From cjfields at uiuc.edu  Sun Sep  2 19:54:54 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 2 Sep 2007 18:54:54 -0500
Subject: [Bioperl-l] (no subject)
Message-ID: <CA6A55BB-BB63-4FCE-A0AA-FBB2392C778F@uiuc.edu>

Posted this to biosql-l already but felt it needed posting here as  
well.  Sorry if you get this twice.

I noticed some critical recursion issues with bioperl-db when working  
in Bio::Ontology changes.  This was using bioperl-live (post-feature/ 
annotation fixes).  Bug report is here:

http://bugzilla.open-bio.org/show_bug.cgi?id=2355

It seems to be Bio:Taxon related; this is from 03swiss.t:

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:681
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:692
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
...
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:587
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:253
STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
PrimarySeqAdaptor.pm:229
STACK Bio::DB::BioSQL::SeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
SeqAdaptor.pm:217
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:214
STACK Bio::DB::Persistent::PersistentObject::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/Persistent/ 
PersistentObject.pm:244
STACK toplevel t/04swiss.t:36
---------------------------------------------------

Also, seeing this with 13remove.t and 15.cluster.t, both of which  
appear to infinitely recurse:

Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 587, <GEN0> line 1.
Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 630, <GEN0> line 1.


chris


From cjfields at uiuc.edu  Sun Sep  2 19:57:59 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 2 Sep 2007 18:57:59 -0500
Subject: [Bioperl-l] recursion issues with bioperl-db
Message-ID: <2E14450C-C135-42DD-A9DE-EB47EB80E6AC@uiuc.edu>

Apologies if you get this more than once; the first post appeared to  
get sent w/o a proper subject line.  Posted this to biosql-l already  
but felt it needed posting here as well.

I noticed some critical recursion issues with bioperl-db when working  
in Bio::Ontology changes.  This was using bioperl-live (post-feature/ 
annotation fixes).  Bug report is here:

http://bugzilla.open-bio.org/show_bug.cgi?id=2355

It seems to be Bio:Taxon related; this is from 03swiss.t:

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:681
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:692
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
...
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:587
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:253
STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
PrimarySeqAdaptor.pm:229
STACK Bio::DB::BioSQL::SeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
SeqAdaptor.pm:217
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:214
STACK Bio::DB::Persistent::PersistentObject::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/Persistent/ 
PersistentObject.pm:244
STACK toplevel t/04swiss.t:36
---------------------------------------------------

Also, seeing this with 13remove.t and 15.cluster.t, both of which  
appear to infinitely recurse:

Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 587, <GEN0> line 1.
Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 630, <GEN0> line 1.


chris


From cjfields at uiuc.edu  Sun Sep  2 21:40:48 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 2 Sep 2007 20:40:48 -0500
Subject: [Bioperl-l] recursion issues with bioperl-db
In-Reply-To: <2E14450C-C135-42DD-A9DE-EB47EB80E6AC@uiuc.edu>
References: <2E14450C-C135-42DD-A9DE-EB47EB80E6AC@uiuc.edu>
Message-ID: <25CFD36D-D921-4F5F-BADF-D858A2FE76D4@uiuc.edu>

Okay, we can the previous posts!  Odd, but I started from scratch and  
can't reproduce the issue; there may have been some cross-talk with  
different bioperl installations on my laptop.  Anyway, everything  
passes now w/o recursion so I'll mark the bug as invalid.

chris

On Sep 2, 2007, at 6:57 PM, Chris Fields wrote:

> Apologies if you get this more than once; the first post appeared to
> get sent w/o a proper subject line.  Posted this to biosql-l already
> but felt it needed posting here as well.
>
> I noticed some critical recursion issues with bioperl-db when working
> in Bio::Ontology changes.  This was using bioperl-live (post-feature/
> annotation fixes).  Bug report is here:
>
> http://bugzilla.open-bio.org/show_bug.cgi?id=2355
>
> It seems to be Bio:Taxon related; this is from 03swiss.t:
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:681
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:630
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:692
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:630
> ...
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:587
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:253
> STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> PrimarySeqAdaptor.pm:229
> STACK Bio::DB::BioSQL::SeqAdaptor::store_children
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> SeqAdaptor.pm:217
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:214
> STACK Bio::DB::Persistent::PersistentObject::create
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/Persistent/
> PersistentObject.pm:244
> STACK toplevel t/04swiss.t:36
> ---------------------------------------------------
>
> Also, seeing this with 13remove.t and 15.cluster.t, both of which
> appear to infinitely recurse:
>
> Deep recursion on subroutine
> "Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent" at
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm
> line 587, <GEN0> line 1.
> Deep recursion on subroutine
> "Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child" at
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm
> line 630, <GEN0> line 1.
>
>
> chris
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From bernd.web at gmail.com  Mon Sep  3 08:43:26 2007
From: bernd.web at gmail.com (Bernd Web)
Date: Mon, 3 Sep 2007 14:43:26 +0200
Subject: [Bioperl-l] Fh::flush warning
Message-ID: <716af09c0709030543w79f83368gf0ac74d220a96f8c@mail.gmail.com>

Hi,

Sometimes with Bio::SimpleAlign/AlignIO, I get the following warning:
(in cleanup) Undefined subroutine Fh::flush, at
/lib/perl/Bio/Root/IO.pm line 541.

This occurs in a rather large script and have not been able to isolate
a small example where I also get this warning. Does someone know more
about this warning and why it is thrown?

Regards,
Bernd

From cjfields at uiuc.edu  Mon Sep  3 10:41:49 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 3 Sep 2007 09:41:49 -0500
Subject: [Bioperl-l] Fh::flush warning
In-Reply-To: <716af09c0709030543w79f83368gf0ac74d220a96f8c@mail.gmail.com>
References: <716af09c0709030543w79f83368gf0ac74d220a96f8c@mail.gmail.com>
Message-ID: <98A9D081-2570-4D4E-A8F8-D03282D41E0C@uiuc.edu>

Could you give a bit more info (bioperl version, OS, etc)?

I'm guessing a recent version as the error coincides with a call to  
flush() in Root::IO (which is probably called indirectly via DESTROY)  
and that you're probably using a tied filehandle somewhere for  
output, e.g. Bio::AlignIO::newFh() or Bio::AlignIO::fh(), so knowing  
the input/output formats could help.

chris

On Sep 3, 2007, at 7:43 AM, Bernd Web wrote:

> Hi,
>
> Sometimes with Bio::SimpleAlign/AlignIO, I get the following warning:
> (in cleanup) Undefined subroutine Fh::flush, at
> /lib/perl/Bio/Root/IO.pm line 541.
>
> This occurs in a rather large script and have not been able to isolate
> a small example where I also get this warning. Does someone know more
> about this warning and why it is thrown?
>
> Regards,
> Bernd
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From xianranli78 at yahoo.com.cn  Mon Sep  3 22:11:09 2007
From: xianranli78 at yahoo.com.cn (xianran li)
Date: Tue, 4 Sep 2007 10:11:09 +0800 (CST)
Subject: [Bioperl-l] question about Bio::DB::GFF
Message-ID: <361239.6752.qm@web15309.mail.cnb.yahoo.com>

 
  Hi,
   
  I tried to load the  gff3 file with load_gff.pl and extrac some information with Bio::DB::GFF. Althougth this code work properly under windows xp, the $seg got nothing when i run it under Linux. 
   
  Here is my code and the gff3 file,
  ####################################################################
   
    #!/usr/local/bin/perl -w
   
  use strict;
use Bio::SeqIO;
use Bio::DB::GFF; 
   
  my $in_gff = Bio::DB::GFF->new( -adaptor    => 'dbi::mysqlopt',
                                -dsn        => 'dbi:mysql:test',
                                -aggregator => ['coding'],
                                -user       => "lixr",
                                -pass       => "123456"
                                );                           
my $seg = $in_gff->segment'BGIOSIBCE000001.1');
print $seg->abs_start."\n"; 


  ##################################################################
  ##gff-version 3 
##sequence-region       Chr01   1       43037
Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1
Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
Chr01 bgf CDS 19344 20165 . + 0 Parent=BGIOSIBCE000001.1
Chr01 bgf mRNA 30220 36442 . + . ID=BGIOSIBCE000002.1
Chr01 bgf CDS 30220 30387 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 31128 31226 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 32228 32331 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 33907 34715 . + 1 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 34799 34921 . + 2 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 35003 35091 . + 2 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 35179 35379 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 35981 36442 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf mRNA 38143 39015 . - . ID=BGIOSIBCE000003.1
Chr01 bgf CDS 38143 38541 . - 0 Parent=BGIOSIBCE000003.1
Chr01 bgf CDS 38649 38813 . - 0 Parent=BGIOSIBCE000003.1
Chr01 bgf CDS 38917 39015 . - 0 Parent=BGIOSIBCE000003.1
Chr01 bgf mRNA 39545 42080 . + . ID=BGIOSIBCE000004.1
Chr01 bgf CDS 39545 40584 . + 0 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 40677 41042 . + 1 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 41130 41208 . + 1 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 41740 41920 . + 0 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 42037 42080 . + 2 Parent=BGIOSIBCE000004.1
  #################################################################
   
   
  I would appreaciate if any one can give me some clues/link to accomplish this. 
   
  thanks in advance ,

  Xianran Li

       
---------------------------------
???????????????????????????????????????????? 

From cjfields at uiuc.edu  Tue Sep  4 00:04:29 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 3 Sep 2007 23:04:29 -0500
Subject: [Bioperl-l] question about Bio::DB::GFF
In-Reply-To: <361239.6752.qm@web15309.mail.cnb.yahoo.com>
References: <361239.6752.qm@web15309.mail.cnb.yahoo.com>
Message-ID: <37BE6493-B49B-47DF-8047-37D616B669A8@uiuc.edu>

Not sure if the gff3 you show was modified for demonstration here but  
it should always be tab-delimited.  Also, I have had problems myself  
when using files with Windows/Mac Classic line endings on UNIX'y  
systems (Excel and a few other Mac OS X programs insist on adding \r  
instead of \n, which plays havoc with parsers sometimes even with  
readline fixes).

chris

On Sep 3, 2007, at 9:11 PM, xianran li wrote:

>
>   Hi,
>
>   I tried to load the  gff3 file with load_gff.pl and extrac some  
> information with Bio::DB::GFF. Althougth this code work properly  
> under windows xp, the $seg got nothing when i run it under Linux.
>
>   Here is my code and the gff3 file,
>   ####################################################################
>
>     #!/usr/local/bin/perl -w
>
>   use strict;
> use Bio::SeqIO;
> use Bio::DB::GFF;
>
>   my $in_gff = Bio::DB::GFF->new( -adaptor    => 'dbi::mysqlopt',
>                                 -dsn        => 'dbi:mysql:test',
>                                 -aggregator => ['coding'],
>                                 -user       => "lixr",
>                                 -pass       => "123456"
>                                 );
> my $seg = $in_gff->segment'BGIOSIBCE000001.1');
> print $seg->abs_start."\n";
>
>
>   ##################################################################
>   ##gff-version 3
> ##sequence-region       Chr01   1       43037
> Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1
> Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf CDS 19344 20165 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf mRNA 30220 36442 . + . ID=BGIOSIBCE000002.1
> Chr01 bgf CDS 30220 30387 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 31128 31226 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 32228 32331 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 33907 34715 . + 1 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 34799 34921 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35003 35091 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35179 35379 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35981 36442 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf mRNA 38143 39015 . - . ID=BGIOSIBCE000003.1
> Chr01 bgf CDS 38143 38541 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38649 38813 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38917 39015 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf mRNA 39545 42080 . + . ID=BGIOSIBCE000004.1
> Chr01 bgf CDS 39545 40584 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 40677 41042 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41130 41208 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41740 41920 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 42037 42080 . + 2 Parent=BGIOSIBCE000004.1
>   #################################################################
>
>
>   I would appreaciate if any one can give me some clues/link to  
> accomplish this.
>
>   thanks in advance ,
>
>   Xianran Li
>
>
> ---------------------------------
> ??????????????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From xianranli78 at yahoo.com.cn  Tue Sep  4 00:58:48 2007
From: xianranli78 at yahoo.com.cn (xianran li)
Date: Tue, 4 Sep 2007 12:58:48 +0800 (CST)
Subject: [Bioperl-l]
 =?gb2312?q?=BB=D8=B8=B4=A3=BA=20Re:=20=20question=20about=20Bi?=
 =?gb2312?q?o::DB::GFF?=
In-Reply-To: <37BE6493-B49B-47DF-8047-37D616B669A8@uiuc.edu>
Message-ID: <866169.66154.qm@web15309.mail.cnb.yahoo.com>

Hi, everybody,
   
  It looks like for the different perl version(5.8.8 of  windows and 5.8.5 for linux). And I fixed this problem by adding ";Name=XXXX" after each line with "mRNA"
  ##############################################################################
  Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1;Name=BGIOSIBCE000001.1
Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
    ##############################################################################

  This time my code works properly.
   
  Xianran

Chris Fields <cjfields at uiuc.edu> ??????
  Not sure if the gff3 you show was modified for demonstration here but 
it should always be tab-delimited. Also, I have had problems myself 
when using files with Windows/Mac Classic line endings on UNIX'y 
systems (Excel and a few other Mac OS X programs insist on adding \r 
instead of \n, which plays havoc with parsers sometimes even with 
readline fixes).

chris

On Sep 3, 2007, at 9:11 PM, xianran li wrote:

>
> Hi,
>
> I tried to load the gff3 file with load_gff.pl and extrac some 
> information with Bio::DB::GFF. Althougth this code work properly 
> under windows xp, the $seg got nothing when i run it under Linux.
>
> Here is my code and the gff3 file,
> ####################################################################
>
> #!/usr/local/bin/perl -w
>
> use strict;
> use Bio::SeqIO;
> use Bio::DB::GFF;
>
> my $in_gff = Bio::DB::GFF->new( -adaptor => 'dbi::mysqlopt',
> -dsn => 'dbi:mysql:test',
> -aggregator => ['coding'],
> -user => "lixr",
> -pass => "123456"
> );
> my $seg = $in_gff->segment'BGIOSIBCE000001.1');
> print $seg->abs_start."\n";
>
>
> ##################################################################
> ##gff-version 3
> ##sequence-region Chr01 1 43037
> Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1
> Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf CDS 19344 20165 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf mRNA 30220 36442 . + . ID=BGIOSIBCE000002.1
> Chr01 bgf CDS 30220 30387 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 31128 31226 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 32228 32331 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 33907 34715 . + 1 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 34799 34921 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35003 35091 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35179 35379 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35981 36442 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf mRNA 38143 39015 . - . ID=BGIOSIBCE000003.1
> Chr01 bgf CDS 38143 38541 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38649 38813 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38917 39015 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf mRNA 39545 42080 . + . ID=BGIOSIBCE000004.1
> Chr01 bgf CDS 39545 40584 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 40677 41042 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41130 41208 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41740 41920 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 42037 42080 . + 2 Parent=BGIOSIBCE000004.1
> #################################################################
>
>
> I would appreaciate if any one can give me some clues/link to 
> accomplish this.
>
> thanks in advance ,
>
> Xianran Li
>
>
> ---------------------------------
> ????????????????????????????????????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





       
---------------------------------
 ????????????????????????????????

From jay at jays.net  Tue Sep  4 10:31:36 2007
From: jay at jays.net (Jay Hannah)
Date: Tue, 4 Sep 2007 09:31:36 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
Message-ID: <96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>

On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> Probably a bit of a long shot but does anyone have code for
> displaying protein or CDS multiple sequence alignments with the exon
> boundaries of each gene in the alignment?
>
> Something in the bioperl world without funky external dependencies.  
> I think
> it would be an awesome addition to the howtos.
>
> Currently, the Bio::Graphics howto has cdna to genome mapping  
> scripts or
> blast output scripts, but
> I couldn't find code for dealing with multiple sequence alignments.

I'm currently under the (potentially uninformed) impression that  
Bio::Graphics and related tools only work with a single  coordinate  
system. I've never seen a multiple sequence alignment example.

(
   I Google'd for "gbrowse alignment" and hit this:
   http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi

   Click the second Example link and you'll see exons mapped out.

   But zooming all the way in with all the tracks turned on it looks  
like the AZM tracks are just the coding regions. I don't see any  
multiple sequence alignment...
)

I doubt that helped.  :)

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah



From cjfields at uiuc.edu  Tue Sep  4 11:28:01 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 4 Sep 2007 10:28:01 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
Message-ID: <59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>


On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:

> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>> Probably a bit of a long shot but does anyone have code for
>> displaying protein or CDS multiple sequence alignments with the exon
>> boundaries of each gene in the alignment?
>>
>> Something in the bioperl world without funky external dependencies.
>> I think
>> it would be an awesome addition to the howtos.
>>
>> Currently, the Bio::Graphics howto has cdna to genome mapping
>> scripts or
>> blast output scripts, but
>> I couldn't find code for dealing with multiple sequence alignments.
>
> I'm currently under the (potentially uninformed) impression that
> Bio::Graphics and related tools only work with a single  coordinate
> system. I've never seen a multiple sequence alignment example.
>
> (
>    I Google'd for "gbrowse alignment" and hit this:
>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>
>    Click the second Example link and you'll see exons mapped out.
>
>    But zooming all the way in with all the tracks turned on it looks
> like the AZM tracks are just the coding regions. I don't see any
> multiple sequence alignment...
> )
>
> I doubt that helped.  :)
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:

http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
Browser/docs/tutorial/tutorial.html

chris


From avilella at gmail.com  Wed Sep  5 05:42:37 2007
From: avilella at gmail.com (Albert Vilella)
Date: Wed, 5 Sep 2007 11:42:37 +0200
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
Message-ID: <358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>

A couple of examples:

http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041

treefam has exon boundary and PFAM domain mappings

http://www.ensembl.org/Homo_sapiens/genetreeview?gene=ENSG00000139618

here the tree is shown as well, but the idea would be to plot the alignment

So it's more "show me the multiple CDS/protein alignment" rather than "show
my aligned CDS/proteins wrt my reference genome"

I think it would be quite neat to have this as a bioperl howto,

Comments?

    Albert.

On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>
>
> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>
> > On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> >> Probably a bit of a long shot but does anyone have code for
> >> displaying protein or CDS multiple sequence alignments with the exon
> >> boundaries of each gene in the alignment?
> >>
> >> Something in the bioperl world without funky external dependencies.
> >> I think
> >> it would be an awesome addition to the howtos.
> >>
> >> Currently, the Bio::Graphics howto has cdna to genome mapping
> >> scripts or
> >> blast output scripts, but
> >> I couldn't find code for dealing with multiple sequence alignments.
> >
> > I'm currently under the (potentially uninformed) impression that
> > Bio::Graphics and related tools only work with a single  coordinate
> > system. I've never seen a multiple sequence alignment example.
> >
> > (
> >    I Google'd for "gbrowse alignment" and hit this:
> >    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
> >
> >    Click the second Example link and you'll see exons mapped out.
> >
> >    But zooming all the way in with all the tracks turned on it looks
> > like the AZM tracks are just the coding regions. I don't see any
> > multiple sequence alignment...
> > )
> >
> > I doubt that helped.  :)
> >
> > Jay Hannah
> > http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>
> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>
> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
> Browser/docs/tutorial/tutorial.html
>
> chris
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From alexl at users.sourceforge.net  Wed Sep  5 06:08:14 2007
From: alexl at users.sourceforge.net (Alex Lancaster)
Date: Wed, 05 Sep 2007 03:08:14 -0700
Subject: [Bioperl-l] Clarifying license of bioperl
In-Reply-To: <8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net> (Hilmar Lapp's
	message of "Sat\, 18 Aug 2007 12\:13\:28 -0400")
References: <cg3ayi39sn.fsf@allele2.localdomain>
	<nrsl6i1ub4.fsf@allele2.localdomain>
	<1A4207F8295607498283FE9E93B775B40390172E@EX02.asurite.ad.asu.edu>
	<n9ir7e18y2.fsf@allele2.localdomain>
	<3515AB25-9919-407B-93E9-352BC426AFA1@uiuc.edu>
	<8td4xlyt4h.fsf@allele2.localdomain>
	<8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net>
Message-ID: <s73axt5ss1.fsf@allele2.localdomain>

>>>>> "HL" == Hilmar Lapp  writes:

HL> On Aug 18, 2007, at 7:33 AM, Alex Lancaster wrote:

> I imagine the intent of the bioperl
>> contributors is that it should be under the same terms as Perl,
>> whatever that happens to be (which just happens to be GPL or
>> Artistic, which is fine).

HL> I fully agree.

>> A clarification to that effect would be useful.

HL> Agreed, too. Would you mind changing that language on the wiki,
HL> since you seem to have a fairly good grasp on the issue?

OK, I've updated the wiki in two places:

http://www.bioperl.org/wiki/Licensing_BioPerl

http://www.bioperl.org/wiki/FAQ#What_are_the_license_terms_for_BioPerl.3F

It would also be nice if the LICENSE and Build.PL files in CVS (so it
finds its way into the next release) were also updated to reflect the
dual-licensed status, currently they only mention the Artistic
license:

http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/LICENSE?rev=HEAD&content-type=text/vnd.viewcvs-markup

http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/Build.PL?rev=HEAD&content-type=text/vnd.viewcvs-markup

For Build.PL this is easy:

(e.g., license             => 'artistic', should be 
       license             => 'GPL or Artistic',)

Possible solutions for the LICENSE file include:

1) The GPL could be added to LICENSE file at the end (with a note at
   the top to indicate that GPL is also included);

2) LICENSE could be moved to LICENSE.Artistic and another file
   "LICENSE.GPL" added with the GPL (version 2+) conditions, and the
   contents of LICENSE would include a note about each license.

I don't have access to the bioperl CVS repository, so I can't make the
changes myself).  This would also apply to the Build.PL (and LICENSE
files if they are present) in bioperl-run and other modules.

Thanks,
Alex

From cjfields at uiuc.edu  Wed Sep  5 08:25:21 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 07:25:21 -0500
Subject: [Bioperl-l] Clarifying license of bioperl
In-Reply-To: <s73axt5ss1.fsf@allele2.localdomain>
References: <cg3ayi39sn.fsf@allele2.localdomain>
	<nrsl6i1ub4.fsf@allele2.localdomain>
	<1A4207F8295607498283FE9E93B775B40390172E@EX02.asurite.ad.asu.edu>
	<n9ir7e18y2.fsf@allele2.localdomain>
	<3515AB25-9919-407B-93E9-352BC426AFA1@uiuc.edu>
	<8td4xlyt4h.fsf@allele2.localdomain>
	<8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net>
	<s73axt5ss1.fsf@allele2.localdomain>
Message-ID: <EE93F2F5-A76B-40C6-8A95-3E1DDD3D8562@uiuc.edu>


On Sep 5, 2007, at 5:08 AM, Alex Lancaster wrote:
...
>
> OK, I've updated the wiki in two places:
>
> http://www.bioperl.org/wiki/Licensing_BioPerl
>
> http://www.bioperl.org/wiki/ 
> FAQ#What_are_the_license_terms_for_BioPerl.3F
>
> It would also be nice if the LICENSE and Build.PL files in CVS (so it
> finds its way into the next release) were also updated to reflect the
> dual-licensed status, currently they only mention the Artistic
> license:
>
> http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/LICENSE? 
> rev=HEAD&content-type=text/vnd.viewcvs-markup
>
> http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/Build.PL? 
> rev=HEAD&content-type=text/vnd.viewcvs-markup
>
> For Build.PL this is easy:
>
> (e.g., license             => 'artistic', should be
>        license             => 'GPL or Artistic',)
>
> Possible solutions for the LICENSE file include:
>
> 1) The GPL could be added to LICENSE file at the end (with a note at
>    the top to indicate that GPL is also included);
>
> 2) LICENSE could be moved to LICENSE.Artistic and another file
>    "LICENSE.GPL" added with the GPL (version 2+) conditions, and the
>    contents of LICENSE would include a note about each license.
>
> I don't have access to the bioperl CVS repository, so I can't make the
> changes myself).  This would also apply to the Build.PL (and LICENSE
> files if they are present) in bioperl-run and other modules.
>
> Thanks,
> Alex

Looks like Sendu has done that.  There have been recent troubling  
developments re: Artistic License:

http://use.perl.org/article.pl?sid=07/08/26/1541205&from=rss

but the case hasn't been conclusively decided yet.

chris

From bix at sendu.me.uk  Wed Sep  5 08:18:35 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Wed, 05 Sep 2007 13:18:35 +0100
Subject: [Bioperl-l] Clarifying license of bioperl
In-Reply-To: <s73axt5ss1.fsf@allele2.localdomain>
References: <cg3ayi39sn.fsf@allele2.localdomain>	<nrsl6i1ub4.fsf@allele2.localdomain>	<1A4207F8295607498283FE9E93B775B40390172E@EX02.asurite.ad.asu.edu>	<n9ir7e18y2.fsf@allele2.localdomain>	<3515AB25-9919-407B-93E9-352BC426AFA1@uiuc.edu>	<8td4xlyt4h.fsf@allele2.localdomain>	<8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net>
	<s73axt5ss1.fsf@allele2.localdomain>
Message-ID: <46DE9E9B.80107@sendu.me.uk>

Alex Lancaster wrote:
>>>>>> "HL" == Hilmar Lapp  writes:
> 
> HL> On Aug 18, 2007, at 7:33 AM, Alex Lancaster wrote:
> 
>>> I imagine the intent of the bioperl
>>> contributors is that it should be under the same terms as Perl,
>>> whatever that happens to be (which just happens to be GPL or
>>> Artistic, which is fine).
> 
> HL> I fully agree.
> 
>>> A clarification to that effect would be useful.
> 
> HL> Agreed, too. Would you mind changing that language on the wiki,
> HL> since you seem to have a fairly good grasp on the issue?
> 
> OK, I've updated the wiki in two places:
> 
> http://www.bioperl.org/wiki/Licensing_BioPerl
> 
> http://www.bioperl.org/wiki/FAQ#What_are_the_license_terms_for_BioPerl.3F

Thank you very much for that Alex.


> It would also be nice if the LICENSE and Build.PL files in CVS (so it
> finds its way into the next release) were also updated to reflect the
> dual-licensed status, currently they only mention the Artistic
> license:
[snip]
> For Build.PL this is easy:
> 
> (e.g., license             => 'artistic', should be 
>        license             => 'GPL or Artistic',)

As per the 'license' section of 
http://search.cpan.org/~kwilliams/Module-Build-0.2808/lib/Module/Build/API.pod, 
I've changed it to 'perl', which means Artistic or GPL.


> Possible solutions for the LICENSE file include:
> 
> 1) The GPL could be added to LICENSE file at the end (with a note at
>    the top to indicate that GPL is also included);

I took this approach, using your language for the explanation at the 
top, and including GPL 3.0 at the bottom.


I've made these changes for core (live), run, db and network.

Thanks again for your help and advice.

From cjfields at uiuc.edu  Wed Sep  5 08:53:25 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 07:53:25 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
Message-ID: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>

You mean something like this?

http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics

chris

On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:

> A couple of examples:
>
> http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
>
> treefam has exon boundary and PFAM domain mappings
>
> http://www.ensembl.org/Homo_sapiens/genetreeview?gene=ENSG00000139618
>
> here the tree is shown as well, but the idea would be to plot the  
> alignment
>
> So it's more "show me the multiple CDS/protein alignment" rather  
> than "show
> my aligned CDS/proteins wrt my reference genome"
>
> I think it would be quite neat to have this as a bioperl howto,
>
> Comments?
>
>     Albert.
>
> On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>
>>
>> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>>
>>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>>>> Probably a bit of a long shot but does anyone have code for
>>>> displaying protein or CDS multiple sequence alignments with the  
>>>> exon
>>>> boundaries of each gene in the alignment?
>>>>
>>>> Something in the bioperl world without funky external dependencies.
>>>> I think
>>>> it would be an awesome addition to the howtos.
>>>>
>>>> Currently, the Bio::Graphics howto has cdna to genome mapping
>>>> scripts or
>>>> blast output scripts, but
>>>> I couldn't find code for dealing with multiple sequence alignments.
>>>
>>> I'm currently under the (potentially uninformed) impression that
>>> Bio::Graphics and related tools only work with a single  coordinate
>>> system. I've never seen a multiple sequence alignment example.
>>>
>>> (
>>>    I Google'd for "gbrowse alignment" and hit this:
>>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>>>
>>>    Click the second Example link and you'll see exons mapped out.
>>>
>>>    But zooming all the way in with all the tracks turned on it looks
>>> like the AZM tracks are just the coding regions. I don't see any
>>> multiple sequence alignment...
>>> )
>>>
>>> I doubt that helped.  :)
>>>
>>> Jay Hannah
>>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>>
>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>>
>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
>> Browser/docs/tutorial/tutorial.html
>>
>> chris
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From avilella at gmail.com  Wed Sep  5 09:31:24 2007
From: avilella at gmail.com (Albert Vilella)
Date: Wed, 5 Sep 2007 15:31:24 +0200
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
Message-ID: <358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>

Awesome!!

Thanks Chris!

On 9/5/07, Chris Fields <cjfields at uiuc.edu> wrote:
>
> You mean something like this?
>
> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>
> chris
>
> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>
> > A couple of examples:
> >
> > http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
> >
> > treefam has exon boundary and PFAM domain mappings
> >
> > http://www.ensembl.org/Homo_sapiens/genetreeview?gene=ENSG00000139618
> >
> > here the tree is shown as well, but the idea would be to plot the
> > alignment
> >
> > So it's more "show me the multiple CDS/protein alignment" rather
> > than "show
> > my aligned CDS/proteins wrt my reference genome"
> >
> > I think it would be quite neat to have this as a bioperl howto,
> >
> > Comments?
> >
> >     Albert.
> >
> > On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
> >>
> >>
> >> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
> >>
> >>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> >>>> Probably a bit of a long shot but does anyone have code for
> >>>> displaying protein or CDS multiple sequence alignments with the
> >>>> exon
> >>>> boundaries of each gene in the alignment?
> >>>>
> >>>> Something in the bioperl world without funky external dependencies.
> >>>> I think
> >>>> it would be an awesome addition to the howtos.
> >>>>
> >>>> Currently, the Bio::Graphics howto has cdna to genome mapping
> >>>> scripts or
> >>>> blast output scripts, but
> >>>> I couldn't find code for dealing with multiple sequence alignments.
> >>>
> >>> I'm currently under the (potentially uninformed) impression that
> >>> Bio::Graphics and related tools only work with a single  coordinate
> >>> system. I've never seen a multiple sequence alignment example.
> >>>
> >>> (
> >>>    I Google'd for "gbrowse alignment" and hit this:
> >>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
> >>>
> >>>    Click the second Example link and you'll see exons mapped out.
> >>>
> >>>    But zooming all the way in with all the tracks turned on it looks
> >>> like the AZM tracks are just the coding regions. I don't see any
> >>> multiple sequence alignment...
> >>> )
> >>>
> >>> I doubt that helped.  :)
> >>>
> >>> Jay Hannah
> >>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
> >>
> >> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
> >>
> >> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
> >> Browser/docs/tutorial/tutorial.html
> >>
> >> chris
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
>

From cjfields at uiuc.edu  Wed Sep  5 10:17:51 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 09:17:51 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
Message-ID: <31E25B64-2043-4460-ADC8-9684D01C2468@uiuc.edu>

It would be nice to place the labels to the left of the segments.  I  
believe there is a way to do this, but can't remember; if I can find  
it I'll revise the script.

chris

On Sep 5, 2007, at 8:31 AM, Albert Vilella wrote:

> Awesome!!
>
> Thanks Chris!
>
> On 9/5/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>
>> You mean something like this?
>>
>> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>>
>> chris
>>
>> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>>
>>> A couple of examples:
>>>
>>> http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
>>>
>>> treefam has exon boundary and PFAM domain mappings
>>>
>>> http://www.ensembl.org/Homo_sapiens/genetreeview? 
>>> gene=ENSG00000139618
>>>
>>> here the tree is shown as well, but the idea would be to plot the
>>> alignment
>>>
>>> So it's more "show me the multiple CDS/protein alignment" rather
>>> than "show
>>> my aligned CDS/proteins wrt my reference genome"
>>>
>>> I think it would be quite neat to have this as a bioperl howto,
>>>
>>> Comments?
>>>
>>>     Albert.
>>>
>>> On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>>>
>>>>
>>>> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>>>>
>>>>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>>>>>> Probably a bit of a long shot but does anyone have code for
>>>>>> displaying protein or CDS multiple sequence alignments with the
>>>>>> exon
>>>>>> boundaries of each gene in the alignment?
>>>>>>
>>>>>> Something in the bioperl world without funky external  
>>>>>> dependencies.
>>>>>> I think
>>>>>> it would be an awesome addition to the howtos.
>>>>>>
>>>>>> Currently, the Bio::Graphics howto has cdna to genome mapping
>>>>>> scripts or
>>>>>> blast output scripts, but
>>>>>> I couldn't find code for dealing with multiple sequence  
>>>>>> alignments.
>>>>>
>>>>> I'm currently under the (potentially uninformed) impression that
>>>>> Bio::Graphics and related tools only work with a single   
>>>>> coordinate
>>>>> system. I've never seen a multiple sequence alignment example.
>>>>>
>>>>> (
>>>>>    I Google'd for "gbrowse alignment" and hit this:
>>>>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>>>>>
>>>>>    Click the second Example link and you'll see exons mapped out.
>>>>>
>>>>>    But zooming all the way in with all the tracks turned on it  
>>>>> looks
>>>>> like the AZM tracks are just the coding regions. I don't see any
>>>>> multiple sequence alignment...
>>>>> )
>>>>>
>>>>> I doubt that helped.  :)
>>>>>
>>>>> Jay Hannah
>>>>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>>>>
>>>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>>>>
>>>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
>>>> Browser/docs/tutorial/tutorial.html
>>>>
>>>> chris
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From n.haigh at sheffield.ac.uk  Wed Sep  5 10:22:44 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Wed, 05 Sep 2007 15:22:44 +0100
Subject: [Bioperl-l] Bio::Graphics support for floating point positions
In-Reply-To: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
Message-ID: <46DEBBB4.1030200@sheffield.ac.uk>

Chris Fields wrote:
> You mean something like this?
>
> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>
> chris
>
> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>
>   

Nice!

