From cjfields at uiuc.edu  Sun Sep  2 19:54:54 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 2 Sep 2007 18:54:54 -0500
Subject: [Bioperl-l] (no subject)
Message-ID: <CA6A55BB-BB63-4FCE-A0AA-FBB2392C778F@uiuc.edu>

Posted this to biosql-l already but felt it needed posting here as  
well.  Sorry if you get this twice.

I noticed some critical recursion issues with bioperl-db when working  
in Bio::Ontology changes.  This was using bioperl-live (post-feature/ 
annotation fixes).  Bug report is here:

http://bugzilla.open-bio.org/show_bug.cgi?id=2355

It seems to be Bio:Taxon related; this is from 03swiss.t:

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:681
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:692
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
...
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:587
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:253
STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
PrimarySeqAdaptor.pm:229
STACK Bio::DB::BioSQL::SeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
SeqAdaptor.pm:217
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:214
STACK Bio::DB::Persistent::PersistentObject::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/Persistent/ 
PersistentObject.pm:244
STACK toplevel t/04swiss.t:36
---------------------------------------------------

Also, seeing this with 13remove.t and 15.cluster.t, both of which  
appear to infinitely recurse:

Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 587, <GEN0> line 1.
Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 630, <GEN0> line 1.


chris


From cjfields at uiuc.edu  Sun Sep  2 19:57:59 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 2 Sep 2007 18:57:59 -0500
Subject: [Bioperl-l] recursion issues with bioperl-db
Message-ID: <2E14450C-C135-42DD-A9DE-EB47EB80E6AC@uiuc.edu>

Apologies if you get this more than once; the first post appeared to  
get sent w/o a proper subject line.  Posted this to biosql-l already  
but felt it needed posting here as well.

I noticed some critical recursion issues with bioperl-db when working  
in Bio::Ontology changes.  This was using bioperl-live (post-feature/ 
annotation fixes).  Bug report is here:

http://bugzilla.open-bio.org/show_bug.cgi?id=2355

It seems to be Bio:Taxon related; this is from 03swiss.t:

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:681
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:692
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
...
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:587
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:253
STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
PrimarySeqAdaptor.pm:229
STACK Bio::DB::BioSQL::SeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
SeqAdaptor.pm:217
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:214
STACK Bio::DB::Persistent::PersistentObject::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/Persistent/ 
PersistentObject.pm:244
STACK toplevel t/04swiss.t:36
---------------------------------------------------

Also, seeing this with 13remove.t and 15.cluster.t, both of which  
appear to infinitely recurse:

Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 587, <GEN0> line 1.
Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 630, <GEN0> line 1.


chris


From cjfields at uiuc.edu  Sun Sep  2 21:40:48 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 2 Sep 2007 20:40:48 -0500
Subject: [Bioperl-l] recursion issues with bioperl-db
In-Reply-To: <2E14450C-C135-42DD-A9DE-EB47EB80E6AC@uiuc.edu>
References: <2E14450C-C135-42DD-A9DE-EB47EB80E6AC@uiuc.edu>
Message-ID: <25CFD36D-D921-4F5F-BADF-D858A2FE76D4@uiuc.edu>

Okay, we can the previous posts!  Odd, but I started from scratch and  
can't reproduce the issue; there may have been some cross-talk with  
different bioperl installations on my laptop.  Anyway, everything  
passes now w/o recursion so I'll mark the bug as invalid.

chris

On Sep 2, 2007, at 6:57 PM, Chris Fields wrote:

> Apologies if you get this more than once; the first post appeared to
> get sent w/o a proper subject line.  Posted this to biosql-l already
> but felt it needed posting here as well.
>
> I noticed some critical recursion issues with bioperl-db when working
> in Bio::Ontology changes.  This was using bioperl-live (post-feature/
> annotation fixes).  Bug report is here:
>
> http://bugzilla.open-bio.org/show_bug.cgi?id=2355
>
> It seems to be Bio:Taxon related; this is from 03swiss.t:
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:681
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:630
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:692
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:630
> ...
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:587
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:253
> STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> PrimarySeqAdaptor.pm:229
> STACK Bio::DB::BioSQL::SeqAdaptor::store_children
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> SeqAdaptor.pm:217
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:214
> STACK Bio::DB::Persistent::PersistentObject::create
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/Persistent/
> PersistentObject.pm:244
> STACK toplevel t/04swiss.t:36
> ---------------------------------------------------
>
> Also, seeing this with 13remove.t and 15.cluster.t, both of which
> appear to infinitely recurse:
>
> Deep recursion on subroutine
> "Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent" at
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm
> line 587, <GEN0> line 1.
> Deep recursion on subroutine
> "Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child" at
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm
> line 630, <GEN0> line 1.
>
>
> chris
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From bernd.web at gmail.com  Mon Sep  3 08:43:26 2007
From: bernd.web at gmail.com (Bernd Web)
Date: Mon, 3 Sep 2007 14:43:26 +0200
Subject: [Bioperl-l] Fh::flush warning
Message-ID: <716af09c0709030543w79f83368gf0ac74d220a96f8c@mail.gmail.com>

Hi,

Sometimes with Bio::SimpleAlign/AlignIO, I get the following warning:
(in cleanup) Undefined subroutine Fh::flush, at
/lib/perl/Bio/Root/IO.pm line 541.

This occurs in a rather large script and have not been able to isolate
a small example where I also get this warning. Does someone know more
about this warning and why it is thrown?

Regards,
Bernd

From cjfields at uiuc.edu  Mon Sep  3 10:41:49 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 3 Sep 2007 09:41:49 -0500
Subject: [Bioperl-l] Fh::flush warning
In-Reply-To: <716af09c0709030543w79f83368gf0ac74d220a96f8c@mail.gmail.com>
References: <716af09c0709030543w79f83368gf0ac74d220a96f8c@mail.gmail.com>
Message-ID: <98A9D081-2570-4D4E-A8F8-D03282D41E0C@uiuc.edu>

Could you give a bit more info (bioperl version, OS, etc)?

I'm guessing a recent version as the error coincides with a call to  
flush() in Root::IO (which is probably called indirectly via DESTROY)  
and that you're probably using a tied filehandle somewhere for  
output, e.g. Bio::AlignIO::newFh() or Bio::AlignIO::fh(), so knowing  
the input/output formats could help.

chris

On Sep 3, 2007, at 7:43 AM, Bernd Web wrote:

> Hi,
>
> Sometimes with Bio::SimpleAlign/AlignIO, I get the following warning:
> (in cleanup) Undefined subroutine Fh::flush, at
> /lib/perl/Bio/Root/IO.pm line 541.
>
> This occurs in a rather large script and have not been able to isolate
> a small example where I also get this warning. Does someone know more
> about this warning and why it is thrown?
>
> Regards,
> Bernd
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From xianranli78 at yahoo.com.cn  Mon Sep  3 22:11:09 2007
From: xianranli78 at yahoo.com.cn (xianran li)
Date: Tue, 4 Sep 2007 10:11:09 +0800 (CST)
Subject: [Bioperl-l] question about Bio::DB::GFF
Message-ID: <361239.6752.qm@web15309.mail.cnb.yahoo.com>

 
  Hi,
   
  I tried to load the  gff3 file with load_gff.pl and extrac some information with Bio::DB::GFF. Althougth this code work properly under windows xp, the $seg got nothing when i run it under Linux. 
   
  Here is my code and the gff3 file,
  ####################################################################
   
    #!/usr/local/bin/perl -w
   
  use strict;
use Bio::SeqIO;
use Bio::DB::GFF; 
   
  my $in_gff = Bio::DB::GFF->new( -adaptor    => 'dbi::mysqlopt',
                                -dsn        => 'dbi:mysql:test',
                                -aggregator => ['coding'],
                                -user       => "lixr",
                                -pass       => "123456"
                                );                           
my $seg = $in_gff->segment'BGIOSIBCE000001.1');
print $seg->abs_start."\n"; 


  ##################################################################
  ##gff-version 3 
##sequence-region       Chr01   1       43037
Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1
Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
Chr01 bgf CDS 19344 20165 . + 0 Parent=BGIOSIBCE000001.1
Chr01 bgf mRNA 30220 36442 . + . ID=BGIOSIBCE000002.1
Chr01 bgf CDS 30220 30387 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 31128 31226 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 32228 32331 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 33907 34715 . + 1 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 34799 34921 . + 2 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 35003 35091 . + 2 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 35179 35379 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 35981 36442 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf mRNA 38143 39015 . - . ID=BGIOSIBCE000003.1
Chr01 bgf CDS 38143 38541 . - 0 Parent=BGIOSIBCE000003.1
Chr01 bgf CDS 38649 38813 . - 0 Parent=BGIOSIBCE000003.1
Chr01 bgf CDS 38917 39015 . - 0 Parent=BGIOSIBCE000003.1
Chr01 bgf mRNA 39545 42080 . + . ID=BGIOSIBCE000004.1
Chr01 bgf CDS 39545 40584 . + 0 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 40677 41042 . + 1 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 41130 41208 . + 1 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 41740 41920 . + 0 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 42037 42080 . + 2 Parent=BGIOSIBCE000004.1
  #################################################################
   
   
  I would appreaciate if any one can give me some clues/link to accomplish this. 
   
  thanks in advance ,

  Xianran Li

       
---------------------------------
???????????????????????????????????????????? 

From cjfields at uiuc.edu  Tue Sep  4 00:04:29 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 3 Sep 2007 23:04:29 -0500
Subject: [Bioperl-l] question about Bio::DB::GFF
In-Reply-To: <361239.6752.qm@web15309.mail.cnb.yahoo.com>
References: <361239.6752.qm@web15309.mail.cnb.yahoo.com>
Message-ID: <37BE6493-B49B-47DF-8047-37D616B669A8@uiuc.edu>

Not sure if the gff3 you show was modified for demonstration here but  
it should always be tab-delimited.  Also, I have had problems myself  
when using files with Windows/Mac Classic line endings on UNIX'y  
systems (Excel and a few other Mac OS X programs insist on adding \r  
instead of \n, which plays havoc with parsers sometimes even with  
readline fixes).

chris

On Sep 3, 2007, at 9:11 PM, xianran li wrote:

>
>   Hi,
>
>   I tried to load the  gff3 file with load_gff.pl and extrac some  
> information with Bio::DB::GFF. Althougth this code work properly  
> under windows xp, the $seg got nothing when i run it under Linux.
>
>   Here is my code and the gff3 file,
>   ####################################################################
>
>     #!/usr/local/bin/perl -w
>
>   use strict;
> use Bio::SeqIO;
> use Bio::DB::GFF;
>
>   my $in_gff = Bio::DB::GFF->new( -adaptor    => 'dbi::mysqlopt',
>                                 -dsn        => 'dbi:mysql:test',
>                                 -aggregator => ['coding'],
>                                 -user       => "lixr",
>                                 -pass       => "123456"
>                                 );
> my $seg = $in_gff->segment'BGIOSIBCE000001.1');
> print $seg->abs_start."\n";
>
>
>   ##################################################################
>   ##gff-version 3
> ##sequence-region       Chr01   1       43037
> Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1
> Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf CDS 19344 20165 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf mRNA 30220 36442 . + . ID=BGIOSIBCE000002.1
> Chr01 bgf CDS 30220 30387 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 31128 31226 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 32228 32331 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 33907 34715 . + 1 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 34799 34921 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35003 35091 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35179 35379 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35981 36442 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf mRNA 38143 39015 . - . ID=BGIOSIBCE000003.1
> Chr01 bgf CDS 38143 38541 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38649 38813 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38917 39015 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf mRNA 39545 42080 . + . ID=BGIOSIBCE000004.1
> Chr01 bgf CDS 39545 40584 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 40677 41042 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41130 41208 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41740 41920 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 42037 42080 . + 2 Parent=BGIOSIBCE000004.1
>   #################################################################
>
>
>   I would appreaciate if any one can give me some clues/link to  
> accomplish this.
>
>   thanks in advance ,
>
>   Xianran Li
>
>
> ---------------------------------
> ??????????????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From xianranli78 at yahoo.com.cn  Tue Sep  4 00:58:48 2007
From: xianranli78 at yahoo.com.cn (xianran li)
Date: Tue, 4 Sep 2007 12:58:48 +0800 (CST)
Subject: [Bioperl-l]
 =?gb2312?q?=BB=D8=B8=B4=A3=BA=20Re:=20=20question=20about=20Bi?=
 =?gb2312?q?o::DB::GFF?=
In-Reply-To: <37BE6493-B49B-47DF-8047-37D616B669A8@uiuc.edu>
Message-ID: <866169.66154.qm@web15309.mail.cnb.yahoo.com>

Hi, everybody,
   
  It looks like for the different perl version(5.8.8 of  windows and 5.8.5 for linux). And I fixed this problem by adding ";Name=XXXX" after each line with "mRNA"
  ##############################################################################
  Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1;Name=BGIOSIBCE000001.1
Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
    ##############################################################################

  This time my code works properly.
   
