[Bioperl-l] bug in Bio::SearchIO?
Chris Fields
cjfields at uiuc.edu
Wed Sep 12 10:57:22 EDT 2007
Try updating to bioperl from CVS. I believe this issue was fixed but
I don't believe it made the 1.5.2 release.
chris
On Sep 12, 2007, at 3:44 AM, Stephan Roessner wrote:
> Hi,
>
> I am parsing a BlastN output with Bio::SearchIO and getting an
> error for some
> of the hits when retrieving the start and/or the end position with
> $hit->end('sbjct') , $hit->start('sbjct'). I want to filter for
> hits which
> are are of equal length (~ > 0.9) to the query sequences.
>
> SearchIO is retrieving the right results, but throws an exemption,
> in this
> case: MSG:Undefined sub-sequence (1633,760). Valid range = 693 -
> 760 .....
>
> It seems to me valid range is parsed incorrectly, isn't it? Is this
> a bug?
>
> Does anybody have a similar problem?
>
> see code, error, and blastn output below.
>
> thanks,
> Stephan
>
>
> Stephan Roessner
> MIPS/IBI Inst. for Bioinformatics
> GSF Research Center for Environment and Health
> Ingolstädter Landstr. 1
> 85764 Neuherberg; Germany
> phone: +49 (0)89 3187 3583
> fax: +49 (0)89 3187 3585
> email: stephan.roessner at gsf.de
>
>
> Here is the piece of code I am using:
>
> my $blast_report = new Bio::SearchIO ('-format'=>'blast',
> '-file' => $source);
>
> while( my $result=$blast_report->next_result) {
> while( my $hit= $result->next_hit()) {
> print "Name: ".$hit->name."\n";
> print "S: ".$hit->start('sbjct')."\n";
> print "E: ".$hit->end('sbjct')."\n";
> print "L: ".$hit->length()."\n";
> }
> }
>
>
> Here's the message:
>
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: Undefined sub-sequence (1633,760). Valid range = 693 - 760
> STACK: Error::throw
> STACK:
> Bio::Root::Root::throw /usr/lib/perl5/vendor_perl/5.8.8/Bio/Root/
> Root.pm:359
> STACK:
> Bio::Search::HSP::HSPI::matches /usr/lib/perl5/vendor_perl/5.8.8/
> Bio/Search/HSP/HSPI.pm:691
> STACK:
> Bio::Search::SearchUtils::_adjust_contigs /usr/lib/perl5/
> vendor_perl/5.8.8/Bio/Search/SearchUtils.pm:489
> STACK:
> Bio::Search::SearchUtils::tile_hsps /usr/lib/perl5/vendor_perl/
> 5.8.8/Bio/Search/SearchUtils.pm:206
> STACK:
> Bio::Search::Hit::GenericHit::start /usr/lib/perl5/vendor_perl/
> 5.8.8/Bio/Search/Hit/GenericHit.pm:935
> STACK:
> main::parse /home/users/roessner/workspace/GeneSimilarity/
> similarity_analysis.pl:82
> STACK: /home/users/roessner/workspace/GeneSimilarity/
> similarity_analysis.pl:51
> -----------------------------------------------------------
>
> S: 635
> E: 790
> L: 2052
>
> This is the BLASTN output I am parsing::
>
>> LOC_Os11g37470.1 chr11_pseudomolecule_TIGR r_jap version0
> 21623485-21621434 BestGuessTranscript
> Length = 2052
>
> Score = 95.6 bits (48), Expect = 1e-17
> Identities = 106/124 (85%), Gaps = 1/124 (0%)
> Strand = Plus / Plus
>
>
> Query: 3191 tattaagcataattaatgtatcattagcacatgtagg-
> ttactgtagcatttaaggctaa 3249
> |||||||| |||||||| | ||||| ||||||||||| |||||||| || |||
> ||||||
> Sbjct: 635
> tattaagcctaattaatctgtcattggcacatgtagggttactgtaacacttatggctaa 694
>
>
> Query: 3250
> tcatagagtaactagacttaaaagactcgtctcgcgattttcaaccaaactgtgtaatta 3309
> |||| || ||| |||||| |||||| || |||||||||||||| ||||| |||
> |||||
> Sbjct: 695
> tcatggactaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaatta 754
>
>
> Query: 3310 gttt 3313
> ||||
> Sbjct: 755 gttt 758
>
>
>
> Score = 48.1 bits (24), Expect = 0.002
> Identities = 57/68 (83%)
> Strand = Plus / Minus
>
>
> Query: 2253
> aaaaactaattacacaatttacctgtacatcgcgagatgaatcttttaagtttagttact 2312
> ||||||||||| ||| ||| | || | ||||||||||||||||||| ||| ||
> ||| |
> Sbjct: 760
> aaaaactaattgcacggtttgcatgaaaatcgcgagatgaatcttttgagtctatttagt 701
>
>
> Query: 2313 ccatgatt 2320
> ||||||||
> Sbjct: 700 ccatgatt 693
>
>
>
> Score = 44.1 bits (22), Expect = 0.038
> Identities = 76/94 (80%)
> Strand = Plus / Minus
>
>
> Query: 1539
> atgcatgtagtattaaatatagacgaaaataaaaactaattgcacagtttggtcgaaatt 1598
> ||||||| || |||||||||| | ||| ||||||||||||||| |||||
> |||| |
> Sbjct: 790
> atgcatggagcattaaatataaataaaatgaaaaactaattgcacggtttgcatgaaaat 731
>
>
> Query: 1599 gtcgagacgaattttttgagtctagttaggccat 1632
> ||||| |||| ||||||||||| |||| ||||
> Sbjct: 730 cgcgagatgaatcttttgagtctatttagtccat 697
>
>
>
> Score = 44.1 bits (22), Expect = 0.038
> Identities = 73/90 (81%)
> Strand = Plus / Plus
>
>
> Query: 2026
> actaactagaattaaaagattcgtctcgtcatttacagacaaactgtgtaattagttttt 2085
> ||||| |||| | ||||||||| ||||| |||| || ||||| |||
> |||||||||||
> Sbjct: 701
> actaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaattagttttt 760
>
>
> Query: 2086 gttttcgtctatatttaatgcttcatgcat 2115
> ||| | ||||||||||||| |||||||
> Sbjct: 761 cattttatttatatttaatgctccatgcat 790
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign
More information about the Bioperl-l
mailing list