On a similar (well, related to Bio::Graphics) topic, I've written a
script that uses markers that have been mapped from a model organism to
linkage groups in related species in order to estimate the location of
"unknown" markers in those linkage groups.

I'm using the Bio::Map::* modules for much of this work and then I use
Bio::Graphics to display the linkage groups of the non-model organism
with the putative position of the "unknown" markers. However, I've had
to do a bit of fudging to get Bio::Graphics to draw this data. The
problems I encountered are described below. I also have an open bug:
http://bugzilla.open-bio.org/show_bug.cgi?id=2343

1) Linkage maps are measured in cM - which can and are likely to be
non-integer values. Bio::Graphics needs integer values, so I simply
scaled all my cM measurements prior to drawing by *1000. However, the
ruler now doesn't represent the "true scale" - can this be adjusted?

2) Some markers map to 0cM. However, Bio::Graphics requires positions
>0. To get round this I simply incremented these positions by 1
(post-scaling), so they display almost in the correct place.

Is it possible/likely/wise to support positions starting at zero and
float positions? Would such support simply be to internalise what I have
already done outside Bio::Graphics into the Bio::Graphics modules and
have it display the correctly scaled ruler?

Thoughts comments welcome.

Cheers,
Nath

From cjfields at uiuc.edu  Wed Sep  5 10:52:00 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 09:52:00 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
Message-ID: <A8815527-2027-4F9D-BC47-C16E351067AA@uiuc.edu>

Updated the page on the web site with the new script.

Figured it out; if you pass the parameter -label_position 'left' it  
will display the label to the left.  However it displays them right  
next to the segment (ala GBrowse).  I added a hack to  
Bio::Graphics::Glyph::generic in CVS which allows 'alignment_left' as  
an option, displaying it aligned to the far left of the panel; there  
is probably a way to use a callback here as well.

chris

On Sep 5, 2007, at 8:31 AM, Albert Vilella wrote:

> Awesome!!
>
> Thanks Chris!
>
> On 9/5/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>
>> You mean something like this?
>>
>> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>>
>> chris
>>
>> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>>
>>> A couple of examples:
>>>
>>> http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
>>>
>>> treefam has exon boundary and PFAM domain mappings
>>>
>>> http://www.ensembl.org/Homo_sapiens/genetreeview? 
>>> gene=ENSG00000139618
>>>
>>> here the tree is shown as well, but the idea would be to plot the
>>> alignment
>>>
>>> So it's more "show me the multiple CDS/protein alignment" rather
>>> than "show
>>> my aligned CDS/proteins wrt my reference genome"
>>>
>>> I think it would be quite neat to have this as a bioperl howto,
>>>
>>> Comments?
>>>
>>>     Albert.
>>>
>>> On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>>>
>>>>
>>>> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>>>>
>>>>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>>>>>> Probably a bit of a long shot but does anyone have code for
>>>>>> displaying protein or CDS multiple sequence alignments with the
>>>>>> exon
>>>>>> boundaries of each gene in the alignment?
>>>>>>
>>>>>> Something in the bioperl world without funky external  
>>>>>> dependencies.
>>>>>> I think
>>>>>> it would be an awesome addition to the howtos.
>>>>>>
>>>>>> Currently, the Bio::Graphics howto has cdna to genome mapping
>>>>>> scripts or
>>>>>> blast output scripts, but
>>>>>> I couldn't find code for dealing with multiple sequence  
>>>>>> alignments.
>>>>>
>>>>> I'm currently under the (potentially uninformed) impression that
>>>>> Bio::Graphics and related tools only work with a single   
>>>>> coordinate
>>>>> system. I've never seen a multiple sequence alignment example.
>>>>>
>>>>> (
>>>>>    I Google'd for "gbrowse alignment" and hit this:
>>>>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>>>>>
>>>>>    Click the second Example link and you'll see exons mapped out.
>>>>>
>>>>>    But zooming all the way in with all the tracks turned on it  
>>>>> looks
>>>>> like the AZM tracks are just the coding regions. I don't see any
>>>>> multiple sequence alignment...
>>>>> )
>>>>>
>>>>> I doubt that helped.  :)
>>>>>
>>>>> Jay Hannah
>>>>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>>>>
>>>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>>>>
>>>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
>>>> Browser/docs/tutorial/tutorial.html
>>>>
>>>> chris
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From cjfields at uiuc.edu  Wed Sep  5 12:47:46 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 11:47:46 -0500
Subject: [Bioperl-l] Bio::Graphics support for floating point positions
In-Reply-To: <46DEBBB4.1030200@sheffield.ac.uk>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<46DEBBB4.1030200@sheffield.ac.uk>
Message-ID: <C445D375-6B45-476F-B0A9-2B28851EE970@uiuc.edu>

On Sep 5, 2007, at 9:22 AM, Nathan Haigh wrote:

> ...
> On a similar (well, related to Bio::Graphics) topic, I've written a
> script that uses markers that have been mapped from a model  
> organism to
> linkage groups in related species in order to estimate the location of
> "unknown" markers in those linkage groups.
>
> I'm using the Bio::Map::* modules for much of this work and then I use
> Bio::Graphics to display the linkage groups of the non-model organism
> with the putative position of the "unknown" markers. However, I've had
> to do a bit of fudging to get Bio::Graphics to draw this data. The
> problems I encountered are described below. I also have an open bug:
> http://bugzilla.open-bio.org/show_bug.cgi?id=2343
>
> 1) Linkage maps are measured in cM - which can and are likely to be
> non-integer values. Bio::Graphics needs integer values, so I simply
> scaled all my cM measurements prior to drawing by *1000. However, the
> ruler now doesn't represent the "true scale" - can this be adjusted?
>
> 2) Some markers map to 0cM. However, Bio::Graphics requires positions
>> 0. To get round this I simply incremented these positions by 1
> (post-scaling), so they display almost in the correct place.
>
> Is it possible/likely/wise to support positions starting at zero and
> float positions? Would such support simply be to internalise what I  
> have
> already done outside Bio::Graphics into the Bio::Graphics modules and
> have it display the correctly scaled ruler?
>
> Thoughts comments welcome.
>
> Cheers,
> Nath

There is this section in the GBrowse configure doc, which to me  
suggests there is a way to do what you want in Bioperl; you may have  
to delve into the Bio::Graphics or GBrowse code to work it out,  
though.  I think the GBrowse mail list archives also have more on this.

chris

.....

F. DISPLAYING GENETIC AND RH MAPS

GBrowse can be tweaked to make it more suitable for displaying genetic
and radiation hybrid maps.

The main issue is that the Bio::DB::GFF database expects coordinates
to be positive integers, not fractions, but genetic and RH maps use
floating point numbers.  Working around this is a bit of an ugly hack.
Before loading your data you must multiply all your coordinates by a
constant power of 10 in order to convert them into integers.  For
example, if a genetic map uses Morgan units ranging from 0 to 1.80,
you would multiple by 100 to create a map in ranging from 0 to 180.

Create a GFF file containing the markers in modified coordinates and
load it as usual.  Now you must tell GBrowse to reverse these changes.
Enter the following options into the [GENERAL] section of the
configuration file:

  units = M
  unit_divider = 100

These two options tell GBrowse to use "M" (Morgan) units, and to
divide all coordinates by 100.  GBrowse will automatically display the
scale using the most appropriate units, so the displayed map will
typically be drawn using cM units.


From bernd.web at gmail.com  Wed Sep  5 13:44:26 2007
From: bernd.web at gmail.com (Bernd Web)
Date: Wed, 5 Sep 2007 19:44:26 +0200
Subject: [Bioperl-l] SearchIO ResultWriter
Message-ID: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>

Hi,

For SearchIO there are ResultWriters to write text, html and BSML
(BSMLResultWriter). However, is there also a BLAST xml writer, which
writes the original blast xml files. This may have come up before. If
there is not, is there interest in having this?


Regards,
Bernd

From sac at bioperl.org  Wed Sep  5 16:37:37 2007
From: sac at bioperl.org (Steve Chervitz)
Date: Wed, 5 Sep 2007 13:37:37 -0700
Subject: [Bioperl-l] SearchIO ResultWriter
In-Reply-To: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>
References: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>
Message-ID: <8f200b4c0709051337u532804d6r27712b05faaeea7d@mail.gmail.com>

Looks like there is no such functionality in the current repository. If you
have implemented such a beast and are willing to contribute it, go for it
(or coordinate with a developer if you lack CVS write access).

Steve

On 9/5/07, Bernd Web <bernd.web at gmail.com> wrote:
>
> Hi,
>
> For SearchIO there are ResultWriters to write text, html and BSML
> (BSMLResultWriter). However, is there also a BLAST xml writer, which
> writes the original blast xml files. This may have come up before. If
> there is not, is there interest in having this?
>
>
> Regards,
> Bernd
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From n.haigh at sheffield.ac.uk  Wed Sep  5 17:18:17 2007
From: n.haigh at sheffield.ac.uk (Nathan S. Haigh)
Date: Wed, 05 Sep 2007 22:18:17 +0100
Subject: [Bioperl-l] Bio::Graphics support for floating point positions
In-Reply-To: <C445D375-6B45-476F-B0A9-2B28851EE970@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<46DEBBB4.1030200@sheffield.ac.uk>
	<C445D375-6B45-476F-B0A9-2B28851EE970@uiuc.edu>
Message-ID: <46DF1D19.9010707@sheffield.ac.uk>

Chris Fields wrote:
> On Sep 5, 2007, at 9:22 AM, Nathan Haigh wrote:
>
>> ...
>> On a similar (well, related to Bio::Graphics) topic, I've written a
>> script that uses markers that have been mapped from a model organism to
>> linkage groups in related species in order to estimate the location of
>> "unknown" markers in those linkage groups.
>>
>> I'm using the Bio::Map::* modules for much of this work and then I use
>> Bio::Graphics to display the linkage groups of the non-model organism
>> with the putative position of the "unknown" markers. However, I've had
>> to do a bit of fudging to get Bio::Graphics to draw this data. The
>> problems I encountered are described below. I also have an open bug:
>> http://bugzilla.open-bio.org/show_bug.cgi?id=2343
>>
>> 1) Linkage maps are measured in cM - which can and are likely to be
>> non-integer values. Bio::Graphics needs integer values, so I simply
>> scaled all my cM measurements prior to drawing by *1000. However, the
>> ruler now doesn't represent the "true scale" - can this be adjusted?
>>
>> 2) Some markers map to 0cM. However, Bio::Graphics requires positions
>>> 0. To get round this I simply incremented these positions by 1
>> (post-scaling), so they display almost in the correct place.
>>
>> Is it possible/likely/wise to support positions starting at zero and
>> float positions? Would such support simply be to internalise what I have
>> already done outside Bio::Graphics into the Bio::Graphics modules and
>> have it display the correctly scaled ruler?
>>
>> Thoughts comments welcome.
>>
>> Cheers,
>> Nath
>
> There is this section in the GBrowse configure doc, which to me
> suggests there is a way to do what you want in Bioperl; you may have
> to delve into the Bio::Graphics or GBrowse code to work it out,
> though.  I think the GBrowse mail list archives also have more on this.
>
> chris
>
> .....
>
> F. DISPLAYING GENETIC AND RH MAPS
>
> GBrowse can be tweaked to make it more suitable for displaying genetic
> and radiation hybrid maps.
>
> The main issue is that the Bio::DB::GFF database expects coordinates
> to be positive integers, not fractions, but genetic and RH maps use
> floating point numbers.  Working around this is a bit of an ugly hack.
> Before loading your data you must multiply all your coordinates by a
> constant power of 10 in order to convert them into integers.  For
> example, if a genetic map uses Morgan units ranging from 0 to 1.80,
> you would multiple by 100 to create a map in ranging from 0 to 180.
>
> Create a GFF file containing the markers in modified coordinates and
> load it as usual.  Now you must tell GBrowse to reverse these changes.
> Enter the following options into the [GENERAL] section of the
> configuration file:
>
>  units = M
>  unit_divider = 100
>
> These two options tell GBrowse to use "M" (Morgan) units, and to
> divide all coordinates by 100.  GBrowse will automatically display the
> scale using the most appropriate units, so the displayed map will
> typically be drawn using cM units.
>


Thanks for for the pointer Chris!

>From what you've said, it appears they might have done a similar hack to
me - which is always nice to know! It seems then to me, that it may be
worth making the Bio::Graphic::* modules slightly more generic and
applicable for these situations. It's late, so does anyone have
suggestions before I start digging through Bio::Graphic::* modules in
the morning? Maybe you guys across the water have something to say by
the time I wake up in the morning!?

Thanks
Nath

From jason at bioperl.org  Wed Sep  5 17:33:44 2007
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 5 Sep 2007 14:33:44 -0700
Subject: [Bioperl-l] SearchIO ResultWriter
In-Reply-To: <8f200b4c0709051337u532804d6r27712b05faaeea7d@mail.gmail.com>
References: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>
	<8f200b4c0709051337u532804d6r27712b05faaeea7d@mail.gmail.com>
Message-ID: <AE9E4472-3424-49F6-AA93-6F05F14446AA@bioperl.org>

I think most ppl aren't that enamored with the NCBI XML Blast format  
but I guess it is standard if the NCBI puts it out...
It should be a pretty easy writer to make at any rate just follow  
along with what was done for BSMLWriter.

-jason
On Sep 5, 2007, at 1:37 PM, Steve Chervitz wrote:

> Looks like there is no such functionality in the current  
> repository. If you
> have implemented such a beast and are willing to contribute it, go  
> for it
> (or coordinate with a developer if you lack CVS write access).
>
> Steve
>
> On 9/5/07, Bernd Web <bernd.web at gmail.com> wrote:
>>
>> Hi,
>>
>> For SearchIO there are ResultWriters to write text, html and BSML
>> (BSMLResultWriter). However, is there also a BLAST xml writer, which
>> writes the original blast xml files. This may have come up before. If
>> there is not, is there interest in having this?
>>
>>
>> Regards,
>> Bernd
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
jason at bioperl.org


From jay at jays.net  Thu Sep  6 15:50:53 2007
From: jay at jays.net (Jay Hannah)
Date: Thu, 6 Sep 2007 15:50:53 -0400 (EDT)
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
 with exon boundaries
In-Reply-To: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
Message-ID: <Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>


On Wed, 5 Sep 2007, Chris Fields wrote:
> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics

Wow. That's slick.  :)   Is it possible to zoom in far enough to see the 
individual bases and gaps??

On Tue, 4 Sep 2007, Chris Fields wrote:
> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-Browser/docs/tutorial/tutorial.html

Yes, indeed. GBrowse graphs all sorts of amazing things. Specifically, 
this image might be what Albert is looking for:

http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-Browser/docs/tutorial/figures/segmented_features2.gif

He'd need to map his exon boundaries from whatever format he has into a 
GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to munch on.

On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> "Something in the bioperl world without funky external dependencies"

There are still things the long arm of BioPerl justice hasn't reached?   :)

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah


From cjfields at uiuc.edu  Thu Sep  6 19:39:07 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 6 Sep 2007 18:39:07 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
Message-ID: <9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>


On Sep 6, 2007, at 2:50 PM, Jay Hannah wrote:

>
> On Wed, 5 Sep 2007, Chris Fields wrote:
>> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>
> Wow. That's slick.  :)   Is it possible to zoom in far enough to  
> see the
> individual bases and gaps??

I'm not sure; you can do something like that with GBrowse with some  
features so there is probably a way to put something together which  
could do that.

> On Tue, 4 Sep 2007, Chris Fields wrote:
>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
>> Browser/docs/tutorial/tutorial.html
>
> Yes, indeed. GBrowse graphs all sorts of amazing things. Specifically,
> this image might be what Albert is looking for:
>
> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
> Browser/docs/tutorial/figures/segmented_features2.gif
>
> He'd need to map his exon boundaries from whatever format he has  
> into a
> GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to  
> munch on.

I use segmented SeqFeatures in my example.  The HOWTO also uses a  
variation ('graded_segments'):

http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output

The subseqfeatures are colored by score.  Feasibly one could hack  
this so that the exons/introns have a different 'score', thus  
displaying different colors.

> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>> "Something in the bioperl world without funky external dependencies"
>
> There are still things the long arm of BioPerl justice hasn't  
> reached?   :)
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

chris

From cain.cshl at gmail.com  Thu Sep  6 23:20:04 2007
From: cain.cshl at gmail.com (Scott Cain)
Date: Thu, 06 Sep 2007 23:20:04 -0400
Subject: [Bioperl-l] display protein/CDS multiple sequence
	alignments	with exon boundaries
In-Reply-To: <9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
Message-ID: <1189135204.2560.52.camel@localhost.localdomain>

On Thu, 2007-09-06 at 18:39 -0500, Chris Fields wrote:
> On Sep 6, 2007, at 2:50 PM, Jay Hannah wrote:
> 
> >
> > On Wed, 5 Sep 2007, Chris Fields wrote:
> >> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
> >
> > Wow. That's slick.  :)   Is it possible to zoom in far enough to  
> > see the
> > individual bases and gaps??
> 
> I'm not sure; you can do something like that with GBrowse with some  
> features so there is probably a way to put something together which  
> could do that.

Yeah, if it were me, I would install GBrowse, hack my data into GFF and
use gbrowse_img to generate pictures.  It would probably be easier than
starting from scratch.


> 
> > On Tue, 4 Sep 2007, Chris Fields wrote:
> >> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
> >> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
> >> Browser/docs/tutorial/tutorial.html
> >
> > Yes, indeed. GBrowse graphs all sorts of amazing things. Specifically,
> > this image might be what Albert is looking for:
> >
> > http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
> > Browser/docs/tutorial/figures/segmented_features2.gif
> >
> > He'd need to map his exon boundaries from whatever format he has  
> > into a
> > GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to  
> > munch on.
> 
> I use segmented SeqFeatures in my example.  The HOWTO also uses a  
> variation ('graded_segments'):
> 
> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
> 
> The subseqfeatures are colored by score.  Feasibly one could hack  
> this so that the exons/introns have a different 'score', thus  
> displaying different colors.
> 
> > On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> >> "Something in the bioperl world without funky external dependencies"
> >
> > There are still things the long arm of BioPerl justice hasn't  
> > reached?   :)
> >
> > Jay Hannah
> > http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
> 
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain at cshl.edu
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory
-------------- next part --------------
A non-text attachment was scrubbed...
Name: not available
Type: application/pgp-signature
Size: 189 bytes
Desc: This is a digitally signed message part
Url : http://lists.open-bio.org/pipermail/bioperl-l/attachments/20070906/6b2b9ea2/attachment.bin 

From avilella at gmail.com  Fri Sep  7 05:20:01 2007
From: avilella at gmail.com (Albert Vilella)
Date: Fri, 7 Sep 2007 10:20:01 +0100
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
Message-ID: <358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>

>
> > He'd need to map his exon boundaries from whatever format he has
> > into a
> > GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to
> > munch on.
>
> I use segmented SeqFeatures in my example.  The HOWTO also uses a
> variation ('graded_segments'):
>
> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
>
> The subseqfeatures are colored by score.  Feasibly one could hack
> this so that the exons/introns have a different 'score', thus
> displaying different colors.


The exon boundary could be a vertical line or a triangular tick or
something. I don't know if there is a consensus on this kind of cartoons.
Does anybody know how exon boundaries are displayed in different
browsers/apps?

From yangmeng at genomics.org.cn  Fri Sep  7 03:57:14 2007
From: yangmeng at genomics.org.cn (=?ISO-8859-1?Q?=D1=EE=C3=CD=A3=A8=D6=D0=D0=C4=CA=B5=D1=E9=CA=D2?= )
Date: Fri,  7 Sep 2007 15:57:14 +0800
Subject: [Bioperl-l] a question
Message-ID: <200709071557.AA78971054@genomics.org.cn>

I am a student from China.During my learing the bioperl,I encounter a problem as follows:

I run the program,

use Bio::Perl;
$seq_object = get_sequence('swissprot',"ROA1_HUMAN");
write_sequence(">roa1.fasta",'fasta',$seq_object);

But It returns lots of mistake informatiom,

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: WebDBSeqI Request Error:
501 Protocol scheme '' is not supported
Content-Type: text/plain
Client-Date: Fri, 07 Sep 2007 07:26:06 GMT
Client-Warning: Internal response
501 Protocol scheme '' is not supported
STACK: Error::throw
STACK: Bio::Root::Root::throw D:/perl/site/lib/Bio/Root/Root.pm:359
STACK: Bio::DB::WebDBSeqI::_request D:/perl/site/lib/Bio/DB/WebDBSeqI.pm:685
STACK: Bio::DB::WebDBSeqI::get_seq_stream D:/perl/site/lib/Bio/DB/WebDBSeqI.pm:4
91
STACK: Bio::DB::WebDBSeqI::get_Stream_by_id D:/perl/site/lib/Bio/DB/WebDBSeqI.pm
:275
STACK: Bio::DB::WebDBSeqI::get_Seq_by_id D:/perl/site/lib/Bio/DB/WebDBSeqI.pm:14
5
STACK: Bio::Perl::get_sequence D:/perl/site/lib/Bio/Perl.pm:510
STACK: C:\DOCUME~1\yangmeng\LOCALS~1\Temp\dir13D.tmp\Untitled.pl:6
-----------------------------------------------------------

I don't know the reason of the problem.I have installed the addition perl modules such as bioperl-db,bioperl-network,bioperlgui and almost all "BioPerl Dependencies modules".My network is also OK. It's an annoying promleb to me.
I have consulted many experts but didn't got a reply. Could you vacuate in your mass business to give me a help?

Thank you!

Best regards!

YangMeng  




________________________________________________________________
Sent via the WebMail system at genomics.org.cn


 
                   

From cjfields at uiuc.edu  Fri Sep  7 10:09:18 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 7 Sep 2007 09:09:18 -0500
Subject: [Bioperl-l] a question
In-Reply-To: <200709071557.AA78971054@genomics.org.cn>
References: <200709071557.AA78971054@genomics.org.cn>
Message-ID: <7F176E39-18A6-4BF9-9247-863D6F3C167D@uiuc.edu>


On Sep 7, 2007, at 2:57 AM, ???????????????? wrote:

> I am a student from China.During my learing the bioperl,I encounter  
> a problem as follows:
>
> I run the program,
>
> use Bio::Perl;
> $seq_object = get_sequence('swissprot',"ROA1_HUMAN");
> write_sequence(">roa1.fasta",'fasta',$seq_object);
>
> But It returns lots of mistake informatiom,

First, always preface problems of this sort with the version of  
BioPerl you are using (there are quite a few versions still being used).

> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: WebDBSeqI Request Error:
> 501 Protocol scheme '' is not supported
> Content-Type: text/plain
> Client-Date: Fri, 07 Sep 2007 07:26:06 GMT
> Client-Warning: Internal response
> 501 Protocol scheme '' is not supported
> STACK: Error::throw
> STACK: Bio::Root::Root::throw D:/perl/site/lib/Bio/Root/Root.pm:359
> STACK: Bio::DB::WebDBSeqI::_request D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm:685
> STACK: Bio::DB::WebDBSeqI::get_seq_stream D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm:4
> 91
> STACK: Bio::DB::WebDBSeqI::get_Stream_by_id D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm
> :275
> STACK: Bio::DB::WebDBSeqI::get_Seq_by_id D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm:14
> 5
> STACK: Bio::Perl::get_sequence D:/perl/site/lib/Bio/Perl.pm:510
> STACK: C:\DOCUME~1\yangmeng\LOCALS~1\Temp\dir13D.tmp\Untitled.pl:6
> -----------------------------------------------------------

This works for me using bioperl from CVS.  There were a few remote  
DbFetch server changes if I recall correctly, so updating from CVS  
may be your best option.

> I don't know the reason of the problem.I have installed the  
> addition perl modules such as bioperl-db,bioperl-network,bioperlgui  
> and almost all "BioPerl Dependencies modules".My network is also  
> OK. It's an annoying promleb to me.
> I have consulted many experts but didn't got a reply. Could you  
> vacuate in your mass business to give me a help?
>
> Thank you!
>
> Best regards!
>
> YangMeng

I think my 'vacuating' is a private matter, let alone doing so in my  
mass business...

http://www.thefreedictionary.com/Vacuate

;>

chris

From cjfields at uiuc.edu  Mon Sep 10 18:04:14 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 10 Sep 2007 17:04:14 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
Message-ID: <3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>

On Sep 7, 2007, at 4:20 AM, Albert Vilella wrote:

>>> He'd need to map his exon boundaries from whatever format he has
>>> into a
>>> GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to
>>> munch on.
>>
>> I use segmented SeqFeatures in my example.  The HOWTO also uses a
>> variation ('graded_segments'):
>>
>> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
>>
>> The subseqfeatures are colored by score.  Feasibly one could hack
>> this so that the exons/introns have a different 'score', thus
>> displaying different colors.
>
>
> The exon boundary could be a vertical line or a triangular tick or
> something. I don't know if there is a consensus on this kind of  
> cartoons.
> Does anybody know how exon boundaries are displayed in different
> browsers/apps?

Don't know.  BTW, apparently there is something being cooked up as an  
alignment browser (among other things) for GBrowse:

https://www.nescent.org/wg_phyloinformatics/ 
PhyloSoC:Phylogenetic_and_Haplotype_Displays_for_GBrowse

Acc. to Lincoln (from his last GBrowse post) there will be a testable  
version within a few weeks or so.  You could always ask more  
questions about it on the GBrowse list.

chris

From lstein at cshl.edu  Mon Sep 10 18:09:41 2007
From: lstein at cshl.edu (Lincoln Stein)
Date: Mon, 10 Sep 2007 18:09:41 -0400
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
Message-ID: <6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>

You can view a simple multiple alignment now. Go to www.wormbase.org, turn
on some of the EST tracks and then zoom down to base pair level.

In bio::graphics, use the "segments" glyph and turn on the -draw_target
option. The features must have DNA attached to them.

What's coming soon is support for MAF format, which provides genome-level
alignments.

Lincoln

On 9/10/07, Chris Fields <cjfields at uiuc.edu> wrote:
>
> On Sep 7, 2007, at 4:20 AM, Albert Vilella wrote:
>
> >>> He'd need to map his exon boundaries from whatever format he has
> >>> into a
> >>> GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to
> >>> munch on.
> >>
> >> I use segmented SeqFeatures in my example.  The HOWTO also uses a
> >> variation ('graded_segments'):
> >>
> >> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
> >>
> >> The subseqfeatures are colored by score.  Feasibly one could hack
> >> this so that the exons/introns have a different 'score', thus
> >> displaying different colors.
> >
> >
> > The exon boundary could be a vertical line or a triangular tick or
> > something. I don't know if there is a consensus on this kind of
> > cartoons.
> > Does anybody know how exon boundaries are displayed in different
> > browsers/apps?
>
> Don't know.  BTW, apparently there is something being cooked up as an
> alignment browser (among other things) for GBrowse:
>
> https://www.nescent.org/wg_phyloinformatics/
> PhyloSoC:Phylogenetic_and_Haplotype_Displays_for_GBrowse
>
> Acc. to Lincoln (from his last GBrowse post) there will be a testable
> version within a few weeks or so.  You could always ask more
> questions about it on the GBrowse list.
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
(516) 367-8380 (voice)
(516) 367-8389 (fax)
FOR URGENT MESSAGES & SCHEDULING,
PLEASE CONTACT MY ASSISTANT,
SANDRA MICHELSEN, AT michelse at cshl.edu

From cjfields at uiuc.edu  Mon Sep 10 23:00:29 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 10 Sep 2007 22:00:29 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
	<6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
Message-ID: <885E5E3B-E2F7-4279-8EE3-FC21AF535D7E@uiuc.edu>

Doesn't that work only for SeqFeature::SimilarityPair and HSP-like  
(paired) alignments, or am I mistaken?

chris

On Sep 10, 2007, at 5:09 PM, Lincoln Stein wrote:

> You can view a simple multiple alignment now. Go to  
> www.wormbase.org, turn
> on some of the EST tracks and then zoom down to base pair level.
>
> In bio::graphics, use the "segments" glyph and turn on the - 
> draw_target
> option. The features must have DNA attached to them.
>
> What's coming soon is support for MAF format, which provides genome- 
> level
> alignments.
>
> Lincoln



From christoph.theunert at web.de  Tue Sep 11 06:37:49 2007
From: christoph.theunert at web.de (Christoph Theunert)
Date: Tue, 11 Sep 2007 03:37:49 -0700 (PDT)
Subject: [Bioperl-l] release of own projects
Message-ID: <12611951.post@talk.nabble.com>


Hi, I am a bioinformatics student from germany and I need your help 

Working with perl and bioperl is pretty new to me - 
currently I am working on a Bioperl project, and I don't know how to release
my project when i am finished with it.

I want to pack my modules so that other users can download it and install it
on their machines.

Do I use the command h2xs as to create cpan modules ( makefiles ...) or what
is the best way to solve my 
problem ?

thanks for help 

Christoph
-- 
View this message in context: http://www.nabble.com/release-of-own-projects-tf4421681.html#a12611951
Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.


From spiros at lokku.com  Tue Sep 11 06:57:14 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 11 Sep 2007 11:57:14 +0100
Subject: [Bioperl-l] release of own projects
In-Reply-To: <12611951.post@talk.nabble.com>
References: <12611951.post@talk.nabble.com>
Message-ID: <bba689ec0709110357o2fb66071w611a8598bef8134e@mail.gmail.com>

Hey,

Yes, IMHO the best way would be to create CPANesque modules that
people are able to download and install. The installation is pretty
straightforward, covers prerequisites  and more advanced features if
needed and as an approach it is widely supported. Also, it gives you
the ability to create and integrate tests seamlessly :)

Check out these URL's on how to do it:

http://search.cpan.org/~nwclark/perl-5.8.8/pod/perlnewmod.pod
http://www.perlmonks.org/?node_id=158999
http://www.perlmonks.org/?node_id=431702

Btw, more friendly and automated tools exist besides h2xs. Be sure to
have a look at:

http://search.cpan.org/perldoc?ExtUtils::ModuleMaker
http://search.cpan.org/perldoc?Module::Starter

Hope this helps,
Spiros

ps. i suggest since its your research work you are going to be handing
out to read a bit on the various software licenses which exist and
which you prefer to license your code under.


On 9/11/07, Christoph Theunert <christoph.theunert at web.de> wrote:
>
> Hi, I am a bioinformatics student from germany and I need your help
>
> Working with perl and bioperl is pretty new to me -
> currently I am working on a Bioperl project, and I don't know how to release
> my project when i am finished with it.
>
> I want to pack my modules so that other users can download it and install it
> on their machines.
>
> Do I use the command h2xs as to create cpan modules ( makefiles ...) or what
> is the best way to solve my
> problem ?
>
> thanks for help
>
> Christoph
> --
> View this message in context: http://www.nabble.com/release-of-own-projects-tf4421681.html#a12611951
> Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From bix at sendu.me.uk  Tue Sep 11 07:12:41 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 11 Sep 2007 12:12:41 +0100
Subject: [Bioperl-l] release of own projects
In-Reply-To: <12611951.post@talk.nabble.com>
References: <12611951.post@talk.nabble.com>
Message-ID: <46E67829.8060303@sendu.me.uk>

Christoph Theunert wrote:
> Hi, I am a bioinformatics student from germany and I need your help 
> 
> Working with perl and bioperl is pretty new to me - 
> currently I am working on a Bioperl project, and I don't know how to release
> my project when i am finished with it.
> 
> I want to pack my modules so that other users can download it and install it
> on their machines.
> 
> Do I use the command h2xs as to create cpan modules ( makefiles ...) or what
> is the best way to solve my 
> problem ?