  Xianran

Chris Fields <cjfields at uiuc.edu> ??????
  Not sure if the gff3 you show was modified for demonstration here but 
it should always be tab-delimited. Also, I have had problems myself 
when using files with Windows/Mac Classic line endings on UNIX'y 
systems (Excel and a few other Mac OS X programs insist on adding \r 
instead of \n, which plays havoc with parsers sometimes even with 
readline fixes).

chris

On Sep 3, 2007, at 9:11 PM, xianran li wrote:

>
> Hi,
>
> I tried to load the gff3 file with load_gff.pl and extrac some 
> information with Bio::DB::GFF. Althougth this code work properly 
> under windows xp, the $seg got nothing when i run it under Linux.
>
> Here is my code and the gff3 file,
> ####################################################################
>
> #!/usr/local/bin/perl -w
>
> use strict;
> use Bio::SeqIO;
> use Bio::DB::GFF;
>
> my $in_gff = Bio::DB::GFF->new( -adaptor => 'dbi::mysqlopt',
> -dsn => 'dbi:mysql:test',
> -aggregator => ['coding'],
> -user => "lixr",
> -pass => "123456"
> );
> my $seg = $in_gff->segment'BGIOSIBCE000001.1');
> print $seg->abs_start."\n";
>
>
> ##################################################################
> ##gff-version 3
> ##sequence-region Chr01 1 43037
> Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1
> Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf CDS 19344 20165 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf mRNA 30220 36442 . + . ID=BGIOSIBCE000002.1
> Chr01 bgf CDS 30220 30387 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 31128 31226 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 32228 32331 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 33907 34715 . + 1 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 34799 34921 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35003 35091 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35179 35379 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35981 36442 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf mRNA 38143 39015 . - . ID=BGIOSIBCE000003.1
> Chr01 bgf CDS 38143 38541 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38649 38813 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38917 39015 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf mRNA 39545 42080 . + . ID=BGIOSIBCE000004.1
> Chr01 bgf CDS 39545 40584 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 40677 41042 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41130 41208 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41740 41920 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 42037 42080 . + 2 Parent=BGIOSIBCE000004.1
> #################################################################
>
>
> I would appreaciate if any one can give me some clues/link to 
> accomplish this.
>
> thanks in advance ,
>
> Xianran Li
>
>
> ---------------------------------
> ????????????????????????????????????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





       
---------------------------------
 ????????????????????????????????

From jay at jays.net  Tue Sep  4 10:31:36 2007
From: jay at jays.net (Jay Hannah)
Date: Tue, 4 Sep 2007 09:31:36 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
Message-ID: <96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>

On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> Probably a bit of a long shot but does anyone have code for
> displaying protein or CDS multiple sequence alignments with the exon
> boundaries of each gene in the alignment?
>
> Something in the bioperl world without funky external dependencies.  
> I think
> it would be an awesome addition to the howtos.
>
> Currently, the Bio::Graphics howto has cdna to genome mapping  
> scripts or
> blast output scripts, but
> I couldn't find code for dealing with multiple sequence alignments.

I'm currently under the (potentially uninformed) impression that  
Bio::Graphics and related tools only work with a single  coordinate  
system. I've never seen a multiple sequence alignment example.

(
   I Google'd for "gbrowse alignment" and hit this:
   http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi

   Click the second Example link and you'll see exons mapped out.

   But zooming all the way in with all the tracks turned on it looks  
like the AZM tracks are just the coding regions. I don't see any  
multiple sequence alignment...
)

I doubt that helped.  :)

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah



From cjfields at uiuc.edu  Tue Sep  4 11:28:01 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 4 Sep 2007 10:28:01 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
Message-ID: <59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>


On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:

> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>> Probably a bit of a long shot but does anyone have code for
>> displaying protein or CDS multiple sequence alignments with the exon
>> boundaries of each gene in the alignment?
>>
>> Something in the bioperl world without funky external dependencies.
>> I think
>> it would be an awesome addition to the howtos.
>>
>> Currently, the Bio::Graphics howto has cdna to genome mapping
>> scripts or
>> blast output scripts, but
>> I couldn't find code for dealing with multiple sequence alignments.
>
> I'm currently under the (potentially uninformed) impression that
> Bio::Graphics and related tools only work with a single  coordinate
> system. I've never seen a multiple sequence alignment example.
>
> (
>    I Google'd for "gbrowse alignment" and hit this:
>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>
>    Click the second Example link and you'll see exons mapped out.
>
>    But zooming all the way in with all the tracks turned on it looks
> like the AZM tracks are just the coding regions. I don't see any
> multiple sequence alignment...
> )
>
> I doubt that helped.  :)
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:

http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
Browser/docs/tutorial/tutorial.html

chris


From avilella at gmail.com  Wed Sep  5 05:42:37 2007
From: avilella at gmail.com (Albert Vilella)
Date: Wed, 5 Sep 2007 11:42:37 +0200
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
Message-ID: <358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>

A couple of examples:

http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041

treefam has exon boundary and PFAM domain mappings

http://www.ensembl.org/Homo_sapiens/genetreeview?gene=ENSG00000139618

here the tree is shown as well, but the idea would be to plot the alignment

So it's more "show me the multiple CDS/protein alignment" rather than "show
my aligned CDS/proteins wrt my reference genome"

I think it would be quite neat to have this as a bioperl howto,

Comments?

    Albert.

On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>
>
> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>
> > On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> >> Probably a bit of a long shot but does anyone have code for
> >> displaying protein or CDS multiple sequence alignments with the exon
> >> boundaries of each gene in the alignment?
> >>
> >> Something in the bioperl world without funky external dependencies.
> >> I think
> >> it would be an awesome addition to the howtos.
> >>
> >> Currently, the Bio::Graphics howto has cdna to genome mapping
> >> scripts or
> >> blast output scripts, but
> >> I couldn't find code for dealing with multiple sequence alignments.
> >
> > I'm currently under the (potentially uninformed) impression that
> > Bio::Graphics and related tools only work with a single  coordinate
> > system. I've never seen a multiple sequence alignment example.
> >
> > (
> >    I Google'd for "gbrowse alignment" and hit this:
> >    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
> >
> >    Click the second Example link and you'll see exons mapped out.
> >
> >    But zooming all the way in with all the tracks turned on it looks
> > like the AZM tracks are just the coding regions. I don't see any
> > multiple sequence alignment...
> > )
> >
> > I doubt that helped.  :)
> >
> > Jay Hannah
> > http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>
> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>
> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
> Browser/docs/tutorial/tutorial.html
>
> chris
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From alexl at users.sourceforge.net  Wed Sep  5 06:08:14 2007
From: alexl at users.sourceforge.net (Alex Lancaster)
Date: Wed, 05 Sep 2007 03:08:14 -0700
Subject: [Bioperl-l] Clarifying license of bioperl
In-Reply-To: <8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net> (Hilmar Lapp's
	message of "Sat\, 18 Aug 2007 12\:13\:28 -0400")
References: <cg3ayi39sn.fsf@allele2.localdomain>
	<nrsl6i1ub4.fsf@allele2.localdomain>
	<1A4207F8295607498283FE9E93B775B40390172E@EX02.asurite.ad.asu.edu>
	<n9ir7e18y2.fsf@allele2.localdomain>
	<3515AB25-9919-407B-93E9-352BC426AFA1@uiuc.edu>
	<8td4xlyt4h.fsf@allele2.localdomain>
	<8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net>
Message-ID: <s73axt5ss1.fsf@allele2.localdomain>

>>>>> "HL" == Hilmar Lapp  writes:

HL> On Aug 18, 2007, at 7:33 AM, Alex Lancaster wrote:

> I imagine the intent of the bioperl
>> contributors is that it should be under the same terms as Perl,
>> whatever that happens to be (which just happens to be GPL or
>> Artistic, which is fine).

HL> I fully agree.

>> A clarification to that effect would be useful.

HL> Agreed, too. Would you mind changing that language on the wiki,
HL> since you seem to have a fairly good grasp on the issue?

OK, I've updated the wiki in two places:

http://www.bioperl.org/wiki/Licensing_BioPerl

http://www.bioperl.org/wiki/FAQ#What_are_the_license_terms_for_BioPerl.3F

It would also be nice if the LICENSE and Build.PL files in CVS (so it
finds its way into the next release) were also updated to reflect the
dual-licensed status, currently they only mention the Artistic
license:

http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/LICENSE?rev=HEAD&content-type=text/vnd.viewcvs-markup

http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/Build.PL?rev=HEAD&content-type=text/vnd.viewcvs-markup

For Build.PL this is easy:

(e.g., license             => 'artistic', should be 
       license             => 'GPL or Artistic',)

Possible solutions for the LICENSE file include:

1) The GPL could be added to LICENSE file at the end (with a note at
   the top to indicate that GPL is also included);

2) LICENSE could be moved to LICENSE.Artistic and another file
   "LICENSE.GPL" added with the GPL (version 2+) conditions, and the
   contents of LICENSE would include a note about each license.

I don't have access to the bioperl CVS repository, so I can't make the
changes myself).  This would also apply to the Build.PL (and LICENSE
files if they are present) in bioperl-run and other modules.

Thanks,
Alex

From cjfields at uiuc.edu  Wed Sep  5 08:25:21 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 07:25:21 -0500
Subject: [Bioperl-l] Clarifying license of bioperl
In-Reply-To: <s73axt5ss1.fsf@allele2.localdomain>
References: <cg3ayi39sn.fsf@allele2.localdomain>
	<nrsl6i1ub4.fsf@allele2.localdomain>
	<1A4207F8295607498283FE9E93B775B40390172E@EX02.asurite.ad.asu.edu>
	<n9ir7e18y2.fsf@allele2.localdomain>
	<3515AB25-9919-407B-93E9-352BC426AFA1@uiuc.edu>
	<8td4xlyt4h.fsf@allele2.localdomain>
	<8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net>
	<s73axt5ss1.fsf@allele2.localdomain>
Message-ID: <EE93F2F5-A76B-40C6-8A95-3E1DDD3D8562@uiuc.edu>


On Sep 5, 2007, at 5:08 AM, Alex Lancaster wrote:
...
>
> OK, I've updated the wiki in two places:
>
> http://www.bioperl.org/wiki/Licensing_BioPerl
>
> http://www.bioperl.org/wiki/ 
> FAQ#What_are_the_license_terms_for_BioPerl.3F
>
> It would also be nice if the LICENSE and Build.PL files in CVS (so it
> finds its way into the next release) were also updated to reflect the
> dual-licensed status, currently they only mention the Artistic
> license:
>
> http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/LICENSE? 
> rev=HEAD&content-type=text/vnd.viewcvs-markup
>
> http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/Build.PL? 
> rev=HEAD&content-type=text/vnd.viewcvs-markup
>
> For Build.PL this is easy:
>
> (e.g., license             => 'artistic', should be
>        license             => 'GPL or Artistic',)
>
> Possible solutions for the LICENSE file include:
>
> 1) The GPL could be added to LICENSE file at the end (with a note at
>    the top to indicate that GPL is also included);
>
> 2) LICENSE could be moved to LICENSE.Artistic and another file
>    "LICENSE.GPL" added with the GPL (version 2+) conditions, and the
>    contents of LICENSE would include a note about each license.
>
> I don't have access to the bioperl CVS repository, so I can't make the
> changes myself).  This would also apply to the Build.PL (and LICENSE
> files if they are present) in bioperl-run and other modules.
>
> Thanks,
> Alex

Looks like Sendu has done that.  There have been recent troubling  
developments re: Artistic License:

http://use.perl.org/article.pl?sid=07/08/26/1541205&from=rss

but the case hasn't been conclusively decided yet.

chris

From bix at sendu.me.uk  Wed Sep  5 08:18:35 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Wed, 05 Sep 2007 13:18:35 +0100
Subject: [Bioperl-l] Clarifying license of bioperl
In-Reply-To: <s73axt5ss1.fsf@allele2.localdomain>
References: <cg3ayi39sn.fsf@allele2.localdomain>	<nrsl6i1ub4.fsf@allele2.localdomain>	<1A4207F8295607498283FE9E93B775B40390172E@EX02.asurite.ad.asu.edu>	<n9ir7e18y2.fsf@allele2.localdomain>	<3515AB25-9919-407B-93E9-352BC426AFA1@uiuc.edu>	<8td4xlyt4h.fsf@allele2.localdomain>	<8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net>
	<s73axt5ss1.fsf@allele2.localdomain>
Message-ID: <46DE9E9B.80107@sendu.me.uk>

Alex Lancaster wrote:
>>>>>> "HL" == Hilmar Lapp  writes:
> 
> HL> On Aug 18, 2007, at 7:33 AM, Alex Lancaster wrote:
> 
>>> I imagine the intent of the bioperl
>>> contributors is that it should be under the same terms as Perl,
>>> whatever that happens to be (which just happens to be GPL or
>>> Artistic, which is fine).
> 
> HL> I fully agree.
> 
>>> A clarification to that effect would be useful.
> 
> HL> Agreed, too. Would you mind changing that language on the wiki,
> HL> since you seem to have a fairly good grasp on the issue?
> 
> OK, I've updated the wiki in two places:
> 
> http://www.bioperl.org/wiki/Licensing_BioPerl
> 
> http://www.bioperl.org/wiki/FAQ#What_are_the_license_terms_for_BioPerl.3F

Thank you very much for that Alex.


