or if what I expected would be better functionality.
 > >
 > > t/CoordinateMapper.t sets up the following scenario:
 > >
 > > #
 > > # Collection
 > > #
 > > #         1   5     6   10
 > > #         |---|     |---|
 > > #-----|-----------------------
 > > #     1   5   9     15  19
 > > #         pair1     pair2
 > >
 > > Then goes on to do the following query:
 > >
 > >   # match more than two
 > >   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
 > >   ok $res = $transcribe->map($pos);
 > >   is $res->each_gap, 2;
 > >   is $res->each_match, 2;
 > >
 > > I was surprised to see that there were two gaps, one gene:10-19 and
 > > one from gene:5-14.  Looking at the code, what's really happening is
 > > that, for the exon1 mapper there's match with gene:5-9 and a gap with
 > > gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
 > > match with gene:15-19.  All four Result's just get tossed into the
 > > return value.
 > >
 > > The result my intuition wants is that there are two matches (gene:5-9
 > > with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
 > >
 > > Yes, I guess that I could just synthesize these myself from the result
 > > in my app.
 > >
 > > It still seems that the current result is a bug though, since there's
 > > no way of knowing when you're walking through $res->each_Location that
 > > the first "gap" is with respect to the exon1 mapper and that the
 > > second "gap" is with respect to the exon2 mapper.  The gaps are
 > > meaningless.
 > >
 > > I "fixed" it to work the way I think it should (two matches, one
 > > gap).  I actually extended the test case a bit so that there's a
 > > multi-base gap, a match, another multibase-gap, another match, then a
 > > single base gap (just to make sure I got that right...).  I had to
 > > touch up the test file a bit to account for my new test.
 > >
 > > The gaps that I return have a strand of 'undef', which seems to be The
 > > Right Thing.  There's also a bit of funny business where I hang onto
 > > the seq_id of the gapped sequence.  It assumes that the "in" sequence
 > > is the same for all of the mappers.  This seems safe since otherwise
 > > the entire query is kind of weird....
 > >
 > > There's a patch to todays svn head at:
 > >
 > >   http://shrimp.alerce.com/bioperl/collection-diffs.txt
 > >
 > > The patch changes Build.PL to include a dependency on Set::IntSpan,
 > > CoordinateMapper.t to update the tests, and
 > > Bio/CoordinateMapper/Collection.pm for the new code.
 > >
 > > Who's code would this break.
 > >
 > > If anyone's relying on the current behaviour re: gaps, what's the
 > > situation in which you find it useful?
 > >
 > > Thanks!
 > >
 > > g.
 > [...]

So, I'm out of round 'tuit's trying to think of an _easy_ way to do
this using Range/RangeI.  I might just not be thinking clearly, and
I've definitely trained myself to solve these kinds of problems with
Set::IntSpan problems so I may just be waving my favorite hammer
around.

There may also be a BioPerl native way to do it using some fancier
object than a RangeI (split locations?).

It's easy to get the set of gaps for each pair, but is there already
something that takes the intersection of a set of non-intersecting
Range's?

g.


From hartzell at alerce.com  Thu Sep 25 05:17:54 2008
From: hartzell at alerce.com (George Hartzell)
Date: Wed, 24 Sep 2008 22:17:54 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18651.7938.496813.710345@almost.alerce.com>

Heikki Lehvaslaiho writes:
 > George,
 > 
 > This is an error from my side. Great that you have a fix already.
 > 
 > My only worry is the number of external dependencies in BioPerl. To limit 
 > these we have recoded number of functionalities into BioPerl-specific modules. 
 > Before you commit the fix, could you see if Bio::RangeI could be used or easily 
 > extended to be used instead of Set::IntSpan?
 > 
 > Thanks,
 > 
 >    -Heikki
 > 
 > On Friday 05 September 2008 21:01:35 George Hartzell wrote:
 > > Hi all,
 > >
 > > Bio::Coordinate::Collection surprised me a bit.  At first I thought
 > > there was a bug, but it's clearly doing what it's supposed to.  Now
 > > I'm wondering if what it's supposed to be doing makes sense in some
 > > context, or if what I expected would be better functionality.
 > >
 > > t/CoordinateMapper.t sets up the following scenario:
 > >
 > > #
 > > # Collection
 > > #
 > > #         1   5     6   10
 > > #         |---|     |---|
 > > #-----|-----------------------
 > > #     1   5   9     15  19
 > > #         pair1     pair2
 > >
 > > Then goes on to do the following query:
 > >
 > >   # match more than two
 > >   $pos = Bio::Location::Simple->new (-start => 5, -end => 19 );
 > >   ok $res = $transcribe->map($pos);
 > >   is $res->each_gap, 2;
 > >   is $res->each_match, 2;
 > >
 > > I was surprised to see that there were two gaps, one gene:10-19 and
 > > one from gene:5-14.  Looking at the code, what's really happening is
 > > that, for the exon1 mapper there's match with gene:5-9 and a gap with
 > > gene:10-19 and for the exon2 mapper there's a gap with gene:5-14 and a
 > > match with gene:15-19.  All four Result's just get tossed into the
 > > return value.
 > >
 > > The result my intuition wants is that there are two matches (gene:5-9
 > > with exon1 and gene:15-19 with exon2) and a gap (gene:10-14).
 > >
 > > Yes, I guess that I could just synthesize these myself from the result
 > > in my app.
 > >
 > > It still seems that the current result is a bug though, since there's
 > > no way of knowing when you're walking through $res->each_Location that
 > > the first "gap" is with respect to the exon1 mapper and that the
 > > second "gap" is with respect to the exon2 mapper.  The gaps are
 > > meaningless.
 > >
 > > I "fixed" it to work the way I think it should (two matches, one
 > > gap).  I actually extended the test case a bit so that there's a
 > > multi-base gap, a match, another multibase-gap, another match, then a
 > > single base gap (just to make sure I got that right...).  I had to
 > > touch up the test file a bit to account for my new test.
 > >
 > > The gaps that I return have a strand of 'undef', which seems to be The
 > > Right Thing.  There's also a bit of funny business where I hang onto
 > > the seq_id of the gapped sequence.  It assumes that the "in" sequence
 > > is the same for all of the mappers.  This seems safe since otherwise
 > > the entire query is kind of weird....
 > >
 > > There's a patch to todays svn head at:
 > >
 > >   http://shrimp.alerce.com/bioperl/collection-diffs.txt
 > >
 > > The patch changes Build.PL to include a dependency on Set::IntSpan,
 > > CoordinateMapper.t to update the tests, and
 > > Bio/CoordinateMapper/Collection.pm for the new code.
 > >
 > > Who's code would this break.
 > >
 > > If anyone's relying on the current behaviour re: gaps, what's the
 > > situation in which you find it useful?
 > >
 > > Thanks!
 > >
 > > g.
 > [...]