You can do it however you like. You can just stick the modules in a 
folder, .tar.gz it and offer that to people. You can use h2xs to 
automate certain things. You can use Module::Build.

To make your work available via cpan, see
http://www.cpan.org/modules/04pause.html

If your modules are of general bioinformatic utility you might even 
consider making them a part of bioperl itself.

From jay at jays.net  Tue Sep 11 17:15:17 2007
From: jay at jays.net (Jay Hannah)
Date: Tue, 11 Sep 2007 16:15:17 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
 with exon boundaries
In-Reply-To: <6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>	
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>	
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>	
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>	
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>	
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
	<6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
Message-ID: <46E70565.5040503@jays.net>

Lincoln Stein wrote:
> You can view a simple multiple alignment now. Go to www.wormbase.org 
> <http://www.wormbase.org>, turn on some of the EST tracks and then 
> zoom down to base pair level.
>
> In bio::graphics, use the "segments" glyph and turn on the 
> -draw_target option. The features must have DNA attached to them.

Wow.  *http://tinyurl.com/yuz8bq*   I hadn't seen that done before.

> What's coming soon is support for MAF format, which provides 
> genome-level alignments.

I'm looking forward to trying to wrap my head around that.  :)

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah


From cjfields at uiuc.edu  Tue Sep 11 18:40:55 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 11 Sep 2007 17:40:55 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <46E70565.5040503@jays.net>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>	
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>	
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>	
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>	
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>	
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
	<6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
	<46E70565.5040503@jays.net>
Message-ID: <BC255B1A-EBB6-401B-BCDF-357A653A5972@uiuc.edu>


On Sep 11, 2007, at 4:15 PM, Jay Hannah wrote:

> Lincoln Stein wrote:
>> You can view a simple multiple alignment now. Go to www.wormbase.org
>> <http://www.wormbase.org>, turn on some of the EST tracks and then
>> zoom down to base pair level.
>>
>> In bio::graphics, use the "segments" glyph and turn on the
>> -draw_target option. The features must have DNA attached to them.
>
> Wow.  *http://tinyurl.com/yuz8bq*   I hadn't seen that done before.

There is a section detailing how this is done in the GBrowse tutorial  
(though it uses older GFF):

http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
Browser/docs/tutorial/tutorial.html

>> What's coming soon is support for MAF format, which provides
>> genome-level alignments.
>
> I'm looking forward to trying to wrap my head around that.  :)
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

It's easily parsible, which is nice!

chris

From stephan.roessner at gsf.de  Wed Sep 12 04:44:10 2007
From: stephan.roessner at gsf.de (Stephan Roessner)
Date: Wed, 12 Sep 2007 10:44:10 +0200
Subject: [Bioperl-l] bug in Bio::SearchIO?
Message-ID: <200709121044.11741.stephan.roessner@gsf.de>

Hi,

I am parsing a BlastN output with Bio::SearchIO and getting an error for some 
of the hits when retrieving the start and/or the end position with 
$hit->end('sbjct') , $hit->start('sbjct'). I want to filter for hits which 
are are of equal length (~ > 0.9) to the query sequences. 

SearchIO is retrieving the right results, but throws an exemption, in this 
case: MSG:Undefined sub-sequence (1633,760). Valid range = 693 - 760 .....

It seems to me valid range is parsed incorrectly, isn't it? Is this a bug?

Does anybody have a similar problem?

see code, error, and blastn output below.

thanks,
Stephan


Stephan Roessner
MIPS/IBI Inst. for Bioinformatics
GSF Research Center for Environment and Health
Ingolst?dter Landstr. 1
85764 Neuherberg; Germany
phone: +49 (0)89 3187 3583
fax: ? ? ? +49 (0)89 3187 3585
email: stephan.roessner at gsf.de


Here is the piece of code I am using:

my $blast_report = new Bio::SearchIO ('-format'=>'blast',
                                         '-file' => $source);
  	
while( my $result=$blast_report->next_result) {
		while( my $hit= $result->next_hit()) {
			print "Name: ".$hit->name."\n";
			print "S: ".$hit->start('sbjct')."\n";
			print "E: ".$hit->end('sbjct')."\n";
			print "L: ".$hit->length()."\n";
		}
 	}


Here's the message: 

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Undefined sub-sequence (1633,760). Valid range = 693 - 760
STACK: Error::throw
STACK: 
Bio::Root::Root::throw /usr/lib/perl5/vendor_perl/5.8.8/Bio/Root/Root.pm:359
STACK: 
Bio::Search::HSP::HSPI::matches /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/HSP/HSPI.pm:691
STACK: 
Bio::Search::SearchUtils::_adjust_contigs /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/SearchUtils.pm:489
STACK: 
Bio::Search::SearchUtils::tile_hsps /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/SearchUtils.pm:206
STACK: 
Bio::Search::Hit::GenericHit::start /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/Hit/GenericHit.pm:935
STACK: 
main::parse /home/users/roessner/workspace/GeneSimilarity/similarity_analysis.pl:82
STACK: /home/users/roessner/workspace/GeneSimilarity/similarity_analysis.pl:51
-----------------------------------------------------------

S: 635
E: 790
L: 2052

This is the BLASTN output I am parsing::

>LOC_Os11g37470.1 chr11_pseudomolecule_TIGR r_jap version0
            21623485-21621434 BestGuessTranscript
          Length = 2052

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 106/124 (85%), Gaps = 1/124 (0%)
 Strand = Plus / Plus

                                                                        
Query: 3191 tattaagcataattaatgtatcattagcacatgtagg-ttactgtagcatttaaggctaa 3249
            |||||||| |||||||| | ||||| ||||||||||| |||||||| || ||| ||||||
Sbjct: 635  tattaagcctaattaatctgtcattggcacatgtagggttactgtaacacttatggctaa 694

                                                                        
Query: 3250 tcatagagtaactagacttaaaagactcgtctcgcgattttcaaccaaactgtgtaatta 3309
            |||| || ||| |||||| |||||| || ||||||||||||||  ||||| ||| |||||
Sbjct: 695  tcatggactaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaatta 754

                
Query: 3310 gttt 3313
            ||||
Sbjct: 755  gttt 758



 Score = 48.1 bits (24), Expect = 0.002
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                        
Query: 2253 aaaaactaattacacaatttacctgtacatcgcgagatgaatcttttaagtttagttact 2312
            ||||||||||| |||  ||| | || | ||||||||||||||||||| ||| || ||| |
Sbjct: 760  aaaaactaattgcacggtttgcatgaaaatcgcgagatgaatcttttgagtctatttagt 701

                    
Query: 2313 ccatgatt 2320
            ||||||||
Sbjct: 700  ccatgatt 693



 Score = 44.1 bits (22), Expect = 0.038
 Identities = 76/94 (80%)
 Strand = Plus / Minus

                                                                        
Query: 1539 atgcatgtagtattaaatatagacgaaaataaaaactaattgcacagtttggtcgaaatt 1598
            ||||||| || |||||||||| |  |||  ||||||||||||||| |||||   |||| |
Sbjct: 790  atgcatggagcattaaatataaataaaatgaaaaactaattgcacggtttgcatgaaaat 731

                                              
Query: 1599 gtcgagacgaattttttgagtctagttaggccat 1632
              ||||| |||| ||||||||||| |||| ||||
Sbjct: 730  cgcgagatgaatcttttgagtctatttagtccat 697



 Score = 44.1 bits (22), Expect = 0.038
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 2026 actaactagaattaaaagattcgtctcgtcatttacagacaaactgtgtaattagttttt 2085
            ||||| |||| | ||||||||| |||||  |||| ||  ||||| ||| |||||||||||
Sbjct: 701  actaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaattagttttt 760

                                          
Query: 2086 gttttcgtctatatttaatgcttcatgcat 2115
              |||  | ||||||||||||| |||||||
Sbjct: 761  cattttatttatatttaatgctccatgcat 790






From cjfields at uiuc.edu  Wed Sep 12 10:57:22 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 12 Sep 2007 09:57:22 -0500
Subject: [Bioperl-l] bug in Bio::SearchIO?
In-Reply-To: <200709121044.11741.stephan.roessner@gsf.de>
References: <200709121044.11741.stephan.roessner@gsf.de>
Message-ID: <74CE1BB2-FCEB-43C3-B783-09706C7F55D8@uiuc.edu>

Try updating to bioperl from CVS.  I believe this issue was fixed but  
I don't believe it made the 1.5.2 release.

chris

On Sep 12, 2007, at 3:44 AM, Stephan Roessner wrote:

> Hi,
>
> I am parsing a BlastN output with Bio::SearchIO and getting an  
> error for some
> of the hits when retrieving the start and/or the end position with
> $hit->end('sbjct') , $hit->start('sbjct'). I want to filter for  
> hits which
> are are of equal length (~ > 0.9) to the query sequences.
>
> SearchIO is retrieving the right results, but throws an exemption,  
> in this
> case: MSG:Undefined sub-sequence (1633,760). Valid range = 693 -  
> 760 .....
>
> It seems to me valid range is parsed incorrectly, isn't it? Is this  
> a bug?
>
> Does anybody have a similar problem?
>
> see code, error, and blastn output below.
>
> thanks,
> Stephan
>
>
> Stephan Roessner
> MIPS/IBI Inst. for Bioinformatics
> GSF Research Center for Environment and Health
> Ingolst?dter Landstr. 1
> 85764 Neuherberg; Germany
> phone: +49 (0)89 3187 3583
> fax:       +49 (0)89 3187 3585
> email: stephan.roessner at gsf.de
>
>
> Here is the piece of code I am using:
>
> my $blast_report = new Bio::SearchIO ('-format'=>'blast',
>                                          '-file' => $source);
>   	
> while( my $result=$blast_report->next_result) {
> 		while( my $hit= $result->next_hit()) {
> 			print "Name: ".$hit->name."\n";
> 			print "S: ".$hit->start('sbjct')."\n";
> 			print "E: ".$hit->end('sbjct')."\n";
> 			print "L: ".$hit->length()."\n";
> 		}
>  	}
>
>
> Here's the message:
>
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: Undefined sub-sequence (1633,760). Valid range = 693 - 760
> STACK: Error::throw
> STACK:
> Bio::Root::Root::throw /usr/lib/perl5/vendor_perl/5.8.8/Bio/Root/ 
> Root.pm:359
> STACK:
> Bio::Search::HSP::HSPI::matches /usr/lib/perl5/vendor_perl/5.8.8/ 
> Bio/Search/HSP/HSPI.pm:691
> STACK:
> Bio::Search::SearchUtils::_adjust_contigs /usr/lib/perl5/ 
> vendor_perl/5.8.8/Bio/Search/SearchUtils.pm:489
> STACK:
> Bio::Search::SearchUtils::tile_hsps /usr/lib/perl5/vendor_perl/ 
> 5.8.8/Bio/Search/SearchUtils.pm:206
> STACK:
> Bio::Search::Hit::GenericHit::start /usr/lib/perl5/vendor_perl/ 
> 5.8.8/Bio/Search/Hit/GenericHit.pm:935
> STACK:
> main::parse /home/users/roessner/workspace/GeneSimilarity/ 
> similarity_analysis.pl:82
> STACK: /home/users/roessner/workspace/GeneSimilarity/ 
> similarity_analysis.pl:51
> -----------------------------------------------------------
>
> S: 635
> E: 790
> L: 2052
>
> This is the BLASTN output I am parsing::
>
>> LOC_Os11g37470.1 chr11_pseudomolecule_TIGR r_jap version0
>             21623485-21621434 BestGuessTranscript
>           Length = 2052
>
>  Score = 95.6 bits (48), Expect = 1e-17
>  Identities = 106/124 (85%), Gaps = 1/124 (0%)
>  Strand = Plus / Plus
>
>
> Query: 3191 tattaagcataattaatgtatcattagcacatgtagg- 
> ttactgtagcatttaaggctaa 3249
>             |||||||| |||||||| | ||||| ||||||||||| |||||||| || |||  
> ||||||
> Sbjct: 635   
> tattaagcctaattaatctgtcattggcacatgtagggttactgtaacacttatggctaa 694
>
>
> Query: 3250  
> tcatagagtaactagacttaaaagactcgtctcgcgattttcaaccaaactgtgtaatta 3309
>             |||| || ||| |||||| |||||| || ||||||||||||||  ||||| |||  
> |||||
> Sbjct: 695   
> tcatggactaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaatta 754
>
>
> Query: 3310 gttt 3313
>             ||||
> Sbjct: 755  gttt 758
>
>
>
>  Score = 48.1 bits (24), Expect = 0.002
>  Identities = 57/68 (83%)
>  Strand = Plus / Minus
>
>
> Query: 2253  
> aaaaactaattacacaatttacctgtacatcgcgagatgaatcttttaagtttagttact 2312
>             ||||||||||| |||  ||| | || | ||||||||||||||||||| ||| ||  
> ||| |
> Sbjct: 760   
> aaaaactaattgcacggtttgcatgaaaatcgcgagatgaatcttttgagtctatttagt 701
>
>
> Query: 2313 ccatgatt 2320
>             ||||||||
> Sbjct: 700  ccatgatt 693
>
>
>
>  Score = 44.1 bits (22), Expect = 0.038
>  Identities = 76/94 (80%)
>  Strand = Plus / Minus
>
>
> Query: 1539  
> atgcatgtagtattaaatatagacgaaaataaaaactaattgcacagtttggtcgaaatt 1598
>             ||||||| || |||||||||| |  |||  ||||||||||||||| |||||    
> |||| |
> Sbjct: 790   
> atgcatggagcattaaatataaataaaatgaaaaactaattgcacggtttgcatgaaaat 731
>
>
> Query: 1599 gtcgagacgaattttttgagtctagttaggccat 1632
>               ||||| |||| ||||||||||| |||| ||||
> Sbjct: 730  cgcgagatgaatcttttgagtctatttagtccat 697
>
>
>
>  Score = 44.1 bits (22), Expect = 0.038
>  Identities = 73/90 (81%)
>  Strand = Plus / Plus
>
>
> Query: 2026  
> actaactagaattaaaagattcgtctcgtcatttacagacaaactgtgtaattagttttt 2085
>             ||||| |||| | ||||||||| |||||  |||| ||  ||||| |||  
> |||||||||||
> Sbjct: 701   
> actaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaattagttttt 760
>
>
> Query: 2086 gttttcgtctatatttaatgcttcatgcat 2115
>               |||  | ||||||||||||| |||||||
> Sbjct: 761  cattttatttatatttaatgctccatgcat 790
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From n.haigh at sheffield.ac.uk  Wed Sep 12 12:34:26 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Wed, 12 Sep 2007 17:34:26 +0100
Subject: [Bioperl-l] Bio::Graphics transparent background
Message-ID: <46E81512.3090503@sheffield.ac.uk>

Is it possible to set the bg colour of glyphs and the panel background
to be transparent? If so, which output formats support transparency?

Cheers
Nath



From Kevin.M.Brown at asu.edu  Wed Sep 12 14:15:10 2007
From: Kevin.M.Brown at asu.edu (Kevin Brown)
Date: Wed, 12 Sep 2007 11:15:10 -0700
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <46E81512.3090503@sheffield.ac.uk>
References: <46E81512.3090503@sheffield.ac.uk>
Message-ID: <1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>

> Is it possible to set the bg colour of glyphs and the panel 
> background to be transparent? If so, which output formats 
> support transparency?

Not sure if you can, but SVG, PNG, Gif all support a transparent
background.


From bioperl-list at superfrink.net  Thu Sep 13 01:15:39 2007
From: bioperl-list at superfrink.net (bioperl-list at superfrink.net)
Date: Wed, 12 Sep 2007 23:15:39 -0600 (MDT)
Subject: [Bioperl-l]  Bio::Graphics transparent background
Message-ID: <Pine.LNX.4.64.0709122245450.8424@gurchecyrohssnyb.arg>

> Is it possible to set the bg colour of glyphs and the panel background
> to be transparent? If so, which output formats support transparency?

I had a look at the code and I don't believe it is possible.

You could produce a PNG file and knowing the red/green/blue values of the 
background colour run the following script to make an image with the bg 
colour transparent.

For example:
    ./make-transparent.pl 252 253 252 2004-11-22.png

will produce:  2004-11-22.png.new.png
with the RGB colour of (252, 253, 252) replaced with transparency.

Regards,
Chad


#!/usr/bin/perl -w
#
# file: make-transparent.pl
# purpose: make a single colour in a PNG file transparent
# author: chad c d clark
# $Id$

use strict;
use GD;

# -- subroutines -------------------------------------------------------
sub usage_message();


# -- main() ------------------------------------------------------------

if(scalar @ARGV < 4) {
     print usage_message();
     exit 1;
}

# get the colour and make sure it is valid
my @RGB = splice @ARGV, 0, 3;
for my $i (@RGB) {

     if ( ($i !~ /^[\d]+$/) or (255 < $i) ) {
 	print "Invalid colour '$i'.\n";
         print usage_message();
         exit 1;
     }
}
print "RGB: (@RGB)\n";

# process each file
FILE: while (my $filename = shift @ARGV) {

     # read the file
     my $image = GD::Image->new($filename);
     unless(defined $image) {
 	warn "Unable to read image from file.  Skipping '$filename'.\n";
 	next FILE;
     }

     # find the colour index
     my $index = $image->colorExact(@RGB);
     if(-1 == $index) {
 	warn "Colour not found in file.  Skipping '$filename'.\n";
 	next FILE;
     }

     # make the colour index transparent
     if(-1 == $image->transparent($index)) {
 	warn "Unable to make colour transparent.  Skipping '$filename'.\n";
 	next FILE;
     }

     # write the updated image file
     my $new_filename = $filename . ".new.png";
     # my $new_filename = $filename;  # use to over-write existing file
     open FH, ">" . $new_filename or die "can't open $new_filename";
     print FH $image->png;
     close FH;

     print "Found file '$filename'.\tCreated '$new_filename'.\n";
}

exit 0;


# -- subroutines -------------------------------------------------------

sub usage_message() {

return qq/
   Usage: $0 RED GREEN BLUE FILELIST

   Where:
       RED       - red   value in decimal (0 to 255)
       GREEN     - green value in decimal (0 to 255)
       BLUE      - blue  value in decimal (0 to 255)
       FILELIST  - list of files to convert

   Examples:
       $0 255 255 255 2004-11-22.png
       $0 252 253 252 2004-11-22.png second.png
       $0 1   1   200 2004-11-22.png second.png third.png

   Description:
   For each file "foo.png" a new file "foo.png.new.png" will be created (and
   over-written if it existed).  The new file will be the same as the original
   but the colour specified by the RED, GREEN, and BLUE value will be removed
   and replaced by transparent pixels.

/;
}

From n.haigh at sheffield.ac.uk  Thu Sep 13 06:07:46 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Thu, 13 Sep 2007 11:07:46 +0100
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
References: <46E81512.3090503@sheffield.ac.uk>
	<1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
Message-ID: <46E90BF2.5010607@sheffield.ac.uk>

Kevin Brown wrote:
>> Is it possible to set the bg colour of glyphs and the panel 
>> background to be transparent? If so, which output formats 
>> support transparency?
>>     
>
> Not sure if you can, but SVG, PNG, Gif all support a transparent
> background.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>   

Looking at the GD module documentation:
http://search.cpan.org/~lds/GD-2.30/GD.pm

It appears that you can set a colour as being transparent - so I think
it should be possible to get Bio::Graphics to do this = may require some
code to be written. Any one got ideas?

Cheers,
Nath

From n.haigh at sheffield.ac.uk  Thu Sep 13 07:59:20 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Thu, 13 Sep 2007 12:59:20 +0100
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <46E90BF2.5010607@sheffield.ac.uk>
References: <46E81512.3090503@sheffield.ac.uk>	<1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
	<46E90BF2.5010607@sheffield.ac.uk>
Message-ID: <46E92618.7050208@sheffield.ac.uk>

Nathan Haigh wrote:
> Kevin Brown wrote:
>   
>>> Is it possible to set the bg colour of glyphs and the panel 
>>> background to be transparent? If so, which output formats 
>>> support transparency?
>>>     
>>>       
>> Not sure if you can, but SVG, PNG, Gif all support a transparent
>> background.
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>   
>>     
>
> Looking at the GD module documentation:
> http://search.cpan.org/~lds/GD-2.30/GD.pm
>
> It appears that you can set a colour as being transparent - so I think
> it should be possible to get Bio::Graphics to do this = may require some
> code to be written. Any one got ideas?
>
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>   

I took a look and made a simple change to Bio::Graphics::Panel

Please see the following bug for a patch and explanation:
http://bugzilla.open-bio.org/show_bug.cgi?id=2365

I'd appreciate any comments, especially regarding the method name! If
there aren't any complaints I'll commit it later today.

Nath

From n.haigh at sheffield.ac.uk  Thu Sep 13 08:26:57 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Thu, 13 Sep 2007 13:26:57 +0100
Subject: [Bioperl-l] Bio::Graphics Resolution
Message-ID: <46E92C91.5020307@sheffield.ac.uk>

I want to be able to print my Bio::Graphics image on a poster with good
resolution. What can I do to ensure I don't get blocky graphics/text.

Altering the width/height of the panel simple increases the size of the
canvas on which to draw the image, but the text appears the same size
and thus relatively smaller to the rest of the image. So I don't think
this would work for printing on a poster.

Cheers,
Nath

From cjfields at uiuc.edu  Thu Sep 13 08:46:02 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 13 Sep 2007 07:46:02 -0500
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <69321A85-8715-43C0-BCB0-CEE8F42D7235@uiuc.edu>

Print to SVG instead of PNG (should be resolution-independent); I use  
Illustrator to fine-tune it but there are several other programs  
which can do the same.  You'll need to install GD::SVG for it to work.

The alignment example I posted previously about (http:// 
www.bioperl.org/wiki/HOWTO_Discussion:Graphics) shows essentially  
what you need to do:

my $panel = Bio::Graphics::Panel->new(
     -image_class => 'SVG',
     # and whatever else
);

# later...

print $panel->svg;

chris

On Sep 13, 2007, at 7:26 AM, Nathan Haigh wrote:

> I want to be able to print my Bio::Graphics image on a poster with  
> good
> resolution. What can I do to ensure I don't get blocky graphics/text.
>
> Altering the width/height of the panel simple increases the size of  
> the
> canvas on which to draw the image, but the text appears the same size
> and thus relatively smaller to the rest of the image. So I don't think
> this would work for printing on a poster.
>
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From jonathancrabtree at gmail.com  Thu Sep 13 09:09:56 2007
From: jonathancrabtree at gmail.com (Jonathan Crabtree)
Date: Thu, 13 Sep 2007 09:09:56 -0400
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <46E92618.7050208@sheffield.ac.uk>
References: <46E81512.3090503@sheffield.ac.uk>
	<1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
	<46E90BF2.5010607@sheffield.ac.uk> <46E92618.7050208@sheffield.ac.uk>
Message-ID: <8e5b8bf80709130609x4be19cf6y60f2440a1ac5d332@mail.gmail.com>

Hi Nathan-

One problem with your proposed solution is that it won't necessarily work
when GD::SVG is being used instead of GD (i.e., via the image_class method
of Bio::Graphics::Panel).  SVG doesn't handle transparency in the same way
as GD.  At least when you're compositing multiple SVG images/documents,
transparency is the default; if you superimpose one SVG image on another (
e.g., by merging the two into a single SVG document) then the bottom image
will be visible through any area of the top image that has not been drawn
on.  When I'm working in SVG with Bio::Graphics I get a "transparent"
background by simply not setting the bgcolor; this ensures that
Bio::Graphics::Panel will refrain from drawing a filled background rectangle
underneath the drawing area.  What I don't know is how to ensure that the
background is transparent when you're working with the various methods of
embedding SVG in web pages ( i.e., transparent with respect to whatever is
_underneath_ the SVG-rendered content); this is probably a slightly
different issue that's more a question of what the browser/plugin supports.

I'm not sure what to suggest as an alternative, but at the very least this
probably warrants a YMMV comment in the documentation for the new method, or
perhaps it could even throw a runtime error if called when the $gd object is
of type GD::SVG.  A final option would be to say that this (setting a
transparent background) is something that should get handled outside of
Bio::Graphics::Panel; I don't think there's any technical reason why the
calling code couldn't be responsible for this.  I don't think we can modify
your new method to unset the bgcolor when working with GD::SVG, because that
might affect the image in other ways.  I do it in my code but I'm not sure
it's 100% safe, since I think GD::SVG might actually _use_ the bgcolor in
some situations (e.g., drawing dashed lines) and I haven't checked the code
thoroughly to make sure that there are no unintended consequences.

Jonathan

p.s. I see that Chris has beaten me to the punch in mentioning SVG as a fix
to your blocky font problems.  All the more reason to think about how this
feature will work in that context!


On 9/13/07, Nathan Haigh <n.haigh at sheffield.ac.uk > wrote:
>
> Nathan Haigh wrote:
> > Kevin Brown wrote:
> >
> >>> Is it possible to set the bg colour of glyphs and the panel
> >>> background to be transparent? If so, which output formats
> >>> support transparency?
> >>>
> >>>
> >> Not sure if you can, but SVG, PNG, Gif all support a transparent
> >> background.
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>
> >>
> >
> > Looking at the GD module documentation:
> > http://search.cpan.org/~lds/GD-2.30/GD.pm
> <http://search.cpan.org/%7Elds/GD-2.30/GD.pm>
> >
> > It appears that you can set a colour as being transparent - so I think
> > it should be possible to get Bio::Graphics to do this = may require some
> > code to be written. Any one got ideas?
> >
> > Cheers,
> > Nath
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
>
> I took a look and made a simple change to Bio::Graphics::Panel
>
> Please see the following bug for a patch and explanation:
> http://bugzilla.open-bio.org/show_bug.cgi?id=2365
>
> I'd appreciate any comments, especially regarding the method name! If
> there aren't any complaints I'll commit it later today.
>
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From bix at sendu.me.uk  Thu Sep 13 09:03:46 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 13 Sep 2007 14:03:46 +0100
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <46E93532.6030505@sendu.me.uk>

Nathan Haigh wrote:
> I want to be able to print my Bio::Graphics image on a poster with good
> resolution. What can I do to ensure I don't get blocky graphics/text.

Output in SVG, which is a vector format == no blockiness.

From jonathancrabtree at gmail.com  Thu Sep 13 09:20:43 2007
From: jonathancrabtree at gmail.com (Jonathan Crabtree)
Date: Thu, 13 Sep 2007 09:20:43 -0400
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <8e5b8bf80709130620r4a24fe8fi5171539f50735bf3@mail.gmail.com>

Nathan-

As Chris said, you'll want to use GD::SVG instead of GD.  However, you're
still going to have the issue that you raised that the fonts will be
proportionally small with respect to your figure (particularly if you're
printing a large region at poster size.)  From what I remember GD only gives
you a few font sizes to choose from, so even at the largest size you may
still have problems.  I've worked around this in the past by using scripts
to post-process the resulting SVG.  I do a global search and replace to
increase the font sizes (and, in many cases, to adjust the y-offset of the
text accordingly.)  You may also need to tweak the amount of vertical
whitespace in the image (e.g., between adjacent rows of features) to give
yourself space to increase the font size.  The same caveat applies to the
horizontal dimension, since with a larger font you may have collisions
between labels (assuming that the features in your figure are labeled.)  To
fix this you need to trick Bio::Graphics into thinking the feature labels
are longer than they actually are.  I forget whether I did this by padding
the labels with extra whitespace or actually modifying the code that
computes the feature bounding boxes, but something along those lines should
work.  Essentially you have to trick Bio::Graphics into leaving extra
whitespace so that everything looks OK when you bump up the font sizes.
Unfortunately I don't have a generic script that does this; after generating
a couple of posters this way I switched to direct SVG generation to avoid
the constraints imposed by going through GD.

Jonathan


On 9/13/07, Nathan Haigh <n.haigh at sheffield.ac.uk> wrote:
>
> I want to be able to print my Bio::Graphics image on a poster with good
> resolution. What can I do to ensure I don't get blocky graphics/text.
>
> Altering the width/height of the panel simple increases the size of the
> canvas on which to draw the image, but the text appears the same size
> and thus relatively smaller to the rest of the image. So I don't think
> this would work for printing on a poster.
>
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From arareko at campus.iztacala.unam.mx  Thu Sep 13 10:59:31 2007
From: arareko at campus.iztacala.unam.mx (Mauricio Herrera Cuadra)
Date: Thu, 13 Sep 2007 09:59:31 -0500
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <46E95053.8090300@campus.iztacala.unam.mx>

Try saving the output of your Bio::Graphics image as SVG (with the 
desired proportions between text & graphics), then, at the moment of 
printing, set the desired output size (from the SVG file) and everything 
should be scaled accordingly. That can probably work.

Cheers,
Mauricio.

Nathan Haigh wrote:
> I want to be able to print my Bio::Graphics image on a poster with good
> resolution. What can I do to ensure I don't get blocky graphics/text.
> 
> Altering the width/height of the panel simple increases the size of the
> canvas on which to draw the image, but the text appears the same size
> and thus relatively smaller to the rest of the image. So I don't think
> this would work for printing on a poster.
> 
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 

-- 
MAURICIO HERRERA CUADRA
arareko at campus.iztacala.unam.mx
Laboratorio de Gen?tica
Unidad de Morfofisiolog?a y Funci?n
Facultad de Estudios Superiores Iztacala, UNAM


From jay at jays.net  Fri Sep 14 10:27:38 2007
From: jay at jays.net (Jay Hannah)
Date: Fri, 14 Sep 2007 09:27:38 -0500
Subject: [Bioperl-l] [patch] getGenBank.pl
Message-ID: <1088BA7F-009A-482E-B15E-80D4D59218BE@jays.net>

http://cvs.bioperl.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/ 
examples/db/getGenBank.pl

Using this:
my $seqio = $gb->get_Stream_by_batch([ qw( 124430577 )]);

Throws this warning:
$ ./fetch.pl > 124430577.gbk
get_Stream_by_batch() is deprecated; use get_Stream_by_id() instead
STACK Bio::DB::NCBIHelper::__ANON__ /usr/lib/perl5/Bio/DB/ 
NCBIHelper.pm:261
STACK toplevel ./fetch.pl:17


Can someone with commit access please change getGenBank.pl?

24,25c24,25
< # if you want to get a bunch of sequences use the batch method
< my $seqio = $gb->get_Stream_by_batch([ qw(J00522 AF303112 2981014)]);
---
 > # feel free to pull multiple sequences
 > my $seqio = $gb->get_Stream_by_id([ qw(J00522 AF303112 2981014)]);


The tweaked version works fine for me and the warning goes away.

Thanks,

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah



From cjfields at uiuc.edu  Fri Sep 14 12:36:56 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 14 Sep 2007 11:36:56 -0500
Subject: [Bioperl-l] [patch] getGenBank.pl
In-Reply-To: <1088BA7F-009A-482E-B15E-80D4D59218BE@jays.net>
References: <1088BA7F-009A-482E-B15E-80D4D59218BE@jays.net>
Message-ID: <5255407E-F19E-45B6-9F66-3DC1AB25C0AC@uiuc.edu>

Done.  Thanks for the heads up!

chris

On Sep 14, 2007, at 9:27 AM, Jay Hannah wrote:

> http://cvs.bioperl.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/
> examples/db/getGenBank.pl
>
> Using this:
> my $seqio = $gb->get_Stream_by_batch([ qw( 124430577 )]);
>
> Throws this warning:
> $ ./fetch.pl > 124430577.gbk
> get_Stream_by_batch() is deprecated; use get_Stream_by_id() instead
> STACK Bio::DB::NCBIHelper::__ANON__ /usr/lib/perl5/Bio/DB/
> NCBIHelper.pm:261
> STACK toplevel ./fetch.pl:17
>
>
> Can someone with commit access please change getGenBank.pl?
>
> 24,25c24,25
> < # if you want to get a bunch of sequences use the batch method
> < my $seqio = $gb->get_Stream_by_batch([ qw(J00522 AF303112  
> 2981014)]);
> ---
>> # feel free to pull multiple sequences
>> my $seqio = $gb->get_Stream_by_id([ qw(J00522 AF303112 2981014)]);
>
>
> The tweaked version works fine for me and the warning goes away.
>
> Thanks,
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From MEC at stowers-institute.org  Mon Sep 17 16:15:39 2007
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Mon, 17 Sep 2007 15:15:39 -0500
Subject: [Bioperl-l] Bioperl -- why so old? ... or ...
	Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
Message-ID: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>

Sometime ago, in the ensembl-dev mailing list, mdr wrote:

> > I'm always running into bugs in bioperl that have been fixed in more
recent
> > versions than the version 1-2-3 that the installation document
specifies.  
> > 
> > Just wondering, are there plans to try to move to 1-5 any time soon,
or is that
> > not possible for some reason?  Or, by any chance, is Ensembl
actually compatible
> > with 1-5 and it's just a documentation issue?
> 
> "Ewan Birney" replied
> Ensembl doesn't make heavy use of Bioperl anymore - most of the
critical things
> we re-wrote, mainly due to speed/memory issues. I think the short
answer is that
> it _probably_ works with 1.5, but we don't have a strong desire to
move up
> as certainly there are no problems with the 1.2.3 release we are
using.