> It would also be nice if the LICENSE and Build.PL files in CVS (so it
> finds its way into the next release) were also updated to reflect the
> dual-licensed status, currently they only mention the Artistic
> license:
[snip]
> For Build.PL this is easy:
> 
> (e.g., license             => 'artistic', should be 
>        license             => 'GPL or Artistic',)

As per the 'license' section of 
http://search.cpan.org/~kwilliams/Module-Build-0.2808/lib/Module/Build/API.pod, 
I've changed it to 'perl', which means Artistic or GPL.


> Possible solutions for the LICENSE file include:
> 
> 1) The GPL could be added to LICENSE file at the end (with a note at
>    the top to indicate that GPL is also included);

I took this approach, using your language for the explanation at the 
top, and including GPL 3.0 at the bottom.


I've made these changes for core (live), run, db and network.

Thanks again for your help and advice.

From cjfields at uiuc.edu  Wed Sep  5 08:53:25 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 07:53:25 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
Message-ID: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>

You mean something like this?

http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics

chris

On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:

> A couple of examples:
>
> http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
>
> treefam has exon boundary and PFAM domain mappings
>
> http://www.ensembl.org/Homo_sapiens/genetreeview?gene=ENSG00000139618
>
> here the tree is shown as well, but the idea would be to plot the  
> alignment
>
> So it's more "show me the multiple CDS/protein alignment" rather  
> than "show
> my aligned CDS/proteins wrt my reference genome"
>
> I think it would be quite neat to have this as a bioperl howto,
>
> Comments?
>
>     Albert.
>
> On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>
>>
>> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>>
>>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>>>> Probably a bit of a long shot but does anyone have code for
>>>> displaying protein or CDS multiple sequence alignments with the  
>>>> exon
>>>> boundaries of each gene in the alignment?
>>>>
>>>> Something in the bioperl world without funky external dependencies.
>>>> I think
>>>> it would be an awesome addition to the howtos.
>>>>
>>>> Currently, the Bio::Graphics howto has cdna to genome mapping
>>>> scripts or
>>>> blast output scripts, but
>>>> I couldn't find code for dealing with multiple sequence alignments.
>>>
>>> I'm currently under the (potentially uninformed) impression that
>>> Bio::Graphics and related tools only work with a single  coordinate
>>> system. I've never seen a multiple sequence alignment example.
>>>
>>> (
>>>    I Google'd for "gbrowse alignment" and hit this:
>>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>>>
>>>    Click the second Example link and you'll see exons mapped out.
>>>
>>>    But zooming all the way in with all the tracks turned on it looks
>>> like the AZM tracks are just the coding regions. I don't see any
>>> multiple sequence alignment...
>>> )
>>>
>>> I doubt that helped.  :)
>>>
>>> Jay Hannah
>>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>>
>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>>
>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
>> Browser/docs/tutorial/tutorial.html
>>
>> chris
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From avilella at gmail.com  Wed Sep  5 09:31:24 2007
From: avilella at gmail.com (Albert Vilella)
Date: Wed, 5 Sep 2007 15:31:24 +0200
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
Message-ID: <358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>

Awesome!!

Thanks Chris!

On 9/5/07, Chris Fields <cjfields at uiuc.edu> wrote:
>
> You mean something like this?
>
> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>
> chris
>
> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>
> > A couple of examples:
> >
> > http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
> >
> > treefam has exon boundary and PFAM domain mappings
> >
> > http://www.ensembl.org/Homo_sapiens/genetreeview?gene=ENSG00000139618
> >
> > here the tree is shown as well, but the idea would be to plot the
> > alignment
> >
> > So it's more "show me the multiple CDS/protein alignment" rather
> > than "show
> > my aligned CDS/proteins wrt my reference genome"
> >
> > I think it would be quite neat to have this as a bioperl howto,
> >
> > Comments?
> >
> >     Albert.
> >
> > On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
> >>
> >>
> >> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
> >>
> >>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> >>>> Probably a bit of a long shot but does anyone have code for
> >>>> displaying protein or CDS multiple sequence alignments with the
> >>>> exon
> >>>> boundaries of each gene in the alignment?
> >>>>
> >>>> Something in the bioperl world without funky external dependencies.
> >>>> I think
> >>>> it would be an awesome addition to the howtos.
> >>>>
> >>>> Currently, the Bio::Graphics howto has cdna to genome mapping
> >>>> scripts or
> >>>> blast output scripts, but
> >>>> I couldn't find code for dealing with multiple sequence alignments.
> >>>
> >>> I'm currently under the (potentially uninformed) impression that
> >>> Bio::Graphics and related tools only work with a single  coordinate
> >>> system. I've never seen a multiple sequence alignment example.
> >>>
> >>> (
> >>>    I Google'd for "gbrowse alignment" and hit this:
> >>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
> >>>
> >>>    Click the second Example link and you'll see exons mapped out.
> >>>
> >>>    But zooming all the way in with all the tracks turned on it looks
> >>> like the AZM tracks are just the coding regions. I don't see any
> >>> multiple sequence alignment...
> >>> )
> >>>
> >>> I doubt that helped.  :)
> >>>
> >>> Jay Hannah
> >>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
> >>
> >> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
> >>
> >> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
> >> Browser/docs/tutorial/tutorial.html
> >>
> >> chris
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
>

From cjfields at uiuc.edu  Wed Sep  5 10:17:51 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 09:17:51 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
Message-ID: <31E25B64-2043-4460-ADC8-9684D01C2468@uiuc.edu>

It would be nice to place the labels to the left of the segments.  I  
believe there is a way to do this, but can't remember; if I can find  
it I'll revise the script.

chris

On Sep 5, 2007, at 8:31 AM, Albert Vilella wrote:

> Awesome!!
>
> Thanks Chris!
>
> On 9/5/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>
>> You mean something like this?
>>
>> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>>
>> chris
>>
>> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>>
>>> A couple of examples:
>>>
>>> http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
>>>
>>> treefam has exon boundary and PFAM domain mappings
>>>
>>> http://www.ensembl.org/Homo_sapiens/genetreeview? 
>>> gene=ENSG00000139618
>>>
>>> here the tree is shown as well, but the idea would be to plot the
>>> alignment
>>>
>>> So it's more "show me the multiple CDS/protein alignment" rather
>>> than "show
>>> my aligned CDS/proteins wrt my reference genome"
>>>
>>> I think it would be quite neat to have this as a bioperl howto,
>>>
>>> Comments?
>>>
>>>     Albert.
>>>
>>> On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>>>
>>>>
>>>> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>>>>
>>>>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>>>>>> Probably a bit of a long shot but does anyone have code for
>>>>>> displaying protein or CDS multiple sequence alignments with the
>>>>>> exon
>>>>>> boundaries of each gene in the alignment?
>>>>>>
>>>>>> Something in the bioperl world without funky external  
>>>>>> dependencies.
>>>>>> I think
>>>>>> it would be an awesome addition to the howtos.
>>>>>>
>>>>>> Currently, the Bio::Graphics howto has cdna to genome mapping
>>>>>> scripts or
>>>>>> blast output scripts, but
>>>>>> I couldn't find code for dealing with multiple sequence  
>>>>>> alignments.
>>>>>
>>>>> I'm currently under the (potentially uninformed) impression that
>>>>> Bio::Graphics and related tools only work with a single   
>>>>> coordinate
>>>>> system. I've never seen a multiple sequence alignment example.
>>>>>
>>>>> (
>>>>>    I Google'd for "gbrowse alignment" and hit this:
>>>>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>>>>>
>>>>>    Click the second Example link and you'll see exons mapped out.
>>>>>
>>>>>    But zooming all the way in with all the tracks turned on it  
>>>>> looks
>>>>> like the AZM tracks are just the coding regions. I don't see any
>>>>> multiple sequence alignment...
>>>>> )
>>>>>
>>>>> I doubt that helped.  :)
>>>>>
>>>>> Jay Hannah
>>>>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>>>>
>>>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>>>>
>>>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
>>>> Browser/docs/tutorial/tutorial.html
>>>>
>>>> chris
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From n.haigh at sheffield.ac.uk  Wed Sep  5 10:22:44 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Wed, 05 Sep 2007 15:22:44 +0100
Subject: [Bioperl-l] Bio::Graphics support for floating point positions
In-Reply-To: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
Message-ID: <46DEBBB4.1030200@sheffield.ac.uk>

Chris Fields wrote:
> You mean something like this?
>
> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>
> chris
>
> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>
>   

Nice!

On a similar (well, related to Bio::Graphics) topic, I've written a
script that uses markers that have been mapped from a model organism to
linkage groups in related species in order to estimate the location of
"unknown" markers in those linkage groups.

I'm using the Bio::Map::* modules for much of this work and then I use
Bio::Graphics to display the linkage groups of the non-model organism
with the putative position of the "unknown" markers. However, I've had
to do a bit of fudging to get Bio::Graphics to draw this data. The
problems I encountered are described below. I also have an open bug:
http://bugzilla.open-bio.org/show_bug.cgi?id=2343

1) Linkage maps are measured in cM - which can and are likely to be
non-integer values. Bio::Graphics needs integer values, so I simply
scaled all my cM measurements prior to drawing by *1000. However, the
ruler now doesn't represent the "true scale" - can this be adjusted?

2) Some markers map to 0cM. However, Bio::Graphics requires positions
>0. To get round this I simply incremented these positions by 1
(post-scaling), so they display almost in the correct place.

Is it possible/likely/wise to support positions starting at zero and
float positions? Would such support simply be to internalise what I have
already done outside Bio::Graphics into the Bio::Graphics modules and
have it display the correctly scaled ruler?

Thoughts comments welcome.

Cheers,
Nath

From cjfields at uiuc.edu  Wed Sep  5 10:52:00 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 09:52:00 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
Message-ID: <A8815527-2027-4F9D-BC47-C16E351067AA@uiuc.edu>

Updated the page on the web site with the new script.

Figured it out; if you pass the parameter -label_position 'left' it  
will display the label to the left.  However it displays them right  
next to the segment (ala GBrowse).  I added a hack to  
Bio::Graphics::Glyph::generic in CVS which allows 'alignment_left' as  
an option, displaying it aligned to the far left of the panel; there  
is probably a way to use a callback here as well.

chris

On Sep 5, 2007, at 8:31 AM, Albert Vilella wrote:

> Awesome!!
>
> Thanks Chris!
>
> On 9/5/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>
>> You mean something like this?
>>
>> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>>
>> chris
>>
>> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>>
>>> A couple of examples:
>>>
>>> http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
>>>
>>> treefam has exon boundary and PFAM domain mappings
>>>
>>> http://www.ensembl.org/Homo_sapiens/genetreeview? 
>>> gene=ENSG00000139618
>>>
>>> here the tree is shown as well, but the idea would be to plot the
>>> alignment
>>>
>>> So it's more "show me the multiple CDS/protein alignment" rather
>>> than "show
>>> my aligned CDS/proteins wrt my reference genome"
>>>
>>> I think it would be quite neat to have this as a bioperl howto,
>>>
>>> Comments?
>>>
>>>     Albert.
>>>
>>> On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>>>
>>>>
>>>> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>>>>
>>>>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>>>>>> Probably a bit of a long shot but does anyone have code for
>>>>>> displaying protein or CDS multiple sequence alignments with the
>>>>>> exon
>>>>>> boundaries of each gene in the alignment?
>>>>>>
>>>>>> Something in the bioperl world without funky external  
>>>>>> dependencies.
>>>>>> I think
>>>>>> it would be an awesome addition to the howtos.
>>>>>>
>>>>>> Currently, the Bio::Graphics howto has cdna to genome mapping
>>>>>> scripts or
>>>>>> blast output scripts, but
>>>>>> I couldn't find code for dealing with multiple sequence  
>>>>>> alignments.
>>>>>
>>>>> I'm currently under the (potentially uninformed) impression that
>>>>> Bio::Graphics and related tools only work with a single   
>>>>> coordinate
>>>>> system. I've never seen a multiple sequence alignment example.
>>>>>
>>>>> (
>>>>>    I Google'd for "gbrowse alignment" and hit this:
>>>>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>>>>>
>>>>>    Click the second Example link and you'll see exons mapped out.
>>>>>
>>>>>    But zooming all the way in with all the tracks turned on it  
>>>>> looks
>>>>> like the AZM tracks are just the coding regions. I don't see any
>>>>> multiple sequence alignment...
>>>>> )
>>>>>
>>>>> I doubt that helped.  :)
>>>>>
>>>>> Jay Hannah
>>>>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>>>>
>>>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>>>>
>>>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
>>>> Browser/docs/tutorial/tutorial.html
>>>>
>>>> chris
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From cjfields at uiuc.edu  Wed Sep  5 12:47:46 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 11:47:46 -0500
Subject: [Bioperl-l] Bio::Graphics support for floating point positions
In-Reply-To: <46DEBBB4.1030200@sheffield.ac.uk>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<46DEBBB4.1030200@sheffield.ac.uk>
Message-ID: <C445D375-6B45-476F-B0A9-2B28851EE970@uiuc.edu>

On Sep 5, 2007, at 9:22 AM, Nathan Haigh wrote:

> ...
> On a similar (well, related to Bio::Graphics) topic, I've written a
> script that uses markers that have been mapped from a model  
> organism to
> linkage groups in related species in order to estimate the location of
> "unknown" markers in those linkage groups.
>
> I'm using the Bio::Map::* modules for much of this work and then I use
> Bio::Graphics to display the linkage groups of the non-model organism
> with the putative position of the "unknown" markers. However, I've had
> to do a bit of fudging to get Bio::Graphics to draw this data. The
> problems I encountered are described below. I also have an open bug:
> http://bugzilla.open-bio.org/show_bug.cgi?id=2343
>
> 1) Linkage maps are measured in cM - which can and are likely to be
> non-integer values. Bio::Graphics needs integer values, so I simply
> scaled all my cM measurements prior to drawing by *1000. However, the
> ruler now doesn't represent the "true scale" - can this be adjusted?
>
> 2) Some markers map to 0cM. However, Bio::Graphics requires positions
>> 0. To get round this I simply incremented these positions by 1
> (post-scaling), so they display almost in the correct place.
>
> Is it possible/likely/wise to support positions starting at zero and
> float positions? Would such support simply be to internalise what I  
> have
> already done outside Bio::Graphics into the Bio::Graphics modules and
> have it display the correctly scaled ruler?
>
> Thoughts comments welcome.
>
> Cheers,
> Nath

There is this section in the GBrowse configure doc, which to me  
suggests there is a way to do what you want in Bioperl; you may have  
to delve into the Bio::Graphics or GBrowse code to work it out,  
though.  I think the GBrowse mail list archives also have more on this.

chris

.....