So, I'm out of round 'tuit's trying to think of an _easy_ way to do
this using Range/RangeI.  I might just not be thinking clearly, and
I've definitely trained myself to solve these kinds of problems with
Set::IntSpan problems so I may just be waving my favorite hammer
around.

There may also be a BioPerl native way to do it using some fancier
object than a RangeI (split locations?).

It's easy to get the set of gaps for each pair, but is there already
something that takes the intersection of a set of non-intersecting
Range's?

g.


From tatedger at googlemail.com  Thu Sep 25 15:23:46 2008
From: tatedger at googlemail.com (john paul)
Date: Thu, 25 Sep 2008 16:23:46 +0100
Subject: [Bioperl-l] Can't locate object method "get_dbxrefs"
Message-ID: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>

Hello guys,

I need to pick your brain on this. I was trying to load some sequences in a
fresh RH build using bioperl-db and got the following error:

[tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
--dbuser root --dbname biosql --namespace swissprot --format swiss
/home/tatedger/tmp/uniprot_sprot.dat  --testonly
Loading /home/tatedger/tmp/uniprot_sprot.dat ...
Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via package
"Bio::Ontology::Term" at
/usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
552, <GEN0> line 70.


I have seen some posts on this regard (
http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but it wasn't
clear to me what the solution would be.


My configuration:
- mysql version 4.1.7
- Red Hat Enterprise Linux ES release 4 (Nahant)

to install bioperl and bioperl-db I used the help found on the website
following
- cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
- svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
- biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.

bioperl-db  test 04 shows the same error.

[tatedger at localhost bioperl-db]$ perl t/04swiss.t
1..52
ok 1
ok 2
ok 3
ok 4
ok 5
Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
552, <GEN0> line 78.


my @INC file looks like
/usr/lib/perl5/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/5.8.5
/usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.5
/usr/lib/perl5/site_perl/5.8.4
/usr/lib/perl5/site_perl/5.8.3
/usr/lib/perl5/site_perl/5.8.2
/usr/lib/perl5/site_perl/5.8.1
/usr/lib/perl5/site_perl/5.8.0
/usr/lib/perl5/site_perl
/usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.5
/usr/lib/perl5/vendor_perl/5.8.4
/usr/lib/perl5/vendor_perl/5.8.3
/usr/lib/perl5/vendor_perl/5.8.2
/usr/lib/perl5/vendor_perl/5.8.1
/usr/lib/perl5/vendor_perl/5.8.0
/usr/lib/perl5/vendor_perl

What am I doing wrong? Could you help?

Thanks in advance for your help
Tom


From bosborne11 at verizon.net  Thu Sep 25 15:40:45 2008
From: bosborne11 at verizon.net (Brian Osborne)
Date: Thu, 25 Sep 2008 11:40:45 -0400
Subject: [Bioperl-l] Can't locate object method "get_dbxrefs"
In-Reply-To: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
References: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
Message-ID: <2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>

John,

What does:

 >locate Bio/Ontology/Term.pm

Say?


Brian O.


On Sep 25, 2008, at 11:23 AM, john paul wrote:

> Hello guys,
>
> I need to pick your brain on this. I was trying to load some  
> sequences in a
> fresh RH build using bioperl-db and got the following error:
>
> [tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
> --dbuser root --dbname biosql --namespace swissprot --format swiss
> /home/tatedger/tmp/uniprot_sprot.dat  --testonly
> Loading /home/tatedger/tmp/uniprot_sprot.dat ...
> Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via  
> package
> "Bio::Ontology::Term" at
> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm  
> line
> 552, <GEN0> line 70.
>
>
> I have seen some posts on this regard (
> http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but  
> it wasn't
> clear to me what the solution would be.
>
>
> My configuration:
> - mysql version 4.1.7
> - Red Hat Enterprise Linux ES release 4 (Nahant)
>
> to install bioperl and bioperl-db I used the help found on the website
> following
> - cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
> - svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
> - biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.
>
> bioperl-db  test 04 shows the same error.
>
> [tatedger at localhost bioperl-db]$ perl t/04swiss.t
> 1..52
> ok 1
> ok 2
> ok 3
> ok 4
> ok 5
> Can't locate object method "get_dbxrefs" via package  
> "Bio::Ontology::Term"
> at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/ 
> PersistentObject.pm line
> 552, <GEN0> line 78.
>
>
> my @INC file looks like
> /usr/lib/perl5/5.8.5/i386-linux-thread-multi
> /usr/lib/perl5/5.8.5
> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.5
> /usr/lib/perl5/site_perl/5.8.4
> /usr/lib/perl5/site_perl/5.8.3
> /usr/lib/perl5/site_perl/5.8.2
> /usr/lib/perl5/site_perl/5.8.1
> /usr/lib/perl5/site_perl/5.8.0
> /usr/lib/perl5/site_perl
> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.5
> /usr/lib/perl5/vendor_perl/5.8.4
> /usr/lib/perl5/vendor_perl/5.8.3
> /usr/lib/perl5/vendor_perl/5.8.2
> /usr/lib/perl5/vendor_perl/5.8.1
> /usr/lib/perl5/vendor_perl/5.8.0
> /usr/lib/perl5/vendor_perl
>
> What am I doing wrong? Could you help?
>
> Thanks in advance for your help
> Tom
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From reece at harts.net  Thu Sep 25 16:15:23 2008
From: reece at harts.net (Reece Hart)
Date: Thu, 25 Sep 2008 09:15:23 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could
	DoWhatIMean	better	(w/ patch)
In-Reply-To: <18651.7938.496813.710345@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
	<18651.7938.496813.710345@almost.alerce.com>
Message-ID: <1222359323.15677.4.camel@snafu>

An embedded and charset-unspecified text was scrubbed...
Name: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20080925/ad977fb3/attachment.ksh>

From tatedger at googlemail.com  Thu Sep 25 16:27:29 2008
From: tatedger at googlemail.com (john paul)
Date: Thu, 25 Sep 2008 17:27:29 +0100
Subject: [Bioperl-l] Can't locate object method "get_dbxrefs"
In-Reply-To: <2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>
References: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
	<2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>
Message-ID: <efc5e9750809250927h741c083cl60dca40fee89280@mail.gmail.com>

On Thu, Sep 25, 2008 at 4:40 PM, Brian Osborne <bosborne11 at verizon.net>wrote:

> John,
>
> What does:
>
> >locate Bio/Ontology/Term.pm
>
> Say?
>

Silly me.