FWIW, I have just discovered that the round of bioperl changes in
service of http://www.bioperl.org/wiki/Feature_Annotation_rollback
introduce (additional?) incompatibilities between current bioperl and
the Ensembl Core API.  The changes bring me to obtain and use Bioperl
version 1.2.3 for use in conjunction with Ensemble API application (as
is recommended by Ensembl).

Until now, the ways I have used the Ensembl API appear not to have
been effected by changes in Bioperl; I have successfully used it
in conjunction with the bioperl's leading edge.  Of course there may be
other incompatibilities that I have just not noticed yet.

Evidence of the new incompatibility is present in this back trace,
which bridges between code in current bioperl-live and current
ensembl/modules/Bio:

-------------------- EXCEPTION --------------------
MSG: Operator overloading of AnnotationI is deprecated
STACK Bio::Annotation::DBLink::__ANON__
/home/mec/cvs/bioperl-live/Bio/Annotation/DBLink.pm:59
STACK Bio::EnsEMBL::DBSQL::DBEntryAdaptor::_fetch_by_object_type
/home/mec/cvs/foo/ensembl/modules/Bio/EnsEMBL/DBSQL/DBEntryAdaptor.pm:77
8


Obtaining version 1.2.3 fixes the issue for me.  

This is just a warning to others....

Your milage may vary....

--

Malcolm Cook
Stowers Institute for Medical Research - Kansas City, Missouri
 


From cjfields at uiuc.edu  Mon Sep 17 17:52:55 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 17 Sep 2007 16:52:55 -0500
Subject: [Bioperl-l] Bioperl -- why so old? ... or ...
	Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
In-Reply-To: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>
References: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>
Message-ID: <1CAA1977-45AE-4A8F-815C-4C726DB0E6E4@uiuc.edu>

Malcolm,

I have removed the Bio::Annotation overloading exceptions from  
bioperl-live; they're just more trouble than they're worth right  
now.  Could you try it out and see if that suffices, and drop us a  
note if it doesn't or if you run into other odd issues?  I'll be busy  
until the end of the month but I'll do the best I can to help out.

The rollbacks were fairly simple and essentially reversed, corrected,  
or simplified many changes made prior to the 1.5 release (most of  
which were undocumented and not completely implemented).  They pass  
all current tests and should make BioPerl classes (particularly  
Annotations and SeqFeatures) behave more like 1.4.  Beyond the now- 
removed exceptions it should be fine unless it is in an area of  
already-known incompatibility between BioPerl and Ensembl, some of  
which you've already outlined.

chris

On Sep 17, 2007, at 3:15 PM, Cook, Malcolm wrote:

> ...
> FWIW, I have just discovered that the round of bioperl changes in
> service of http://www.bioperl.org/wiki/Feature_Annotation_rollback
> introduce (additional?) incompatibilities between current bioperl and
> the Ensembl Core API.  The changes bring me to obtain and use Bioperl
> version 1.2.3 for use in conjunction with Ensemble API application (as
> is recommended by Ensembl).
>
> Until now, the ways I have used the Ensembl API appear not to have
> been effected by changes in Bioperl; I have successfully used it
> in conjunction with the bioperl's leading edge.  Of course there  
> may be
> other incompatibilities that I have just not noticed yet.
>
> Evidence of the new incompatibility is present in this back trace,
> which bridges between code in current bioperl-live and current
> ensembl/modules/Bio:
>
> -------------------- EXCEPTION --------------------
> MSG: Operator overloading of AnnotationI is deprecated
> STACK Bio::Annotation::DBLink::__ANON__
> /home/mec/cvs/bioperl-live/Bio/Annotation/DBLink.pm:59
> STACK Bio::EnsEMBL::DBSQL::DBEntryAdaptor::_fetch_by_object_type
> /home/mec/cvs/foo/ensembl/modules/Bio/EnsEMBL/DBSQL/ 
> DBEntryAdaptor.pm:77
> 8
>
>
> Obtaining version 1.2.3 fixes the issue for me.
>
> This is just a warning to others....
>
> Your milage may vary....
>
> --
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri



From MEC at stowers-institute.org  Mon Sep 17 18:14:41 2007
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Mon, 17 Sep 2007 17:14:41 -0500
Subject: [Bioperl-l] Bioperl -- why so old? ... or ...
	Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
In-Reply-To: <1CAA1977-45AE-4A8F-815C-4C726DB0E6E4@uiuc.edu>
References: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>
	<1CAA1977-45AE-4A8F-815C-4C726DB0E6E4@uiuc.edu>
Message-ID: <CED81D34E37D5043A1211565277A51E509514EB3@exchkc02.stowers-institute.org>

Chris,

Removing those exceptions makes my application work with current
bioperl-live again.  Hooray!  Thanks.

But!  I have been warned!

Regards,

Malcolm Cook
Stowers Institute for Medical Research - Kansas City, Missouri
  

> -----Original Message-----
> From: Chris Fields [mailto:cjfields at uiuc.edu] 
> Sent: Monday, September 17, 2007 4:53 PM
> To: Cook, Malcolm
> Cc: bioperl list; ensembl-dev at ebi.ac.uk
> Subject: Re: [Bioperl-l] Bioperl -- why so old? ... or ... 
> Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
> 
> Malcolm,
> 
> I have removed the Bio::Annotation overloading exceptions 
> from bioperl-live; they're just more trouble than they're 
> worth right now.  Could you try it out and see if that 
> suffices, and drop us a note if it doesn't or if you run into 
> other odd issues?  I'll be busy until the end of the month 
> but I'll do the best I can to help out.
> 
> The rollbacks were fairly simple and essentially reversed, 
> corrected, or simplified many changes made prior to the 1.5 
> release (most of which were undocumented and not completely 
> implemented).  They pass all current tests and should make 
> BioPerl classes (particularly Annotations and SeqFeatures) 
> behave more like 1.4.  Beyond the now- removed exceptions it 
> should be fine unless it is in an area of already-known 
> incompatibility between BioPerl and Ensembl, some of which 
> you've already outlined.
> 
> chris
> 
> On Sep 17, 2007, at 3:15 PM, Cook, Malcolm wrote:
> 
> > ...
> > FWIW, I have just discovered that the round of bioperl changes in 
> > service of http://www.bioperl.org/wiki/Feature_Annotation_rollback
> > introduce (additional?) incompatibilities between current 
> bioperl and 
> > the Ensembl Core API.  The changes bring me to obtain and 
> use Bioperl 
> > version 1.2.3 for use in conjunction with Ensemble API 
> application (as 
> > is recommended by Ensembl).
> >
> > Until now, the ways I have used the Ensembl API appear not to have 
> > been effected by changes in Bioperl; I have successfully used it in 
> > conjunction with the bioperl's leading edge.  Of course 
> there may be 
> > other incompatibilities that I have just not noticed yet.
> >
> > Evidence of the new incompatibility is present in this back trace, 
> > which bridges between code in current bioperl-live and current
> > ensembl/modules/Bio:
> >
> > -------------------- EXCEPTION --------------------
> > MSG: Operator overloading of AnnotationI is deprecated STACK 
> > Bio::Annotation::DBLink::__ANON__
> > /home/mec/cvs/bioperl-live/Bio/Annotation/DBLink.pm:59
> > STACK Bio::EnsEMBL::DBSQL::DBEntryAdaptor::_fetch_by_object_type
> > /home/mec/cvs/foo/ensembl/modules/Bio/EnsEMBL/DBSQL/
> > DBEntryAdaptor.pm:77
> > 8
> >
> >
> > Obtaining version 1.2.3 fixes the issue for me.
> >
> > This is just a warning to others....
> >
> > Your milage may vary....
> >
> > --
> >
> > Malcolm Cook
> > Stowers Institute for Medical Research - Kansas City, Missouri
> 
> 
> 


From neetisomaiya at gmail.com  Tue Sep 18 06:30:34 2007
From: neetisomaiya at gmail.com (neeti somaiya)
Date: Tue, 18 Sep 2007 16:00:34 +0530
Subject: [Bioperl-l] A perl regex query
Message-ID: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>

Hi,

This isnt really a bioperl query.
But does anyone know how I can substitute all special characters (+ some
other things) in a string with nothing in perl?
I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.

-- 
-Neeti
Even my blood says, B positive

From spiros at lokku.com  Tue Sep 18 06:57:18 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 18 Sep 2007 11:57:18 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
Message-ID: <bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>

Heya, seperate the items you want to remove by a pipe and add the g
regex flag. For example:

spiros$ echo Cyclic-2,3-bisphospho-D-glycerate | perl -ne ' $_ =~
s at -D-|Cyclic\-@@g ; print $_ ;'
2,3-bisphosphoglycerate

IMHO this is ugly. Best to make an array of all the elements you want
to remove and then iterate through the array, calling the regex each
time with a different element. This way it will be much more easy to
read, debug and maintain.

For example

my $ra_bad_terms = [  '-D-', 'Cyclic-' ] ;

foreach (@$ra_bad_terms) {
   $string =~ s@$_@@g ;
}

etc.

Dont forget escaping and \Q \E if needed.

Spiros



On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
> Hi,
>
> This isnt really a bioperl query.
> But does anyone know how I can substitute all special characters (+ some
> other things) in a string with nothing in perl?
> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
>
> --
> -Neeti
> Even my blood says, B positive
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From n.haigh at sheffield.ac.uk  Tue Sep 18 07:44:14 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Tue, 18 Sep 2007 12:44:14 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
Message-ID: <46EFBA0E.4030104@sheffield.ac.uk>

An even better way is to use the array as Spiros suggested, but you
should then be able to use that in the regex like this:

my @ra_bad_terms = (  '-D-', 'Cyclic-' );
$string =~ s/@ra_bad_terms//g;

Again you might need escaping with \Q and \E - can't remember off hand.

You might also want to look here:
http://www.perl.com/pub/a/2002/06/04/apo5.html?page=15

Cheers
Nath



Spiros Denaxas wrote:
> Heya, seperate the items you want to remove by a pipe and add the g
> regex flag. For example:
>
> spiros$ echo Cyclic-2,3-bisphospho-D-glycerate | perl -ne ' $_ =~
> s at -D-|Cyclic\-@@g ; print $_ ;'
> 2,3-bisphosphoglycerate
>
> IMHO this is ugly. Best to make an array of all the elements you want
> to remove and then iterate through the array, calling the regex each
> time with a different element. This way it will be much more easy to
> read, debug and maintain.
>
> For example
>
> my $ra_bad_terms = [  '-D-', 'Cyclic-' ] ;
>
> foreach (@$ra_bad_terms) {
>    $string =~ s@$_@@g ;
> }
>
> etc.
>
> Dont forget escaping and \Q \E if needed.
>
> Spiros
>
>
>
> On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
>   
>> Hi,
>>
>> This isnt really a bioperl query.
>> But does anyone know how I can substitute all special characters (+ some
>> other things) in a string with nothing in perl?
>> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
>> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
>>
>> --
>> -Neeti
>> Even my blood says, B positive
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>     
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>   


From neetisomaiya at gmail.com  Tue Sep 18 08:13:42 2007
From: neetisomaiya at gmail.com (neeti somaiya)
Date: Tue, 18 Sep 2007 17:43:42 +0530
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFBE8A.6080402@cam.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
Message-ID: <764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>

Thanks.
It might work, but not always, because the string could be somthing like
Cyclic-2,3-Bisphospho-D-Glycerate.
Here I will first convert the full thing to a lower case and would then try
to get what I want.

Nothing seems to work, when I try to substitute -D- with nothing, "D" and
"-" when occuring separately also get substituted with nothing.

On 9/18/07, Roy Chaudhuri <rrc22 at cam.ac.uk> wrote:
>
> > This isnt really a bioperl query.
> > But does anyone know how I can substitute all special characters (+ some
> > other things) in a string with nothing in perl?
> > I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I
> want
> > ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
> >
>
> A more general approach that might work is to keep lower case words (I
> don't know if that will be true for all your cases):
>
> $_='Cyclic-2,3-bisphospho-D-glycerate';
> print join '', /\b[a-z]+\b/g;
>
> Roy.
> --
> Dr. Roy Chaudhuri
> Department of Veterinary Medicine
> University of Cambridge, U.K.
>



-- 
-Neeti
Even my blood says, B positive

From ak at ebi.ac.uk  Tue Sep 18 08:20:32 2007
From: ak at ebi.ac.uk (Andreas Kahari)
Date: Tue, 18 Sep 2007 13:20:32 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
Message-ID: <20070918122032.GV14066@ebi.ac.uk>

On Tue, Sep 18, 2007 at 04:00:34PM +0530, neeti somaiya wrote:
> Hi,
> 
> This isnt really a bioperl query.
> But does anyone know how I can substitute all special characters (+ some
> other things) in a string with nothing in perl?
> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.

This is in additions to the suggestions you've already had.

If you always want to concatenate the 3rd and 5th part of the string, as
delimited by dashes, then you could do this:

  my $string = 'Cyclic-2,3-bisphospho-D-glycerate';
  my $newstring = join( '', ( split( /-/, $string ) )[ 2, 4 ] );


Cheers,
Andreas

-- 
Andreas K?h?ri :: Ensembl Software Developer
European Bioinformatics Institute (EMBL-EBI)
--------------------------------------------

From spiros at lokku.com  Tue Sep 18 08:23:49 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 18 Sep 2007 13:23:49 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
Message-ID: <bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>

Its not impossibe, you just have to use \b to denote the word boundaries :)

echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'

this-is-a_teststring-D

It only gets rid of -D- , all other occurrences of D and - remain intact.

Spiros


On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
> Thanks.
> It might work, but not always, because the string could be somthing like
> Cyclic-2,3-Bisphospho-D-Glycerate.
> Here I will first convert the full thing to a lower case and would then try
> to get what I want.
>
> Nothing seems to work, when I try to substitute -D- with nothing, "D" and
> "-" when occuring separately also get substituted with nothing.
>
> On 9/18/07, Roy Chaudhuri <rrc22 at cam.ac.uk> wrote:
> >
> > > This isnt really a bioperl query.
> > > But does anyone know how I can substitute all special characters (+ some
> > > other things) in a string with nothing in perl?
> > > I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I
> > want
> > > ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
> > >
> >
> > A more general approach that might work is to keep lower case words (I
> > don't know if that will be true for all your cases):
> >
> > $_='Cyclic-2,3-bisphospho-D-glycerate';
> > print join '', /\b[a-z]+\b/g;
> >
> > Roy.
> > --
> > Dr. Roy Chaudhuri
> > Department of Veterinary Medicine
> > University of Cambridge, U.K.
> >
>
>
>
> --
> -Neeti
> Even my blood says, B positive
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From rrc22 at cam.ac.uk  Tue Sep 18 08:03:22 2007
From: rrc22 at cam.ac.uk (Roy Chaudhuri)
Date: Tue, 18 Sep 2007 13:03:22 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
Message-ID: <46EFBE8A.6080402@cam.ac.uk>

> This isnt really a bioperl query.
> But does anyone know how I can substitute all special characters (+ some
> other things) in a string with nothing in perl?
> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
> 

A more general approach that might work is to keep lower case words (I 
don't know if that will be true for all your cases):

$_='Cyclic-2,3-bisphospho-D-glycerate';
print join '', /\b[a-z]+\b/g;

Roy.
--
Dr. Roy Chaudhuri
Department of Veterinary Medicine
University of Cambridge, U.K.

From neetisomaiya at gmail.com  Tue Sep 18 08:47:18 2007
From: neetisomaiya at gmail.com (neeti somaiya)
Date: Tue, 18 Sep 2007 18:17:18 +0530
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
Message-ID: <764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>

My actual problem is a bit more complicated.
It is not just one string, nut lakhs of them, they are actually names of
chemical compounds.

THe problem is there are 2 different data sources, I need to match the
compond names between them, but the problem is though the compound may be
the same in the two, they use different naming formats for them.

eg 1 : Glucose
DB1 : D-glucose
DB2 : alpha-D-Glucose

eg2 : 2,3-bisphosphoglycerate
DB1 : Cyclic-2,3-bisphospho-D-Glycerate
DB2 : 2,3 bisphoshpglycerate

And there are some simple examples, there are even more complicated ones,
with many digits, alhas, betas, hyphens, S, R, cis, trans etc etc.

I just want to see if the basic compond is the same, i.e. the first one will
be glucose and second one will be 2,3-biphosphoglycerate (can't take just
bisphosphoglycerate because 1,3-bisphosphoglycerate would mean something
else).

Anyone has any suggestions how to tackle this?

Thanks.

On 9/18/07, Spiros Denaxas <spiros at lokku.com> wrote:
>
> Its not impossibe, you just have to use \b to denote the word boundaries
> :)
>
> echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'
>
> this-is-a_teststring-D
>
> It only gets rid of -D- , all other occurrences of D and - remain intact.
>
> Spiros
>
>
> On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
> > Thanks.
> > It might work, but not always, because the string could be somthing like
> > Cyclic-2,3-Bisphospho-D-Glycerate.
> > Here I will first convert the full thing to a lower case and would then
> try
> > to get what I want.
> >
> > Nothing seems to work, when I try to substitute -D- with nothing, "D"
> and
> > "-" when occuring separately also get substituted with nothing.
> >
> > On 9/18/07, Roy Chaudhuri <rrc22 at cam.ac.uk> wrote:
> > >
> > > > This isnt really a bioperl query.
> > > > But does anyone know how I can substitute all special characters (+
> some
> > > > other things) in a string with nothing in perl?
> > > > I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and
> I
> > > want
> > > > ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3-
> etc.
> > > >
> > >
> > > A more general approach that might work is to keep lower case words (I
> > > don't know if that will be true for all your cases):
> > >
> > > $_='Cyclic-2,3-bisphospho-D-glycerate';
> > > print join '', /\b[a-z]+\b/g;
> > >
> > > Roy.
> > > --
> > > Dr. Roy Chaudhuri
> > > Department of Veterinary Medicine
> > > University of Cambridge, U.K.
> > >
> >
> >
> >
> > --
> > -Neeti
> > Even my blood says, B positive
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
>



-- 
-Neeti
Even my blood says, B positive

From spiros at lokku.com  Tue Sep 18 08:56:44 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 18 Sep 2007 13:56:44 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFCA4E.5090605@sendu.me.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<46EFCA4E.5090605@sendu.me.uk>
Message-ID: <bba689ec0709180556q5f23e8a7ub50302891e0c3849@mail.gmail.com>

On 9/18/07, Sendu Bala <bix at sendu.me.uk> wrote:
> Spiros Denaxas wrote:
> > Its not impossibe, you just have to use \b to denote the word boundaries :)
> >
> > echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'
> >
> > this-is-a_teststring-D
> >
> > It only gets rid of -D- , all other occurrences of D and - remain intact.
>
> I'm confused. The simpler:
>
> echo 'this-is-a_test-D-string-D' | perl -ne ' s/-D-//g ; print ;'
>
> gives the same answer. You'd have to something very strange for a regex
> on -D- to match D or - alone.
>

Its the same thing. He was just mixing up character classes in the regex.

Spiros

From bix at sendu.me.uk  Tue Sep 18 08:53:34 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 18 Sep 2007 13:53:34 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<46EFBE8A.6080402@cam.ac.uk>	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
Message-ID: <46EFCA4E.5090605@sendu.me.uk>

Spiros Denaxas wrote:
> Its not impossibe, you just have to use \b to denote the word boundaries :)
> 
> echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'
> 
> this-is-a_teststring-D
> 
> It only gets rid of -D- , all other occurrences of D and - remain intact.

I'm confused. The simpler:

echo 'this-is-a_test-D-string-D' | perl -ne ' s/-D-//g ; print ;'

gives the same answer. You'd have to something very strange for a regex 
on -D- to match D or - alone.

From rrc22 at cam.ac.uk  Tue Sep 18 09:26:47 2007
From: rrc22 at cam.ac.uk (Roy Chaudhuri)
Date: Tue, 18 Sep 2007 14:26:47 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	
	<46EFBE8A.6080402@cam.ac.uk>	
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>	
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
Message-ID: <46EFD217.1030103@cam.ac.uk>

> My actual problem is a bit more complicated.
> It is not just one string, nut lakhs of them, they are actually names of 
> chemical compounds.
> 
> THe problem is there are 2 different data sources, I need to match the 
> compond names between them, but the problem is though the compound may 
> be the same in the two, they use different naming formats for them.

Unless you can define in simple and precise terms exactly which parts of 
the string you need then there is no way that you will be able to code a 
solution in Perl.

Maybe you could look for a database that contains the synonyms for each 
molecule? A quick Google finds ChEBI (http://www.ebi.ac.uk/chebi), which 
is available to download as flat files.

Roy.
--
Dr. Roy Chaudhuri
Department of Veterinary Medicine
University of Cambridge, U.K.

From js5 at sanger.ac.uk  Tue Sep 18 08:58:36 2007
From: js5 at sanger.ac.uk (James Smith)
Date: Tue, 18 Sep 2007 13:58:36 +0100 (BST)
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <20070918122032.GV14066@ebi.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<20070918122032.GV14066@ebi.ac.uk>
Message-ID: <Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>


Neeti,

This isn't really a bioperl query - but I will try and explain a simple
solution...

warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );

sub simplify {
   local $_ = "-$_[0]-";
         ## Quick hack add -'s at start and end! as always match "-string-"
   s/-(
     Cyclic | # The prefix "cyclic"
     \d+    | # a single number between two "-"s
     \d+,\d+| # number,number between two "-"s
     \w       # a single letter between two "-"s
   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
         ## 0-width +ve lookahead assertion - so can match
         ## multiple consecutive -x- constructions in same regexp!
   s/-//g;
         ## remove remaining "-"s from string...
}

Not sure what other test strings you may want - but most should be able to
fit in the () brackets in the first regexp of simplify

James

On Tue, 18 Sep 2007, Andreas Kahari wrote:

> On Tue, Sep 18, 2007 at 04:00:34PM +0530, neeti somaiya wrote:
>> Hi,
>>
>> This isnt really a bioperl query.
>> But does anyone know how I can substitute all special characters (+ some
>> other things) in a string with nothing in perl?
>> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
>> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
>
> This is in additions to the suggestions you've already had.
>
> If you always want to concatenate the 3rd and 5th part of the string, as
> delimited by dashes, then you could do this:
>
>  my $string = 'Cyclic-2,3-bisphospho-D-glycerate';
>  my $newstring = join( '', ( split( /-/, $string ) )[ 2, 4 ] );
>
>
> Cheers,
> Andreas
>
> -- 
> Andreas K?h?ri :: Ensembl Software Developer
> European Bioinformatics Institute (EMBL-EBI)
> --------------------------------------------
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 


From stefan.kirov at bms.com  Tue Sep 18 09:05:16 2007
From: stefan.kirov at bms.com (Stefan Kirov)
Date: Tue, 18 Sep 2007 09:05:16 -0400
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
Message-ID: <46EFCD0C.3010306@bms.com>

neeti somaiya wrote:
> My actual problem is a bit more complicated.
> It is not just one string, nut lakhs of them, they are actually names of
> chemical compounds.
>
> THe problem is there are 2 different data sources, I need to match the
> compond names between them, but the problem is though the compound may be
> the same in the two, they use different naming formats for them.
>
> eg 1 : Glucose
> DB1 : D-glucose
> DB2 : alpha-D-Glucose
>
> eg2 : 2,3-bisphosphoglycerate
> DB1 : Cyclic-2,3-bisphospho-D-Glycerate
> DB2 : 2,3 bisphoshpglycerate
>   
It seems to me you are trying to match 2 collections of chemical
compounds. If you need to do this reliably you need to use canonical
smiles (perhaps there are other solutions but I am not aware of them).
There are many resources for that, including open-source:
http://openbabel.sourceforge.net/wiki/Main_Page
It is not really bioperl's cup of tea, this is much more a
chemi-informatics problem. I am not sure if there is a need for bioperl
to be extended this way- any thoughts on that?
Hope this helps, regards
Stefan
> And there are some simple examples, there are even more complicated ones,
> with many digits, alhas, betas, hyphens, S, R, cis, trans etc etc.
>
> I just want to see if the basic compond is the same, i.e. the first one will
> be glucose and second one will be 2,3-biphosphoglycerate (can't take just
> bisphosphoglycerate because 1,3-bisphosphoglycerate would mean something
> else).
>
> Anyone has any suggestions how to tackle this?
>
> Thanks.
>
> On 9/18/07, Spiros Denaxas <spiros at lokku.com> wrote:
>   
>> Its not impossibe, you just have to use \b to denote the word boundaries
>> :)
>>
>> echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'
>>
>> this-is-a_teststring-D
>>
>> It only gets rid of -D- , all other occurrences of D and - remain intact.
>>
>> Spiros
>>
>>
>> On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
>>     
>>> Thanks.
>>> It might work, but not always, because the string could be somthing like
>>> Cyclic-2,3-Bisphospho-D-Glycerate.
>>> Here I will first convert the full thing to a lower case and would then
>>>       
>> try
>>     
>>> to get what I want.
>>>
>>> Nothing seems to work, when I try to substitute -D- with nothing, "D"
>>>       
>> and
>>     
>>> "-" when occuring separately also get substituted with nothing.
>>>
>>> On 9/18/07, Roy Chaudhuri <rrc22 at cam.ac.uk> wrote:
>>>       
>>>>> This isnt really a bioperl query.
>>>>> But does anyone know how I can substitute all special characters (+
>>>>>           
>> some
>>     
>>>>> other things) in a string with nothing in perl?
>>>>> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and
>>>>>           
>> I
>>     
>>>> want
>>>>         
>>>>> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3-
>>>>>           
>> etc.
>>     
>>>> A more general approach that might work is to keep lower case words (I
>>>> don't know if that will be true for all your cases):
>>>>
>>>> $_='Cyclic-2,3-bisphospho-D-glycerate';
>>>> print join '', /\b[a-z]+\b/g;
>>>>
>>>> Roy.
>>>> --
>>>> Dr. Roy Chaudhuri
>>>> Department of Veterinary Medicine
>>>> University of Cambridge, U.K.
>>>>
>>>>         
>>>
>>> --
>>> -Neeti
>>> Even my blood says, B positive
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>       
>
>
>
>   


From stephane.teletchea at jouy.inra.fr  Tue Sep 18 09:48:05 2007
From: stephane.teletchea at jouy.inra.fr (=?ISO-8859-1?Q?St=E9phane_T=E9letch=E9a?=)
Date: Tue, 18 Sep 2007 15:48:05 +0200
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<46EFBE8A.6080402@cam.ac.uk>	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
Message-ID: <46EFD715.4060308@jouy.inra.fr>

neeti somaiya a ?crit :
> My actual problem is a bit more complicated.
> It is not just one string, nut lakhs of them, they are actually names of
> chemical compounds.
> 
> THe problem is there are 2 different data sources, I need to match the
> compond names between them, but the problem is though the compound may be
> the same in the two, they use different naming formats for them.
> 
> eg 1 : Glucose
> DB1 : D-glucose
> DB2 : alpha-D-Glucose
> 
> eg2 : 2,3-bisphosphoglycerate
> DB1 : Cyclic-2,3-bisphospho-D-Glycerate
> DB2 : 2,3 bisphoshpglycerate
> 
> And there are some simple examples, there are even more complicated ones,
> with many digits, alhas, betas, hyphens, S, R, cis, trans etc etc.
> 
> I just want to see if the basic compond is the same, i.e. the first one will
> be glucose and second one will be 2,3-biphosphoglycerate (can't take just
> bisphosphoglycerate because 1,3-bisphosphoglycerate would mean something
> else).
> 
> Anyone has any suggestions how to tackle this?
> 

I would use a two step approach :
1 - filter the entries, use a convention, for instance translata all '+' 
into their 'plus' literal equivalent, change spaces by '_', change all 
'-' for '_' also, etc
2 - try matching the result, if the match does not work, try to match 
some characters (for instance, try to remove all non alphabetical 
characters and see if the resulting produces a match).

That's theory, now, you have some time for errors and trials, but i 
think there is not essay, one shot solution, neither a bioperl facility 
for handling (bio)chemical compounds.

Cheers,
St?phane

-- 
St?phane T?letch?a, PhD.                  http://www.steletch.org
Unit? Math?matique Informatique et G?nome http://migale.jouy.inra.fr/mig
INRA, Domaine de Vilvert                  T?l : (33) 134 652 891
78352 Jouy-en-Josas cedex, France         Fax : (33) 134 652 901

From puetz at mpipsykl.mpg.de  Tue Sep 18 10:12:47 2007
From: puetz at mpipsykl.mpg.de (Benno Puetz)
Date: Tue, 18 Sep 2007 16:12:47 +0200
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<20070918122032.GV14066@ebi.ac.uk>
	<Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
Message-ID: <46EFDCDF.6030309@mpipsykl.mpg.de>

James Smith wrote:
>
> Neeti,
>
> This isn't really a bioperl query - but I will try and explain a simple
> solution...
>
> warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );
>
> sub simplify {
>   local $_ = "-$_[0]-";
>         ## Quick hack add -'s at start and end! as always match 
> "-string-"
>   s/-(
>     Cyclic | # The prefix "cyclic"
>     \d+    | # a single number between two "-"s
>     \d+,\d+| # number,number between two "-"s
>     \w       # a single letter between two "-"s
>   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
>         ## 0-width +ve lookahead assertion - so can match
>         ## multiple consecutive -x- constructions in same regexp!
>   s/-//g;
>         ## remove remaining "-"s from string...
> }
>
> Not sure what other test strings you may want - but most should be 
> able to
> fit in the () brackets in the first regexp of simplify
>
> James
Along the same line

# some test for most of the removals below
my $string = "Alpha-Cyclic-2,3-bi-sphos-1,2,5-pho-D-beta-glycerate";
my @ra_bad_terms = (  '-?(D|R|S)-',
                      '-?([aA]lpha|[bB]eta|[gG]amma)-',
                      '-?([cC]is|[tT]rans)-',
                      '-?[cC]yclic-',
                    # '-?\d+(,\d+)+-',   # uncomment to remove numbers, too
                      '(?<!\d)-' );          # '-' following number
print "$string\n";
foreach ( @ra_bad_terms ){

  eval { $string =~ s/$_//g; };
  print "$_:$string\n";   # for feedback only
}
#$string =~ s/<@ra_bad_terms>//g;

print lc($string),"\n";


-- 
Benno P?tz
Statistische Genetik
Max-Planck-Institut f. Psychiatrie            Tel.: +49-89-30622-222
Kraepelinstr. 10                              Fax : +49-89-30622-601
80804 M?nchen, Germany


From spiros at lokku.com  Tue Sep 18 10:41:20 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 18 Sep 2007 15:41:20 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFDCDF.6030309@mpipsykl.mpg.de>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<20070918122032.GV14066@ebi.ac.uk>
	<Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
	<46EFDCDF.6030309@mpipsykl.mpg.de>
Message-ID: <bba689ec0709180741s13b358e3l1b326a47700259a6@mail.gmail.com>

On 9/18/07, Benno Puetz <puetz at mpipsykl.mpg.de> wrote:
> James Smith wrote:
> >
> > Neeti,
> >
> > This isn't really a bioperl query - but I will try and explain a simple
> > solution...
> >
> > warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );
> >
> > sub simplify {
> >   local $_ = "-$_[0]-";
> >         ## Quick hack add -'s at start and end! as always match
> > "-string-"
> >   s/-(
> >     Cyclic | # The prefix "cyclic"
> >     \d+    | # a single number between two "-"s
> >     \d+,\d+| # number,number between two "-"s
> >     \w       # a single letter between two "-"s
> >   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
> >         ## 0-width +ve lookahead assertion - so can match
> >         ## multiple consecutive -x- constructions in same regexp!
> >   s/-//g;
> >         ## remove remaining "-"s from string...
> > }
> >
> > Not sure what other test strings you may want - but most should be
> > able to
> > fit in the () brackets in the first regexp of simplify
> >
> > James
> Along the same line
>
> # some test for most of the removals below
> my $string = "Alpha-Cyclic-2,3-bi-sphos-1,2,5-pho-D-beta-glycerate";
> my @ra_bad_terms = (  '-?(D|R|S)-',
>                       '-?([aA]lpha|[bB]eta|[gG]amma)-',
>                       '-?([cC]is|[tT]rans)-',
>                       '-?[cC]yclic-',
>                     # '-?\d+(,\d+)+-',   # uncomment to remove numbers, too
>                       '(?<!\d)-' );          # '-' following number
> print "$string\n";
> foreach ( @ra_bad_terms ){
>
>   eval { $string =~ s/$_//g; };
>   print "$_:$string\n";   # for feedback only
> }
> #$string =~ s/<@ra_bad_terms>//g;
>
> print lc($string),"\n";
>
>
> --
> Benno P?tz

My humble opinion would be to avoid using regular expressions to do
your task and try and locate a more valid and centralized information
repository to use, be it a database of synonyms or some other indexing
code. This will add the required domain knowledge in your solution.
Using regular expressions will almost certainly lead to problems and
bugs which will be very hard to resolve.
Should you decide to go forward and treat everything simply as strings
and compare them, I feel this is more of an NLP problem.