F. DISPLAYING GENETIC AND RH MAPS

GBrowse can be tweaked to make it more suitable for displaying genetic
and radiation hybrid maps.

The main issue is that the Bio::DB::GFF database expects coordinates
to be positive integers, not fractions, but genetic and RH maps use
floating point numbers.  Working around this is a bit of an ugly hack.
Before loading your data you must multiply all your coordinates by a
constant power of 10 in order to convert them into integers.  For
example, if a genetic map uses Morgan units ranging from 0 to 1.80,
you would multiple by 100 to create a map in ranging from 0 to 180.

Create a GFF file containing the markers in modified coordinates and
load it as usual.  Now you must tell GBrowse to reverse these changes.
Enter the following options into the [GENERAL] section of the
configuration file:

  units = M
  unit_divider = 100

These two options tell GBrowse to use "M" (Morgan) units, and to
divide all coordinates by 100.  GBrowse will automatically display the
scale using the most appropriate units, so the displayed map will
typically be drawn using cM units.


From bernd.web at gmail.com  Wed Sep  5 13:44:26 2007
From: bernd.web at gmail.com (Bernd Web)
Date: Wed, 5 Sep 2007 19:44:26 +0200
Subject: [Bioperl-l] SearchIO ResultWriter
Message-ID: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>

Hi,

For SearchIO there are ResultWriters to write text, html and BSML
(BSMLResultWriter). However, is there also a BLAST xml writer, which
writes the original blast xml files. This may have come up before. If
there is not, is there interest in having this?


Regards,
Bernd

From sac at bioperl.org  Wed Sep  5 16:37:37 2007
From: sac at bioperl.org (Steve Chervitz)
Date: Wed, 5 Sep 2007 13:37:37 -0700
Subject: [Bioperl-l] SearchIO ResultWriter
In-Reply-To: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>
References: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>
Message-ID: <8f200b4c0709051337u532804d6r27712b05faaeea7d@mail.gmail.com>

Looks like there is no such functionality in the current repository. If you
have implemented such a beast and are willing to contribute it, go for it
(or coordinate with a developer if you lack CVS write access).

Steve

On 9/5/07, Bernd Web <bernd.web at gmail.com> wrote:
>
> Hi,
>
> For SearchIO there are ResultWriters to write text, html and BSML
> (BSMLResultWriter). However, is there also a BLAST xml writer, which
> writes the original blast xml files. This may have come up before. If
> there is not, is there interest in having this?
>
>
> Regards,
> Bernd
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From n.haigh at sheffield.ac.uk  Wed Sep  5 17:18:17 2007
From: n.haigh at sheffield.ac.uk (Nathan S. Haigh)
Date: Wed, 05 Sep 2007 22:18:17 +0100
Subject: [Bioperl-l] Bio::Graphics support for floating point positions
In-Reply-To: <C445D375-6B45-476F-B0A9-2B28851EE970@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<46DEBBB4.1030200@sheffield.ac.uk>
	<C445D375-6B45-476F-B0A9-2B28851EE970@uiuc.edu>
Message-ID: <46DF1D19.9010707@sheffield.ac.uk>

Chris Fields wrote:
> On Sep 5, 2007, at 9:22 AM, Nathan Haigh wrote:
>
>> ...
>> On a similar (well, related to Bio::Graphics) topic, I've written a
>> script that uses markers that have been mapped from a model organism to
>> linkage groups in related species in order to estimate the location of
>> "unknown" markers in those linkage groups.
>>
>> I'm using the Bio::Map::* modules for much of this work and then I use
>> Bio::Graphics to display the linkage groups of the non-model organism
>> with the putative position of the "unknown" markers. However, I've had
>> to do a bit of fudging to get Bio::Graphics to draw this data. The
>> problems I encountered are described below. I also have an open bug:
>> http://bugzilla.open-bio.org/show_bug.cgi?id=2343
>>
>> 1) Linkage maps are measured in cM - which can and are likely to be
>> non-integer values. Bio::Graphics needs integer values, so I simply
>> scaled all my cM measurements prior to drawing by *1000. However, the
>> ruler now doesn't represent the "true scale" - can this be adjusted?
>>
>> 2) Some markers map to 0cM. However, Bio::Graphics requires positions
>>> 0. To get round this I simply incremented these positions by 1
>> (post-scaling), so they display almost in the correct place.
>>
>> Is it possible/likely/wise to support positions starting at zero and
>> float positions? Would such support simply be to internalise what I have
>> already done outside Bio::Graphics into the Bio::Graphics modules and
>> have it display the correctly scaled ruler?
>>
>> Thoughts comments welcome.
>>
>> Cheers,
>> Nath
>
> There is this section in the GBrowse configure doc, which to me
> suggests there is a way to do what you want in Bioperl; you may have
> to delve into the Bio::Graphics or GBrowse code to work it out,
> though.  I think the GBrowse mail list archives also have more on this.
>
> chris
>
> .....
>
> F. DISPLAYING GENETIC AND RH MAPS
>
> GBrowse can be tweaked to make it more suitable for displaying genetic
> and radiation hybrid maps.
>
> The main issue is that the Bio::DB::GFF database expects coordinates
> to be positive integers, not fractions, but genetic and RH maps use
> floating point numbers.  Working around this is a bit of an ugly hack.
> Before loading your data you must multiply all your coordinates by a
> constant power of 10 in order to convert them into integers.  For
> example, if a genetic map uses Morgan units ranging from 0 to 1.80,
> you would multiple by 100 to create a map in ranging from 0 to 180.
>
> Create a GFF file containing the markers in modified coordinates and
> load it as usual.  Now you must tell GBrowse to reverse these changes.
> Enter the following options into the [GENERAL] section of the
> configuration file:
>
>  units = M
>  unit_divider = 100
>
> These two options tell GBrowse to use "M" (Morgan) units, and to
> divide all coordinates by 100.  GBrowse will automatically display the
> scale using the most appropriate units, so the displayed map will
> typically be drawn using cM units.
>


Thanks for for the pointer Chris!

>From what you've said, it appears they might have done a similar hack to
me - which is always nice to know! It seems then to me, that it may be
worth making the Bio::Graphic::* modules slightly more generic and
applicable for these situations. It's late, so does anyone have
suggestions before I start digging through Bio::Graphic::* modules in
the morning? Maybe you guys across the water have something to say by
the time I wake up in the morning!?

Thanks
Nath

From jason at bioperl.org  Wed Sep  5 17:33:44 2007
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 5 Sep 2007 14:33:44 -0700
Subject: [Bioperl-l] SearchIO ResultWriter
In-Reply-To: <8f200b4c0709051337u532804d6r27712b05faaeea7d@mail.gmail.com>
References: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>
	<8f200b4c0709051337u532804d6r27712b05faaeea7d@mail.gmail.com>
Message-ID: <AE9E4472-3424-49F6-AA93-6F05F14446AA@bioperl.org>

I think most ppl aren't that enamored with the NCBI XML Blast format  
but I guess it is standard if the NCBI puts it out...
It should be a pretty easy writer to make at any rate just follow  
along with what was done for BSMLWriter.

-jason
On Sep 5, 2007, at 1:37 PM, Steve Chervitz wrote:

> Looks like there is no such functionality in the current  
> repository. If you
> have implemented such a beast and are willing to contribute it, go  
> for it
> (or coordinate with a developer if you lack CVS write access).
>
> Steve
>
> On 9/5/07, Bernd Web <bernd.web at gmail.com> wrote:
>>
>> Hi,
>>
>> For SearchIO there are ResultWriters to write text, html and BSML
>> (BSMLResultWriter). However, is there also a BLAST xml writer, which
>> writes the original blast xml files. This may have come up before. If
>> there is not, is there interest in having this?
>>
>>
>> Regards,
>> Bernd
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
jason at bioperl.org


From jay at jays.net  Thu Sep  6 15:50:53 2007
From: jay at jays.net (Jay Hannah)
Date: Thu, 6 Sep 2007 15:50:53 -0400 (EDT)
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
 with exon boundaries
In-Reply-To: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
Message-ID: <Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>


On Wed, 5 Sep 2007, Chris Fields wrote:
> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics

Wow. That's slick.  :)   Is it possible to zoom in far enough to see the 
individual bases and gaps??

On Tue, 4 Sep 2007, Chris Fields wrote:
> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-Browser/docs/tutorial/tutorial.html

Yes, indeed. GBrowse graphs all sorts of amazing things. Specifically, 
this image might be what Albert is looking for:

http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-Browser/docs/tutorial/figures/segmented_features2.gif

He'd need to map his exon boundaries from whatever format he has into a 
GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to munch on.

On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> "Something in the bioperl world without funky external dependencies"

There are still things the long arm of BioPerl justice hasn't reached?   :)

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah


From cjfields at uiuc.edu  Thu Sep  6 19:39:07 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 6 Sep 2007 18:39:07 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
Message-ID: <9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>


On Sep 6, 2007, at 2:50 PM, Jay Hannah wrote:

>
> On Wed, 5 Sep 2007, Chris Fields wrote:
>> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>
> Wow. That's slick.  :)   Is it possible to zoom in far enough to  
> see the
> individual bases and gaps??

I'm not sure; you can do something like that with GBrowse with some  
features so there is probably a way to put something together which  
could do that.

> On Tue, 4 Sep 2007, Chris Fields wrote:
>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
>> Browser/docs/tutorial/tutorial.html
>
> Yes, indeed. GBrowse graphs all sorts of amazing things. Specifically,
> this image might be what Albert is looking for:
>
> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
> Browser/docs/tutorial/figures/segmented_features2.gif
>
> He'd need to map his exon boundaries from whatever format he has  
> into a
> GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to  
> munch on.

I use segmented SeqFeatures in my example.  The HOWTO also uses a  
variation ('graded_segments'):

http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output

The subseqfeatures are colored by score.  Feasibly one could hack  
this so that the exons/introns have a different 'score', thus  
displaying different colors.

> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>> "Something in the bioperl world without funky external dependencies"
>
> There are still things the long arm of BioPerl justice hasn't  
> reached?   :)
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

chris

From cain.cshl at gmail.com  Thu Sep  6 23:20:04 2007
From: cain.cshl at gmail.com (Scott Cain)
Date: Thu, 06 Sep 2007 23:20:04 -0400
Subject: [Bioperl-l] display protein/CDS multiple sequence
	alignments	with exon boundaries
In-Reply-To: <9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
Message-ID: <1189135204.2560.52.camel@localhost.localdomain>

On Thu, 2007-09-06 at 18:39 -0500, Chris Fields wrote:
> On Sep 6, 2007, at 2:50 PM, Jay Hannah wrote:
> 
> >
> > On Wed, 5 Sep 2007, Chris Fields wrote:
> >> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
> >
> > Wow. That's slick.  :)   Is it possible to zoom in far enough to  
> > see the
> > individual bases and gaps??
> 
> I'm not sure; you can do something like that with GBrowse with some  
> features so there is probably a way to put something together which  
> could do that.

Yeah, if it were me, I would install GBrowse, hack my data into GFF and
use gbrowse_img to generate pictures.  It would probably be easier than
starting from scratch.