$ locate  Bio/Ontology/Term.pm
/usr/lib/perl5/site_perl/5.8.5/Bio/Ontology/Term.pm

and

 $ cat /usr/lib/perl5/site_perl/5.8.5/Bio/Ontology/Term.pm|grep get_dbxrefs
produced no answer

the latest version posted by Sendu on cpan says for that module

# $Id: Term.pm,v 1.31.4.1 2006/10/02 23:10:22 sendu Exp $
#
# BioPerl module for Bio::Ontology::Term
and the live version at (
http://code.open-bio.org/svnweb/index.cgi/bioperl/view/bioperl-live/trunk/Bio/Ontology/Term.pm
)

says
# $Id: Term.pm 14708 2008-06-10 00:08:17Z heikki $
#
# BioPerl module for Bio::Ontology::Term
#
I was using an old distribution from CPAN.

reinstalling from the main trunk

svn co svn://code.open-bio.org/bioperl/bioperl-live/trunk bioperl-live

solved the problem.

Thanks again

Tom


>
> Brian O.
>
>
>
> On Sep 25, 2008, at 11:23 AM, john paul wrote:
>
>   Hello guys,
>>
>> I need to pick your brain on this. I was trying to load some sequences in
>> a
>> fresh RH build using bioperl-db and got the following error:
>>
>> [tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
>> --dbuser root --dbname biosql --namespace swissprot --format swiss
>> /home/tatedger/tmp/uniprot_sprot.dat  --testonly
>> Loading /home/tatedger/tmp/uniprot_sprot.dat ...
>> Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via
>> package
>> "Bio::Ontology::Term" at
>> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
>> 552, <GEN0> line 70.
>>
>>
>> I have seen some posts on this regard (
>> http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but it
>> wasn't
>> clear to me what the solution would be.
>>
>>
>> My configuration:
>> - mysql version 4.1.7
>> - Red Hat Enterprise Linux ES release 4 (Nahant)
>>
>> to install bioperl and bioperl-db I used the help found on the website
>> following
>> - cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
>> - svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
>> - biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.
>>
>> bioperl-db  test 04 shows the same error.
>>
>> [tatedger at localhost bioperl-db]$ perl t/04swiss.t
>> 1..52
>> ok 1
>> ok 2
>> ok 3
>> ok 4
>> ok 5
>> Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
>> at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm
>> line
>> 552, <GEN0> line 78.
>>
>>
>> my @INC file looks like
>> /usr/lib/perl5/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/5.8.5
>> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.5
>> /usr/lib/perl5/site_perl/5.8.4
>> /usr/lib/perl5/site_perl/5.8.3
>> /usr/lib/perl5/site_perl/5.8.2
>> /usr/lib/perl5/site_perl/5.8.1
>> /usr/lib/perl5/site_perl/5.8.0
>> /usr/lib/perl5/site_perl
>> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.5
>> /usr/lib/perl5/vendor_perl/5.8.4
>> /usr/lib/perl5/vendor_perl/5.8.3
>> /usr/lib/perl5/vendor_perl/5.8.2
>> /usr/lib/perl5/vendor_perl/5.8.1
>> /usr/lib/perl5/vendor_perl/5.8.0
>> /usr/lib/perl5/vendor_perl
>>
>> What am I doing wrong? Could you help?
>>
>> Thanks in advance for your help
>> Tom
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>


From bix at sendu.me.uk  Thu Sep 25 17:12:22 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 25 Sep 2008 18:12:22 +0100
Subject: [Bioperl-l] Can't locate object method "get_dbxrefs"
In-Reply-To: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
References: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
Message-ID: <48DBC676.7090704@sendu.me.uk>

john paul wrote:
> - cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
> - svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
[...]
> Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
[...]
> What am I doing wrong? Could you help?

You're using the svb versuib bioperl-db but the release version of core 
(aka live). Don't mix and match; use the same version of both. So either 
install bioperl-live from svn as well, or get rid of you svn bioperl-db 
and install bioperl-db 1.5.2: 
http://bioperl.org/DIST/bioperl-db-1.5.2_100.tar.gz

I'd recommend using svn for both.


From hlapp at gmx.net  Thu Sep 25 22:24:37 2008
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu, 25 Sep 2008 18:24:37 -0400
Subject: [Bioperl-l] Using Storable with SeqFeatures
In-Reply-To: <5626ED9CB91C814197079FB9940312E506445F9B@MAIL.bc.iop.kcl.ac.uk>
References: <5626ED9CB91C814197079FB9940312E506445F9B@MAIL.bc.iop.kcl.ac.uk>
Message-ID: <517FAB85-BC7F-4135-B510-A2087267A314@gmx.net>


On Sep 24, 2008, at 10:19 AM, Johnston, Caroline wrote:

> Hello.
>
> I'm trying to use Storable to save a Bio::Seq object and Storable  
> seems to be having a weird problem dealing with freezing and thawing  
> the code ref to Bio::SeqFeature::Generic cleanup_generic. If I  
> change one line (931) in that function from
>
>    foreach my $t ( keys %{$self->{'_gsf_tag_hash'} || {} } ) {
>                                                    ------
> to
>
>    foreach my $t ( keys %{$self->{'_gsf_tag_hash'} } ) {
>
> it works fine. I've pasted an example script at http://sial.org/pbot/32320 
> .
>
> Any ideas why this syntax would break Storable? Would wrapping the  
> foreach in an if(defined $self->{'_gsf_tag_hash'}) serve to replace  
> the || {} ?

This should have exactly the same behavior as far as I can see.

Would you mind filing this as a bug repot with patch?

	-hilmar

>
>
> I get the same problem using Bio::Root::Storable.
>
> Cxx
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================





From mdschultz at ucdavis.edu  Thu Sep 25 22:06:02 2008
From: mdschultz at ucdavis.edu (Matthew Schultz)
Date: Thu, 25 Sep 2008 15:06:02 -0700 (PDT)
Subject: [Bioperl-l] BioPerl Installation Help
Message-ID: <200809252206.m8PM62Se004142@phaenicia.ucdavis.edu>


Hi Bioperl,

I've been trying to install bioperl on my Ubuntu machine I'm new to Bioperl
and don't have much experience in unix so I'm at a loss for what to do
next.  I tried to follow the instructions on using CPAN to install Bioperl,
but the installation failed.  At first I thought it was because of the few
warnings I received, but after trying the "force install" command without
success either I'm not so sure.  I was about to try the alternate option
using Build.pl, but am not sure where the Bioperl installation should go
(or will the Build.pl script place it in the right folder?).  Any help or
advice you could give would be appreciated.  Thanks for your time.