Spiros


From cjfields at uiuc.edu  Tue Sep 18 11:24:52 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 10:24:52 -0500
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFD217.1030103@cam.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	
	<46EFBE8A.6080402@cam.ac.uk>	
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>	
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
	<46EFD217.1030103@cam.ac.uk>
Message-ID: <155C67C0-1F81-4A1C-AD68-A21B4E6918C9@uiuc.edu>


On Sep 18, 2007, at 8:26 AM, Roy Chaudhuri wrote:

>> My actual problem is a bit more complicated.
>> It is not just one string, nut lakhs of them, they are actually  
>> names of
>> chemical compounds.
>>
>> THe problem is there are 2 different data sources, I need to match  
>> the
>> compond names between them, but the problem is though the compound  
>> may
>> be the same in the two, they use different naming formats for them.
>
> Unless you can define in simple and precise terms exactly which  
> parts of
> the string you need then there is no way that you will be able to  
> code a
> solution in Perl.
>
> Maybe you could look for a database that contains the synonyms for  
> each
> molecule? A quick Google finds ChEBI (http://www.ebi.ac.uk/chebi),  
> which
> is available to download as flat files.
>
> Roy.
> --
> Dr. Roy Chaudhuri
> Department of Veterinary Medicine
> University of Cambridge, U.K.

D'oh!  Roy beat me to it; that's what I was going to suggest.  I  
agree; don't trust simple word munging to always get you the correct  
answer in this case, it's just too complicated to try and catch every  
case.

ChEBI is a good choice; Stefan's suggestion of OpenBabel is also a  
good one.  I would also try not to reinvent the wheel; there may be  
some modules available via CPAN which do what you need, such as these:

http://search.cpan.org/search?query=chem&mode=module

or this:

http://search.cpan.org/~ghutchis/Chemistry-OpenBabel-1.2.0/

chris

From shameer at ncbs.res.in  Tue Sep 18 10:57:55 2007
From: shameer at ncbs.res.in (Shameer Khadar)
Date: Tue, 18 Sep 2007 20:27:55 +0530 (IST)
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFDCDF.6030309@mpipsykl.mpg.de>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<20070918122032.GV14066@ebi.ac.uk>
	<Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
	<46EFDCDF.6030309@mpipsykl.mpg.de>
Message-ID: <53713.192.168.1.1.1190127475.squirrel@mail.ncbs.res.in>

I used this module for my simple chemoinformatics tasks,

http://www.perlmol.org/ - PerlMol - Perl Modules for Molecular Chemistry
Please explore, you may find something useful.

-- 



> James Smith wrote:
>>
>> Neeti,
>>
>> This isn't really a bioperl query - but I will try and explain a simple
>> solution...
>>
>> warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );
>>
>> sub simplify {
>>   local $_ = "-$_[0]-";
>>         ## Quick hack add -'s at start and end! as always match
>> "-string-"
>>   s/-(
>>     Cyclic | # The prefix "cyclic"
>>     \d+    | # a single number between two "-"s
>>     \d+,\d+| # number,number between two "-"s
>>     \w       # a single letter between two "-"s
>>   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
>>         ## 0-width +ve lookahead assertion - so can match
>>         ## multiple consecutive -x- constructions in same regexp!
>>   s/-//g;
>>         ## remove remaining "-"s from string...
>> }
>>
>> Not sure what other test strings you may want - but most should be
>> able to
>> fit in the () brackets in the first regexp of simplify
>>
>> James
> Along the same line
>
> # some test for most of the removals below
> my $string = "Alpha-Cyclic-2,3-bi-sphos-1,2,5-pho-D-beta-glycerate";
> my @ra_bad_terms = (  '-?(D|R|S)-',
>                       '-?([aA]lpha|[bB]eta|[gG]amma)-',
>                       '-?([cC]is|[tT]rans)-',
>                       '-?[cC]yclic-',
>                     # '-?\d+(,\d+)+-',   # uncomment to remove numbers,
> too
>                       '(?<!\d)-' );          # '-' following number
> print "$string\n";
> foreach ( @ra_bad_terms ){
>
>   eval { $string =~ s/$_//g; };
>   print "$_:$string\n";   # for feedback only
> }
> #$string =~ s/<@ra_bad_terms>//g;
>
> print lc($string),"\n";
>
>
> --
> Benno P?tz
> Statistische Genetik
> Max-Planck-Institut f. Psychiatrie            Tel.: +49-89-30622-222
> Kraepelinstr. 10                              Fax : +49-89-30622-601
> 80804 M?nchen, Germany
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


-- 
Shameer Khadar
Prof. R. Sowdhamini's Lab (# 25) The Computational Biology Group
National Centre for Biological Sciences (TIFR)
GKVK Campus, Bellary Road, Bangalore - 65, Karnataka - India
T - 91-080-23666001 EXT - 6251
W - http://www.ncbs.res.in


From js5 at sanger.ac.uk  Tue Sep 18 11:37:57 2007
From: js5 at sanger.ac.uk (James Smith)
Date: Tue, 18 Sep 2007 16:37:57 +0100 (BST)
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <bba689ec0709180741s13b358e3l1b326a47700259a6@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<20070918122032.GV14066@ebi.ac.uk>
	<Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
	<46EFDCDF.6030309@mpipsykl.mpg.de>
	<bba689ec0709180741s13b358e3l1b326a47700259a6@mail.gmail.com>
Message-ID: <Pine.LNX.4.64.0709181632450.28437@cbi4a.internal.sanger.ac.uk>



On Tue, 18 Sep 2007, Spiros Denaxas wrote:

> On 9/18/07, Benno Puetz <puetz at mpipsykl.mpg.de> wrote:
> James Smith wrote:
> >
> > Neeti,
> >
> > This isn't really a bioperl query - but I will try and explain a simple
> > solution...
> >
> > warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );
> >
> > sub simplify {
> >   local $_ = "-$_[0]-";
> >         ## Quick hack add -'s at start and end! as always match
> > "-string-"
> >   s/-(
> >     Cyclic | # The prefix "cyclic"
> >     \d+    | # a single number between two "-"s
> >     \d+,\d+| # number,number between two "-"s
> >     \w       # a single letter between two "-"s
> >   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
> >         ## 0-width +ve lookahead assertion - so can match
> >         ## multiple consecutive -x- constructions in same regexp!
> >   s/-//g;
> >         ## remove remaining "-"s from string...
> > }
> >
> > Not sure what other test strings you may want - but most should be
> > able to
> > fit in the () brackets in the first regexp of simplify
> >
> > James
> Along the same line
>

But the point is you don't need to loop over things....


Updated regexp...


sub simplify {
   local $_ = "-$_[0]-";             # Add '-' at start and end!
   s{-(
     [cC]yclic                     | # The prefix "cyclic"
     [aA]lpha | [bB]eta | [gG]amma | # Alpha/beta/gamma
     [tT]rans | [cC]is             | # Trans/cis
     [DRS]                         | # Single letter "D","R" or "S"
#    \d+(,\d+)*                   | # list of 1 or more "," separated nos
   )(?=-)}{}xg;                      # No. list currently commented out!
   s/-//g;                           # remove all "-"
   s/([^\d,])([\d,])/\1-\2/g;        # re-introduce "-" between number/
   s/([\d,])([^\d,])/\1-\2/g;        #  comma and letters
   s/--/-/g;                         # remove duplicate "-" signs..
   return $_;
}




-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 

From cjfields at uiuc.edu  Tue Sep 18 11:38:04 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 10:38:04 -0500
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFCD0C.3010306@bms.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
	<46EFCD0C.3010306@bms.com>
Message-ID: <68EC5D58-9D84-4692-BD99-F53FC75FD0E7@uiuc.edu>


On Sep 18, 2007, at 8:05 AM, Stefan Kirov wrote:

> neeti somaiya wrote:
>> ...
> It seems to me you are trying to match 2 collections of chemical
> compounds. If you need to do this reliably you need to use canonical
> smiles (perhaps there are other solutions but I am not aware of them).
> There are many resources for that, including open-source:
> http://openbabel.sourceforge.net/wiki/Main_Page
> It is not really bioperl's cup of tea, this is much more a
> chemi-informatics problem. I am not sure if there is a need for  
> bioperl
> to be extended this way- any thoughts on that?
> Hope this helps, regards
> Stefan

I would vote nyet myself unless I was convinced that this would be  
beneficial to bioperl core.  Right now I'm not yet there, primarily b/ 
c of the already available OpenBabel (with available CPAN interface)  
and other resources, not to mention there are too many areas in  
bioperl which need more focus (tests, documentation, etc).

However, if we do want to incorporate chemi-informatics at some point  
it could be something which is not integrated into the core  
architecture and can be installed separately (like network, ext, db,  
etc).

chris

From bioperl-list at superfrink.net  Tue Sep 18 12:16:48 2007
From: bioperl-list at superfrink.net (bioperl-list at superfrink.net)
Date: Tue, 18 Sep 2007 10:16:48 -0600 (MDT)
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFBA0E.4030104@sheffield.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
	<46EFBA0E.4030104@sheffield.ac.uk>
Message-ID: <Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>

On Tue, 18 Sep 2007, Nathan Haigh wrote:

> An even better way is to use the array as Spiros suggested, but you
> should then be able to use that in the regex like this:
>
> my @ra_bad_terms = (  '-D-', 'Cyclic-' );
> $string =~ s/@ra_bad_terms//g;

I didn't know one could do that.  I couldn't get it to work so I asked 
around.  In case anyone else read it and thought about using that code it 
might only work in Perl 6.

Regards,
Chad

From bix at sendu.me.uk  Tue Sep 18 13:21:06 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 18 Sep 2007 18:21:06 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>
	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
Message-ID: <46F00902.9070401@sendu.me.uk>

bioperl-list at superfrink.net wrote:
> On Tue, 18 Sep 2007, Nathan Haigh wrote:
> 
>> An even better way is to use the array as Spiros suggested, but you
>> should then be able to use that in the regex like this:
>>
>> my @ra_bad_terms = (  '-D-', 'Cyclic-' );
>> $string =~ s/@ra_bad_terms//g;
> 
> I didn't know one could do that.  I couldn't get it to work so I asked 
> around.  In case anyone else read it and thought about using that code it 
> might only work in Perl 6.

I assumed it was a typo. You can get it to work by adding

$" = '|';

before the regex;

From cjfields at uiuc.edu  Tue Sep 18 13:52:00 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 12:52:00 -0500
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
	<46EFBA0E.4030104@sheffield.ac.uk>
	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
Message-ID: <F7ADCFDC-D065-4401-AF1F-F53D6958CF37@uiuc.edu>


On Sep 18, 2007, at 11:16 AM, bioperl-list at superfrink.net wrote:

> On Tue, 18 Sep 2007, Nathan Haigh wrote:
>
>> An even better way is to use the array as Spiros suggested, but you
>> should then be able to use that in the regex like this:
>>
>> my @ra_bad_terms = (  '-D-', 'Cyclic-' );
>> $string =~ s/@ra_bad_terms//g;
>
> I didn't know one could do that.  I couldn't get it to work so I asked
> around.  In case anyone else read it and thought about using that  
> code it
> might only work in Perl 6.
>
> Regards,
> Chad

I think the problem is what s/@terms//g means.  To most it means  
group substitutions, which you can get by using s/(?:a|b|c|d)//g; to  
others it means stepwise 's/$old//g for $old (@terms)'.

To go from an array of terms to an optimized group regex, use  
Regexp::List (CPAN to the rescue!):

http://search.cpan.org/~dankogai/Regexp-Optimizer-0.15/lib/Regexp/ 
List.pm

chris

From cjfields at uiuc.edu  Tue Sep 18 14:23:37 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 13:23:37 -0500
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46F00902.9070401@sendu.me.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>
	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
	<46F00902.9070401@sendu.me.uk>
Message-ID: <5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>


On Sep 18, 2007, at 12:21 PM, Sendu Bala wrote:

> bioperl-list at superfrink.net wrote:
>> On Tue, 18 Sep 2007, Nathan Haigh wrote:
>>
>>> An even better way is to use the array as Spiros suggested, but you
>>> should then be able to use that in the regex like this:
>>>
>>> my @ra_bad_terms = (  '-D-', 'Cyclic-' );
>>> $string =~ s/@ra_bad_terms//g;
>>
>> I didn't know one could do that.  I couldn't get it to work so I  
>> asked
>> around.  In case anyone else read it and thought about using that  
>> code it
>> might only work in Perl 6.
>
> I assumed it was a typo. You can get it to work by adding
>
> $" = '|';
>
> before the regex;

Ah, didn't know that one.  Nice, though shouldn't it be localized?

The (supposed) advantage of Regexp::List is the regex is optimized  
for speed; I haven't tried it out myself, so YMMV.

chris

From stefan.kirov at bms.com  Tue Sep 18 14:54:49 2007
From: stefan.kirov at bms.com (Stefan Kirov)
Date: Tue, 18 Sep 2007 14:54:49 -0400
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <155C67C0-1F81-4A1C-AD68-A21B4E6918C9@uiuc.edu>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
	<46EFD217.1030103@cam.ac.uk>
	<155C67C0-1F81-4A1C-AD68-A21B4E6918C9@uiuc.edu>
Message-ID: <46F01EF9.80003@bms.com>

Actually, smiles can be tricky too- you can easily generate
non-canonical keys, where InChi is unique (as I understand it at least).
It is promoted by IUAPC:
http://www.iupac.org/inchi/
and can be generated by OpenBabel.
My take is that if you need to map between small molecules InChi might
be the best way..
Stefan

Chris Fields wrote:
> On Sep 18, 2007, at 8:26 AM, Roy Chaudhuri wrote:
>
>   
>>> My actual problem is a bit more complicated.
>>> It is not just one string, nut lakhs of them, they are actually  
>>> names of
>>> chemical compounds.
>>>
>>> THe problem is there are 2 different data sources, I need to match  
>>> the
>>> compond names between them, but the problem is though the compound  
>>> may
>>> be the same in the two, they use different naming formats for them.
>>>       
>> Unless you can define in simple and precise terms exactly which  
>> parts of
>> the string you need then there is no way that you will be able to  
>> code a
>> solution in Perl.
>>
>> Maybe you could look for a database that contains the synonyms for  
>> each
>> molecule? A quick Google finds ChEBI (http://www.ebi.ac.uk/chebi),  
>> which
>> is available to download as flat files.
>>
>> Roy.
>> --
>> Dr. Roy Chaudhuri
>> Department of Veterinary Medicine
>> University of Cambridge, U.K.
>>     
>
> D'oh!  Roy beat me to it; that's what I was going to suggest.  I  
> agree; don't trust simple word munging to always get you the correct  
> answer in this case, it's just too complicated to try and catch every  
> case.
>
> ChEBI is a good choice; Stefan's suggestion of OpenBabel is also a  
> good one.  I would also try not to reinvent the wheel; there may be  
> some modules available via CPAN which do what you need, such as these:
>
> http://search.cpan.org/search?query=chem&mode=module
>
> or this:
>
> http://search.cpan.org/~ghutchis/Chemistry-OpenBabel-1.2.0/
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>   


From jason at bioperl.org  Tue Sep 18 20:04:05 2007
From: jason at bioperl.org (Jason Stajich)
Date: Tue, 18 Sep 2007 17:04:05 -0700
Subject: [Bioperl-l] bioperl + GFF3 audit
Message-ID: <C7895984-E679-4079-A584-9EB013F22EB5@bioperl.org>

Something to throw out there for discussion with GFF3 gurus.  Maybe  
we can have a little STATE-OF-GFF3 and compliance at the GMOD  
workshop after Genome Informatics in Nov?

I propose after we get the next stable release out we consider doing  
a systematic code audit to insure that we can really generate proper  
GFF3 compliant data from all of our parsers.  This would include both  
good ID/Parent as well as .  I'd be happy to also think about making  
sure we can generate proper GTF/GFF2.5 - whether this means we have a  
translator that works on these objects or we have to code this into  
the parser software that creating the sequence features, not sure.   
The whole Bio::Tools mishmash is a little unsettling when trying to  
generate standardized output.  I'm not really clear if Bio::FeatureIO  
actually tries to do this properly, but 'gene_id'/'transcript_id' for  
GTF and ID/Parent 3-level Features for gene->transcript->exon/CDS  
doesn't really come out properly and I end up writing workarounds on  
the downstream data.

One aspect that is biting is the flat versus multi-level features  
(genes -> transcripts -> exons) and how we handle them.  I think this  
ought to get fleshed out better so we can really support .  A lot of  
the Bio::Tools parsers are generally pretty laissez fair here about  
things and we have a variety of non-standard and non-compliant aspects.

For example, I am playing with tRNA parsing and I assume that proper  
GFF3 here is three levels of :
gene -> tRNA -> exon
with those being the primary_tag names that correspond to the  
Sequence Ontology.

I have modified the code locally to report generic features but which  
have sub-features that must be extracted.  In addition the ID/Parent  
fields are explicitly filled in and I wonder if we want to do a  
better job insuring these are meaningfully entered?

So if there are interested people out there we can try and hammer out  
a todo list on the wiki and see if we're generating proper GFF3 in  
the first place and trying to make sure all the features that get fed  
out to Bio::FeatureIO or Bio::Tools::GFF can get properly transformed  
into GFF3 and GTF output.

Comments/Volunteers?

-jason

--
Jason Stajich
jason at bioperl.org


From cjfields at uiuc.edu  Tue Sep 18 23:37:30 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 22:37:30 -0500
Subject: [Bioperl-l] bioperl + GFF3 audit
In-Reply-To: <C7895984-E679-4079-A584-9EB013F22EB5@bioperl.org>
References: <C7895984-E679-4079-A584-9EB013F22EB5@bioperl.org>
Message-ID: <D6630AE3-B968-462C-9CED-D09C90BE786B@uiuc.edu>

On Sep 18, 2007, at 7:04 PM, Jason Stajich wrote:

> Something to throw out there for discussion with GFF3 gurus.  Maybe
> we can have a little STATE-OF-GFF3 and compliance at the GMOD
> workshop after Genome Informatics in Nov?
>
> I propose after we get the next stable release out we consider doing
> a systematic code audit to insure that we can really generate proper
> GFF3 compliant data from all of our parsers.  This would include both
> good ID/Parent as well as .  I'd be happy to also think about making
> sure we can generate proper GTF/GFF2.5 - whether this means we have a
> translator that works on these objects or we have to code this into
> the parser software that creating the sequence features, not sure.
> The whole Bio::Tools mishmash is a little unsettling when trying to
> generate standardized output.  I'm not really clear if Bio::FeatureIO
> actually tries to do this properly, but 'gene_id'/'transcript_id' for
> GTF and ID/Parent 3-level Features for gene->transcript->exon/CDS
> doesn't really come out properly and I end up writing workarounds on
> the downstream data.

This suggests we should try to get a stable out fairly quickly and  
work on the next dev straight away.  I'm okay with that, though it  
would be nice to finish up a few loose ends first, the svn move  
foremost.

The Feature/Annotation stuff has been pretty much rolled back so  
maybe a stable release can be done fairly quickly.  My main concern  
was that any rollback would break FeatureIO or SF::Annotated, but so  
far FeatureIO and SF::Annotated both pass tests.  However, I think  
both also need better documentation and possibly more/better test  
coverage.

> One aspect that is biting is the flat versus multi-level features
> (genes -> transcripts -> exons) and how we handle them.  I think this
> ought to get fleshed out better so we can really support .  A lot of
> the Bio::Tools parsers are generally pretty laissez fair here about
> things and we have a variety of non-standard and non-compliant  
> aspects.

Agreed.

> For example, I am playing with tRNA parsing and I assume that proper
> GFF3 here is three levels of :
> gene -> tRNA -> exon
> with those being the primary_tag names that correspond to the
> Sequence Ontology.
>
> I have modified the code locally to report generic features but which
> have sub-features that must be extracted.  In addition the ID/Parent
> fields are explicitly filled in and I wonder if we want to do a
> better job insuring these are meaningfully entered?

Would a factory approach work here?  For instance, have a Factory  
which generates the SeqFeature type you want on the fly if passed  
appropriate parameters and location, say flattened vs unflattened,  
strictly typed vs lightweight, etc.  For that matter, maybe we could  
reimplement FTHelper in SeqIO to do the same...

> So if there are interested people out there we can try and hammer out
> a todo list on the wiki and see if we're generating proper GFF3 in
> the first place and trying to make sure all the features that get fed
> out to Bio::FeatureIO or Bio::Tools::GFF can get properly transformed
> into GFF3 and GTF output.
>
> Comments/Volunteers?
>
> -jason
>
> --
> Jason Stajich
> jason at bioperl.org

I'll be busy 'til mid-Oct but I'll chip in.  I'll keep tabs on the wiki.

chris

From harryzs1981 at yahoo.com.cn  Fri Sep 21 10:40:55 2007
From: harryzs1981 at yahoo.com.cn (sheng zhao)
Date: Fri, 21 Sep 2007 22:40:55 +0800 (CST)
Subject: [Bioperl-l] Help for extracting CDS sequences from FASTA form
Message-ID: <815154.22486.qm@web15901.mail.cnb.yahoo.com>

              Dear all:      
I have got a set of DAN sequences in FASTA form as following: 
   
  >gnl|UG|Bt#S37443275 Bos taurus cathelicidin 4, mRNA (cDNA clone MGC:157131 IMAGE:8442308), complete cds /cds=p(18,452) /gb=BC133480 /gi=126717494 /ug=Bt.3 /len=572
  TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................................
  >gnl|UG|Bt#S11932596 B.taurus mRNA for interleukin-5 /cds=p(1,405) /gb=Z67872 /gi=1113120 /ug=Bt.5 /len=405
  TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC...................................
  >gnl|UG|Bt#S29311270 Hw_Loin_11_0520_C11 Bos taurus CF-24-HW loin cDNA library Bos taurus cDNA, mRNA sequence /gb=DV796078 /gi=82648993 /ug=Bt.10 /len=1332
  AACCGGGAGCACGCCGTGTACCCGCCAGTGGGGCTTCTGAGGACATGGGGGCCACCGTCA...................................
   
  I would like to know how to extract CDS sequences from them? Or a Perl program?
   
  Thank you for your reply and help.
   
  Sincerely yours,
  Best wishes,
  Harry 




       
---------------------------------
 @yahoo.cn ??????????????????????????

From bix at sendu.me.uk  Fri Sep 21 11:28:30 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 21 Sep 2007 16:28:30 +0100
Subject: [Bioperl-l] Help for extracting CDS sequences from FASTA form
In-Reply-To: <815154.22486.qm@web15901.mail.cnb.yahoo.com>
References: <815154.22486.qm@web15901.mail.cnb.yahoo.com>
Message-ID: <46F3E31E.2010606@sendu.me.uk>

sheng zhao wrote:
> >gnl|UG|Bt#S37443275 [snip] /gb=BC133480 /gi=126717494 /ug=Bt.3 /len=572
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGC
[snip]
> I would like to know how to extract CDS sequences from them? Or a Perl program?

Where did you get the fasta sequences from? It would be easiest to go to 
the source that originally generated them and get it to give you the CDS 
coordinates as well.

Failing that you can get them from the NCBI database using the gb or gi ids.

Someone else will be along to give you the Bioperl code to do that, I'm 
sure :)

From harryzs1981 at yahoo.com.cn  Fri Sep 21 12:30:45 2007
From: harryzs1981 at yahoo.com.cn (sheng zhao)
Date: Sat, 22 Sep 2007 00:30:45 +0800 (CST)
Subject: [Bioperl-l]  Help for extracting CDS sequences from FASTA form
Message-ID: <352861.19969.qm@web15909.mail.cnb.yahoo.com>

Dear sir:
   
  Thank you for your relp.
   
  I got these sequences from NCBI(ftp.ncbi.nlm.nih.gov/repository/UniGene/Bos_taurus/Bt.seq.uniq.gz).
   
  Would you mind to tell me how to get gb or gi ids from this form?
  Thank you again.
   
  Best wishes.
  Harry
  


Sendu Bala <bix at sendu.me.uk> ??????
    sheng zhao wrote:
> >gnl|UG|Bt#S37443275 [snip] /gb=BC133480 /gi=126717494 /ug=Bt.3 /len=572
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGC
[snip]
> I would like to know how to extract CDS sequences from them? Or a Perl program?

Where did you get the fasta sequences from? It would be easiest to go to 
the source that originally generated them and get it to give you the CDS 
coordinates as well.

Failing that you can get them from the NCBI database using the gb or gi ids.

Someone else will be along to give you the Bioperl code to do that, I'm 
sure :)
   


       
---------------------------------
???????????????????? 

From harryzs1981 at yahoo.com.cn  Fri Sep 21 12:32:21 2007
From: harryzs1981 at yahoo.com.cn (sheng zhao)
Date: Sat, 22 Sep 2007 00:32:21 +0800 (CST)
Subject: [Bioperl-l]
 =?gb2312?q?=BB=D8=B8=B4=A3=BA=20Re:=20=20Help=20for=20extracti?=
 =?gb2312?q?ng=20CDS=20sequences=20from=20FASTA=20form?=
In-Reply-To: <C319614A.FB06%bosborne11@verizon.net>
Message-ID: <548016.71302.qm@web15914.mail.cnb.yahoo.com>

Dear Brian O.:
   
   Thank you for your reple.
  I just want to get CDS sequences (DNA sequence) from them according to the CDS information in the title for each sequence. 
   
  For example, for the first sequence, the information is "complete cds /cds=p(18,452)" .

  Thank you again!
   
  Best wishes!
  Harry



Brian Osborne <bosborne11 at verizon.net> ??????
  Harry,

Do you mean find an ORF starting at the first initiation codon and translate
that? Or some other approach?

Take a look at the translate() method:

http://www.bioperl.org/wiki/Bptutorial.pl#Translating


Brian O.


On 9/21/07 10:40 AM, "sheng zhao" wrote:

> Dear all:
> I have got a set of DAN sequences in FASTA form as following:
> 
>> gnl|UG|Bt#S37443275 Bos taurus cathelicidin 4, mRNA (cDNA clone MGC:157131
>> IMAGE:8442308), complete cds /cds=p(18,452) /gb=BC133480 /gi=126717494
>> /ug=Bt.3 /len=572
> 
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................
> ................
>> gnl|UG|Bt#S11932596 B.taurus mRNA for interleukin-5 /cds=p(1,405) /gb=Z67872
>> /gi=1113120 /ug=Bt.5 /len=405
> 
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................
> .................
>> gnl|UG|Bt#S29311270 Hw_Loin_11_0520_C11 Bos taurus CF-24-HW loin cDNA library
>> Bos taurus cDNA, mRNA sequence /gb=DV796078 /gi=82648993 /ug=Bt.10 /len=1332
> 
> AACCGGGAGCACGCCGTGTACCCGCCAGTGGGGCTTCTGAGGACATGGGGGCCACCGTCA..................
> .................
> 
> I would like to know how to extract CDS sequences from them? Or a Perl
> program?
> 
> Thank you for your reply and help.
> 
> Sincerely yours,
> Best wishes,
> Harry 
> 
> 
> 
> 
> 
> ---------------------------------
> @yahoo.cn ??????????????????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




       
---------------------------------
???????????????????? 

From bosborne11 at verizon.net  Fri Sep 21 11:53:46 2007
From: bosborne11 at verizon.net (Brian Osborne)
Date: Fri, 21 Sep 2007 11:53:46 -0400
Subject: [Bioperl-l] Help for extracting CDS sequences from FASTA form
In-Reply-To: <815154.22486.qm@web15901.mail.cnb.yahoo.com>
Message-ID: <C319614A.FB06%bosborne11@verizon.net>

Harry,

Do you mean find an ORF starting at the first initiation codon and translate
that? Or some other approach?

Take a look at the translate() method:

http://www.bioperl.org/wiki/Bptutorial.pl#Translating


Brian O.


On 9/21/07 10:40 AM, "sheng zhao" <harryzs1981 at yahoo.com.cn> wrote:

>               Dear all:
> I have got a set of DAN sequences in FASTA form as following:
>    
>> gnl|UG|Bt#S37443275 Bos taurus cathelicidin 4, mRNA (cDNA clone MGC:157131
>> IMAGE:8442308), complete cds /cds=p(18,452) /gb=BC133480 /gi=126717494
>> /ug=Bt.3 /len=572
>   
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................
> ................
>> gnl|UG|Bt#S11932596 B.taurus mRNA for interleukin-5 /cds=p(1,405) /gb=Z67872
>> /gi=1113120 /ug=Bt.5 /len=405
>   
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................
> .................
>> gnl|UG|Bt#S29311270 Hw_Loin_11_0520_C11 Bos taurus CF-24-HW loin cDNA library
>> Bos taurus cDNA, mRNA sequence /gb=DV796078 /gi=82648993 /ug=Bt.10 /len=1332
>   
> AACCGGGAGCACGCCGTGTACCCGCCAGTGGGGCTTCTGAGGACATGGGGGCCACCGTCA..................
> .................
>    
>   I would like to know how to extract CDS sequences from them? Or a Perl
> program?
>    
>   Thank you for your reply and help.
>    
>   Sincerely yours,
>   Best wishes,
>   Harry 
> 
> 
> 
> 
>        
> ---------------------------------
>  @yahoo.cn ??????????????????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




From florent.angly at gmail.com  Sat Sep 22 01:02:28 2007
From: florent.angly at gmail.com (Florent Angly)
Date: Fri, 21 Sep 2007 22:02:28 -0700
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
Message-ID: <46F4A1E4.7020002@gmail.com>

Hi,
I need to quantify how good some overlaps in contigs are. I have 
extracted the alignment of the overlapping region and only need to score 
it. I noticed the Bio::Tools::dpAlign has a scoring function.
Is it the right tool for the right tool? Is there anything else?
Thank you,
Florent

From florent.angly at gmail.com  Sat Sep 22 21:41:40 2007
From: florent.angly at gmail.com (Florent Angly)
Date: Sat, 22 Sep 2007 18:41:40 -0700
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <46F4A1E4.7020002@gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com>
Message-ID: <46F5C454.3050005@gmail.com>

Eventually, I gave Bio::Tools::dpAlign a try. I had no luck running it 
when installing its dependency, bioperl-ext v1.4 or v1.5.1. However all 
the tests passed when installing the CVS version.
So finally, here I am trying to score my alignments. For alignments of 2 
small sequences, it works, but as soon as the sequences get bigger than 
a few dozen nucleotides, it crashes:
Segmentation fault (core dumped)

I did not find any help in the documentation...

Can I fix this? Is this a bug?

Thanks for your help,

Florent

Florent Angly wrote:
> Hi,
> I need to quantify how good some overlaps in contigs are. I have 
> extracted the alignment of the overlapping region and only need to 
> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
> Is it the right tool for the right tool? Is there anything else?
> Thank you,
> Florent
>


From bioperl-list at superfrink.net  Sun Sep 23 12:21:44 2007
From: bioperl-list at superfrink.net (Chad Clark)
Date: Sun, 23 Sep 2007 10:21:44 -0600 (MDT)
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <46F5C454.3050005@gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
	<46EFBA0E.4030104@sheffield.ac.uk>
	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
Message-ID: <Pine.LNX.4.64.0709231013340.21280@gurchecyrohssnyb.arg>

On Sat, 22 Sep 2007, Florent Angly wrote:

> So finally, here I am trying to score my alignments. For alignments of 2
> small sequences, it works, but as soon as the sequences get bigger than
> a few dozen nucleotides, it crashes:
> Segmentation fault (core dumped)

In my experience if a program runs on small sets of data and segfaults on 
larger sets it is likely running out of stack space.  You can try changing 
the allowed stack size with "ulimit" before running your program and see 
if it works with more data.

   [chad at water ~]$ ulimit -a | grep -i stack
   stack size              (kbytes, -s) 10240
   [chad at water ~]$ ulimit -s 40960
   [chad at water ~]$ ulimit -a | grep -i stack
   stack size              (kbytes, -s) 40960

I don't know the code / algorithm in question but it might require 
significantly more stack space as the data set grows in size so this 
change might not help enough.

Good luck,
Chad

From bix at sendu.me.uk  Mon Sep 24 05:35:39 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Mon, 24 Sep 2007 10:35:39 +0100
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
Message-ID: <46F784EB.9050507@sendu.me.uk>

Hi,

I'm finding that when writing GFF files the version header line gets 
printed out twice. This is because:

sub _initialize {
   # [snip]

   if ($arg{-file} =~ /^>.*/ ) {
     $self->_print("##gff-version " . $self->version() . "\n");
   }
   else {
     my $directive;
     while(($directive = $self->_readline()) && ( $directive =~ /^##/ || 
$directive =~ /^>/)){
       $self->_handle_directive($directive);
     }
     $self->_pushback($directive);
   }

   if ($arg{-file} =~ /^>.*/ ) {
     $self->_print("##gff-version " . $self->version() . "\n");
   }

   # [snip]
}

Does it make sense for if ($arg{-file} =~ /^>.*/ ) to appear twice like 
that? If not, which one should be removed? The independent one, or the 
if/else one?