> 
> > On Tue, 4 Sep 2007, Chris Fields wrote:
> >> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
> >> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
> >> Browser/docs/tutorial/tutorial.html
> >
> > Yes, indeed. GBrowse graphs all sorts of amazing things. Specifically,
> > this image might be what Albert is looking for:
> >
> > http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
> > Browser/docs/tutorial/figures/segmented_features2.gif
> >
> > He'd need to map his exon boundaries from whatever format he has  
> > into a
> > GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to  
> > munch on.
> 
> I use segmented SeqFeatures in my example.  The HOWTO also uses a  
> variation ('graded_segments'):
> 
> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
> 
> The subseqfeatures are colored by score.  Feasibly one could hack  
> this so that the exons/introns have a different 'score', thus  
> displaying different colors.
> 
> > On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> >> "Something in the bioperl world without funky external dependencies"
> >
> > There are still things the long arm of BioPerl justice hasn't  
> > reached?   :)
> >
> > Jay Hannah
> > http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
> 
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain at cshl.edu
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory
-------------- next part --------------
A non-text attachment was scrubbed...
Name: not available
Type: application/pgp-signature
Size: 189 bytes
Desc: This is a digitally signed message part
Url : http://lists.open-bio.org/pipermail/bioperl-l/attachments/20070906/6b2b9ea2/attachment.bin 

From avilella at gmail.com  Fri Sep  7 05:20:01 2007
From: avilella at gmail.com (Albert Vilella)
Date: Fri, 7 Sep 2007 10:20:01 +0100
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
Message-ID: <358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>

>
> > He'd need to map his exon boundaries from whatever format he has
> > into a
> > GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to
> > munch on.
>
> I use segmented SeqFeatures in my example.  The HOWTO also uses a
> variation ('graded_segments'):
>
> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
>
> The subseqfeatures are colored by score.  Feasibly one could hack
> this so that the exons/introns have a different 'score', thus
> displaying different colors.


The exon boundary could be a vertical line or a triangular tick or
something. I don't know if there is a consensus on this kind of cartoons.
Does anybody know how exon boundaries are displayed in different
browsers/apps?

From yangmeng at genomics.org.cn  Fri Sep  7 03:57:14 2007
From: yangmeng at genomics.org.cn (=?ISO-8859-1?Q?=D1=EE=C3=CD=A3=A8=D6=D0=D0=C4=CA=B5=D1=E9=CA=D2?= )
Date: Fri,  7 Sep 2007 15:57:14 +0800
Subject: [Bioperl-l] a question
Message-ID: <200709071557.AA78971054@genomics.org.cn>

I am a student from China.During my learing the bioperl,I encounter a problem as follows:

I run the program,

use Bio::Perl;
$seq_object = get_sequence('swissprot',"ROA1_HUMAN");
write_sequence(">roa1.fasta",'fasta',$seq_object);

But It returns lots of mistake informatiom,

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: WebDBSeqI Request Error:
501 Protocol scheme '' is not supported
Content-Type: text/plain
Client-Date: Fri, 07 Sep 2007 07:26:06 GMT
Client-Warning: Internal response
501 Protocol scheme '' is not supported
STACK: Error::throw
STACK: Bio::Root::Root::throw D:/perl/site/lib/Bio/Root/Root.pm:359
STACK: Bio::DB::WebDBSeqI::_request D:/perl/site/lib/Bio/DB/WebDBSeqI.pm:685
STACK: Bio::DB::WebDBSeqI::get_seq_stream D:/perl/site/lib/Bio/DB/WebDBSeqI.pm:4
91
STACK: Bio::DB::WebDBSeqI::get_Stream_by_id D:/perl/site/lib/Bio/DB/WebDBSeqI.pm
:275
STACK: Bio::DB::WebDBSeqI::get_Seq_by_id D:/perl/site/lib/Bio/DB/WebDBSeqI.pm:14
5
STACK: Bio::Perl::get_sequence D:/perl/site/lib/Bio/Perl.pm:510
STACK: C:\DOCUME~1\yangmeng\LOCALS~1\Temp\dir13D.tmp\Untitled.pl:6
-----------------------------------------------------------

I don't know the reason of the problem.I have installed the addition perl modules such as bioperl-db,bioperl-network,bioperlgui and almost all "BioPerl Dependencies modules".My network is also OK. It's an annoying promleb to me.
I have consulted many experts but didn't got a reply. Could you vacuate in your mass business to give me a help?

Thank you!

Best regards!

YangMeng  




________________________________________________________________
Sent via the WebMail system at genomics.org.cn


 
                   

From cjfields at uiuc.edu  Fri Sep  7 10:09:18 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 7 Sep 2007 09:09:18 -0500
Subject: [Bioperl-l] a question
In-Reply-To: <200709071557.AA78971054@genomics.org.cn>
References: <200709071557.AA78971054@genomics.org.cn>
Message-ID: <7F176E39-18A6-4BF9-9247-863D6F3C167D@uiuc.edu>


On Sep 7, 2007, at 2:57 AM, ???????????????? wrote:

> I am a student from China.During my learing the bioperl,I encounter  
> a problem as follows:
>
> I run the program,
>
> use Bio::Perl;
> $seq_object = get_sequence('swissprot',"ROA1_HUMAN");
> write_sequence(">roa1.fasta",'fasta',$seq_object);
>
> But It returns lots of mistake informatiom,

First, always preface problems of this sort with the version of  
BioPerl you are using (there are quite a few versions still being used).

> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: WebDBSeqI Request Error:
> 501 Protocol scheme '' is not supported
> Content-Type: text/plain
> Client-Date: Fri, 07 Sep 2007 07:26:06 GMT
> Client-Warning: Internal response
> 501 Protocol scheme '' is not supported
> STACK: Error::throw
> STACK: Bio::Root::Root::throw D:/perl/site/lib/Bio/Root/Root.pm:359
> STACK: Bio::DB::WebDBSeqI::_request D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm:685
> STACK: Bio::DB::WebDBSeqI::get_seq_stream D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm:4
> 91
> STACK: Bio::DB::WebDBSeqI::get_Stream_by_id D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm
> :275
> STACK: Bio::DB::WebDBSeqI::get_Seq_by_id D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm:14
> 5
> STACK: Bio::Perl::get_sequence D:/perl/site/lib/Bio/Perl.pm:510
> STACK: C:\DOCUME~1\yangmeng\LOCALS~1\Temp\dir13D.tmp\Untitled.pl:6
> -----------------------------------------------------------

This works for me using bioperl from CVS.  There were a few remote  
DbFetch server changes if I recall correctly, so updating from CVS  
may be your best option.

> I don't know the reason of the problem.I have installed the  
> addition perl modules such as bioperl-db,bioperl-network,bioperlgui  
> and almost all "BioPerl Dependencies modules".My network is also  
> OK. It's an annoying promleb to me.
> I have consulted many experts but didn't got a reply. Could you  
> vacuate in your mass business to give me a help?
>
> Thank you!
>
> Best regards!
>
> YangMeng

I think my 'vacuating' is a private matter, let alone doing so in my  
mass business...

http://www.thefreedictionary.com/Vacuate

;>

chris

From cjfields at uiuc.edu  Mon Sep 10 18:04:14 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 10 Sep 2007 17:04:14 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
Message-ID: <3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>

On Sep 7, 2007, at 4:20 AM, Albert Vilella wrote:

>>> He'd need to map his exon boundaries from whatever format he has
>>> into a
>>> GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to
>>> munch on.
>>
>> I use segmented SeqFeatures in my example.  The HOWTO also uses a
>> variation ('graded_segments'):
>>
>> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
>>
>> The subseqfeatures are colored by score.  Feasibly one could hack
>> this so that the exons/introns have a different 'score', thus
>> displaying different colors.
>
>
> The exon boundary could be a vertical line or a triangular tick or
> something. I don't know if there is a consensus on this kind of  
> cartoons.
> Does anybody know how exon boundaries are displayed in different
> browsers/apps?

Don't know.  BTW, apparently there is something being cooked up as an  
alignment browser (among other things) for GBrowse:

https://www.nescent.org/wg_phyloinformatics/ 
PhyloSoC:Phylogenetic_and_Haplotype_Displays_for_GBrowse

Acc. to Lincoln (from his last GBrowse post) there will be a testable  
version within a few weeks or so.  You could always ask more  
questions about it on the GBrowse list.

chris

From lstein at cshl.edu  Mon Sep 10 18:09:41 2007
From: lstein at cshl.edu (Lincoln Stein)
Date: Mon, 10 Sep 2007 18:09:41 -0400
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
Message-ID: <6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>

You can view a simple multiple alignment now. Go to www.wormbase.org, turn
on some of the EST tracks and then zoom down to base pair level.

In bio::graphics, use the "segments" glyph and turn on the -draw_target
option. The features must have DNA attached to them.

What's coming soon is support for MAF format, which provides genome-level
alignments.

Lincoln

On 9/10/07, Chris Fields <cjfields at uiuc.edu> wrote:
>
> On Sep 7, 2007, at 4:20 AM, Albert Vilella wrote:
>
> >>> He'd need to map his exon boundaries from whatever format he has
> >>> into a
> >>> GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to
> >>> munch on.
> >>
> >> I use segmented SeqFeatures in my example.  The HOWTO also uses a
> >> variation ('graded_segments'):
> >>
> >> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
> >>
> >> The subseqfeatures are colored by score.  Feasibly one could hack
> >> this so that the exons/introns have a different 'score', thus
> >> displaying different colors.
> >
> >
> > The exon boundary could be a vertical line or a triangular tick or
> > something. I don't know if there is a consensus on this kind of
> > cartoons.
> > Does anybody know how exon boundaries are displayed in different
> > browsers/apps?
>
> Don't know.  BTW, apparently there is something being cooked up as an
> alignment browser (among other things) for GBrowse:
>
> https://www.nescent.org/wg_phyloinformatics/
> PhyloSoC:Phylogenetic_and_Haplotype_Displays_for_GBrowse
>
> Acc. to Lincoln (from his last GBrowse post) there will be a testable
> version within a few weeks or so.  You could always ask more
> questions about it on the GBrowse list.
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
(516) 367-8380 (voice)
(516) 367-8389 (fax)
FOR URGENT MESSAGES & SCHEDULING,
PLEASE CONTACT MY ASSISTANT,
SANDRA MICHELSEN, AT michelse at cshl.edu

From cjfields at uiuc.edu  Mon Sep 10 23:00:29 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 10 Sep 2007 22:00:29 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
	<6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
Message-ID: <885E5E3B-E2F7-4279-8EE3-FC21AF535D7E@uiuc.edu>

Doesn't that work only for SeqFeature::SimilarityPair and HSP-like  
(paired) alignments, or am I mistaken?

chris

On Sep 10, 2007, at 5:09 PM, Lincoln Stein wrote:

> You can view a simple multiple alignment now. Go to  
> www.wormbase.org, turn
> on some of the EST tracks and then zoom down to base pair level.
>
> In bio::graphics, use the "segments" glyph and turn on the - 
> draw_target
> option. The features must have DNA attached to them.
>
> What's coming soon is support for MAF format, which provides genome- 
> level
> alignments.
>
> Lincoln



From christoph.theunert at web.de  Tue Sep 11 06:37:49 2007
From: christoph.theunert at web.de (Christoph Theunert)
Date: Tue, 11 Sep 2007 03:37:49 -0700 (PDT)
Subject: [Bioperl-l] release of own projects
Message-ID: <12611951.post@talk.nabble.com>


Hi, I am a bioinformatics student from germany and I need your help 

Working with perl and bioperl is pretty new to me - 
currently I am working on a Bioperl project, and I don't know how to release
my project when i am finished with it.

I want to pack my modules so that other users can download it and install it
on their machines.

Do I use the command h2xs as to create cpan modules ( makefiles ...) or what
is the best way to solve my 
problem ?

thanks for help 

Christoph
-- 
View this message in context: http://www.nabble.com/release-of-own-projects-tf4421681.html#a12611951
Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.


From spiros at lokku.com  Tue Sep 11 06:57:14 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 11 Sep 2007 11:57:14 +0100
Subject: [Bioperl-l] release of own projects
In-Reply-To: <12611951.post@talk.nabble.com>
References: <12611951.post@talk.nabble.com>
Message-ID: <bba689ec0709110357o2fb66071w611a8598bef8134e@mail.gmail.com>

Hey,

Yes, IMHO the best way would be to create CPANesque modules that
people are able to download and install. The installation is pretty
straightforward, covers prerequisites  and more advanced features if
needed and as an approach it is widely supported. Also, it gives you
the ability to create and integrate tests seamlessly :)

Check out these URL's on how to do it:

http://search.cpan.org/~nwclark/perl-5.8.8/pod/perlnewmod.pod
http://www.perlmonks.org/?node_id=158999
http://www.perlmonks.org/?node_id=431702

Btw, more friendly and automated tools exist besides h2xs. Be sure to
have a look at:

http://search.cpan.org/perldoc?ExtUtils::ModuleMaker
http://search.cpan.org/perldoc?Module::Starter

Hope this helps,
Spiros

ps. i suggest since its your research work you are going to be handing
out to read a bit on the various software licenses which exist and
which you prefer to license your code under.


On 9/11/07, Christoph Theunert <christoph.theunert at web.de> wrote:
>
> Hi, I am a bioinformatics student from germany and I need your help
>
> Working with perl and bioperl is pretty new to me -
> currently I am working on a Bioperl project, and I don't know how to release
> my project when i am finished with it.
>
> I want to pack my modules so that other users can download it and install it
> on their machines.
>
> Do I use the command h2xs as to create cpan modules ( makefiles ...) or what
> is the best way to solve my
> problem ?
>
> thanks for help
>
> Christoph
> --
> View this message in context: http://www.nabble.com/release-of-own-projects-tf4421681.html#a12611951
> Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From bix at sendu.me.uk  Tue Sep 11 07:12:41 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 11 Sep 2007 12:12:41 +0100
Subject: [Bioperl-l] release of own projects
In-Reply-To: <12611951.post@talk.nabble.com>
References: <12611951.post@talk.nabble.com>
Message-ID: <46E67829.8060303@sendu.me.uk>

Christoph Theunert wrote:
> Hi, I am a bioinformatics student from germany and I need your help 
> 
> Working with perl and bioperl is pretty new to me - 
> currently I am working on a Bioperl project, and I don't know how to release
> my project when i am finished with it.
> 
> I want to pack my modules so that other users can download it and install it
> on their machines.
> 
> Do I use the command h2xs as to create cpan modules ( makefiles ...) or what
> is the best way to solve my 
> problem ?