-Matt Schultz

P.S.  Here are the failed test results:

Failed Test        Stat Wstat Total Fail  Failed  List of Failed
-------------------------------------------------------------------------------
t/BioFetch_DB.t                  27    4  14.81%  8 20-21 27
t/DB.t                           78    2   2.56%  30-31
t/EMBL_DB.t                      15    3  20.00%  6 13-14
t/GuessSeqFormat.t               46    1   2.17%  11
t/InterProParser.t    2   512    47    1   2.13%  2
t/tutorial.t          2   512    21    6  28.57%  19-21
18 subtests skipped.
Failed 6/179 test scripts, 96.65% okay. 14/8122 subtests failed, 99.83% okay.
make: *** [test_dynamic] Error 255
  /usr/bin/make test -- NOT OK
Running make install
  make test had returned bad status, won't install without force



From caroline.johnston at iop.kcl.ac.uk  Fri Sep 26 03:19:38 2008
From: caroline.johnston at iop.kcl.ac.uk (Caroline)
Date: Fri, 26 Sep 2008 04:19:38 +0100
Subject: [Bioperl-l] Using Storable with SeqFeatures
In-Reply-To: <517FAB85-BC7F-4135-B510-A2087267A314@gmx.net>
References: <5626ED9CB91C814197079FB9940312E506445F9B@MAIL.bc.iop.kcl.ac.uk>
	<517FAB85-BC7F-4135-B510-A2087267A314@gmx.net>
Message-ID: <1222399178.18153.0.camel@clive>

On Thu, 2008-09-25 at 18:24 -0400, Hilmar Lapp wrote:

> Would you mind filing this as a bug repot with patch?
> 
> 	-hilmar
> 

Done, I think. I haven't used Bugzilla before, so give me a shout if I
haven't submitted it properly.

Cxx


From hartzell at alerce.com  Fri Sep 26 04:25:08 2008
From: hartzell at alerce.com (George Hartzell)
Date: Thu, 25 Sep 2008 21:25:08 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18652.25636.694188.904749@almost.alerce.com>


What would people think about a Bio::Range::Set (and/or SetI) which
behaves like Set::Intspan (which alone would be a waste of effort) but
also embraces RangeI's concepts of stranded-ness and
strong/weak/unspecified comparisons?

g. (who's sometimes thinks that 'tuits grow on trees...)



From hartzell at alerce.com  Fri Sep 26 04:25:08 2008
From: hartzell at alerce.com (George Hartzell)
Date: Thu, 25 Sep 2008 21:25:08 -0700
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better	(w/ patch)
In-Reply-To: <200809090950.11821.heikki@sanbi.ac.za>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
Message-ID: <18652.25636.694188.904749@almost.alerce.com>


What would people think about a Bio::Range::Set (and/or SetI) which
behaves like Set::Intspan (which alone would be a waste of effort) but
also embraces RangeI's concepts of stranded-ness and
strong/weak/unspecified comparisons?

g. (who's sometimes thinks that 'tuits grow on trees...)



From heikki at sanbi.ac.za  Fri Sep 26 06:25:54 2008
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Fri, 26 Sep 2008 08:25:54 +0200
Subject: [Bioperl-l] Bio::Coordinate::Collection could DoWhatIMean
	better (w/ patch)
In-Reply-To: <18652.25636.694188.904749@almost.alerce.com>
References: <m263pabenk.fsf@almost.alerce.com>
	<200809090950.11821.heikki@sanbi.ac.za>
	<18652.25636.694188.904749@almost.alerce.com>
Message-ID: <200809260825.54638.heikki@sanbi.ac.za>

George,

Bio::Range::Set sounds like great idea.

Sorry to put you in a tight spot with the request for keeping external 
dependencies to the minimum. I should have stressed that follow it only if it 
can be done easily. If you look at the actual dependencies of BioPerl at the 
moment, you'll realize not many have to patience to follow that guideline.

The main thing is the get working code in. If you then have the energy to code 
a module that gets rid of the dependency, that's an added bonus.

Thanks for your effort,

 Yours,
    -Heikki



On Friday 26 September 2008 06:25:08 George Hartzell wrote:
> What would people think about a Bio::Range::Set (and/or SetI) which
> behaves like Set::Intspan (which alone would be a waste of effort) but
> also embraces RangeI's concepts of stranded-ness and
> strong/weak/unspecified comparisons?
>
> g. (who's sometimes thinks that 'tuits grow on trees...)

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Senior Scientist    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________



From tatedger at googlemail.com  Thu Sep 25 16:27:29 2008
From: tatedger at googlemail.com (john paul)
Date: Thu, 25 Sep 2008 17:27:29 +0100
Subject: [Bioperl-l] [BioSQL-l] Can't locate object method "get_dbxrefs"
In-Reply-To: <2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>
References: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>
	<2A46D690-D925-4188-9DDF-468E31CE83BE@verizon.net>
Message-ID: <efc5e9750809250927h741c083cl60dca40fee89280@mail.gmail.com>

On Thu, Sep 25, 2008 at 4:40 PM, Brian Osborne <bosborne11 at verizon.net>wrote:

> John,
>
> What does:
>
> >locate Bio/Ontology/Term.pm
>
> Say?
>

Silly me.

$ locate  Bio/Ontology/Term.pm
/usr/lib/perl5/site_perl/5.8.5/Bio/Ontology/Term.pm

and

 $ cat /usr/lib/perl5/site_perl/5.8.5/Bio/Ontology/Term.pm|grep get_dbxrefs
produced no answer

the latest version posted by Sendu on cpan says for that module

# $Id: Term.pm,v 1.31.4.1 2006/10/02 23:10:22 sendu Exp $
#
# BioPerl module for Bio::Ontology::Term
and the live version at (
http://code.open-bio.org/svnweb/index.cgi/bioperl/view/bioperl-live/trunk/Bio/Ontology/Term.pm
)

says
# $Id: Term.pm 14708 2008-06-10 00:08:17Z heikki $
#
# BioPerl module for Bio::Ontology::Term
#
I was using an old distribution from CPAN.

reinstalling from the main trunk

svn co svn://code.open-bio.org/bioperl/bioperl-live/trunk bioperl-live

solved the problem.