Cheers,
Sendu.

From awitney at sgul.ac.uk  Mon Sep 24 08:40:07 2007
From: awitney at sgul.ac.uk (Adam Witney)
Date: Mon, 24 Sep 2007 13:40:07 +0100
Subject: [Bioperl-l] Minor docs discrepancy?
In-Reply-To: <E8CEAD6A-9F6B-43B8-94A3-95A1C96E872D@duke.edu>
Message-ID: <C31D6EB7.1A1BD%awitney@sgul.ac.uk>


Hi,

I was just going through the BlastHSP.pm POD and lines 23-24 say

"For Bio::SearchIO BLAST parsing usage examples, see the
"examples/search-blast" directory of the Bioperl distribution."

However in the distribution (1.4 and 1.5.2_102) it looks to be
"examples/searchio"

Is this in need of updating, or am I looking in the wrong place?

Thanks

Adam



From cjfields at uiuc.edu  Mon Sep 24 09:09:46 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 08:09:46 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <46F784EB.9050507@sendu.me.uk>
References: <46F784EB.9050507@sendu.me.uk>
Message-ID: <7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>

It looks like the first is a cut-and-paste revision of the second, so  
I would say the second independent if block is redundant.

Should we be printing output in _initialize()?  I would think any  
output would be handled in a write_* method of some sort and not in a  
common method used for initializing both input and output stream  
data.  What happens here if you use '-fh' and want output redirected  
to STDOUT?

chris

On Sep 24, 2007, at 4:35 AM, Sendu Bala wrote:

> Hi,
>
> I'm finding that when writing GFF files the version header line gets
> printed out twice. This is because:
>
> sub _initialize {
>    # [snip]
>
>    if ($arg{-file} =~ /^>.*/ ) {
>      $self->_print("##gff-version " . $self->version() . "\n");
>    }
>    else {
>      my $directive;
>      while(($directive = $self->_readline()) && ( $directive =~ / 
> ^##/ ||
> $directive =~ /^>/)){
>        $self->_handle_directive($directive);
>      }
>      $self->_pushback($directive);
>    }
>
>    if ($arg{-file} =~ /^>.*/ ) {
>      $self->_print("##gff-version " . $self->version() . "\n");
>    }
>
>    # [snip]
> }
>
> Does it make sense for if ($arg{-file} =~ /^>.*/ ) to appear twice  
> like
> that? If not, which one should be removed? The independent one, or the
> if/else one?
>
>
> Cheers,
> Sendu.


From cjfields at uiuc.edu  Mon Sep 24 09:13:53 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 08:13:53 -0500
Subject: [Bioperl-l] Minor docs discrepancy?
In-Reply-To: <C31D6EB7.1A1BD%awitney@sgul.ac.uk>
References: <C31D6EB7.1A1BD%awitney@sgul.ac.uk>
Message-ID: <B692F0F5-7CA3-4D32-B588-78087B25D193@uiuc.edu>

I have updated that in CVS.  Thanks for pointing that out!

chris

On Sep 24, 2007, at 7:40 AM, Adam Witney wrote:

>
> Hi,
>
> I was just going through the BlastHSP.pm POD and lines 23-24 say
>
> "For Bio::SearchIO BLAST parsing usage examples, see the
> "examples/search-blast" directory of the Bioperl distribution."
>
> However in the distribution (1.4 and 1.5.2_102) it looks to be
> "examples/searchio"
>
> Is this in need of updating, or am I looking in the wrong place?
>
> Thanks
>
> Adam

From bix at sendu.me.uk  Mon Sep 24 09:20:33 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Mon, 24 Sep 2007 14:20:33 +0100
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
Message-ID: <46F7B9A1.9080206@sendu.me.uk>

Chris Fields wrote:
> It looks like the first is a cut-and-paste revision of the second, so I 
> would say the second independent if block is redundant.

I agree. I'll make that change.


> Should we be printing output in _initialize()?  I would think any output 
> would be handled in a write_* method of some sort and not in a common 
> method used for initializing both input and output stream data.  What 
> happens here if you use '-fh' and want output redirected to STDOUT?

I think the problem is that the method is write_feature(), which can be 
called many times for a single output file, but the version should only 
be printed once at the very start of the file.

I suppose it just needs better capturing of when we're intending to 
write... Hmmm... didn't I fix a method related to that?...

Yes, yes I did:
Bio::Root::IO->mode
;)

Any objections to me replacing the if clause with one using that method?

From cjfields at uiuc.edu  Mon Sep 24 09:35:22 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 08:35:22 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <46F7B9A1.9080206@sendu.me.uk>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
Message-ID: <EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>


On Sep 24, 2007, at 8:20 AM, Sendu Bala wrote:

> Chris Fields wrote:
>> It looks like the first is a cut-and-paste revision of the second,  
>> so I would say the second independent if block is redundant.
>
> I agree. I'll make that change.
>
>
>> Should we be printing output in _initialize()?  I would think any  
>> output would be handled in a write_* method of some sort and not  
>> in a common method used for initializing both input and output  
>> stream data.  What happens here if you use '-fh' and want output  
>> redirected to STDOUT?
>
> I think the problem is that the method is write_feature(), which  
> can be called many times for a single output file, but the version  
> should only be printed once at the very start of the file.
>
> I suppose it just needs better capturing of when we're intending to  
> write... Hmmm... didn't I fix a method related to that?...
>
> Yes, yes I did:
> Bio::Root::IO->mode
> ;)
>
> Any objections to me replacing the if clause with one using that  
> method?

I think that'll work fine.  The other option would be call a  
print_gff_header() function within write_feature() with the intent to  
print the header only once, using a flag or similar:

if (!$self->header_printed) {
     $self->print_gff_header;
     $self->header_printed(1);
}

chris

From hlapp at gmx.net  Mon Sep 24 13:41:34 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Mon, 24 Sep 2007 13:41:34 -0400
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
Message-ID: <234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>

I'd lean toward this or a similar approach too. Writing stuff out in  
the constructor doesn't feel like the best design.

	-hilmar

On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:

>
> On Sep 24, 2007, at 8:20 AM, Sendu Bala wrote:
>
>> Chris Fields wrote:
>>> It looks like the first is a cut-and-paste revision of the second,
>>> so I would say the second independent if block is redundant.
>>
>> I agree. I'll make that change.
>>
>>
>>> Should we be printing output in _initialize()?  I would think any
>>> output would be handled in a write_* method of some sort and not
>>> in a common method used for initializing both input and output
>>> stream data.  What happens here if you use '-fh' and want output
>>> redirected to STDOUT?
>>
>> I think the problem is that the method is write_feature(), which
>> can be called many times for a single output file, but the version
>> should only be printed once at the very start of the file.
>>
>> I suppose it just needs better capturing of when we're intending to
>> write... Hmmm... didn't I fix a method related to that?...
>>
>> Yes, yes I did:
>> Bio::Root::IO->mode
>> ;)
>>
>> Any objections to me replacing the if clause with one using that
>> method?
>
> I think that'll work fine.  The other option would be call a
> print_gff_header() function within write_feature() with the intent to
> print the header only once, using a flag or similar:
>
> if (!$self->header_printed) {
>      $self->print_gff_header;
>      $self->header_printed(1);
> }
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================






From cjfields at uiuc.edu  Mon Sep 24 14:11:47 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 13:11:47 -0500
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <46F5C454.3050005@gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
Message-ID: <9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>

As Chad mentioned it could be a stack issue, but it might be worth  
filing a bug on.  I will note that bioperl-ext has seen very little  
use in the last few years, so don't expect it to be fixed unless you  
can contact the ext module author.

chris

On Sep 22, 2007, at 8:41 PM, Florent Angly wrote:

> Eventually, I gave Bio::Tools::dpAlign a try. I had no luck running it
> when installing its dependency, bioperl-ext v1.4 or v1.5.1. However  
> all
> the tests passed when installing the CVS version.
> So finally, here I am trying to score my alignments. For alignments  
> of 2
> small sequences, it works, but as soon as the sequences get bigger  
> than
> a few dozen nucleotides, it crashes:
> Segmentation fault (core dumped)
>
> I did not find any help in the documentation...
>
> Can I fix this? Is this a bug?
>
> Thanks for your help,
>
> Florent
>
> Florent Angly wrote:
>> Hi,
>> I need to quantify how good some overlaps in contigs are. I have
>> extracted the alignment of the overlapping region and only need to
>> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
>> Is it the right tool for the right tool? Is there anything else?
>> Thank you,
>> Florent
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From florent.angly at gmail.com  Mon Sep 24 15:07:35 2007
From: florent.angly at gmail.com (Florent Angly)
Date: Mon, 24 Sep 2007 12:07:35 -0700
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
	<9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>
Message-ID: <46F80AF7.4090109@gmail.com>

I see... Thanks for the replies Chad and Chris. Then I have two more 
questions!
1/ Do you know how to get a core dump that could help debug my 
segmentation fault? I have produced dumps of binary C programs before 
with gdb. I have used the Perl debugger for Perl scripts. But how to 
deal with C functions called by Perl?
2/ Is there an easier method to calculate an alignment score in BioPerl 
than using Bio::Tools::dpAlign? I didn't seem to locate something else, 
but who knows...
I have workarounds for quantifying the quality of the overlap, so 
calculating a score is not critical for me (though I believe this would 
be the most accurate/adapted method).
Florent

Chris Fields wrote:
> As Chad mentioned it could be a stack issue, but it might be worth 
> filing a bug on.  I will note that bioperl-ext has seen very little 
> use in the last few years, so don't expect it to be fixed unless you 
> can contact the ext module author.
>
> chris
>
> On Sep 22, 2007, at 8:41 PM, Florent Angly wrote:
>
>> Eventually, I gave Bio::Tools::dpAlign a try. I had no luck running it
>> when installing its dependency, bioperl-ext v1.4 or v1.5.1. However all
>> the tests passed when installing the CVS version.
>> So finally, here I am trying to score my alignments. For alignments of 2
>> small sequences, it works, but as soon as the sequences get bigger than
>> a few dozen nucleotides, it crashes:
>> Segmentation fault (core dumped)
>>
>> I did not find any help in the documentation...
>>
>> Can I fix this? Is this a bug?
>>
>> Thanks for your help,
>>
>> Florent
>>
>> Florent Angly wrote:
>>> Hi,
>>> I need to quantify how good some overlaps in contigs are. I have
>>> extracted the alignment of the overlapping region and only need to
>>> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
>>> Is it the right tool for the right tool? Is there anything else?
>>> Thank you,
>>> Florent
>>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
>


From cjfields at uiuc.edu  Mon Sep 24 15:26:46 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 14:26:46 -0500
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <46F80AF7.4090109@gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
	<9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>
	<46F80AF7.4090109@gmail.com>
Message-ID: <0C6508FB-4765-4E4E-AFD1-6E5BFE8F9368@uiuc.edu>

I suppose if you can find a way to export the contig data into a  
Bio::SimpleAlign you look at the methods in  
Bio::Align::DNAStatistics.  SimpleAlign also has some builtin methods  
like average_percentage_identity, percentage_identity, etc, which may  
be worth a look.

chris

On Sep 24, 2007, at 2:07 PM, Florent Angly wrote:

> I see... Thanks for the replies Chad and Chris. Then I have two more
> questions!
> 1/ Do you know how to get a core dump that could help debug my
> segmentation fault? I have produced dumps of binary C programs before
> with gdb. I have used the Perl debugger for Perl scripts. But how to
> deal with C functions called by Perl?
> 2/ Is there an easier method to calculate an alignment score in  
> BioPerl
> than using Bio::Tools::dpAlign? I didn't seem to locate something  
> else,
> but who knows...
> I have workarounds for quantifying the quality of the overlap, so
> calculating a score is not critical for me (though I believe this  
> would
> be the most accurate/adapted method).
> Florent
>
> Chris Fields wrote:
>> As Chad mentioned it could be a stack issue, but it might be worth
>> filing a bug on.  I will note that bioperl-ext has seen very little
>> use in the last few years, so don't expect it to be fixed unless you
>> can contact the ext module author.
>>
>> chris
>>
>> On Sep 22, 2007, at 8:41 PM, Florent Angly wrote:
>>
>>> Eventually, I gave Bio::Tools::dpAlign a try. I had no luck  
>>> running it
>>> when installing its dependency, bioperl-ext v1.4 or v1.5.1.  
>>> However all
>>> the tests passed when installing the CVS version.
>>> So finally, here I am trying to score my alignments. For  
>>> alignments of 2
>>> small sequences, it works, but as soon as the sequences get  
>>> bigger than
>>> a few dozen nucleotides, it crashes:
>>> Segmentation fault (core dumped)
>>>
>>> I did not find any help in the documentation...
>>>
>>> Can I fix this? Is this a bug?
>>>
>>> Thanks for your help,
>>>
>>> Florent
>>>
>>> Florent Angly wrote:
>>>> Hi,
>>>> I need to quantify how good some overlaps in contigs are. I have
>>>> extracted the alignment of the overlapping region and only need to
>>>> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
>>>> Is it the right tool for the right tool? Is there anything else?
>>>> Thank you,
>>>> Florent
>>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From florent.angly at gmail.com  Mon Sep 24 15:46:36 2007
From: florent.angly at gmail.com (Florent Angly)
Date: Mon, 24 Sep 2007 12:46:36 -0700
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <0C6508FB-4765-4E4E-AFD1-6E5BFE8F9368@uiuc.edu>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
	<9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>
	<46F80AF7.4090109@gmail.com>
	<0C6508FB-4765-4E4E-AFD1-6E5BFE8F9368@uiuc.edu>
Message-ID: <46F8141C.8010507@gmail.com>

Yes, right! That's the methods I use as my workarounds. =)
Thanks for suggesting.
Florent

Chris Fields wrote:
> I suppose if you can find a way to export the contig data into a 
> Bio::SimpleAlign you look at the methods in 
> Bio::Align::DNAStatistics.  SimpleAlign also has some builtin methods 
> like average_percentage_identity, percentage_identity, etc, which may 
> be worth a look.
>
> chris
>
> On Sep 24, 2007, at 2:07 PM, Florent Angly wrote:
>
>> I see... Thanks for the replies Chad and Chris. Then I have two more
>> questions!
>> 1/ Do you know how to get a core dump that could help debug my
>> segmentation fault? I have produced dumps of binary C programs before
>> with gdb. I have used the Perl debugger for Perl scripts. But how to
>> deal with C functions called by Perl?
>> 2/ Is there an easier method to calculate an alignment score in BioPerl
>> than using Bio::Tools::dpAlign? I didn't seem to locate something else,
>> but who knows...
>> I have workarounds for quantifying the quality of the overlap, so
>> calculating a score is not critical for me (though I believe this would
>> be the most accurate/adapted method).
>> Florent
>>
>> Chris Fields wrote:
>>> As Chad mentioned it could be a stack issue, but it might be worth
>>> filing a bug on.  I will note that bioperl-ext has seen very little
>>> use in the last few years, so don't expect it to be fixed unless you
>>> can contact the ext module author.
>>>
>>> chris
>>>
>>> On Sep 22, 2007, at 8:41 PM, Florent Angly wrote:
>>>
>>>> Eventually, I gave Bio::Tools::dpAlign a try. I had no luck running it
>>>> when installing its dependency, bioperl-ext v1.4 or v1.5.1. However 
>>>> all
>>>> the tests passed when installing the CVS version.
>>>> So finally, here I am trying to score my alignments. For alignments 
>>>> of 2
>>>> small sequences, it works, but as soon as the sequences get bigger 
>>>> than
>>>> a few dozen nucleotides, it crashes:
>>>> Segmentation fault (core dumped)
>>>>
>>>> I did not find any help in the documentation...
>>>>
>>>> Can I fix this? Is this a bug?
>>>>
>>>> Thanks for your help,
>>>>
>>>> Florent
>>>>
>>>> Florent Angly wrote:
>>>>> Hi,
>>>>> I need to quantify how good some overlaps in contigs are. I have
>>>>> extracted the alignment of the overlapping region and only need to
>>>>> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
>>>>> Is it the right tool for the right tool? Is there anything else?
>>>>> Thank you,
>>>>> Florent
>>>>>
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>> Christopher Fields
>>> Postdoctoral Researcher
>>> Lab of Dr. Robert Switzer
>>> Dept of Biochemistry
>>> University of Illinois Urbana-Champaign
>>>
>>>
>>>
>>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
>


From bix at sendu.me.uk  Tue Sep 25 06:00:20 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 25 Sep 2007 11:00:20 +0100
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
Message-ID: <46F8DC34.6020908@sendu.me.uk>

Hilmar Lapp wrote:
> On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:
>> I think that'll work fine.  The other option would be call a
>> print_gff_header() function within write_feature() with the intent to
>> print the header only once, using a flag or similar:
>>
>> if (!$self->header_printed) {
>>      $self->print_gff_header;
>>      $self->header_printed(1);
>> }
 >
> I'd lean toward this or a similar approach too. Writing stuff out in the 
> constructor doesn't feel like the best design.

I'd argue that the alternative is just inefficient with no compensating 
benefit. You have something that must only be done once, and a method 
(_initialize) that is only called once. The constructor is used to set 
up the file, getting it into a state ready to add features. This 
involves opening it for writing with the correct filename and setting 
the desired GFF version. Why wouldn't it also output what ever else was 
necessary it initialize the file?

Also, what do we expect should happen when we use Bioperl to create a 
GFF file and don't write any features to it? Should it be an empty file, 
or should it contain whatever GFF information the user had managed to 
supply (the version)?

From cjfields at uiuc.edu  Tue Sep 25 10:14:04 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 25 Sep 2007 09:14:04 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <46F8DC34.6020908@sendu.me.uk>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
Message-ID: <22FB7AE5-2E1C-450C-A48C-6014CC5EB786@uiuc.edu>


On Sep 25, 2007, at 5:00 AM, Sendu Bala wrote:

> Hilmar Lapp wrote:
>> On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:
>>> I think that'll work fine.  The other option would be call a
>>> print_gff_header() function within write_feature() with the  
>>> intent to
>>> print the header only once, using a flag or similar:
>>>
>>> if (!$self->header_printed) {
>>>      $self->print_gff_header;
>>>      $self->header_printed(1);
>>> }
>>
>> I'd lean toward this or a similar approach too. Writing stuff out  
>> in the
>> constructor doesn't feel like the best design.
>
> I'd argue that the alternative is just inefficient with no  
> compensating
> benefit. You have something that must only be done once, and a method
> (_initialize) that is only called once. The constructor is used to set
> up the file, getting it into a state ready to add features. This
> involves opening it for writing with the correct filename and setting
> the desired GFF version. Why wouldn't it also output what ever else  
> was
> necessary it initialize the file?

It's great to have someone picking this up, so anything that works is  
fine by me, to tell the truth.  I'll state my piece, though, and  
stand out of the way.

In my opinion there are a couple of compensating benefits.  One is  
long-term maintenance, primarily being all calls to generate output  
are contained within the write_features method and are thus easier to  
find and more maintainable.  The logic goes, if there were a bug I  
would expect to find output in a write_* method or a method called  
from within write_* method, not in the constructor or something  
called from the constructor, like _initialize().  I've always been  
told the constructor in any OO language is typically limited to  
setting state data and behavior, not generating new data (i.e.  
generating output).

Related to that, the other benefit is expected behavior when calling  
a method.  I don't know of cases in other IO classes in Bioperl which  
generate output when a new() instance is created; output is expected  
specifically when calling a particular write_* method.  Therefore I  
wouldn't expect any output be generated until write_feature() were  
called (or calling similarly named methods where output would be  
expected, like a print_* method).

Saying all that, I'm probably not the best one to bang the 'best  
practices' drum right now as I haven't had time to finish up several  
modules I've been working on!  Speaking of (going back to work...)

> Also, what do we expect should happen when we use Bioperl to create a
> GFF file and don't write any features to it? Should it be an empty  
> file,
> or should it contain whatever GFF information the user had managed to
> supply (the version)?

As mentioned above, I would expect no output generated at all unless  
explicitly calling write_features(), just like any of the other IOs;  
the header info would be generated then.  BioPerl has traditionally  
been for whatever works though, which is fine by me.

chris

From forrest_zhang at 163.com  Thu Sep 27 03:41:44 2007
From: forrest_zhang at 163.com (Forrest)
Date: Thu, 27 Sep 2007 15:41:44 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
Message-ID: <000501c800d9$dc9c8e90$95d5abb0$@com>

Hi, all
    I install the biosql, and bioperl-db. I want to import swissport data.
But the programe show some error as below:
============================================================================
===============================================
>perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
-namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
Loading /home/forrest/uniprot/uniprot_sprot.dat ...
Could not store Q6DAH5:
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: The supplied lineage does not start near 'Erwinia carotovora subsp.
atroseptica' (I was supplied 'Erwinia carotovora subsp. | Pectobacterium |
Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
Proteobacteria | Bacteria')
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
STACK: Bio::Species::classification
/usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:552
STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:1305
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:973
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:852
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:182
STACK: Bio::DB::Persistent::PersistentObject::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:244
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:169
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:251
STACK: Bio::DB::Persistent::PersistentObject::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:271
STACK: load_seqdatabase.pl:620
-----------------------------------------------------------

 at load_seqdatabase.pl line 633
============================================================================
===============================================

How can I solve it, please help me, Thank you.

Thanks
Forrest zhang




From bix at sendu.me.uk  Thu Sep 27 04:38:00 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 27 Sep 2007 09:38:00 +0100
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000501c800d9$dc9c8e90$95d5abb0$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
Message-ID: <46FB6BE8.9050203@sendu.me.uk>

Forrest wrote:
> Hi, all
>     I install the biosql, and bioperl-db. I want to import swissport data.
> But the programe show some error as below:
> ============================================================================
> ===============================================
>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
> Could not store Q6DAH5:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: The supplied lineage does not start near 'Erwinia carotovora subsp.
> atroseptica' (I was supplied 'Erwinia carotovora subsp. | Pectobacterium |
> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
> Proteobacteria | Bacteria')

From:
OS   Erwinia carotovora subsp. atroseptica (Pectobacterium atrosepticum).
OC   Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales;
OC   Enterobacteriaceae; Pectobacterium.

I'm guessing some oddity in the Swissprot parser where in one place it 
truncates the OS to the first '.', and in another it doesn't?

Can someone confirm this with CVS versions of bioperl-live and -db in 
case Chris already fixed it in recent parser changes?

From cjfields at uiuc.edu  Thu Sep 27 08:47:00 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 07:47:00 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <46FB6BE8.9050203@sendu.me.uk>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<46FB6BE8.9050203@sendu.me.uk>
Message-ID: <AB3D3A39-0B66-4C22-9EE1-98429A958598@uiuc.edu>


On Sep 27, 2007, at 3:38 AM, Sendu Bala wrote:

> Forrest wrote:
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import  
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora  
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |  
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>
> From:
> OS   Erwinia carotovora subsp. atroseptica (Pectobacterium  
> atrosepticum).
> OC   Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales;
> OC   Enterobacteriaceae; Pectobacterium.
>
> I'm guessing some oddity in the Swissprot parser where in one place it
> truncates the OS to the first '.', and in another it doesn't?
>
> Can someone confirm this with CVS versions of bioperl-live and -db in
> case Chris already fixed it in recent parser changes?

It looks suspiciously like he isn't using bioperl-live code (I  
changed the exception to a warning a while back, and I think the '.'  
truncation was fixed).  This is still an outstanding issue with  
bioperl-db which hasn't been fully fixed yet, though; we may have to  
move the priority up on this one.

chris

From bix at sendu.me.uk  Thu Sep 27 09:47:06 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 27 Sep 2007 14:47:06 +0100
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
Message-ID: <46FBB45A.10505@sendu.me.uk>

I want to create a Bio::SeqFeature::Annotated object where the 'type' is 
'conserved_region'.

I got the idea that 'conserved_region' might be ok from here:
http://song.sourceforge.net/SOterm_tables.html#SO:0000330

However, this doesn't work since:

------------- EXCEPTION -------------
MSG: couldn't find a SOFA term matching type 'conserved_region'.
STACK Bio::SeqFeature::Annotated::type 
/data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/Annotated.pm:371
[snip]


I'm guessing Bio::Ontology::OntologyStore is getting its allowed SOFA 
terms from:
http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition


I don't know much about this area. Can someone offer a little guidance 
as to what the significance of these two different files is, why they 
don't contain the same terms, and why I can't use 'conserved_region'?

What's the closest alternative term?

From cain.cshl at gmail.com  Thu Sep 27 10:20:50 2007
From: cain.cshl at gmail.com (Scott Cain)
Date: Thu, 27 Sep 2007 10:20:50 -0400
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
In-Reply-To: <46FBB45A.10505@sendu.me.uk>
References: <46FBB45A.10505@sendu.me.uk>
Message-ID: <1190902850.12078.26.camel@localhost.localdomain>

Hi Sendu,

I believe that BSFA uses SOFA but the growing consensus is that SOFA
should be pitched and all of SO should be used where SOFA was being
used.  I also suspect that BioPerl is using a very old version of SOFA,
since at the time BSFA was written, BioPerl couldn't parse OBO files
(can it now?), so it was using the very old file format (whose name I
can't even remember now) and that file hasn't been updated in a long
time (which is why it isn't finding conserved_region).

If BioPerl can parse OBO files, we should switch BSFA to validate
against 

http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo

Scott


On Thu, 2007-09-27 at 14:47 +0100, Sendu Bala wrote:
> I want to create a Bio::SeqFeature::Annotated object where the 'type' is 
> 'conserved_region'.
> 
> I got the idea that 'conserved_region' might be ok from here:
> http://song.sourceforge.net/SOterm_tables.html#SO:0000330
> 
> However, this doesn't work since:
> 
> ------------- EXCEPTION -------------
> MSG: couldn't find a SOFA term matching type 'conserved_region'.
> STACK Bio::SeqFeature::Annotated::type 
> /data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/Annotated.pm:371
> [snip]
> 
> 
> I'm guessing Bio::Ontology::OntologyStore is getting its allowed SOFA 
> terms from:
> http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition
> 
> 
> I don't know much about this area. Can someone offer a little guidance 
> as to what the significance of these two different files is, why they 
> don't contain the same terms, and why I can't use 'conserved_region'?
> 
> What's the closest alternative term?
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain at cshl.edu
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory


From cjfields at uiuc.edu  Thu Sep 27 11:25:13 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 10:25:13 -0500
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
In-Reply-To: <1190902850.12078.26.camel@localhost.localdomain>
References: <46FBB45A.10505@sendu.me.uk>
	<1190902850.12078.26.camel@localhost.localdomain>
Message-ID: <29DFE331-33F5-47ED-9A6D-AF488E5F0689@uiuc.edu>


On Sep 27, 2007, at 9:20 AM, Scott Cain wrote:

> Hi Sendu,
>
> I believe that BSFA uses SOFA but the growing consensus is that SOFA
> should be pitched and all of SO should be used where SOFA was being
> used.  I also suspect that BioPerl is using a very old version of  
> SOFA,
> since at the time BSFA was written, BioPerl couldn't parse OBO files
> (can it now?), so it was using the very old file format (whose name I
> can't even remember now) and that file hasn't been updated in a long
> time (which is why it isn't finding conserved_region).
>
> If BioPerl can parse OBO files, we should switch BSFA to validate
> against
>
> http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo
>
> Scott

I agree, this would definitely be for the best.  BioPerl can parse  
obo; not sure how often it's used or what the tests are like, but  
switching to SO should give it a good workout and might wring out any  
issues.

chris

> On Thu, 2007-09-27 at 14:47 +0100, Sendu Bala wrote:
>> I want to create a Bio::SeqFeature::Annotated object where the  
>> 'type' is
>> 'conserved_region'.
>>
>> I got the idea that 'conserved_region' might be ok from here:
>> http://song.sourceforge.net/SOterm_tables.html#SO:0000330
>>
>> However, this doesn't work since:
>>
>> ------------- EXCEPTION -------------
>> MSG: couldn't find a SOFA term matching type 'conserved_region'.
>> STACK Bio::SeqFeature::Annotated::type
>> /data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/ 
>> Annotated.pm:371
>> [snip]
>>
>>
>> I'm guessing Bio::Ontology::OntologyStore is getting its allowed SOFA
>> terms from:
>> http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition
>>
>>
>> I don't know much about this area. Can someone offer a little  
>> guidance
>> as to what the significance of these two different files is, why they
>> don't contain the same terms, and why I can't use 'conserved_region'?
>>
>> What's the closest alternative term?
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> -- 
> ---------------------------------------------------------------------- 
> --
> Scott Cain, Ph. D.                                          
> cain at cshl.edu
> GMOD Coordinator (http://www.gmod.org/)                      
> 216-392-3087
> Cold Spring Harbor Laboratory
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Research Associate
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From cain.cshl at gmail.com  Thu Sep 27 11:34:57 2007
From: cain.cshl at gmail.com (Scott Cain)
Date: Thu, 27 Sep 2007 11:34:57 -0400
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
In-Reply-To: <29DFE331-33F5-47ED-9A6D-AF488E5F0689@uiuc.edu>
References: <46FBB45A.10505@sendu.me.uk>
	<1190902850.12078.26.camel@localhost.localdomain>
	<29DFE331-33F5-47ED-9A6D-AF488E5F0689@uiuc.edu>
Message-ID: <1190907297.12078.32.camel@localhost.localdomain>

OK--while I would normal volunteer to do this, I don't think I am going
to have time until after the Genome Informatics and GMOD meetings in
November :-/  If it is still not done then, somebody poke me and remind
me that I said that.