You can do it however you like. You can just stick the modules in a 
folder, .tar.gz it and offer that to people. You can use h2xs to 
automate certain things. You can use Module::Build.

To make your work available via cpan, see
http://www.cpan.org/modules/04pause.html

If your modules are of general bioinformatic utility you might even 
consider making them a part of bioperl itself.

From jay at jays.net  Tue Sep 11 17:15:17 2007
From: jay at jays.net (Jay Hannah)
Date: Tue, 11 Sep 2007 16:15:17 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
 with exon boundaries
In-Reply-To: <6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>	
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>	
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>	
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>	
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>	
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
	<6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
Message-ID: <46E70565.5040503@jays.net>

Lincoln Stein wrote:
> You can view a simple multiple alignment now. Go to www.wormbase.org 
> <http://www.wormbase.org>, turn on some of the EST tracks and then 
> zoom down to base pair level.
>
> In bio::graphics, use the "segments" glyph and turn on the 
> -draw_target option. The features must have DNA attached to them.

Wow.  *http://tinyurl.com/yuz8bq*   I hadn't seen that done before.

> What's coming soon is support for MAF format, which provides 
> genome-level alignments.

I'm looking forward to trying to wrap my head around that.  :)

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah


From cjfields at uiuc.edu  Tue Sep 11 18:40:55 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 11 Sep 2007 17:40:55 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <46E70565.5040503@jays.net>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>	
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>	
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>	
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>	
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>	
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
	<6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
	<46E70565.5040503@jays.net>
Message-ID: <BC255B1A-EBB6-401B-BCDF-357A653A5972@uiuc.edu>


On Sep 11, 2007, at 4:15 PM, Jay Hannah wrote:

> Lincoln Stein wrote:
>> You can view a simple multiple alignment now. Go to www.wormbase.org
>> <http://www.wormbase.org>, turn on some of the EST tracks and then
>> zoom down to base pair level.
>>
>> In bio::graphics, use the "segments" glyph and turn on the
>> -draw_target option. The features must have DNA attached to them.
>
> Wow.  *http://tinyurl.com/yuz8bq*   I hadn't seen that done before.

There is a section detailing how this is done in the GBrowse tutorial  
(though it uses older GFF):

http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
Browser/docs/tutorial/tutorial.html

>> What's coming soon is support for MAF format, which provides
>> genome-level alignments.
>
> I'm looking forward to trying to wrap my head around that.  :)
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

It's easily parsible, which is nice!

chris

From stephan.roessner at gsf.de  Wed Sep 12 04:44:10 2007
From: stephan.roessner at gsf.de (Stephan Roessner)
Date: Wed, 12 Sep 2007 10:44:10 +0200
Subject: [Bioperl-l] bug in Bio::SearchIO?
Message-ID: <200709121044.11741.stephan.roessner@gsf.de>

Hi,

I am parsing a BlastN output with Bio::SearchIO and getting an error for some 
of the hits when retrieving the start and/or the end position with 
$hit->end('sbjct') , $hit->start('sbjct'). I want to filter for hits which 
are are of equal length (~ > 0.9) to the query sequences. 

SearchIO is retrieving the right results, but throws an exemption, in this 
case: MSG:Undefined sub-sequence (1633,760). Valid range = 693 - 760 .....

It seems to me valid range is parsed incorrectly, isn't it? Is this a bug?

Does anybody have a similar problem?

see code, error, and blastn output below.

thanks,
Stephan


Stephan Roessner
MIPS/IBI Inst. for Bioinformatics
GSF Research Center for Environment and Health
Ingolst?dter Landstr. 1
85764 Neuherberg; Germany
phone: +49 (0)89 3187 3583
fax: ? ? ? +49 (0)89 3187 3585
email: stephan.roessner at gsf.de


Here is the piece of code I am using:

my $blast_report = new Bio::SearchIO ('-format'=>'blast',
                                         '-file' => $source);
  	
while( my $result=$blast_report->next_result) {
		while( my $hit= $result->next_hit()) {
			print "Name: ".$hit->name."\n";
			print "S: ".$hit->start('sbjct')."\n";
			print "E: ".$hit->end('sbjct')."\n";
			print "L: ".$hit->length()."\n";
		}
 	}


Here's the message: 

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Undefined sub-sequence (1633,760). Valid range = 693 - 760
STACK: Error::throw
STACK: 
Bio::Root::Root::throw /usr/lib/perl5/vendor_perl/5.8.8/Bio/Root/Root.pm:359
STACK: 
Bio::Search::HSP::HSPI::matches /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/HSP/HSPI.pm:691
STACK: 
Bio::Search::SearchUtils::_adjust_contigs /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/SearchUtils.pm:489
STACK: 
Bio::Search::SearchUtils::tile_hsps /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/SearchUtils.pm:206
STACK: 
Bio::Search::Hit::GenericHit::start /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/Hit/GenericHit.pm:935
STACK: 
main::parse /home/users/roessner/workspace/GeneSimilarity/similarity_analysis.pl:82
STACK: /home/users/roessner/workspace/GeneSimilarity/similarity_analysis.pl:51
-----------------------------------------------------------

S: 635
E: 790
L: 2052

This is the BLASTN output I am parsing::

>LOC_Os11g37470.1 chr11_pseudomolecule_TIGR r_jap version0
            21623485-21621434 BestGuessTranscript
          Length = 2052

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 106/124 (85%), Gaps = 1/124 (0%)
 Strand = Plus / Plus

                                                                        
Query: 3191 tattaagcataattaatgtatcattagcacatgtagg-ttactgtagcatttaaggctaa 3249
            |||||||| |||||||| | ||||| ||||||||||| |||||||| || ||| ||||||
Sbjct: 635  tattaagcctaattaatctgtcattggcacatgtagggttactgtaacacttatggctaa 694

                                                                        
Query: 3250 tcatagagtaactagacttaaaagactcgtctcgcgattttcaaccaaactgtgtaatta 3309
            |||| || ||| |||||| |||||| || ||||||||||||||  ||||| ||| |||||
Sbjct: 695  tcatggactaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaatta 754

                
Query: 3310 gttt 3313
            ||||
Sbjct: 755  gttt 758



 Score = 48.1 bits (24), Expect = 0.002
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                        
Query: 2253 aaaaactaattacacaatttacctgtacatcgcgagatgaatcttttaagtttagttact 2312
            ||||||||||| |||  ||| | || | ||||||||||||||||||| ||| || ||| |
Sbjct: 760  aaaaactaattgcacggtttgcatgaaaatcgcgagatgaatcttttgagtctatttagt 701

                    
Query: 2313 ccatgatt 2320
            ||||||||
Sbjct: 700  ccatgatt 693



 Score = 44.1 bits (22), Expect = 0.038
 Identities = 76/94 (80%)
 Strand = Plus / Minus

                                                                        
Query: 1539 atgcatgtagtattaaatatagacgaaaataaaaactaattgcacagtttggtcgaaatt 1598
            ||||||| || |||||||||| |  |||  ||||||||||||||| |||||   |||| |
Sbjct: 790  atgcatggagcattaaatataaataaaatgaaaaactaattgcacggtttgcatgaaaat 731

                                              
Query: 1599 gtcgagacgaattttttgagtctagttaggccat 1632
              ||||| |||| ||||||||||| |||| ||||
Sbjct: 730  cgcgagatgaatcttttgagtctatttagtccat 697



 Score = 44.1 bits (22), Expect = 0.038
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 2026 actaactagaattaaaagattcgtctcgtcatttacagacaaactgtgtaattagttttt 2085
            ||||| |||| | ||||||||| |||||  |||| ||  ||||| ||| |||||||||||
Sbjct: 701  actaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaattagttttt 760

                                          
Query: 2086 gttttcgtctatatttaatgcttcatgcat 2115
              |||  | ||||||||||||| |||||||
Sbjct: 761  cattttatttatatttaatgctccatgcat 790






From cjfields at uiuc.edu  Wed Sep 12 10:57:22 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 12 Sep 2007 09:57:22 -0500
Subject: [Bioperl-l] bug in Bio::SearchIO?
In-Reply-To: <200709121044.11741.stephan.roessner@gsf.de>
References: <200709121044.11741.stephan.roessner@gsf.de>
Message-ID: <74CE1BB2-FCEB-43C3-B783-09706C7F55D8@uiuc.edu>

Try updating to bioperl from CVS.  I believe this issue was fixed but  
I don't believe it made the 1.5.2 release.

chris

On Sep 12, 2007, at 3:44 AM, Stephan Roessner wrote:

> Hi,
>
> I am parsing a BlastN output with Bio::SearchIO and getting an  
> error for some
> of the hits when retrieving the start and/or the end position with
> $hit->end('sbjct') , $hit->start('sbjct'). I want to filter for  
> hits which
> are are of equal length (~ > 0.9) to the query sequences.
>
> SearchIO is retrieving the right results, but throws an exemption,  
> in this
> case: MSG:Undefined sub-sequence (1633,760). Valid range = 693 -  
> 760 .....
>
> It seems to me valid range is parsed incorrectly, isn't it? Is this  
> a bug?
>
> Does anybody have a similar problem?
>
> see code, error, and blastn output below.
>
> thanks,
> Stephan
>
>
> Stephan Roessner
> MIPS/IBI Inst. for Bioinformatics
> GSF Research Center for Environment and Health
> Ingolst?dter Landstr. 1
> 85764 Neuherberg; Germany
> phone: +49 (0)89 3187 3583
> fax:       +49 (0)89 3187 3585
> email: stephan.roessner at gsf.de
>
>
> Here is the piece of code I am using:
>
> my $blast_report = new Bio::SearchIO ('-format'=>'blast',
>                                          '-file' => $source);
>   	
> while( my $result=$blast_report->next_result) {
> 		while( my $hit= $result->next_hit()) {
> 			print "Name: ".$hit->name."\n";
> 			print "S: ".$hit->start('sbjct')."\n";
> 			print "E: ".$hit->end('sbjct')."\n";
> 			print "L: ".$hit->length()."\n";
> 		}
>  	}
>
>
> Here's the message:
>
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: Undefined sub-sequence (1633,760). Valid range = 693 - 760
> STACK: Error::throw
> STACK:
> Bio::Root::Root::throw /usr/lib/perl5/vendor_perl/5.8.8/Bio/Root/ 
> Root.pm:359
> STACK:
> Bio::Search::HSP::HSPI::matches /usr/lib/perl5/vendor_perl/5.8.8/ 
> Bio/Search/HSP/HSPI.pm:691
> STACK:
> Bio::Search::SearchUtils::_adjust_contigs /usr/lib/perl5/ 
> vendor_perl/5.8.8/Bio/Search/SearchUtils.pm:489
> STACK:
> Bio::Search::SearchUtils::tile_hsps /usr/lib/perl5/vendor_perl/ 
> 5.8.8/Bio/Search/SearchUtils.pm:206
> STACK:
> Bio::Search::Hit::GenericHit::start /usr/lib/perl5/vendor_perl/ 
> 5.8.8/Bio/Search/Hit/GenericHit.pm:935
> STACK:
> main::parse /home/users/roessner/workspace/GeneSimilarity/ 
> similarity_analysis.pl:82
> STACK: /home/users/roessner/workspace/GeneSimilarity/ 
> similarity_analysis.pl:51
> -----------------------------------------------------------
>
> S: 635
> E: 790
> L: 2052
>
> This is the BLASTN output I am parsing::
>
>> LOC_Os11g37470.1 chr11_pseudomolecule_TIGR r_jap version0
>             21623485-21621434 BestGuessTranscript
>           Length = 2052
>
>  Score = 95.6 bits (48), Expect = 1e-17
>  Identities = 106/124 (85%), Gaps = 1/124 (0%)
>  Strand = Plus / Plus
>
>
> Query: 3191 tattaagcataattaatgtatcattagcacatgtagg- 
> ttactgtagcatttaaggctaa 3249
>             |||||||| |||||||| | ||||| ||||||||||| |||||||| || |||  
> ||||||
> Sbjct: 635   
> tattaagcctaattaatctgtcattggcacatgtagggttactgtaacacttatggctaa 694
>
>
> Query: 3250  
> tcatagagtaactagacttaaaagactcgtctcgcgattttcaaccaaactgtgtaatta 3309
>             |||| || ||| |||||| |||||| || ||||||||||||||  ||||| |||  
> |||||
> Sbjct: 695   
> tcatggactaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaatta 754
>
>
> Query: 3310 gttt 3313
>             ||||
> Sbjct: 755  gttt 758
>
>
>
>  Score = 48.1 bits (24), Expect = 0.002
>  Identities = 57/68 (83%)
>  Strand = Plus / Minus
>
>
> Query: 2253  
> aaaaactaattacacaatttacctgtacatcgcgagatgaatcttttaagtttagttact 2312
>             ||||||||||| |||  ||| | || | ||||||||||||||||||| ||| ||  
> ||| |
> Sbjct: 760   
> aaaaactaattgcacggtttgcatgaaaatcgcgagatgaatcttttgagtctatttagt 701
>
>
> Query: 2313 ccatgatt 2320
>             ||||||||
> Sbjct: 700  ccatgatt 693
>
>
>
>  Score = 44.1 bits (22), Expect = 0.038
>  Identities = 76/94 (80%)
>  Strand = Plus / Minus
>
>
> Query: 1539  
> atgcatgtagtattaaatatagacgaaaataaaaactaattgcacagtttggtcgaaatt 1598
>             ||||||| || |||||||||| |  |||  ||||||||||||||| |||||    
> |||| |
> Sbjct: 790   
> atgcatggagcattaaatataaataaaatgaaaaactaattgcacggtttgcatgaaaat 731
>
>
> Query: 1599 gtcgagacgaattttttgagtctagttaggccat 1632
>               ||||| |||| ||||||||||| |||| ||||
> Sbjct: 730  cgcgagatgaatcttttgagtctatttagtccat 697
>
>
>
>  Score = 44.1 bits (22), Expect = 0.038
>  Identities = 73/90 (81%)
>  Strand = Plus / Plus
>
>
> Query: 2026  
> actaactagaattaaaagattcgtctcgtcatttacagacaaactgtgtaattagttttt 2085
>             ||||| |||| | ||||||||| |||||  |||| ||  ||||| |||  
> |||||||||||
> Sbjct: 701   
> actaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaattagttttt 760
>
>
> Query: 2086 gttttcgtctatatttaatgcttcatgcat 2115
>               |||  | ||||||||||||| |||||||
> Sbjct: 761  cattttatttatatttaatgctccatgcat 790
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From n.haigh at sheffield.ac.uk  Wed Sep 12 12:34:26 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Wed, 12 Sep 2007 17:34:26 +0100
Subject: [Bioperl-l] Bio::Graphics transparent background
Message-ID: <46E81512.3090503@sheffield.ac.uk>