Thanks again

Tom


>
> Brian O.
>
>
>
> On Sep 25, 2008, at 11:23 AM, john paul wrote:
>
>   Hello guys,
>>
>> I need to pick your brain on this. I was trying to load some sequences in
>> a
>> fresh RH build using bioperl-db and got the following error:
>>
>> [tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
>> --dbuser root --dbname biosql --namespace swissprot --format swiss
>> /home/tatedger/tmp/uniprot_sprot.dat  --testonly
>> Loading /home/tatedger/tmp/uniprot_sprot.dat ...
>> Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via
>> package
>> "Bio::Ontology::Term" at
>> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
>> 552, <GEN0> line 70.
>>
>>
>> I have seen some posts on this regard (
>> http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but it
>> wasn't
>> clear to me what the solution would be.
>>
>>
>> My configuration:
>> - mysql version 4.1.7
>> - Red Hat Enterprise Linux ES release 4 (Nahant)
>>
>> to install bioperl and bioperl-db I used the help found on the website
>> following
>> - cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
>> - svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
>> - biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.
>>
>> bioperl-db  test 04 shows the same error.
>>
>> [tatedger at localhost bioperl-db]$ perl t/04swiss.t
>> 1..52
>> ok 1
>> ok 2
>> ok 3
>> ok 4
>> ok 5
>> Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
>> at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm
>> line
>> 552, <GEN0> line 78.
>>
>>
>> my @INC file looks like
>> /usr/lib/perl5/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/5.8.5
>> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.5
>> /usr/lib/perl5/site_perl/5.8.4
>> /usr/lib/perl5/site_perl/5.8.3
>> /usr/lib/perl5/site_perl/5.8.2
>> /usr/lib/perl5/site_perl/5.8.1
>> /usr/lib/perl5/site_perl/5.8.0
>> /usr/lib/perl5/site_perl
>> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.5
>> /usr/lib/perl5/vendor_perl/5.8.4
>> /usr/lib/perl5/vendor_perl/5.8.3
>> /usr/lib/perl5/vendor_perl/5.8.2
>> /usr/lib/perl5/vendor_perl/5.8.1
>> /usr/lib/perl5/vendor_perl/5.8.0
>> /usr/lib/perl5/vendor_perl
>>
>> What am I doing wrong? Could you help?
>>
>> Thanks in advance for your help
>> Tom
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>
_______________________________________________
BioSQL-l mailing list
BioSQL-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/biosql-l





From bix at sendu.me.uk  Fri Sep 26 08:26:36 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 26 Sep 2008 09:26:36 +0100
Subject: [Bioperl-l] Bio::Species bug,
 was  Species.t tests failing with bioperl-live
In-Reply-To: <CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
Message-ID: <48DC9CBC.1090909@sendu.me.uk>

Chris Fields wrote:
> The last commit to Bio::Species, which was an effort to fix a memory 
> leak, has unfortunately broken Species.t tests.  The relevant commit 
> used weaken(); my guess is something is being garbage collected way too 
> early.  Any ideas?

Was that last commit motivated by a bug report, and/or is there an 
associated test? If not, perhaps it can just be reverted?


From tatedger at googlemail.com  Thu Sep 25 15:23:46 2008
From: tatedger at googlemail.com (john paul)
Date: Thu, 25 Sep 2008 16:23:46 +0100
Subject: [Bioperl-l] [BioSQL-l] Can't locate object method "get_dbxrefs"
Message-ID: <efc5e9750809250823s303208c2kc4539b957017d3d4@mail.gmail.com>

Hello guys,

I need to pick your brain on this. I was trying to load some sequences in a
fresh RH build using bioperl-db and got the following error:

[tatedger at localhost biosql]$ perl load_seqdatabase.pl --host localhost
--dbuser root --dbname biosql --namespace swissprot --format swiss
/home/tatedger/tmp/uniprot_sprot.dat  --testonly
Loading /home/tatedger/tmp/uniprot_sprot.dat ...
Could not store Q4U9M9: Can't locate object method "get_dbxrefs" via package
"Bio::Ontology::Term" at
/usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
552, <GEN0> line 70.


I have seen some posts on this regard (
http://bioperl.org/pipermail/bioperl-l/2008-April/027544.html) but it wasn't
clear to me what the solution would be.


My configuration:
- mysql version 4.1.7
- Red Hat Enterprise Linux ES release 4 (Nahant)

to install bioperl and bioperl-db I used the help found on the website
following
- cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
- svn co svn://code.open-bio.org/bioperl/bioperl-db/trunk bioperl-db
- biosql schema is loaded and load_ncbi_taxonomy.pl worked fine.

bioperl-db  test 04 shows the same error.

[tatedger at localhost bioperl-db]$ perl t/04swiss.t
1..52
ok 1
ok 2
ok 3
ok 4
ok 5
Can't locate object method "get_dbxrefs" via package "Bio::Ontology::Term"
at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/Persistent/PersistentObject.pm line
552, <GEN0> line 78.


my @INC file looks like
/usr/lib/perl5/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/5.8.5
/usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.5
/usr/lib/perl5/site_perl/5.8.4
/usr/lib/perl5/site_perl/5.8.3
/usr/lib/perl5/site_perl/5.8.2
/usr/lib/perl5/site_perl/5.8.1
/usr/lib/perl5/site_perl/5.8.0
/usr/lib/perl5/site_perl
/usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.5
/usr/lib/perl5/vendor_perl/5.8.4
/usr/lib/perl5/vendor_perl/5.8.3
/usr/lib/perl5/vendor_perl/5.8.2
/usr/lib/perl5/vendor_perl/5.8.1
/usr/lib/perl5/vendor_perl/5.8.0
/usr/lib/perl5/vendor_perl

What am I doing wrong? Could you help?

Thanks in advance for your help
Tom
_______________________________________________
BioSQL-l mailing list
BioSQL-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/biosql-l





From cjfields at illinois.edu  Fri Sep 26 12:20:45 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 26 Sep 2008 07:20:45 -0500
Subject: [Bioperl-l] Bio::Species bug,
	was  Species.t tests failing with bioperl-live
In-Reply-To: <48DC9CBC.1090909@sendu.me.uk>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
	<48DC9CBC.1090909@sendu.me.uk>
Message-ID: <F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>


On Sep 26, 2008, at 3:26 AM, Sendu Bala wrote:

> Chris Fields wrote:
>> The last commit to Bio::Species, which was an effort to fix a  
>> memory leak, has unfortunately broken Species.t tests.  The  
>> relevant commit used weaken(); my guess is something is being  
>> garbage collected way too early.  Any ideas?
>
> Was that last commit motivated by a bug report, and/or is there an  
> associated test? If not, perhaps it can just be reverted?