Scott


On Thu, 2007-09-27 at 10:25 -0500, Chris Fields wrote:
> On Sep 27, 2007, at 9:20 AM, Scott Cain wrote:
> 
> > Hi Sendu,
> >
> > I believe that BSFA uses SOFA but the growing consensus is that SOFA
> > should be pitched and all of SO should be used where SOFA was being
> > used.  I also suspect that BioPerl is using a very old version of  
> > SOFA,
> > since at the time BSFA was written, BioPerl couldn't parse OBO files
> > (can it now?), so it was using the very old file format (whose name I
> > can't even remember now) and that file hasn't been updated in a long
> > time (which is why it isn't finding conserved_region).
> >
> > If BioPerl can parse OBO files, we should switch BSFA to validate
> > against
> >
> > http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo
> >
> > Scott
> 
> I agree, this would definitely be for the best.  BioPerl can parse  
> obo; not sure how often it's used or what the tests are like, but  
> switching to SO should give it a good workout and might wring out any  
> issues.
> 
> chris
> 
> > On Thu, 2007-09-27 at 14:47 +0100, Sendu Bala wrote:
> >> I want to create a Bio::SeqFeature::Annotated object where the  
> >> 'type' is
> >> 'conserved_region'.
> >>
> >> I got the idea that 'conserved_region' might be ok from here:
> >> http://song.sourceforge.net/SOterm_tables.html#SO:0000330
> >>
> >> However, this doesn't work since:
> >>
> >> ------------- EXCEPTION -------------
> >> MSG: couldn't find a SOFA term matching type 'conserved_region'.
> >> STACK Bio::SeqFeature::Annotated::type
> >> /data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/ 
> >> Annotated.pm:371
> >> [snip]
> >>
> >>
> >> I'm guessing Bio::Ontology::OntologyStore is getting its allowed SOFA
> >> terms from:
> >> http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition
> >>
> >>
> >> I don't know much about this area. Can someone offer a little  
> >> guidance
> >> as to what the significance of these two different files is, why they
> >> don't contain the same terms, and why I can't use 'conserved_region'?
> >>
> >> What's the closest alternative term?
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > -- 
> > ---------------------------------------------------------------------- 
> > --
> > Scott Cain, Ph. D.                                          
> > cain at cshl.edu
> > GMOD Coordinator (http://www.gmod.org/)                      
> > 216-392-3087
> > Cold Spring Harbor Laboratory
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> Christopher Fields
> Research Associate
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
> 
> 
> 
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   cain.cshl at gmail.com
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory



From cjfields at uiuc.edu  Thu Sep 27 11:43:06 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 10:43:06 -0500
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
In-Reply-To: <1190907297.12078.32.camel@localhost.localdomain>
References: <46FBB45A.10505@sendu.me.uk>
	<1190902850.12078.26.camel@localhost.localdomain>
	<29DFE331-33F5-47ED-9A6D-AF488E5F0689@uiuc.edu>
	<1190907297.12078.32.camel@localhost.localdomain>
Message-ID: <FE3DC3B9-E202-4C92-9618-90D0BF4E3B52@uiuc.edu>

Actually, I just added 'Sequence Ontology OBO' to  
Bio::Ontology::DocumentRegistry and switched BSFA over to use that in  
bioperl-live.  So far it still passes tests checking SO using obo.   
Sendu, does that work or crash-and-burn?

chris

On Sep 27, 2007, at 10:34 AM, Scott Cain wrote:

> OK--while I would normal volunteer to do this, I don't think I am  
> going
> to have time until after the Genome Informatics and GMOD meetings in
> November :-/  If it is still not done then, somebody poke me and  
> remind
> me that I said that.
>
> Scott
>
>
> On Thu, 2007-09-27 at 10:25 -0500, Chris Fields wrote:
>> On Sep 27, 2007, at 9:20 AM, Scott Cain wrote:
>>
>>> Hi Sendu,
>>>
>>> I believe that BSFA uses SOFA but the growing consensus is that SOFA
>>> should be pitched and all of SO should be used where SOFA was being
>>> used.  I also suspect that BioPerl is using a very old version of
>>> SOFA,
>>> since at the time BSFA was written, BioPerl couldn't parse OBO files
>>> (can it now?), so it was using the very old file format (whose  
>>> name I
>>> can't even remember now) and that file hasn't been updated in a long
>>> time (which is why it isn't finding conserved_region).
>>>
>>> If BioPerl can parse OBO files, we should switch BSFA to validate
>>> against
>>>
>>> http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo
>>>
>>> Scott
>>
>> I agree, this would definitely be for the best.  BioPerl can parse
>> obo; not sure how often it's used or what the tests are like, but
>> switching to SO should give it a good workout and might wring out any
>> issues.
>>
>> chris
>>
>>> On Thu, 2007-09-27 at 14:47 +0100, Sendu Bala wrote:
>>>> I want to create a Bio::SeqFeature::Annotated object where the
>>>> 'type' is
>>>> 'conserved_region'.
>>>>
>>>> I got the idea that 'conserved_region' might be ok from here:
>>>> http://song.sourceforge.net/SOterm_tables.html#SO:0000330
>>>>
>>>> However, this doesn't work since:
>>>>
>>>> ------------- EXCEPTION -------------
>>>> MSG: couldn't find a SOFA term matching type 'conserved_region'.
>>>> STACK Bio::SeqFeature::Annotated::type
>>>> /data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/
>>>> Annotated.pm:371
>>>> [snip]
>>>>
>>>>
>>>> I'm guessing Bio::Ontology::OntologyStore is getting its allowed  
>>>> SOFA
>>>> terms from:
>>>> http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition
>>>>
>>>>
>>>> I don't know much about this area. Can someone offer a little
>>>> guidance
>>>> as to what the significance of these two different files is, why  
>>>> they
>>>> don't contain the same terms, and why I can't use  
>>>> 'conserved_region'?
>>>>
>>>> What's the closest alternative term?
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>> -- 
>>> -------------------------------------------------------------------- 
>>> --
>>> --
>>> Scott Cain, Ph. D.
>>> cain at cshl.edu
>>> GMOD Coordinator (http://www.gmod.org/)
>>> 216-392-3087
>>> Cold Spring Harbor Laboratory
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Research Associate
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
> -- 
> ---------------------------------------------------------------------- 
> --
> Scott Cain, Ph. D.                                    
> cain.cshl at gmail.com
> GMOD Coordinator (http://www.gmod.org/)                      
> 216-392-3087
> Cold Spring Harbor Laboratory
>
>

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From hlapp at gmx.net  Thu Sep 27 18:17:16 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu, 27 Sep 2007 18:17:16 -0400
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000501c800d9$dc9c8e90$95d5abb0$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
Message-ID: <2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>

Forrest,

have you preloaded the NCBI taxonomy as suggested in the BioSQL  
installation guidelines? SwissProt format has NCBI taxon IDs, and the  
code will try to use it to look up species and their lineage, rather  
than inserting the lineage from whatever BioPerl parses out of the  
sequence record.

	-hilmar

On Sep 27, 2007, at 3:41 AM, Forrest wrote:

> Hi, all
>     I install the biosql, and bioperl-db. I want to import  
> swissport data.
> But the programe show some error as below:
> ====================================================================== 
> ======
> ===============================================
>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
> Could not store Q6DAH5:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: The supplied lineage does not start near 'Erwinia carotovora  
> subsp.
> atroseptica' (I was supplied 'Erwinia carotovora subsp. |  
> Pectobacterium |
> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
> Proteobacteria | Bacteria')
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
> STACK: Bio::Species::classification
> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:552
> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:1305
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:973
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:852
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:182
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: load_seqdatabase.pl:620
> -----------------------------------------------------------
>
>  at load_seqdatabase.pl line 633
> ====================================================================== 
> ======
> ===============================================
>
> How can I solve it, please help me, Thank you.
>
> Thanks
> Forrest zhang
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================






From wcnelson at usc.edu  Thu Sep 27 15:20:47 2007
From: wcnelson at usc.edu (William C. Nelson)
Date: Thu, 27 Sep 2007 15:20:47 -0400
Subject: [Bioperl-l] cpan install
Message-ID: <46FC028F.3050000@usc.edu>

Hello,

I tried to install v1.5.2 using cpan.

My urllist looks like:

cpan[2]> o conf urllist
    urllist
        0 [ftp://cpan.cs.utah.edu/pub/CPAN/]
        1 [ftp://cpan.mirrors.tds.net/pub/CPAN]
        2 [ftp://ftp.open-bio.org/pub/bioperl/DIST/]
Type 'o conf' to view all configuration items


And when I look for bioperl, I see:

cpan[1]> d /bioperl/
CPAN: Storable loaded ok (v2.16)
Going to read /root/.cpan/Metadata
  Database was generated on Thu, 27 Sep 2007 18:36:44 GMT
Distribution    BIRNEY/bioperl-1.2.1.tar.gz
Distribution    BIRNEY/bioperl-1.2.2.tar.gz
Distribution    BIRNEY/bioperl-1.2.3.tar.gz
Distribution    BIRNEY/bioperl-1.2.tar.gz
Distribution    BIRNEY/bioperl-1.4.tar.gz
Distribution    BIRNEY/bioperl-db-0.1.tar.gz
Distribution    BIRNEY/bioperl-ext-1.4.tar.gz
Distribution    BIRNEY/bioperl-gui-0.7.tar.gz
Distribution    BIRNEY/bioperl-run-1.2.2.tar.gz
Distribution    BIRNEY/bioperl-run-1.4.tar.gz
Distribution    BOZO/Fry-Lib-BioPerl-0.15.tar.gz
Distribution    CRAFFI/Bundle-BioPerl-2.1.8.tar.gz
12 items found


No v 1.5.2.  This may be because it can't see the distribution at 
ftp://ftp.open-bio.org/pub/bioperl/DIST/. When I try to reload the 
index, I get messages saying cpan can't find the files 
ftp://ftp.open-bio.org/pub/bioperl/DIST/authors/01mailrc.txt.gz or 
ftp://ftp.open-bio.org/pub/bioperl/DIST/modules/02packages.details.txt.gz 
or ftp://ftp.open-bio.org/pub/bioperl/DIST/modules/03modlist.data.gz.

Am I doing something wrong?
Does the FTP site need to be updated?

Thanks,
Bill

-- 
-----------------------------------------------------
William C. Nelson, PhD
Research Asst Professor
Wrigely Institute for Environmental Studies
University of Southern California LAS/MEB
310-510-4097
wcnelson at usc.edu


From wgallin at ualberta.ca  Thu Sep 27 22:51:12 2007
From: wgallin at ualberta.ca (Warren Gallin)
Date: Thu, 27 Sep 2007 20:51:12 -0600
Subject: [Bioperl-l] A couple Eutilities questions
Message-ID: <98B80D80-AF6F-424B-81B7-5B0CFD8D6CB2@ualberta.ca>

I've just started using Bio::DB::Eutilities and I have encountered  
two things that seem like problems.

I am using the latest (retrieved Wednesday September 26, 2007) CVS  
version, running in an Apple Xserver.

Problem 1:  When I execute the following code:


#Create new EUTILS object for retrieving sets of entries, given an  
array of accession numbers
	my $gpeptfactory = Bio::DB::EUtilities -> new(	-eutil => 'efetch',
													-db => 'protein',
													-rettype =>'genbank',
													-id => \@pro_acc) ;
	my $file = 'temp_hold.gb';
	
	$gpeptfactory -> get_Response(-file => $file);
	
	my $retr_seq = Bio::SeqIO->new(	-file => $file,
                             		-format => 'genbank');


I get the following warning, consistently:

Use of uninitialized value in concatenation (.) or string at /Library/ 
Perl/5.8.1/Bio/DB/GenericWebAgent.pm line 92.


Also, about half the time I get a crash with the following error  
message:


------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Response Error
Bad Gateway
STACK: Error::throw
STACK: Bio::Root::Root::throw /Library/Perl/5.8.1/Bio/Root/Root.pm:357
STACK: Bio::DB::GenericWebAgent::get_Response /Library/Perl/5.8.1/Bio/ 
DB/GenericWebAgent.pm:184
STACK: gb_update_v4.pl:118
-----------------------------------------------------------



The other half of the time the script runs fine through to the end.   
I have no idea whether the crash is related to the warning or not.  I  
looked at the line where the warning is generated, and it appears to  
be the "new" method for the GenericWebAgent.pm  .  I can't see how  
the call to Eutilities is can be passing an undefined value through  
to this method.


Problem #2:

When the code runs, I retrieve an incorrect record.  I am retrieving  
using accessions, and accession I51532 retrieves two records.  One is  
the record I am after, an ion channel protein, the other comes from a  
patent application; the problem is that, although the accession  
number for the unwanted record is AAB76204, the LOCUS entry in the  
record is I51532.

So, is it possible that the efetch function is collecting on the  
basis of LOCUS, not ACCESSION?  I realize that the two are almost  
always the same, but not apparently in this case.

Any advice and/or explanation is appreciated.

Warren Gallin

From forrest_zhang at 163.com  Thu Sep 27 22:50:53 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 10:50:53 +0800
Subject: [Bioperl-l] cpan install
In-Reply-To: <46FC028F.3050000@usc.edu>
References: <46FC028F.3050000@usc.edu>
Message-ID: <000001c8017a$6384bae0$2a8e30a0$@com>

Try 
cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz

other question you should browse
http://www.bioperl.org/wiki/Installing_Bioperl_for_Unix

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of William C. Nelson
Sent: Friday, September 28, 2007 3:21 AM
To: bioperl-l at bioperl.org
Subject: [Bioperl-l] cpan install

Hello,

I tried to install v1.5.2 using cpan.

My urllist looks like:

cpan[2]> o conf urllist
    urllist
        0 [ftp://cpan.cs.utah.edu/pub/CPAN/]
        1 [ftp://cpan.mirrors.tds.net/pub/CPAN]
        2 [ftp://ftp.open-bio.org/pub/bioperl/DIST/]
Type 'o conf' to view all configuration items


And when I look for bioperl, I see:

cpan[1]> d /bioperl/
CPAN: Storable loaded ok (v2.16)
Going to read /root/.cpan/Metadata
  Database was generated on Thu, 27 Sep 2007 18:36:44 GMT
Distribution    BIRNEY/bioperl-1.2.1.tar.gz
Distribution    BIRNEY/bioperl-1.2.2.tar.gz
Distribution    BIRNEY/bioperl-1.2.3.tar.gz
Distribution    BIRNEY/bioperl-1.2.tar.gz
Distribution    BIRNEY/bioperl-1.4.tar.gz
Distribution    BIRNEY/bioperl-db-0.1.tar.gz
Distribution    BIRNEY/bioperl-ext-1.4.tar.gz
Distribution    BIRNEY/bioperl-gui-0.7.tar.gz
Distribution    BIRNEY/bioperl-run-1.2.2.tar.gz
Distribution    BIRNEY/bioperl-run-1.4.tar.gz
Distribution    BOZO/Fry-Lib-BioPerl-0.15.tar.gz
Distribution    CRAFFI/Bundle-BioPerl-2.1.8.tar.gz
12 items found


No v 1.5.2.  This may be because it can't see the distribution at 
ftp://ftp.open-bio.org/pub/bioperl/DIST/. When I try to reload the 
index, I get messages saying cpan can't find the files 
ftp://ftp.open-bio.org/pub/bioperl/DIST/authors/01mailrc.txt.gz or 
ftp://ftp.open-bio.org/pub/bioperl/DIST/modules/02packages.details.txt.gz 
or ftp://ftp.open-bio.org/pub/bioperl/DIST/modules/03modlist.data.gz.

Am I doing something wrong?
Does the FTP site need to be updated?

Thanks,
Bill

-- 
-----------------------------------------------------
William C. Nelson, PhD
Research Asst Professor
Wrigely Institute for Environmental Studies
University of Southern California LAS/MEB
310-510-4097
wcnelson at usc.edu

_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l




From forrest_zhang at 163.com  Thu Sep 27 23:15:03 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 11:15:03 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
Message-ID: <000101c8017d$c4643360$4d2c9a20$@com>

Hilmar,
	I have already pre-loaded the NCBI taxonomy using
load_ncbi_taxonomy.pl yet. The error message show:

--------------------- WARNING ---------------------
MSG: The supplied lineage does not start near 'Phaseolus aureus' (I was
supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I | rosids
| core eudicotyledons | eudicotyledons | Magnoliophyta | Euphyllophyta |
Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
---------------------------------------------------
Could not store Q40784: 
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: create: object (Bio::Species) failed to insert or to be found by unique
key
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:206
STACK: Bio::DB::Persistent::PersistentObject::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:244
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:169
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:251
STACK: Bio::DB::Persistent::PersistentObject::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:271
STACK: /usr/bin/bp_load_seqdatabase.pl:633
-----------------------------------------------------------
Sigh~~~~~~

Forrest Zhang


-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
Sent: Friday, September 28, 2007 6:17 AM
To: Forrest
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

Forrest,

have you preloaded the NCBI taxonomy as suggested in the BioSQL  
installation guidelines? SwissProt format has NCBI taxon IDs, and the  
code will try to use it to look up species and their lineage, rather  
than inserting the lineage from whatever BioPerl parses out of the  
sequence record.

	-hilmar

On Sep 27, 2007, at 3:41 AM, Forrest wrote:

> Hi, all
>     I install the biosql, and bioperl-db. I want to import  
> swissport data.
> But the programe show some error as below:
> ====================================================================== 
> ======
> ===============================================
>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
> Could not store Q6DAH5:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: The supplied lineage does not start near 'Erwinia carotovora  
> subsp.
> atroseptica' (I was supplied 'Erwinia carotovora subsp. |  
> Pectobacterium |
> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
> Proteobacteria | Bacteria')
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
> STACK: Bio::Species::classification
> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:552
> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:1305
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:973
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:852
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:182
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: load_seqdatabase.pl:620
> -----------------------------------------------------------
>
>  at load_seqdatabase.pl line 633
> ====================================================================== 
> ======
> ===============================================
>
> How can I solve it, please help me, Thank you.
>
> Thanks
> Forrest zhang
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================





_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l




From forrest_zhang at 163.com  Thu Sep 27 23:33:21 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 11:33:21 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000101c8017d$c4643360$4d2c9a20$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
Message-ID: <000201c80180$54762650$fd6272f0$@com>

I reinstall the bioperl-db, I found some error.

t/01dbadaptor.....ok

t/02species.......FAILED tests 66-95

        Failed 30/65 tests, 53.85% okay
t/03simpleseq.....ok

t/04swiss.........ok

t/05seqfeature....ok

t/06comment.......ok

t/07dblink........ok

t/08genbank.......ok

t/09fuzzy2........ok

t/10ensembl.......ok

t/11locuslink.....ok

t/12ontology......ok

t/13remove........ok

t/14query.........ok

t/15cluster.......ok 9/160

--------------------- WARNING ---------------------
MSG: failed to store one or more child objects for an instance of class
Bio::Cluster::UniGene (PK=320)
---------------------------------------------------
t/15cluster.......ok

t/16obda..........ok

Failed Test   Stat Wstat Total Fail  List of Failed
----------------------------------------------------------------------------
---
t/02species.t               65   30  66-95
Failed 1/16 test scripts. -30/1423 subtests failed.
Files=16, Tests=1423, 35 wallclock secs (16.67 cusr +  0.63 csys = 17.30
CPU)
Failed 1/16 test programs. -30/1423 subtests failed.
make: *** [test] Error 255

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Forrest Zhang
Sent: Friday, September 28, 2007 11:15 AM
To: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

Hilmar,
	I have already pre-loaded the NCBI taxonomy using
load_ncbi_taxonomy.pl yet. The error message show:

--------------------- WARNING ---------------------
MSG: The supplied lineage does not start near 'Phaseolus aureus' (I was
supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I | rosids
| core eudicotyledons | eudicotyledons | Magnoliophyta | Euphyllophyta |
Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
---------------------------------------------------
Could not store Q40784: 
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: create: object (Bio::Species) failed to insert or to be found by unique
key
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:206
STACK: Bio::DB::Persistent::PersistentObject::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:244
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:169
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:251
STACK: Bio::DB::Persistent::PersistentObject::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:271
STACK: /usr/bin/bp_load_seqdatabase.pl:633
-----------------------------------------------------------
Sigh~~~~~~

Forrest Zhang


-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
Sent: Friday, September 28, 2007 6:17 AM
To: Forrest
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

Forrest,

have you preloaded the NCBI taxonomy as suggested in the BioSQL  
installation guidelines? SwissProt format has NCBI taxon IDs, and the  
code will try to use it to look up species and their lineage, rather  
than inserting the lineage from whatever BioPerl parses out of the  
sequence record.

	-hilmar

On Sep 27, 2007, at 3:41 AM, Forrest wrote:

> Hi, all
>     I install the biosql, and bioperl-db. I want to import  
> swissport data.
> But the programe show some error as below:
> ====================================================================== 
> ======
> ===============================================
>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
> Could not store Q6DAH5:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: The supplied lineage does not start near 'Erwinia carotovora  
> subsp.
> atroseptica' (I was supplied 'Erwinia carotovora subsp. |  
> Pectobacterium |
> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
> Proteobacteria | Bacteria')
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
> STACK: Bio::Species::classification
> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:552
> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:1305
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:973
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:852
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:182
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: load_seqdatabase.pl:620
> -----------------------------------------------------------
>
>  at load_seqdatabase.pl line 633
> ====================================================================== 
> ======
> ===============================================
>
> How can I solve it, please help me, Thank you.
>
> Thanks
> Forrest zhang
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================





_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l



_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l




From cjfields at uiuc.edu  Fri Sep 28 00:58:27 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 23:58:27 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000201c80180$54762650$fd6272f0$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
	<000201c80180$54762650$fd6272f0$@com>
Message-ID: <9535284F-2DC5-4361-81A2-0B739A7E89E4@uiuc.edu>

Bio::Species will have problems if you test on a database with  
taxonomy loaded (it's mentioned in the install docs I think).

The UniGene warning has always popped up and isn't anything to worry  
about.

chris

On Sep 27, 2007, at 10:33 PM, Forrest Zhang wrote:

> I reinstall the bioperl-db, I found some error.
>
> t/01dbadaptor.....ok
>
> t/02species.......FAILED tests 66-95
>
>         Failed 30/65 tests, 53.85% okay
> t/03simpleseq.....ok
>
> t/04swiss.........ok
>
> t/05seqfeature....ok
>
> t/06comment.......ok
>
> t/07dblink........ok
>
> t/08genbank.......ok
>
> t/09fuzzy2........ok
>
> t/10ensembl.......ok
>
> t/11locuslink.....ok
>
> t/12ontology......ok
>
> t/13remove........ok
>
> t/14query.........ok
>
> t/15cluster.......ok 9/160
>
> --------------------- WARNING ---------------------
> MSG: failed to store one or more child objects for an instance of  
> class
> Bio::Cluster::UniGene (PK=320)
> ---------------------------------------------------
> t/15cluster.......ok
>
> t/16obda..........ok
>
> Failed Test   Stat Wstat Total Fail  List of Failed
> ---------------------------------------------------------------------- 
> ------
> ---
> t/02species.t               65   30  66-95
> Failed 1/16 test scripts. -30/1423 subtests failed.
> Files=16, Tests=1423, 35 wallclock secs (16.67 cusr +  0.63 csys =  
> 17.30
> CPU)
> Failed 1/16 test programs. -30/1423 subtests failed.
> make: *** [test] Error 255
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Forrest  
> Zhang
> Sent: Friday, September 28, 2007 11:15 AM
> To: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From cjfields at uiuc.edu  Fri Sep 28 00:57:55 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 23:57:55 -0500
Subject: [Bioperl-l] A couple Eutilities questions
In-Reply-To: <98B80D80-AF6F-424B-81B7-5B0CFD8D6CB2@ualberta.ca>
References: <98B80D80-AF6F-424B-81B7-5B0CFD8D6CB2@ualberta.ca>
Message-ID: <A8E3D712-1159-43F7-91A6-16BA6103AB7B@uiuc.edu>


On Sep 27, 2007, at 9:51 PM, Warren Gallin wrote:

> I've just started using Bio::DB::Eutilities and I have encountered
> two things that seem like problems.
>
> I am using the latest (retrieved Wednesday September 26, 2007) CVS
> version, running in an Apple Xserver.
>
> Problem 1:  When I execute the following code:
>
>
> #Create new EUTILS object for retrieving sets of entries, given an
> array of accession numbers
> 	my $gpeptfactory = Bio::DB::EUtilities -> new(	-eutil => 'efetch',
> 													-db => 'protein',
> 													-rettype =>'genbank',
> 													-id => \@pro_acc) ;
> 	my $file = 'temp_hold.gb';
> 	
> 	$gpeptfactory -> get_Response(-file => $file);
> 	
> 	my $retr_seq = Bio::SeqIO->new(	-file => $file,
>                              		-format => 'genbank');
>
>
> I get the following warning, consistently:
>
> Use of uninitialized value in concatenation (.) or string at /Library/
> Perl/5.8.1/Bio/DB/GenericWebAgent.pm line 92.

The above works for me w/o problems.  The error itself doesn't make  
much sense; the line is:

     $self->ua(LWP::UserAgent->new(env_proxy => 1,
             agent => ref($self).':'.$self->VERSION));

so either $self isn't a ref (which it appears to be) or there is no  
version (which is odd but may be a perl bug).  What happens if you  
hard-code the version number to something simple?

Also, I noticed you're using perl 5.8.1; which version of Mac OS X  
are you using?  I remember something was off about that perl version  
but I can't remember what it was...

> Also, about half the time I get a crash with the following error
> message:
>
>
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: Response Error
> Bad Gateway
> STACK: Error::throw
> STACK: Bio::Root::Root::throw /Library/Perl/5.8.1/Bio/Root/Root.pm:357
> STACK: Bio::DB::GenericWebAgent::get_Response /Library/Perl/5.8.1/Bio/
> DB/GenericWebAgent.pm:184
> STACK: gb_update_v4.pl:118
> -----------------------------------------------------------

I have seen it sometimes pop up when the NCBI server is under heavy  
server load.  It may also be related to your local ISP or setup; see  
here:

http://www.checkupdown.com/status/E502.html

Supposedly this may pop up with mod_perl but I haven't seen/heard  
anything myself related to this.

> The other half of the time the script runs fine through to the end.
> I have no idea whether the crash is related to the warning or not.  I
> looked at the line where the warning is generated, and it appears to
> be the "new" method for the GenericWebAgent.pm  .  I can't see how
> the call to Eutilities is can be passing an undefined value through
> to this method.

EUtilities is-a GenericWebAgent; the new() constructors are chained  
using SUPER::new().  Also, you can call VERSION from any variable so  
it could be a problem there if VERSION is undef, though again I can't  
think why this would fail.  Regardless, the 'Use of undefined'  
warning is not a fatal error.

> Problem #2:
>
> When the code runs, I retrieve an incorrect record.  I am retrieving
> using accessions, and accession I51532 retrieves two records.  One is
> the record I am after, an ion channel protein, the other comes from a
> patent application; the problem is that, although the accession
> number for the unwanted record is AAB76204, the LOCUS entry in the
> record is I51532.
>
> So, is it possible that the efetch function is collecting on the
> basis of LOCUS, not ACCESSION?  I realize that the two are almost
> always the same, but not apparently in this case.
>
> Any advice and/or explanation is appreciated.
>
> Warren Gallin

The only means NCBI guarantees to retrieve a unique record every time  
is by using the primary ID, which for sequence records is the GI.   
The accession works most of the time, and efetch accepts accs in the  
place of GI (it's the only eutil that does).  However, every once in  
a while you get stung and retrieve multiple seqs.

BTW, I entered your sequence into Entrez and it popped up as  
discontinued (which could be part of the problem); the current acc is  
Q91781.

chris

From cjfields at uiuc.edu  Fri Sep 28 01:00:18 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 00:00:18 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000101c8017d$c4643360$4d2c9a20$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
Message-ID: <8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>

If this is occurring using bioperl from CVS then I'll try taking a  
look at it.

chris

On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:

> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From forrest_zhang at 163.com  Fri Sep 28 01:34:21 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 13:34:21 +0800
Subject: [Bioperl-l] FW:  load_seqdatabase.pl error
Message-ID: <000101c80191$3b300e70$b1902b50$@com>

Oh, my God!  I am tring reinstall bioperl-live using CVS, so many error
shown below.

biocc bioperl-live # perl Build.PL 
Checking whether your kit is complete...
Looks good

Checking prerequisites...
Looks good

Checking features:
  BioDBGFF.................enabled
  BioDBSeqFeature_mysql....enabled
  Network..................enabled
  BioDBSeqFeature_BDB......enabled

Install [a]ll Bioperl scripts, [n]one, or choose groups [i]nteractively? [a]

  - will install all scripts

Do you want to run the BioDBGFF live database tests? y/n [n] y
Which database should I use for testing the mysql driver? [test] 
On which host is database 'test' running (hostname, ip address or host:port)
[localhost] 
User name for connecting to database 'test'? [undef] root
Password for connecting to database 'test'? [undef] 
  - will run the BioDBGFF tests with database driver 'mysql' and these
settings:
    Database test
    Host     localhost
    DSN      dbi:mysql:database=test
    User     root
    Password undef

Do you want to run tests that require connection to servers across the
internet
(likely to cause some failures)? y/n [n] y
  - will run internet-requiring tests
Deleting Build
Removed previous script 'Build'