Is it possible to set the bg colour of glyphs and the panel background
to be transparent? If so, which output formats support transparency?

Cheers
Nath



From Kevin.M.Brown at asu.edu  Wed Sep 12 14:15:10 2007
From: Kevin.M.Brown at asu.edu (Kevin Brown)
Date: Wed, 12 Sep 2007 11:15:10 -0700
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <46E81512.3090503@sheffield.ac.uk>
References: <46E81512.3090503@sheffield.ac.uk>
Message-ID: <1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>

> Is it possible to set the bg colour of glyphs and the panel 
> background to be transparent? If so, which output formats 
> support transparency?

Not sure if you can, but SVG, PNG, Gif all support a transparent
background.


From bioperl-list at superfrink.net  Thu Sep 13 01:15:39 2007
From: bioperl-list at superfrink.net (bioperl-list at superfrink.net)
Date: Wed, 12 Sep 2007 23:15:39 -0600 (MDT)
Subject: [Bioperl-l]  Bio::Graphics transparent background
Message-ID: <Pine.LNX.4.64.0709122245450.8424@gurchecyrohssnyb.arg>

> Is it possible to set the bg colour of glyphs and the panel background
> to be transparent? If so, which output formats support transparency?

I had a look at the code and I don't believe it is possible.

You could produce a PNG file and knowing the red/green/blue values of the 
background colour run the following script to make an image with the bg 
colour transparent.

For example:
    ./make-transparent.pl 252 253 252 2004-11-22.png

will produce:  2004-11-22.png.new.png
with the RGB colour of (252, 253, 252) replaced with transparency.

Regards,
Chad


#!/usr/bin/perl -w
#
# file: make-transparent.pl
# purpose: make a single colour in a PNG file transparent
# author: chad c d clark
# $Id$

use strict;
use GD;

# -- subroutines -------------------------------------------------------
sub usage_message();


# -- main() ------------------------------------------------------------

if(scalar @ARGV < 4) {
     print usage_message();
     exit 1;
}

# get the colour and make sure it is valid
my @RGB = splice @ARGV, 0, 3;
for my $i (@RGB) {

     if ( ($i !~ /^[\d]+$/) or (255 < $i) ) {
 	print "Invalid colour '$i'.\n";
         print usage_message();
         exit 1;
     }
}
print "RGB: (@RGB)\n";

# process each file
FILE: while (my $filename = shift @ARGV) {

     # read the file
     my $image = GD::Image->new($filename);
     unless(defined $image) {
 	warn "Unable to read image from file.  Skipping '$filename'.\n";
 	next FILE;
     }

     # find the colour index
     my $index = $image->colorExact(@RGB);
     if(-1 == $index) {
 	warn "Colour not found in file.  Skipping '$filename'.\n";
 	next FILE;
     }

     # make the colour index transparent
     if(-1 == $image->transparent($index)) {
 	warn "Unable to make colour transparent.  Skipping '$filename'.\n";
 	next FILE;
     }

     # write the updated image file
     my $new_filename = $filename . ".new.png";
     # my $new_filename = $filename;  # use to over-write existing file
     open FH, ">" . $new_filename or die "can't open $new_filename";
     print FH $image->png;
     close FH;

     print "Found file '$filename'.\tCreated '$new_filename'.\n";
}

exit 0;


# -- subroutines -------------------------------------------------------

sub usage_message() {

return qq/
   Usage: $0 RED GREEN BLUE FILELIST

   Where:
       RED       - red   value in decimal (0 to 255)
       GREEN     - green value in decimal (0 to 255)
       BLUE      - blue  value in decimal (0 to 255)
       FILELIST  - list of files to convert

   Examples:
       $0 255 255 255 2004-11-22.png
       $0 252 253 252 2004-11-22.png second.png
       $0 1   1   200 2004-11-22.png second.png third.png

   Description:
   For each file "foo.png" a new file "foo.png.new.png" will be created (and
   over-written if it existed).  The new file will be the same as the original
   but the colour specified by the RED, GREEN, and BLUE value will be removed
   and replaced by transparent pixels.

/;
}

From n.haigh at sheffield.ac.uk  Thu Sep 13 06:07:46 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Thu, 13 Sep 2007 11:07:46 +0100
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
References: <46E81512.3090503@sheffield.ac.uk>
	<1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
Message-ID: <46E90BF2.5010607@sheffield.ac.uk>

Kevin Brown wrote:
>> Is it possible to set the bg colour of glyphs and the panel 
>> background to be transparent? If so, which output formats 
>> support transparency?
>>     
>
> Not sure if you can, but SVG, PNG, Gif all support a transparent
> background.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>   

Looking at the GD module documentation:
http://search.cpan.org/~lds/GD-2.30/GD.pm

It appears that you can set a colour as being transparent - so I think
it should be possible to get Bio::Graphics to do this = may require some
code to be written. Any one got ideas?

Cheers,
Nath

From n.haigh at sheffield.ac.uk  Thu Sep 13 07:59:20 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Thu, 13 Sep 2007 12:59:20 +0100
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <46E90BF2.5010607@sheffield.ac.uk>
References: <46E81512.3090503@sheffield.ac.uk>	<1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
	<46E90BF2.5010607@sheffield.ac.uk>
Message-ID: <46E92618.7050208@sheffield.ac.uk>

Nathan Haigh wrote:
> Kevin Brown wrote:
>   
>>> Is it possible to set the bg colour of glyphs and the panel 
>>> background to be transparent? If so, which output formats 
>>> support transparency?
>>>     
>>>       
>> Not sure if you can, but SVG, PNG, Gif all support a transparent
>> background.
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>   
>>     
>
> Looking at the GD module documentation:
> http://search.cpan.org/~lds/GD-2.30/GD.pm
>
> It appears that you can set a colour as being transparent - so I think
> it should be possible to get Bio::Graphics to do this = may require some
> code to be written. Any one got ideas?
>
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>   

I took a look and made a simple change to Bio::Graphics::Panel

Please see the following bug for a patch and explanation:
http://bugzilla.open-bio.org/show_bug.cgi?id=2365

I'd appreciate any comments, especially regarding the method name! If
there aren't any complaints I'll commit it later today.

Nath

From n.haigh at sheffield.ac.uk  Thu Sep 13 08:26:57 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Thu, 13 Sep 2007 13:26:57 +0100
Subject: [Bioperl-l] Bio::Graphics Resolution
Message-ID: <46E92C91.5020307@sheffield.ac.uk>

I want to be able to print my Bio::Graphics image on a poster with good
resolution. What can I do to ensure I don't get blocky graphics/text.

Altering the width/height of the panel simple increases the size of the
canvas on which to draw the image, but the text appears the same size
and thus relatively smaller to the rest of the image. So I don't think
this would work for printing on a poster.

Cheers,
Nath

From cjfields at uiuc.edu  Thu Sep 13 08:46:02 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 13 Sep 2007 07:46:02 -0500
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <69321A85-8715-43C0-BCB0-CEE8F42D7235@uiuc.edu>

Print to SVG instead of PNG (should be resolution-independent); I use  
Illustrator to fine-tune it but there are several other programs  
which can do the same.  You'll need to install GD::SVG for it to work.

The alignment example I posted previously about (http:// 
www.bioperl.org/wiki/HOWTO_Discussion:Graphics) shows essentially  
what you need to do:

my $panel = Bio::Graphics::Panel->new(
     -image_class => 'SVG',
     # and whatever else
);

# later...

print $panel->svg;

chris

On Sep 13, 2007, at 7:26 AM, Nathan Haigh wrote:

> I want to be able to print my Bio::Graphics image on a poster with  
> good
> resolution. What can I do to ensure I don't get blocky graphics/text.
>
> Altering the width/height of the panel simple increases the size of  
> the
> canvas on which to draw the image, but the text appears the same size
> and thus relatively smaller to the rest of the image. So I don't think
> this would work for printing on a poster.
>
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From jonathancrabtree at gmail.com  Thu Sep 13 09:09:56 2007
From: jonathancrabtree at gmail.com (Jonathan Crabtree)
Date: Thu, 13 Sep 2007 09:09:56 -0400
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <46E92618.7050208@sheffield.ac.uk>
References: <46E81512.3090503@sheffield.ac.uk>
	<1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
	<46E90BF2.5010607@sheffield.ac.uk> <46E92618.7050208@sheffield.ac.uk>
Message-ID: <8e5b8bf80709130609x4be19cf6y60f2440a1ac5d332@mail.gmail.com>

Hi Nathan-

One problem with your proposed solution is that it won't necessarily work
when GD::SVG is being used instead of GD (i.e., via the image_class method
of Bio::Graphics::Panel).  SVG doesn't handle transparency in the same way
as GD.  At least when you're compositing multiple SVG images/documents,
transparency is the default; if you superimpose one SVG image on another (
e.g., by merging the two into a single SVG document) then the bottom image
will be visible through any area of the top image that has not been drawn
on.  When I'm working in SVG with Bio::Graphics I get a "transparent"
background by simply not setting the bgcolor; this ensures that
Bio::Graphics::Panel will refrain from drawing a filled background rectangle
underneath the drawing area.  What I don't know is how to ensure that the
background is transparent when you're working with the various methods of
embedding SVG in web pages ( i.e., transparent with respect to whatever is
_underneath_ the SVG-rendered content); this is probably a slightly
different issue that's more a question of what the browser/plugin supports.

I'm not sure what to suggest as an alternative, but at the very least this
probably warrants a YMMV comment in the documentation for the new method, or
perhaps it could even throw a runtime error if called when the $gd object is
of type GD::SVG.  A final option would be to say that this (setting a
transparent background) is something that should get handled outside of
Bio::Graphics::Panel; I don't think there's any technical reason why the
calling code couldn't be responsible for this.  I don't think we can modify
your new method to unset the bgcolor when working with GD::SVG, because that
might affect the image in other ways.  I do it in my code but I'm not sure
it's 100% safe, since I think GD::SVG might actually _use_ the bgcolor in
some situations (e.g., drawing dashed lines) and I haven't checked the code
thoroughly to make sure that there are no unintended consequences.

Jonathan

p.s. I see that Chris has beaten me to the punch in mentioning SVG as a fix
to your blocky font problems.  All the more reason to think about how this
feature will work in that context!


On 9/13/07, Nathan Haigh <n.haigh at sheffield.ac.uk > wrote:
>
> Nathan Haigh wrote:
> > Kevin Brown wrote:
> >
> >>> Is it possible to set the bg colour of glyphs and the panel
> >>> background to be transparent? If so, which output formats
> >>> support transparency?
> >>>
> >>>
> >> Not sure if you can, but SVG, PNG, Gif all support a transparent
> >> background.
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>
> >>
> >
> > Looking at the GD module documentation:
> > http://search.cpan.org/~lds/GD-2.30/GD.pm
> <http://search.cpan.org/%7Elds/GD-2.30/GD.pm>
> >
> > It appears that you can set a colour as being transparent - so I think
> > it should be possible to get Bio::Graphics to do this = may require some
> > code to be written. Any one got ideas?
> >
> > Cheers,
> > Nath
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
>
> I took a look and made a simple change to Bio::Graphics::Panel
>
> Please see the following bug for a patch and explanation:
> http://bugzilla.open-bio.org/show_bug.cgi?id=2365
>
> I'd appreciate any comments, especially regarding the method name! If
> there aren't any complaints I'll commit it later today.
>
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From bix at sendu.me.uk  Thu Sep 13 09:03:46 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 13 Sep 2007 14:03:46 +0100
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <46E93532.6030505@sendu.me.uk>

Nathan Haigh wrote:
> I want to be able to print my Bio::Graphics image on a poster with good
> resolution. What can I do to ensure I don't get blocky graphics/text.