Here's the relevant list thread:

http://thread.gmane.org/gmane.comp.lang.perl.bio.general/17541/focus=17550

The proposed patch was George's, which gets rid of the leak but causes  
the Species.t failures.  I say we revert the patch, but we'll still  
need to address the original problem addressed by Rutger Vos, i.e.  
that there is a significant memory leak in Bio::Species.

chris


From bix at sendu.me.uk  Fri Sep 26 13:45:21 2008
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 26 Sep 2008 14:45:21 +0100
Subject: [Bioperl-l] Bio::Species bug,
 was  Species.t tests failing with bioperl-live
In-Reply-To: <F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
	<48DC9CBC.1090909@sendu.me.uk>
	<F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>
Message-ID: <48DCE771.8050001@sendu.me.uk>

Chris Fields wrote:
> 
> On Sep 26, 2008, at 3:26 AM, Sendu Bala wrote:
> 
>> Chris Fields wrote:
>>> The last commit to Bio::Species, which was an effort to fix a memory 
>>> leak, has unfortunately broken Species.t tests.  The relevant commit 
>>> used weaken(); my guess is something is being garbage collected way 
>>> too early.  Any ideas?
>>
>> Was that last commit motivated by a bug report, and/or is there an 
>> associated test? If not, perhaps it can just be reverted?
> 
> Here's the relevant list thread:
> 
> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/17541/focus=17550
> 
> The proposed patch was George's, which gets rid of the leak but causes 
> the Species.t failures.  I say we revert the patch, but we'll still need 
> to address the original problem addressed by Rutger Vos, i.e. that there 
> is a significant memory leak in Bio::Species.

Thanks. Rather than revert I've kludged it for now. Everything should be 
fine, it's just that I fear my solution isn't 'correct' and could mess 
things up we don't happen to have tests for.

See http://bugzilla.open-bio.org/show_bug.cgi?id=2594


From cjfields at illinois.edu  Fri Sep 26 14:54:55 2008
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 26 Sep 2008 09:54:55 -0500
Subject: [Bioperl-l] Bio::Species bug,
	was  Species.t tests failing with bioperl-live
In-Reply-To: <48DCE771.8050001@sendu.me.uk>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
	<48DC9CBC.1090909@sendu.me.uk>
	<F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>
	<48DCE771.8050001@sendu.me.uk>
Message-ID: <9C49A138-CC07-4716-AFD6-FFB2F217C825@illinois.edu>


On Sep 26, 2008, at 8:45 AM, Sendu Bala wrote:

> Chris Fields wrote:
>> On Sep 26, 2008, at 3:26 AM, Sendu Bala wrote:
>>> Chris Fields wrote:
>>>> The last commit to Bio::Species, which was an effort to fix a  
>>>> memory leak, has unfortunately broken Species.t tests.  The  
>>>> relevant commit used weaken(); my guess is something is being  
>>>> garbage collected way too early.  Any ideas?
>>>
>>> Was that last commit motivated by a bug report, and/or is there an  
>>> associated test? If not, perhaps it can just be reverted?
>> Here's the relevant list thread:
>> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/17541/focus=17550
>> The proposed patch was George's, which gets rid of the leak but  
>> causes the Species.t failures.  I say we revert the patch, but  
>> we'll still need to address the original problem addressed by  
>> Rutger Vos, i.e. that there is a significant memory leak in  
>> Bio::Species.
>
> Thanks. Rather than revert I've kludged it for now. Everything  
> should be fine, it's just that I fear my solution isn't 'correct'  
> and could mess things up we don't happen to have tests for.
>
> See http://bugzilla.open-bio.org/show_bug.cgi?id=2594

Probably something that will go away when we quit using Bio::Species  
altogether (in favor of Bio::Taxon) after 1.6.   I'm not sure whether  
it will be worth the trouble, but it's worth discussing.

Anyway, I'm still a bit unfamiliar with some aspects of Bio::Species  
(and I'm pretty busy ATM) so it make take a few days.

chris


From hartzell at alerce.com  Sat Sep 27 00:21:41 2008
From: hartzell at alerce.com (George Hartzell)
Date: Fri, 26 Sep 2008 17:21:41 -0700
Subject: [Bioperl-l] Bio::Species bug,
	was  Species.t tests failing with bioperl-live
In-Reply-To: <9C49A138-CC07-4716-AFD6-FFB2F217C825@illinois.edu>
References: <1501D3A7-42BA-4489-95E3-5267FFC8A856@illinois.edu>
	<CC8E5422-FDCD-4492-B5F7-AA5BF6EC49AB@illinois.edu>
	<48DC9CBC.1090909@sendu.me.uk>
	<F76C8810-36CF-4727-971A-22AA5D7F91C5@illinois.edu>
	<48DCE771.8050001@sendu.me.uk>
	<9C49A138-CC07-4716-AFD6-FFB2F217C825@illinois.edu>
Message-ID: <18653.31893.762357.718899@almost.alerce.com>

Chris Fields writes:
 > 
 > On Sep 26, 2008, at 8:45 AM, Sendu Bala wrote:
 > 
 > > Chris Fields wrote:
 > >> On Sep 26, 2008, at 3:26 AM, Sendu Bala wrote:
 > >>> Chris Fields wrote:
 > >>>> The last commit to Bio::Species, which was an effort to fix a  
 > >>>> memory leak, has unfortunately broken Species.t tests.  The  
 > >>>> relevant commit used weaken(); my guess is something is being  
 > >>>> garbage collected way too early.  Any ideas?
 > >>>
 > >>> Was that last commit motivated by a bug report, and/or is there an  
 > >>> associated test? If not, perhaps it can just be reverted?
 > >> Here's the relevant list thread:
 > >> http://thread.gmane.org/gmane.comp.lang.perl.bio.general/17541/focus=17550
 > >> The proposed patch was George's, which gets rid of the leak but  
 > >> causes the Species.t failures.  I say we revert the patch, but  
 > >> we'll still need to address the original problem addressed by  
 > >> Rutger Vos, i.e. that there is a significant memory leak in  
 > >> Bio::Species.
 > >
 > > Thanks. Rather than revert I've kludged it for now. Everything  
 > > should be fine, it's just that I fear my solution isn't 'correct'  
 > > and could mess things up we don't happen to have tests for.
 > >
 > > See http://bugzilla.open-bio.org/show_bug.cgi?id=2594
 > 
 > Probably something that will go away when we quit using Bio::Species  
 > altogether (in favor of Bio::Taxon) after 1.6.   I'm not sure whether  
 > it will be worth the trouble, but it's worth discussing.
 > 
 > Anyway, I'm still a bit unfamiliar with some aspects of Bio::Species  
 > (and I'm pretty busy ATM) so it make take a few days.

I can try to take a look at it again and see if there's a way to make
it work [more] correctly.

g.


From torsten.seemann at infotech.monash.edu.au  Mon Sep 29 01:46:06 2008
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Mon, 29 Sep 2008 11:46:06 +1000
Subject: [Bioperl-l] Retrieving taxonomy information from a GenBank file
In-Reply-To: <E078758D-D451-4973-A66D-2D6D829FCA53@bioperl.org>
References: <f03f40920809181427k168bfc3cu535c023949735cd9@mail.gmail.com>
	<E078758D-D451-4973-A66D-2D6D829FCA53@bioperl.org>
Message-ID: <a79f6a4b0809281846q380b8f77ha445f2112a2dae83@mail.gmail.com>

Anjan,

>> I'm using the following code to access the "ORGANISM" tag value for the
>> record NC_002526.
>> I get a value of 0 even though the ORGANISM tag  has a value.  Any idea
>> how
>> this might be corrected?
>> my $des= $seq->get_tag_values("ORGANISM");

> You want the species object ($seq->species)  -- see the Seq HOWTO, much of
> the Seq API is explained.
>  http://bioperl.org/wiki/HOWTO:Feature-Annotation#The_Species_Object

Of course Jason is correct here but there was still a semantic bug in
your code anyway which you should probably be aware of.
$seq->get_tag_values() returns an ARRAY which you are trying to store
in a SCALAR ($des). An array, in a scalar context, returns the SIZE of
the array, which in your case was zero (0) as there were no ORGANISM
tags. What you probably meant was:

my($des) = $seq->get_tag_values("ORGANISM");
# or
my $des = ($seq->get_tag_values("ORGANISM")) [ 0 ];

-- 
--Torsten Seemann
--Victorian Bioinformatics Consortium, Dept. Microbiology, Monash University
--Tel: 9905 9010 / 0422 923 024


From schwarz at tenaya.caltech.edu  Mon Sep 29 05:57:43 2008
From: schwarz at tenaya.caltech.edu (Erich Schwarz)
Date: Sun, 28 Sep 2008 22:57:43 -0700 (PDT)
Subject: [Bioperl-l] exporting contigs with CDSes, stored via Bio::DB::GFF,
 into individual GenBank records?
Message-ID: <Pine.LNX.4.64.0809282239110.26085@tenaya.caltech.edu>

Hi all,

    I have newly sequenced contigs, with CDS predictions, loaded 
into a Bio::DB::GFF-readable format (i.e., loaded into a MySQL 
database via Bio::DB::GFF).  I'd like to export each contig, with 
its annotated CDSes, into a single GenBank-formatted record for each 
contig (in order to be able submit this stuff to GenBank, without 
having to waste time with Sequin).  Is there some straightforward 
way of getting Bio::DB::GFF to do that?

    Some time ago, when I last had to decipher BioPerl, I came up 
with code that would let me export protein translations of the 
contigs' CDSes in GenBank format:

-------------------------------------------------------------------

#!/usr/bin/env perl

use strict;
use warnings;
use Bio::Seq;
use Bio::SeqIO;
use Bio::DB::GFF;

my $query_database = $ARGV[0];
my $dna = q{};
my $db = Bio::DB::GFF->new( -dsn => $query_database);

my $gb_file = 'example.gb';
my $seq_out = Bio::SeqIO->new( -file => ">$gb_file", -format => 'genbank', );

my @contigs = sort 
              map { $_->display_id }
              $db->features( -types => 'contig:assembly' );

foreach my $contig (@contigs) { 
    my $segment1 = $db->segment($contig);
    my @p_txs = $segment1->features('processed_transcript');
    foreach my $p_t (sort @p_txs) {
        $dna = q{};
        my @CDSes = $p_t->CDS;
        my $cds_name = $CDSes[0]->display_id();
        foreach my $cds (@CDSes) { 
            # $cds->seq == Bio::PrimarySeq, *not* plain nt seq.!
            $dna = $dna . $cds->seq->seq;
        }
        my $full_cds = Bio::Seq->new( -display_id => $cds_name, 
                                      -seq => $dna, );
        my $prot = $full_cds->translate;
        $seq_out->write_seq($prot);
    }
}

--------------------------------------------------------------------

    Returning to this, I tried using

    $db->get_Seq_by_id($contig)

to give me a Bio::Seq object for each contig (which I could then 
output into GenBank form), but that proved futile.

    I'm willing to work this out on my own if I have to, but if 
somebody can answer this in 30 seconds, it will save me a lot of 
time -- and be very appreciated!


--Erich 



From jason at bioperl.org  Tue Sep 30 16:48:17 2008
From: jason at bioperl.org (Jason Stajich)
Date: Tue, 30 Sep 2008 09:48:17 -0700
Subject: [Bioperl-l] exporting contigs with CDSes,
	stored via Bio::DB::GFF, into individual GenBank records?
In-Reply-To: <Pine.LNX.4.64.0809282239110.26085@tenaya.caltech.edu>
References: <Pine.LNX.4.64.0809282239110.26085@tenaya.caltech.edu>
Message-ID: <9880E773-812C-4F16-806F-7DB854346330@bioperl.org>

Eric.
CC-ing Gbrowse since this is regarding Gbrowse data-store.

I've definitely done exactly this although I remember I had to tweak  
the features a bit to make sure i had some some of the necessary stuff  
to sequin.


If you want to get a specific segment you just do what you already  
have in your code:
my $segment = $db->segment($contig_name);

Or you can iterate through all the features - depends on how you named  
your segments/contigs/chromsomes, I named mine "contig:scaffold" for  
type:source
  my $iterator = $dbh->get_seq_stream(-type=>'scaffold');
   while (my $s = $iterator->next_seq) {
   }

Now You *should* be able to pass this segment object to $seqio- 
 >write_seq($segment);
However Bio::DB::GFF::Feature doesn't implement the whole SeqI APi so  
you probably have to create your own sequence and move the features  
over:

y $iterator = $dbh->get_seq_stream(-type=>'scaffold');
   while (my $s = $iterator->next_seq) {
	my $seq = Bio::Seq->new();
	$seq->primary_seq($s->seq);
	for my $feature ( $s->features('processed_transcript') ) {
		my $f = Bio::SeqFeature::Generic->new(-location => $feature->location,
						      -primary_tag => $feature->primary_tag,
						      -source_tag  => $feature->primary_tag,
						      -score => $feature->score,
						      -seq_id => $feature->seq_id);
		$f->add_tag_value('locus_tag',$feature->name);
		# might also add all other tag/value pairs from this feature like  
DBXREF, etc.
		# derive a CDS feature from this feature as well.
		# perhaps derive a gene feature that only has start/end for the  
feature
		# might add a translation tag/value pair for CDS features
		$seq->add_SeqFeature($f);
	}
	$out->write_seq($seq);
  }