Output in SVG, which is a vector format == no blockiness.

From jonathancrabtree at gmail.com  Thu Sep 13 09:20:43 2007
From: jonathancrabtree at gmail.com (Jonathan Crabtree)
Date: Thu, 13 Sep 2007 09:20:43 -0400
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <8e5b8bf80709130620r4a24fe8fi5171539f50735bf3@mail.gmail.com>

Nathan-

As Chris said, you'll want to use GD::SVG instead of GD.  However, you're
still going to have the issue that you raised that the fonts will be
proportionally small with respect to your figure (particularly if you're
printing a large region at poster size.)  From what I remember GD only gives
you a few font sizes to choose from, so even at the largest size you may
still have problems.  I've worked around this in the past by using scripts
to post-process the resulting SVG.  I do a global search and replace to
increase the font sizes (and, in many cases, to adjust the y-offset of the
text accordingly.)  You may also need to tweak the amount of vertical
whitespace in the image (e.g., between adjacent rows of features) to give
yourself space to increase the font size.  The same caveat applies to the
horizontal dimension, since with a larger font you may have collisions
between labels (assuming that the features in your figure are labeled.)  To
fix this you need to trick Bio::Graphics into thinking the feature labels
are longer than they actually are.  I forget whether I did this by padding
the labels with extra whitespace or actually modifying the code that
computes the feature bounding boxes, but something along those lines should
work.  Essentially you have to trick Bio::Graphics into leaving extra
whitespace so that everything looks OK when you bump up the font sizes.
Unfortunately I don't have a generic script that does this; after generating
a couple of posters this way I switched to direct SVG generation to avoid
the constraints imposed by going through GD.

Jonathan


On 9/13/07, Nathan Haigh <n.haigh at sheffield.ac.uk> wrote:
>
> I want to be able to print my Bio::Graphics image on a poster with good
> resolution. What can I do to ensure I don't get blocky graphics/text.
>
> Altering the width/height of the panel simple increases the size of the
> canvas on which to draw the image, but the text appears the same size
> and thus relatively smaller to the rest of the image. So I don't think
> this would work for printing on a poster.
>
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From arareko at campus.iztacala.unam.mx  Thu Sep 13 10:59:31 2007
From: arareko at campus.iztacala.unam.mx (Mauricio Herrera Cuadra)
Date: Thu, 13 Sep 2007 09:59:31 -0500
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <46E95053.8090300@campus.iztacala.unam.mx>

Try saving the output of your Bio::Graphics image as SVG (with the 
desired proportions between text & graphics), then, at the moment of 
printing, set the desired output size (from the SVG file) and everything 
should be scaled accordingly. That can probably work.

Cheers,
Mauricio.

Nathan Haigh wrote:
> I want to be able to print my Bio::Graphics image on a poster with good
> resolution. What can I do to ensure I don't get blocky graphics/text.
> 
> Altering the width/height of the panel simple increases the size of the
> canvas on which to draw the image, but the text appears the same size
> and thus relatively smaller to the rest of the image. So I don't think
> this would work for printing on a poster.
> 
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 

-- 
MAURICIO HERRERA CUADRA
arareko at campus.iztacala.unam.mx
Laboratorio de Gen?tica
Unidad de Morfofisiolog?a y Funci?n
Facultad de Estudios Superiores Iztacala, UNAM


From jay at jays.net  Fri Sep 14 10:27:38 2007
From: jay at jays.net (Jay Hannah)
Date: Fri, 14 Sep 2007 09:27:38 -0500
Subject: [Bioperl-l] [patch] getGenBank.pl
Message-ID: <1088BA7F-009A-482E-B15E-80D4D59218BE@jays.net>

http://cvs.bioperl.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/ 
examples/db/getGenBank.pl

Using this:
my $seqio = $gb->get_Stream_by_batch([ qw( 124430577 )]);

Throws this warning:
$ ./fetch.pl > 124430577.gbk
get_Stream_by_batch() is deprecated; use get_Stream_by_id() instead
STACK Bio::DB::NCBIHelper::__ANON__ /usr/lib/perl5/Bio/DB/ 
NCBIHelper.pm:261
STACK toplevel ./fetch.pl:17


Can someone with commit access please change getGenBank.pl?

24,25c24,25
< # if you want to get a bunch of sequences use the batch method
< my $seqio = $gb->get_Stream_by_batch([ qw(J00522 AF303112 2981014)]);
---
 > # feel free to pull multiple sequences
 > my $seqio = $gb->get_Stream_by_id([ qw(J00522 AF303112 2981014)]);


The tweaked version works fine for me and the warning goes away.

Thanks,

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah



From cjfields at uiuc.edu  Fri Sep 14 12:36:56 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 14 Sep 2007 11:36:56 -0500
Subject: [Bioperl-l] [patch] getGenBank.pl
In-Reply-To: <1088BA7F-009A-482E-B15E-80D4D59218BE@jays.net>
References: <1088BA7F-009A-482E-B15E-80D4D59218BE@jays.net>
Message-ID: <5255407E-F19E-45B6-9F66-3DC1AB25C0AC@uiuc.edu>

Done.  Thanks for the heads up!

chris

On Sep 14, 2007, at 9:27 AM, Jay Hannah wrote:

> http://cvs.bioperl.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/
> examples/db/getGenBank.pl
>
> Using this:
> my $seqio = $gb->get_Stream_by_batch([ qw( 124430577 )]);
>
> Throws this warning:
> $ ./fetch.pl > 124430577.gbk
> get_Stream_by_batch() is deprecated; use get_Stream_by_id() instead
> STACK Bio::DB::NCBIHelper::__ANON__ /usr/lib/perl5/Bio/DB/
> NCBIHelper.pm:261
> STACK toplevel ./fetch.pl:17
>
>
> Can someone with commit access please change getGenBank.pl?
>
> 24,25c24,25
> < # if you want to get a bunch of sequences use the batch method
> < my $seqio = $gb->get_Stream_by_batch([ qw(J00522 AF303112  
> 2981014)]);
> ---
>> # feel free to pull multiple sequences
>> my $seqio = $gb->get_Stream_by_id([ qw(J00522 AF303112 2981014)]);
>
>
> The tweaked version works fine for me and the warning goes away.
>
> Thanks,
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From MEC at stowers-institute.org  Mon Sep 17 16:15:39 2007
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Mon, 17 Sep 2007 15:15:39 -0500
Subject: [Bioperl-l] Bioperl -- why so old? ... or ...
	Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
Message-ID: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>

Sometime ago, in the ensembl-dev mailing list, mdr wrote:

> > I'm always running into bugs in bioperl that have been fixed in more
recent
> > versions than the version 1-2-3 that the installation document
specifies.  
> > 
> > Just wondering, are there plans to try to move to 1-5 any time soon,
or is that
> > not possible for some reason?  Or, by any chance, is Ensembl
actually compatible
> > with 1-5 and it's just a documentation issue?
> 
> "Ewan Birney" replied
> Ensembl doesn't make heavy use of Bioperl anymore - most of the
critical things
> we re-wrote, mainly due to speed/memory issues. I think the short
answer is that
> it _probably_ works with 1.5, but we don't have a strong desire to
move up
> as certainly there are no problems with the 1.2.3 release we are
using.

FWIW, I have just discovered that the round of bioperl changes in
service of http://www.bioperl.org/wiki/Feature_Annotation_rollback
introduce (additional?) incompatibilities between current bioperl and
the Ensembl Core API.  The changes bring me to obtain and use Bioperl
version 1.2.3 for use in conjunction with Ensemble API application (as
is recommended by Ensembl).

Until now, the ways I have used the Ensembl API appear not to have
been effected by changes in Bioperl; I have successfully used it
in conjunction with the bioperl's leading edge.  Of course there may be
other incompatibilities that I have just not noticed yet.

Evidence of the new incompatibility is present in this back trace,
which bridges between code in current bioperl-live and current
ensembl/modules/Bio:

-------------------- EXCEPTION --------------------
MSG: Operator overloading of AnnotationI is deprecated
STACK Bio::Annotation::DBLink::__ANON__
/home/mec/cvs/bioperl-live/Bio/Annotation/DBLink.pm:59
STACK Bio::EnsEMBL::DBSQL::DBEntryAdaptor::_fetch_by_object_type
/home/mec/cvs/foo/ensembl/modules/Bio/EnsEMBL/DBSQL/DBEntryAdaptor.pm:77
8


Obtaining version 1.2.3 fixes the issue for me.  

This is just a warning to others....

Your milage may vary....

--

Malcolm Cook
Stowers Institute for Medical Research - Kansas City, Missouri
 


From cjfields at uiuc.edu  Mon Sep 17 17:52:55 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 17 Sep 2007 16:52:55 -0500
Subject: [Bioperl-l] Bioperl -- why so old? ... or ...
	Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
In-Reply-To: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>
References: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>
Message-ID: <1CAA1977-45AE-4A8F-815C-4C726DB0E6E4@uiuc.edu>

Malcolm,

I have removed the Bio::Annotation overloading exceptions from  
bioperl-live; they're just more trouble than they're worth right  
now.  Could you try it out and see if that suffices, and drop us a  
note if it doesn't or if you run into other odd issues?  I'll be busy  
until the end of the month but I'll do the best I can to help out.

The rollbacks were fairly simple and essentially reversed, corrected,  
or simplified many changes made prior to the 1.5 release (most of  
which were undocumented and not completely implemented).  They pass  
all current tests and should make BioPerl classes (particularly  
Annotations and SeqFeatures) behave more like 1.4.  Beyond the now- 
removed exceptions it should be fine unless it is in an area of  
already-known incompatibility between BioPerl and Ensembl, some of  
which you've already outlined.

chris

On Sep 17, 2007, at 3:15 PM, Cook, Malcolm wrote:

> ...
> FWIW, I have just discovered that the round of bioperl changes in
> service of http://www.bioperl.org/wiki/Feature_Annotation_rollback
> introduce (additional?) incompatibilities between current bioperl and
> the Ensembl Core API.  The changes bring me to obtain and use Bioperl
> version 1.2.3 for use in conjunction with Ensemble API application (as
> is recommended by Ensembl).
>
> Until now, the ways I have used the Ensembl API appear not to have
> been effected by changes in Bioperl; I have successfully used it
> in conjunction with the bioperl's leading edge.  Of course there  
> may be
> other incompatibilities that I have just not noticed yet.
>
> Evidence of the new incompatibility is present in this back trace,
> which bridges between code in current bioperl-live and current
> ensembl/modules/Bio:
>
> -------------------- EXCEPTION --------------------
> MSG: Operator overloading of AnnotationI is deprecated
> STACK Bio::Annotation::DBLink::__ANON__
> /home/mec/cvs/bioperl-live/Bio/Annotation/DBLink.pm:59
> STACK Bio::EnsEMBL::DBSQL::DBEntryAdaptor::_fetch_by_object_type
> /home/mec/cvs/foo/ensembl/modules/Bio/EnsEMBL/DBSQL/ 
> DBEntryAdaptor.pm:77
> 8
>
>
> Obtaining version 1.2.3 fixes the issue for me.
>
> This is just a warning to others....
>
> Your milage may vary....
>
> --
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri



From MEC at stowers-institute.org  Mon Sep 17 18:14:41 2007
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Mon, 17 Sep 2007 17:14:41 -0500
Subject: [Bioperl-l] Bioperl -- why so old? ... or ...
	Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
In-Reply-To: <1CAA1977-45AE-4A8F-815C-4C726DB0E6E4@uiuc.edu>
References: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>
	<1CAA1977-45AE-4A8F-815C-4C726DB0E6E4@uiuc.edu>
Message-ID: <CED81D34E37D5043A1211565277A51E509514EB3@exchkc02.stowers-institute.org>

Chris,

Removing those exceptions makes my application work with current
bioperl-live again.  Hooray!  Thanks.

But!  I have been warned!

Regards,

Malcolm Cook
Stowers Institute for Medical Research - Kansas City, Missouri
  

> -----Original Message-----
> From: Chris Fields [mailto:cjfields at uiuc.edu] 
> Sent: Monday, September 17, 2007 4:53 PM
> To: Cook, Malcolm
> Cc: bioperl list; ensembl-dev at ebi.ac.uk
> Subject: Re: [Bioperl-l] Bioperl -- why so old? ... or ... 
> Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
> 
> Malcolm,
> 
> I have removed the Bio::Annotation overloading exceptions 
> from bioperl-live; they're just more trouble than they're 
> worth right now.  Could you try it out and see if that 
> suffices, and drop us a note if it doesn't or if you run into 
> other odd issues?  I'll be busy until the end of the month 
> but I'll do the best I can to help out.
> 
> The rollbacks were fairly simple and essentially reversed, 
> corrected, or simplified many changes made prior to the 1.5 
> release (most of which were undocumented and not completely 
> implemented).  T