I suspect you'll have to edit the feature objects some to
a) remove the ones you don't want to output
b) add additional info like translation frame -- I think there is a  
slightly different way that NCBI wants things labeled wrt translation  
frame
c) add in other annotation information that may or may not be encoded  
as tag/values that

It is also possible I am missing some things in here, but hopefully it  
gets you started.  I think it would be quite useful for us to try and  
write a generic script for this but maybe focus on Bio::DB::SeqFeature  
dbs since it will be easier to assume that all the 3-level gene->mRNA- 
 >CDS/exon relationships will be explicitly specified.


-jason
On Sep 28, 2008, at 10:57 PM, Erich Schwarz wrote:

> Hi all,
>
>    I have newly sequenced contigs, with CDS predictions, loaded
> into a Bio::DB::GFF-readable format (i.e., loaded into a MySQL
> database via Bio::DB::GFF).  I'd like to export each contig, with
> its annotated CDSes, into a single GenBank-formatted record for each
> contig (in order to be able submit this stuff to GenBank, without
> having to waste time with Sequin).  Is there some straightforward
> way of getting Bio::DB::GFF to do that?
>
>    Some time ago, when I last had to decipher BioPerl, I came up
> with code that would let me export protein translations of the
> contigs' CDSes in GenBank format:
>
> -------------------------------------------------------------------
>
> #!/usr/bin/env perl
>
> use strict;
> use warnings;
> use Bio::Seq;
> use Bio::SeqIO;
> use Bio::DB::GFF;
>
> my $query_database = $ARGV[0];
> my $dna = q{};
> my $db = Bio::DB::GFF->new( -dsn => $query_database);
>
> my $gb_file = 'example.gb';
> my $seq_out = Bio::SeqIO->new( -file => ">$gb_file", -format =>  
> 'genbank', );
>
> my @contigs = sort
>              map { $_->display_id }
>              $db->features( -types => 'contig:assembly' );
>
> foreach my $contig (@contigs) {
>    my $segment1 = $db->segment($contig);
>    my @p_txs = $segment1->features('processed_transcript');
>    foreach my $p_t (sort @p_txs) {
>        $dna = q{};
>        my @CDSes = $p_t->CDS;
>        my $cds_name = $CDSes[0]->display_id();
>        foreach my $cds (@CDSes) {
>            # $cds->seq == Bio::PrimarySeq, *not* plain nt seq.!
>            $dna = $dna . $cds->seq->seq;
>        }
>        my $full_cds = Bio::Seq->new( -display_id => $cds_name,
>                                      -seq => $dna, );
>        my $prot = $full_cds->translate;
>        $seq_out->write_seq($prot);
>    }
> }
>
> --------------------------------------------------------------------
>
>    Returning to this, I tried using
>
>    $db->get_Seq_by_id($contig)
>
> to give me a Bio::Seq object for each contig (which I could then
> output into GenBank form), but that proved futile.
>
>    I'm willing to work this out on my own if I have to, but if
> somebody can answer this in 30 seconds, it will save me a lot of
> time -- and be very appreciated!
>
>
> --Erich
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Jason Stajich
jason at bioperl.org





From gilbertd at cricket.bio.indiana.edu  Tue Sep 30 17:23:56 2008
From: gilbertd at cricket.bio.indiana.edu (Don Gilbert)
Date: Tue, 30 Sep 2008 12:23:56 -0500 (EST)
Subject: [Bioperl-l] [Gmod-gbrowse]  exporting contigs with CDSes,
	stored via Bio::DB::GFF, into individual GenBank records?
Message-ID: <200809301723.m8UHNuc04293@cricket.bio.indiana.edu>


Eric,

If the Bio::DB::GFF database to Genbank submission route doesn't get you
where you want, you can also look at storing your data in a GMOD Chado
database, then using Bulkfiles to produce the Genbank Submission file set.

- Don Gilbert

Find a GenBank Submit output from Chado dbs in this tool release
http://eugenes.org/gmod/GMODTools/
  GMODTools-1.2b.zip      20-Jun-2008 

- adding (in progress) Genbank Submission table writer, 
  'bulkfiles -format=genbanktbl', with output suited
  to submit to NCBI as per these specifications
  http://www.ncbi.nlm.nih.gov/Genbank/eukaryotic_genome_submission.html

see also http://gmod.org/wiki/GMODTools
and this test case with genbank-submit output
 http://gmod.org/wiki/GMODTools_TestCase



From mauricio at open-bio.org  Tue Sep 30 21:56:04 2008
From: mauricio at open-bio.org (Mauricio Herrera Cuadra)
Date: Tue, 30 Sep 2008 16:56:04 -0500
Subject: [Bioperl-l] Test coverage for BioPerl now available
Message-ID: <48E2A074.5060305@open-bio.org>

Hi all,

Daily-updated test coverage reports are now available for those BioPerl 
packages which make use of the Build.PL mechanism (except bioperl-db):

http://bioperl.org/test-coverage/bioperl-live/
http://bioperl.org/test-coverage/bioperl-network/
http://bioperl.org/test-coverage/bioperl-run/

These reports will help us to know the current 'quality' of the code in 
SVN for most of the BioPerl modules. This idea was started by Nathan 
Haigh and Sendu a long time ago and it was my fault to not implement on 
time the necessary script to run the process on a daily basis, so 
apologies for that.

There are still a few things to be done in order to have this working as 
it should:

- Nathan, current Devel::Cover module from CPAN doesn't include the JS 
modifications to make table columns sortable. Do you know what happened 
to the code you contributed to the author for that?

- Reports could be generated for the rest of the BioPerl packages as 
soon as they're migrated to the Build.PL infrastructure. Anyone up for that?

- bioperl-db tests require BioSQL to be setup in the webserver machine, 
and the same goes for bioperl-run's tests with ALL of its dependencies. 
The bioperl.org site is co-hosted with all of the other OBF projects and 
that machine also takes care of other things (mailing lists, etc), so I 
would like your feedback on possible workarounds to not overload the 
server if we want to setup such test reports.

Thanks & regards,
Mauricio.