Creating new 'Build' script for 'bioperl' version '1.0050021'
biocc bioperl-live # ./Build test
Copying Bio/Align/Utilities.pm -> blib/lib/Bio/Align/Utilities.pm
Copying Bio/Search/HSP/ModelHSP.pm -> blib/lib/Bio/Search/HSP/ModelHSP.pm
Copying Bio/Ontology/DocumentRegistry.pm ->
blib/lib/Bio/Ontology/DocumentRegistry.pm
Copying Bio/SeqFeature/Annotated.pm -> blib/lib/Bio/SeqFeature/Annotated.pm
Copying Bio/SimpleAlign.pm -> blib/lib/Bio/SimpleAlign.pm
Copying Bio/AlignIO/stockholm.pm -> blib/lib/Bio/AlignIO/stockholm.pm
Copying scripts/utilities/bp_sreformat.PLS -> blib/script/bp_sreformat.PLS
Deleting blib/script/bp_sreformat.PLS.bak
blib/script/bp_sreformat.PLS -> blib/script/bp_sreformat.pl
Copying scripts/graphics/contig_draw.PLS -> blib/script/contig_draw.PLS
Deleting blib/script/contig_draw.PLS.bak
blib/script/contig_draw.PLS -> blib/script/bp_contig_draw.pl
Copying scripts/Bio-DB-GFF/meta_gff.PLS -> blib/script/meta_gff.PLS
Deleting blib/script/meta_gff.PLS.bak
blib/script/meta_gff.PLS -> blib/script/bp_meta_gff.pl
Copying scripts/tree/tree2pag.PLS -> blib/script/tree2pag.PLS
Deleting blib/script/tree2pag.PLS.bak
blib/script/tree2pag.PLS -> blib/script/bp_tree2pag.pl
Copying scripts/Bio-SeqFeature-Store/bp_seqfeature_gff3.PLS ->
blib/script/bp_seqfeature_gff3.PLS
blib/script/bp_seqfeature_gff3.PLS -> blib/script/bp_seqfeature_gff3.pl
Copying scripts/popgen/heterogeneity_test.PLS ->
blib/script/heterogeneity_test.PLS
Deleting blib/script/heterogeneity_test.PLS.bak
blib/script/heterogeneity_test.PLS -> blib/script/bp_heterogeneity_test.pl
Copying scripts/DB/flanks.PLS -> blib/script/flanks.PLS
Deleting blib/script/flanks.PLS.bak
blib/script/flanks.PLS -> blib/script/bp_flanks.pl
Copying scripts/graphics/feature_draw.PLS -> blib/script/feature_draw.PLS
Deleting blib/script/feature_draw.PLS.bak
blib/script/feature_draw.PLS -> blib/script/bp_feature_draw.pl
Copying scripts/DB/biogetseq.PLS -> blib/script/biogetseq.PLS
Deleting blib/script/biogetseq.PLS.bak
blib/script/biogetseq.PLS -> blib/script/bp_biogetseq.pl
Copying scripts/Bio-SeqFeature-Store/bp_seqfeature_load.PLS ->
blib/script/bp_seqfeature_load.PLS
Deleting blib/script/bp_seqfeature_load.PLS.bak
blib/script/bp_seqfeature_load.PLS -> blib/script/bp_seqfeature_load.pl
Copying scripts/searchio/fastam9_to_table.PLS ->
blib/script/fastam9_to_table.PLS
Deleting blib/script/fastam9_to_table.PLS.bak
blib/script/fastam9_to_table.PLS -> blib/script/bp_fastam9_to_table.pl
Copying scripts/utilities/seq_length.PLS -> blib/script/seq_length.PLS
Deleting blib/script/seq_length.PLS.bak
blib/script/seq_length.PLS -> blib/script/bp_seq_length.pl
Copying scripts/Bio-DB-GFF/genbank2gff.PLS -> blib/script/genbank2gff.PLS
Deleting blib/script/genbank2gff.PLS.bak
blib/script/genbank2gff.PLS -> blib/script/bp_genbank2gff.pl
Copying scripts/taxa/taxid4species.PLS -> blib/script/taxid4species.PLS
Deleting blib/script/taxid4species.PLS.bak
blib/script/taxid4species.PLS -> blib/script/bp_taxid4species.pl
Copying scripts/biographics/bp_glyphs1-demo.PLS ->
blib/script/bp_glyphs1-demo.PLS
Deleting blib/script/bp_glyphs1-demo.PLS.bak
blib/script/bp_glyphs1-demo.PLS -> blib/script/bp_glyphs1-demo.pl
Copying scripts/tree/blast2tree.PLS -> blib/script/blast2tree.PLS
Deleting blib/script/blast2tree.PLS.bak
blib/script/blast2tree.PLS -> blib/script/bp_blast2tree.pl
Copying scripts/graphics/frend.PLS -> blib/script/frend.PLS
Deleting blib/script/frend.PLS.bak
blib/script/frend.PLS -> blib/script/bp_frend.pl
Copying scripts/taxa/query_entrez_taxa.PLS ->
blib/script/query_entrez_taxa.PLS
Deleting blib/script/query_entrez_taxa.PLS.bak
blib/script/query_entrez_taxa.PLS -> blib/script/bp_query_entrez_taxa.pl
Copying scripts/biographics/bp_glyphs2-demo.PLS ->
blib/script/bp_glyphs2-demo.PLS
Deleting blib/script/bp_glyphs2-demo.PLS.bak
blib/script/bp_glyphs2-demo.PLS -> blib/script/bp_glyphs2-demo.pl
Copying scripts/taxa/taxonomy2tree.PLS -> blib/script/taxonomy2tree.PLS
Deleting blib/script/taxonomy2tree.PLS.bak
blib/script/taxonomy2tree.PLS -> blib/script/bp_taxonomy2tree.pl
Copying scripts/utilities/search2alnblocks.PLS ->
blib/script/search2alnblocks.PLS
Deleting blib/script/search2alnblocks.PLS.bak
blib/script/search2alnblocks.PLS -> blib/script/bp_search2alnblocks.pl
Copying scripts/utilities/mask_by_search.PLS ->
blib/script/mask_by_search.PLS
Deleting blib/script/mask_by_search.PLS.bak
blib/script/mask_by_search.PLS -> blib/script/bp_mask_by_search.pl
Copying scripts/seqstats/gccalc.PLS -> blib/script/gccalc.PLS
Deleting blib/script/gccalc.PLS.bak
blib/script/gccalc.PLS -> blib/script/bp_gccalc.pl
Copying scripts/popgen/composite_LD.PLS -> blib/script/composite_LD.PLS
Deleting blib/script/composite_LD.PLS.bak
blib/script/composite_LD.PLS -> blib/script/bp_composite_LD.pl
Copying scripts/seqstats/aacomp.PLS -> blib/script/aacomp.PLS
Deleting blib/script/aacomp.PLS.bak
blib/script/aacomp.PLS -> blib/script/bp_aacomp.pl
Copying scripts/Bio-DB-GFF/process_wormbase.PLS ->
blib/script/process_wormbase.PLS
Deleting blib/script/process_wormbase.PLS.bak
blib/script/process_wormbase.PLS -> blib/script/bp_process_wormbase.pl
Copying scripts/taxa/local_taxonomydb_query.PLS ->
blib/script/local_taxonomydb_query.PLS
Deleting blib/script/local_taxonomydb_query.PLS.bak
blib/script/local_taxonomydb_query.PLS ->
blib/script/bp_local_taxonomydb_query.pl
Copying scripts/biblio/biblio.PLS -> blib/script/biblio.PLS
Deleting blib/script/biblio.PLS.bak
blib/script/biblio.PLS -> blib/script/bp_biblio.pl
Copying scripts/biographics/bp_embl2picture.PLS ->
blib/script/bp_embl2picture.PLS
Deleting blib/script/bp_embl2picture.PLS.bak
blib/script/bp_embl2picture.PLS -> blib/script/bp_embl2picture.pl
Copying scripts/Bio-DB-GFF/genbank2gff3.PLS -> blib/script/genbank2gff3.PLS
Deleting blib/script/genbank2gff3.PLS.bak
blib/script/genbank2gff3.PLS -> blib/script/bp_genbank2gff3.pl
Copying scripts/utilities/search2BSML.PLS -> blib/script/search2BSML.PLS
Deleting blib/script/search2BSML.PLS.bak
blib/script/search2BSML.PLS -> blib/script/bp_search2BSML.pl
Copying scripts/seq/seqconvert.PLS -> blib/script/seqconvert.PLS
Deleting blib/script/seqconvert.PLS.bak
blib/script/seqconvert.PLS -> blib/script/bp_seqconvert.pl
Copying scripts/searchio/parse_hmmsearch.PLS ->
blib/script/parse_hmmsearch.PLS
Deleting blib/script/parse_hmmsearch.PLS.bak
blib/script/parse_hmmsearch.PLS -> blib/script/bp_parse_hmmsearch.pl
Copying scripts/index/bp_seqret.PLS -> blib/script/bp_seqret.PLS
Deleting blib/script/bp_seqret.PLS.bak
blib/script/bp_seqret.PLS -> blib/script/bp_seqret.pl
Copying scripts/searchio/filter_search.PLS -> blib/script/filter_search.PLS
Deleting blib/script/filter_search.PLS.bak
blib/script/filter_search.PLS -> blib/script/bp_filter_search.pl
Copying scripts/tree/nexus2nh.PLS -> blib/script/nexus2nh.PLS
Deleting blib/script/nexus2nh.PLS.bak
blib/script/nexus2nh.PLS -> blib/script/bp_nexus2nh.pl
Copying scripts/Bio-DB-GFF/generate_histogram.PLS ->
blib/script/generate_histogram.PLS
Deleting blib/script/generate_histogram.PLS.bak
blib/script/generate_histogram.PLS -> blib/script/bp_generate_histogram.pl
Copying scripts/seq/split_seq.PLS -> blib/script/split_seq.PLS
Deleting blib/script/split_seq.PLS.bak
blib/script/split_seq.PLS -> blib/script/bp_split_seq.pl
Copying scripts/Bio-DB-GFF/load_gff.PLS -> blib/script/load_gff.PLS
Deleting blib/script/load_gff.PLS.bak
blib/script/load_gff.PLS -> blib/script/bp_load_gff.pl
Copying scripts/index/bp_fetch.PLS -> blib/script/bp_fetch.PLS
Deleting blib/script/bp_fetch.PLS.bak
blib/script/bp_fetch.PLS -> blib/script/bp_fetch.pl
Copying scripts/utilities/mutate.PLS -> blib/script/mutate.PLS
Deleting blib/script/mutate.PLS.bak
blib/script/mutate.PLS -> blib/script/bp_mutate.pl
Copying scripts/Bio-DB-GFF/process_sgd.PLS -> blib/script/process_sgd.PLS
Deleting blib/script/process_sgd.PLS.bak
blib/script/process_sgd.PLS -> blib/script/bp_process_sgd.pl
Copying scripts/index/bp_index.PLS -> blib/script/bp_index.PLS
Deleting blib/script/bp_index.PLS.bak
blib/script/bp_index.PLS -> blib/script/bp_index.pl
Copying scripts/utilities/dbsplit.PLS -> blib/script/dbsplit.PLS
Deleting blib/script/dbsplit.PLS.bak
blib/script/dbsplit.PLS -> blib/script/bp_dbsplit.pl
Copying scripts/seqstats/oligo_count.PLS -> blib/script/oligo_count.PLS
Deleting blib/script/oligo_count.PLS.bak
blib/script/oligo_count.PLS -> blib/script/bp_oligo_count.pl
Copying scripts/searchio/hmmer_to_table.PLS ->
blib/script/hmmer_to_table.PLS
Deleting blib/script/hmmer_to_table.PLS.bak
blib/script/hmmer_to_table.PLS -> blib/script/bp_hmmer_to_table.pl
Copying scripts/Bio-DB-GFF/process_gadfly.PLS ->
blib/script/process_gadfly.PLS
Deleting blib/script/process_gadfly.PLS.bak
blib/script/process_gadfly.PLS -> blib/script/bp_process_gadfly.pl
Copying scripts/DB/biofetch_genbank_proxy.PLS ->
blib/script/biofetch_genbank_proxy.PLS
Deleting blib/script/biofetch_genbank_proxy.PLS.bak
blib/script/biofetch_genbank_proxy.PLS ->
blib/script/bp_biofetch_genbank_proxy.pl
Copying scripts/seq/extract_feature_seq.PLS ->
blib/script/extract_feature_seq.PLS
Deleting blib/script/extract_feature_seq.PLS.bak
blib/script/extract_feature_seq.PLS -> blib/script/bp_extract_feature_seq.pl
Copying scripts/Bio-DB-GFF/bulk_load_gff.PLS ->
blib/script/bulk_load_gff.PLS
Deleting blib/script/bulk_load_gff.PLS.bak
blib/script/bulk_load_gff.PLS -> blib/script/bp_bulk_load_gff.pl
Copying scripts/utilities/search2gff.PLS -> blib/script/search2gff.PLS
Deleting blib/script/search2gff.PLS.bak
blib/script/search2gff.PLS -> blib/script/bp_search2gff.pl
Copying scripts/seq/make_mrna_protein.PLS ->
blib/script/make_mrna_protein.PLS
Deleting blib/script/make_mrna_protein.PLS.bak
blib/script/make_mrna_protein.PLS -> blib/script/bp_make_mrna_protein.pl
Copying scripts/seq/unflatten_seq.PLS -> blib/script/unflatten_seq.PLS
Deleting blib/script/unflatten_seq.PLS.bak
blib/script/unflatten_seq.PLS -> blib/script/bp_unflatten_seq.pl
Copying scripts/utilities/search2tribe.PLS -> blib/script/search2tribe.PLS
Deleting blib/script/search2tribe.PLS.bak
blib/script/search2tribe.PLS -> blib/script/bp_search2tribe.pl
Copying scripts/DB/bioflat_index.PLS -> blib/script/bioflat_index.PLS
Deleting blib/script/bioflat_index.PLS.bak
blib/script/bioflat_index.PLS -> blib/script/bp_bioflat_index.pl
Copying scripts/utilities/pairwise_kaks.PLS -> blib/script/pairwise_kaks.PLS
Deleting blib/script/pairwise_kaks.PLS.bak
blib/script/pairwise_kaks.PLS -> blib/script/bp_pairwise_kaks.pl
Copying scripts/Bio-DB-GFF/fast_load_gff.PLS ->
blib/script/fast_load_gff.PLS
Deleting blib/script/fast_load_gff.PLS.bak
blib/script/fast_load_gff.PLS -> blib/script/bp_fast_load_gff.pl
Copying scripts/seqstats/chaos_plot.PLS -> blib/script/chaos_plot.PLS
Deleting blib/script/chaos_plot.PLS.bak
blib/script/chaos_plot.PLS -> blib/script/bp_chaos_plot.pl
Copying scripts/utilities/bp_mrtrans.PLS -> blib/script/bp_mrtrans.PLS
Deleting blib/script/bp_mrtrans.PLS.bak
blib/script/bp_mrtrans.PLS -> blib/script/bp_mrtrans.pl
Copying scripts/utilities/bp_nrdb.PLS -> blib/script/bp_nrdb.PLS
Deleting blib/script/bp_nrdb.PLS.bak
blib/script/bp_nrdb.PLS -> blib/script/bp_nrdb.pl
Copying scripts/taxa/classify_hits_kingdom.PLS ->
blib/script/classify_hits_kingdom.PLS
Deleting blib/script/classify_hits_kingdom.PLS.bak
blib/script/classify_hits_kingdom.PLS ->
blib/script/bp_classify_hits_kingdom.pl
Copying scripts/utilities/remote_blast.PLS -> blib/script/remote_blast.PLS
Deleting blib/script/remote_blast.PLS.bak
blib/script/remote_blast.PLS -> blib/script/bp_remote_blast.pl
Copying scripts/searchio/search2table.PLS -> blib/script/search2table.PLS
Deleting blib/script/search2table.PLS.bak
blib/script/search2table.PLS -> blib/script/bp_search2table.pl
Copying scripts/seq/translate_seq.PLS -> blib/script/translate_seq.PLS
Deleting blib/script/translate_seq.PLS.bak
blib/script/translate_seq.PLS -> blib/script/bp_translate_seq.pl
Copying scripts/graphics/search_overview.PLS ->
blib/script/search_overview.PLS
Deleting blib/script/search_overview.PLS.bak
blib/script/search_overview.PLS -> blib/script/bp_search_overview.pl
t/AAChange...................ok

t/AAReverseMutate............ok

t/AlignIO....................ok

t/AlignStats.................ok

t/AlignUtil..................ok

t/Allele.....................ok

t/Alphabet...................ok

t/Annotation.................ok 1/112

#   Failed (TODO) test 'The object isa Bio::Annotation::Comment'
#   at t/Annotation.t line 214.
#     The object isn't a 'Bio::Annotation::Comment' it's a
'Bio::Annotation::OntologyTerm'
t/Annotation.................ok

        1/112 unexpectedly succeeded
TODO PASSED test 96

t/AnnotationAdaptor..........ok

t/Assembly...................ok 1/35

#   Failed (TODO) test 'get_nof_singlets'
#   at t/Assembly.t line 44.
#          got: '0'
#     expected: '1'

#   Failed (TODO) test 'get_seq_ids'
#   at t/Assembly.t line 48.
#          got: '0'
#     expected: '2'

#   Failed (TODO) test at t/Assembly.t line 53.
#     '0'
#         ne
#     '0'

#   Failed test at t/Assembly.t line 145.
#          got: '_main_contig_feature:106'
#     expected: '_aligned_coord:sdsu|SDSU_RFPERU_006_E04.x01.phd.1'
t/Assembly...................NOK 31/35# Looks like you failed 1 test of 35.

t/Assembly...................dubious

        Test returned status 1 (wstat 256, 0x100)
DIED. FAILED test 31
        Failed 1/35 tests, 97.14% okay
t/Biblio.....................ok

t/BiblioReferences...........ok

t/Biblio_biofetch............ok

t/Biblio_eutils..............ok

t/BioDBGFF...................ok

        3/277 skipped: various reasons
t/BioDBSeqFeature............ok

t/BioDBSeqFeature_BDB........ok

t/BioDBSeqFeature_mysql......ok

t/BioFetch_DB................ok

t/BioGraphics................ok

t/BlastIndex.................ok

t/Chain......................ok

t/ClusterIO..................ok

t/Coalescent.................ok

t/CodonTable.................ok

t/Compatible.................ok

t/CoordinateGraph............ok

t/CoordinateMapper...........ok

t/Correlate..................ok

t/CytoMap....................ok

t/DB.........................ok 104/116Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 491.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 565.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 565.
t/DB.........................ok 107/116Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 565.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 565.
t/DB.........................ok

t/DBCUTG.....................ok

t/DBFasta....................ok

t/DNAMutation................ok

t/Domcut.....................ok

t/ECnumber...................ok

t/ELM........................ok

t/EMBL_DB....................ok

t/EMBOSS_Tools...............ok

t/ESEfinder..................ok

t/EUtilities.................skipped
        all skipped: Must set BIOPERLDEBUG=1 for network tests
t/EncodedSeq.................ok

t/Exception..................ok

t/Exonerate..................ok

        4/45 skipped: various reasons
t/FeatureIO..................ok

t/FootPrinter................ok

t/GDB........................ok

t/GFF........................ok

t/GOR4.......................ok

t/GOterm.....................ok

t/GbrowseGFF.................ok

t/Gel........................ok

t/GeneCoordinateMapper.......ok

t/Geneid.....................ok

t/Genewise...................ok 1/53

#   Failed (TODO) test at t/Genewise.t line 79.
#          got: 'Scaffold_2042.1'
#     expected: 'SINFRUP00000067802'

#   Failed (TODO) test at t/Genewise.t line 80.
#          got: 'SINFRUP00000067802'
#     expected: 'Scaffold_2042.1'
t/Genewise...................NOK 37/53

#   Failed test at t/Genewise.t line 82.
#          got: ''
#     expected: '2054.68'
t/Genewise...................NOK 41/53

#   Failed test at t/Genewise.t line 88.
#          got: ''
#     expected: '2054.68'
t/Genewise...................NOK 45/53

#   Failed test at t/Genewise.t line 93.
#          got: ''
#     expected: '2054.68'
# Looks like you failed 3 tests of 53.
t/Genewise...................dubious

        Test returned status 3 (wstat 768, 0x300)
DIED. FAILED tests 37, 41, 45
        Failed 3/53 tests, 94.34% okay
t/Genomewise.................ok

t/Genpred....................ok 1/157Argument "<1" isn't numeric in numeric
gt (>) at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/Tools/Glimmer.pm line
519, <GEN11> line 2.
t/Genpred....................ok

t/GraphAdaptor...............ok

t/GuessSeqFormat.............ok

t/HNN........................ok

t/Handler....................ok 288/545

#   Failed (TODO) test at t/Handler.t line 696.
t/Handler....................ok

t/HtSNP......................ok

t/IUPAC......................ok

t/Index......................ok

t/InstanceSite...............ok

t/InterProParser.............ok

t/LargeLocatableSeq..........ok

t/LinkageMap.................ok

t/LiveSeq....................ok

t/LocatableSeq...............ok

t/Location...................ok

t/LocationFactory............ok

t/LocusLink..................ok

t/MK.........................ok

        4/46 skipped: various reasons
t/Map........................ok

t/MapIO......................ok

t/Matrix.....................ok

t/MeSH.......................ok

t/Measure....................ok

t/MetaSeq....................ok

t/MicrosatelliteMarker.......ok

t/MiniMIMentry...............ok

t/MitoProt...................ok

t/Molphy.....................ok

t/MultiFile..................ok

t/Mutation...................ok

t/Mutator....................ok

t/NetPhos....................ok

t/Node.......................ok

t/OMIMentry..................ok

t/OMIMentryAllelicVariant....ok

t/OMIMparser.................ok

t/OddCodes...................ok

t/Ontology...................ok

t/OntologyEngine.............ok

t/OntologyStore..............ok

t/PAML.......................ok

t/Perl.......................ok

t/Phenotype..................ok

t/PhylipDist.................ok

t/PhysicalMap................ok

t/Pictogram..................ok

t/PodSyntax..................skipped
        all skipped: Test::Pod 1.00 required for testing POD
t/PopGen.....................ok 1/99

#   Failed (TODO) test at t/PopGen.t line 242.
t/PopGen.....................ok

        2/99 unexpectedly succeeded
TODO PASSED tests 97-98

t/PopGenSims.................ok

t/PrimarySeq.................ok

t/Primer.....................ok

t/Promoterwise...............ok

t/ProtDist...................ok

t/ProtMatrix.................ok

t/ProtPsm....................ok

        10/14 skipped: various reasons
t/Pseudowise.................ok

t/QRNA.......................ok

t/RNAChange..................ok

t/RNA_SearchIO...............ok 2/496

#   Failed (TODO) test 'HSP meta'
#   at t/RNA_SearchIO.t line 798.
#     undef
#         ne
#     undef

#   Failed (TODO) test at t/RNA_SearchIO.t line 800.
#     undef
#         ne
#     undef

#   Failed (TODO) test at t/RNA_SearchIO.t line 802.
#     undef
#         ne
#     undef

#   Failed (TODO) test 'HSP meta'
#   at t/RNA_SearchIO.t line 848.
#     undef
#         ne
#     undef

#   Failed (TODO) test at t/RNA_SearchIO.t line 850.
#     undef
#         ne
#     undef

#   Failed (TODO) test at t/RNA_SearchIO.t line 852.
#     undef
#         ne
#     undef
t/RNA_SearchIO...............ok

t/RandDistFunctions..........ok

t/RandomTreeFactory..........ok

t/Range......................ok

t/RangeI.....................ok

t/RefSeq.....................ok

t/Registry...................ok 1/14

--------------------- WARNING ---------------------
MSG: Couldn't call new_from_registry() on [Bio::DB::Flat]

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: you must specify an indexing scheme
STACK: Error::throw
STACK: Bio::Root::Root::throw
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/Root/Root.pm:357
STACK: Bio::DB::Flat::new
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/DB/Flat.pm:160
STACK: Bio::DB::Flat::new_from_registry
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/DB/Flat.pm:252
STACK: Bio::DB::Registry::_load_registry
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/DB/Registry.pm:164
STACK: Bio::DB::Registry::new
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/DB/Registry.pm:95
STACK: t/Registry.t:51
-----------------------------------------------------------

---------------------------------------------------
t/Registry...................ok

        6/14 skipped: various reasons
t/Relationship...............ok

t/RelationshipType...........ok

t/RemoteBlast................ok

t/RepeatMasker...............ok

t/RestrictionAnalysis........ok

t/RestrictionIO..............ok 1/15

#   Failed (TODO) test at t/RestrictionIO.t line 31.
t/RestrictionIO..............ok

t/Root-Utilities.............ok 1/50

--------------------- WARNING ---------------------
MSG: Not owner of file t/data/test.txt. Compressing to temp file
/tmp/MBKEv1uzJB.tmp.bioperl.gz.
---------------------------------------------------
t/Root-Utilities.............ok

t/RootI......................ok

t/RootIO.....................ok

t/RootStorable...............ok

t/SNP........................ok

t/Scansite...................ok

        5/14 skipped: various reasons
t/SearchDist.................skipped
        all skipped: The optional module Bio::Ext::Align (or dependencies
thereof) was not installed
t/SearchIO...................ok 529/1449

#   Failed (TODO) test at t/SearchIO.t line 989.
#     '0.852'
#         >
#     '0.9'

#   Failed (TODO) test at t/SearchIO.t line 990.
#     '1.599'
#         <=
#     '1'
t/SearchIO...................ok

t/Seg........................ok

t/Seq........................ok

t/SeqAnalysisParser..........ok

t/SeqBuilder.................ok

t/SeqDiff....................ok

t/SeqEvolution...............ok

t/SeqFeatAnnotated...........ok

t/SeqFeatCollection..........ok

t/SeqFeature.................ok

t/SeqHound_DB................ok

t/SeqIO......................ok

t/SeqPattern.................ok

t/SeqStats...................ok

t/SeqUtils...................ok

t/SeqVersion.................ok

t/SeqWords...................ok

t/SequenceFamily.............ok

t/Sigcleave..................ok

t/Signalp....................ok

t/Signalp2...................ok

t/Sim4.......................ok

t/SimilarityPair.............ok

t/SimpleAlign................ok

t/SiteMatrix.................ok

t/Sopma......................ok

t/Species....................ok

t/Spidey.....................ok

t/StandAloneBlast............ok

        11/45 skipped: various reasons
t/StructIO...................ok

t/Structure..................ok

t/Symbol.....................ok

t/TagHaplotype...............ok

t/TandemRepeatsFinder........ok

t/TaxonTree..................skipped
        all skipped: All tests are being skipped, probably because the
module(s) being tested here are now deprecated
t/Taxonomy...................ok

t/Tempfile...................ok

t/Term.......................ok

t/Tmhmm......................ok

t/Tools......................ok

t/Tree.......................ok

t/TreeBuild..................ok

t/TreeIO.....................ok

t/UCSCParsers................ok

t/Unflattener................ok

t/Unflattener2...............ok

t/UniGene....................ok

t/Variation_IO...............ok

t/WABA.......................ok

t/WrapperBase................ok

t/abi........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
t/ace........................ok

t/alignUtilities.............ok

t/asciitree..................ok

t/blast_pull.................ok 1/287

#   Failed (TODO) test at t/blast_pull.t line 258.
#          got: '0.946'
#     expected: '0.943'
t/blast_pull.................ok

t/bsml_sax...................ok

t/chaosxml...................ok

t/cigarstring................ok

t/consed.....................ok

t/ctf........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
t/dblink.....................ok

t/ePCR.......................ok

t/embl.......................ok

t/entrezgene.................ok 542/1422Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/SeqIO/entrezgene.pm line
491.
t/entrezgene.................ok 966/1422Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/SeqIO/entrezgene.pm line
491.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/SeqIO/entrezgene.pm line
491.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/SeqIO/entrezgene.pm line
491.
t/entrezgene.................ok

t/est2genome.................ok

t/exp........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
t/fasta......................ok

t/flat.......................ok

t/game.......................ok

t/gcg........................ok

t/genbank....................ok

t/hmmer......................ok

t/hmmer_pull.................ok

t/interpro...................ok

t/kegg.......................ok

t/largefasta.................ok

t/largepseq..................ok

t/lasergene..................ok

t/lucy.......................ok

t/masta......................ok

t/metafasta..................ok

t/multiple_fasta.............ok

t/obo_parser.................ok

t/pICalculator...............ok

t/phd........................ok

t/pir........................ok

t/pln........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
t/primaryqual................ok

t/primedseq..................ok

t/primer3....................ok

t/protgraph..................ok 1/70

#   Failed (TODO) test at t/protgraph.t line 55.

#   Failed (TODO) test at t/protgraph.t line 56.
#          got: '13'
#     expected: '14'
t/protgraph..................ok 49/70

#   Failed (TODO) test at t/protgraph.t line 248.
#          got: 'Helicobacter pylori'
#     expected: 'Helicobacter pylori 26695'
t/protgraph..................ok

t/psm........................ok

t/qual.......................ok

t/raw........................ok

t/rnamotif...................ok

t/scf........................ok

t/seq_quality................ok

t/seqfeaturePrimer...........ok

t/seqread_fail...............ok

t/sequencetrace..............ok

t/seqwithquality.............ok

t/simpleGOparser.............ok

t/singlet....................ok

t/sirna......................ok

t/splicedseq.................ok

t/swiss......................ok 1/239

#   Failed (TODO) test at t/swiss.t line 47.
t/swiss......................ok

t/tRNAscanSE.................ok

t/tab........................ok

t/table......................ok

t/targetp....................ok

t/tigrxml....................ok

t/tinyseq....................ok

t/trim.......................ok

t/ztr........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
Failed Test  Stat Wstat Total Fail  List of Failed
----------------------------------------------------------------------------
---
t/Assembly.t    1   256    35    1  31
t/Genewise.t    3   768    53    3  37 41 45
 (3 subtests UNEXPECTEDLY SUCCEEDED), 9 tests and 43 subtests skipped.
Failed 2/248 test scripts. 4/15415 subtests failed.
Files=248, Tests=15415, 973 wallclock secs (123.75 cusr +  8.58 csys =
132.33 CPU)
Failed 2/248 test programs. 4/15415 subtests failed.



-----Original Message-----
From: Chris Fields [mailto:cjfields at uiuc.edu] 
Sent: Friday, September 28, 2007 1:00 PM
To: Forrest Zhang
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

If this is occurring using bioperl from CVS then I'll try taking a  
look at it.

chris

On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:

> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign







From bix at sendu.me.uk  Fri Sep 28 02:46:48 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 28 Sep 2007 07:46:48 +0100
Subject: [Bioperl-l] FW:  load_seqdatabase.pl error
In-Reply-To: <000101c80191$3b300e70$b1902b50$@com>
References: <000101c80191$3b300e70$b1902b50$@com>
Message-ID: <46FCA358.9070202@sendu.me.uk>

Forrest Zhang wrote:
> Oh, my God!  I am tring reinstall bioperl-live using CVS, so many error
> shown below.
[snip]
> t/Assembly.t    1   256    35    1  31
> t/Genewise.t    3   768    53    3  37 41 45

You failed 4 tests, and this is CVS. Don't worry about the failures if 
they're in tests of modules you're not using. Do you use the Assembly or 
Genewise modules?

From bix at sendu.me.uk  Fri Sep 28 02:40:04 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 28 Sep 2007 07:40:04 +0100
Subject: [Bioperl-l] cpan install
In-Reply-To: <000001c8017a$6384bae0$2a8e30a0$@com>
References: <46FC028F.3050000@usc.edu> <000001c8017a$6384bae0$2a8e30a0$@com>
Message-ID: <46FCA1C4.7030101@sendu.me.uk>

Forrest Zhang wrote:
> Try 
> cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
> 
> other question you should browse
> http://www.bioperl.org/wiki/Installing_Bioperl_for_Unix

Yes, the explanation for 1.5.2 not showing up in d /bioperl/ being 'only 
stable versions appear in that list'.

From forrest_zhang at 163.com  Fri Sep 28 07:26:56 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 19:26:56 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
Message-ID: <000301c801c2$7deb6080$79c22180$@com>

Yes, it is happened using CVS.

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Chris Fields
Sent: Friday, September 28, 2007 1:00 PM
To: Forrest Zhang
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

If this is occurring using bioperl from CVS then I'll try taking a  
look at it.

chris

On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:

> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign



_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l




From forrest_zhang at 163.com  Fri Sep 28 07:28:41 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 19:28:41 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
Message-ID: <000401c801c2$ba0bae30$2e230a90$@com>

Message using CVS.

biocc bioperl-db # ./Build test
Copying scripts/biosql/terms/importrelation.pl ->
blib/script/importrelation.pl
blib/script/importrelation.pl -> blib/script/bp_importrelation.pl
Copying scripts/biosql/merge-unique-ann.pl ->
blib/script/merge-unique-ann.pl
blib/script/merge-unique-ann.pl -> blib/script/bp_merge-unique-ann.pl
Copying scripts/biosql/update-on-new-date.pl ->
blib/script/update-on-new-date.pl
blib/script/update-on-new-date.pl -> blib/script/bp_update-on-new-date.pl
Copying scripts/biosql/terms/add-term-annot.pl ->
blib/script/add-term-annot.pl
Deleting blib/script/add-term-annot.pl.bak
blib/script/add-term-annot.pl -> blib/script/bp_add-term-annot.pl
Copying scripts/corba/caching_corba_server.pl ->
blib/script/caching_corba_server.pl
Deleting blib/script/caching_corba_server.pl.bak
blib/script/caching_corba_server.pl ->
blib/script/bp_caching_corba_server.pl
Copying scripts/biosql/load_ontology.pl -> blib/script/load_ontology.pl
Deleting blib/script/load_ontology.pl.bak
blib/script/load_ontology.pl -> blib/script/bp_load_ontology.pl
Copying scripts/biosql/load_seqdatabase.pl ->
blib/script/load_seqdatabase.pl
Deleting blib/script/load_seqdatabase.pl.bak
blib/script/load_seqdatabase.pl -> blib/script/bp_load_seqdatabase.pl
Copying scripts/biosql/terms/interpro2go.pl -> blib/script/interpro2go.pl
blib/script/interpro2go.pl -> blib/script/bp_interpro2go.pl
Copying scripts/biosql/clean_ontology.pl -> blib/script/clean_ontology.pl
blib/script/clean_ontology.pl -> blib/script/bp_clean_ontology.pl
Copying scripts/corba/test_bioenv.pl -> blib/script/test_bioenv.pl
Deleting blib/script/test_bioenv.pl.bak
blib/script/test_bioenv.pl -> blib/script/bp_test_bioenv.pl
Copying scripts/biosql/update-on-new-version.pl ->
blib/script/update-on-new-version.pl
blib/script/update-on-new-version.pl ->
blib/script/bp_update-on-new-version.pl
Copying scripts/biosql/bioentry2flat.pl -> blib/script/bioentry2flat.pl
Deleting blib/script/bioentry2flat.pl.bak
blib/script/bioentry2flat.pl -> blib/script/bp_bioentry2flat.pl
Copying scripts/corba/bioenv_server.pl -> blib/script/bioenv_server.pl
Deleting blib/script/bioenv_server.pl.bak
blib/script/bioenv_server.pl -> blib/script/bp_bioenv_server.pl
Copying scripts/biosql/load_interpro.pl -> blib/script/load_interpro.pl
blib/script/load_interpro.pl -> blib/script/bp_load_interpro.pl
Copying scripts/biosql/cgi-bin/getentry.pl -> blib/script/getentry.pl
Deleting blib/script/getentry.pl.bak
blib/script/getentry.pl -> blib/script/bp_getentry.pl
Copying scripts/biosql/del-assocs-sql.pl -> blib/script/del-assocs-sql.pl
blib/script/del-assocs-sql.pl -> blib/script/bp_del-assocs-sql.pl
Copying scripts/biosql/freshen-annot.pl -> blib/script/freshen-annot.pl
blib/script/freshen-annot.pl -> blib/script/bp_freshen-annot.pl
t/01dbadaptor.....ok

t/02species.......FAILED tests 66-95

        Failed 30/65 tests, 53.85% okay
t/03simpleseq.....ok

t/04swiss.........ok

t/05seqfeature....ok

t/06comment.......ok

t/07dblink........ok

t/08genbank.......ok

t/09fuzzy2........ok

t/10ensembl.......ok

t/11locuslink.....ok

t/12ontology......ok

t/13remove........ok

t/14query.........ok

t/15cluster.......ok 9/160

--------------------- WARNING ---------------------
MSG: failed to store one or more child objects for an instance of class
Bio::Cluster::UniGene (PK=366)
---------------------------------------------------
t/15cluster.......ok

t/16obda..........ok

Failed Test   Stat Wstat Total Fail  List of Failed
----------------------------------------------------------------------------
---
t/02species.t               65   30  66-95
Failed 1/16 test scripts. -30/1423 subtests failed.
Files=16, Tests=1423, 36 wallclock secs (16.64 cusr +  0.65 csys = 17.29
CPU)
Failed 1/16 test programs. -30/1423 subtests failed.

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Chris Fields
Sent: Friday, September 28, 2007 1:00 PM
To: Forrest Zhang
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

If this is occurring using bioperl from CVS then I'll try taking a  
look at it.

chris

On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:

> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign



_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l




From hlapp at gmx.net  Fri Sep 28 11:36:39 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 28 Sep 2007 11:36:39 -0400
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <46F8DC34.6020908@sendu.me.uk>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
Message-ID: <8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>

You do have a point here. From a design perspective, it feels odd if  
instantiating an object can fail with an I/O exception. But in  
reality that's how it's done all the time, from Bio::SeqIO to  
java.io.*, if I'm not mistaken. I also agree that asking a  
conditional that we know will be false every time except once  
violates the sense of elegance.

So upon second consideration, I think I agree with you. And a GFF3  
file with zero features in it should still be a valid GFF3 file,  
i.e., have the mandatory headers.

Does that make sense?

	-hilmar

On Sep 25, 2007, at 6:00 AM, Sendu Bala wrote:

> Hilmar Lapp wrote:
>> On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:
>>> I think that'll work fine.  The other option would be call a
>>> print_gff_header() function within write_feature() with the  
>>> intent to
>>> print the header only once, using a flag or similar:
>>>
>>> if (!$self->header_printed) {
>>>      $self->print_gff_header;
>>>      $self->header_printed(1);
>>> }
> >
>> I'd lean toward this or a similar approach too. Writing stuff out  
>> in the constructor doesn't feel like the best design.
>
> I'd argue that the alternative is just inefficient with no  
> compensating benefit. You have something that must only be done  
> once, and a method (_initialize) that is only called once. The  
> constructor is used to set up the file, getting it into a state  
> ready to add features. This involves opening it for writing with  
> the correct filename and setting the desired GFF version. Why  
> wouldn't it also output what ever else was necessary it initialize  
> the file?
>
> Also, what do we expect should happen when we use Bioperl to create  
> a GFF file and don't write any features to it? Should it be an  
> empty file, or should it contain whatever GFF information the user  
> had managed to supply (the version)?

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================






From hlapp at gmx.net  Fri Sep 28 11:53:33 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 28 Sep 2007 11:53:33 -0400
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
Message-ID: <9917490A-B7AF-4AE6-9C78-AD516700155B@gmx.net>

Chris let me know if you get stumped. I'm surprised that the special  
ranks ('eurosids I' etc) show up in the lineage (has NCBI started to  
assign ranks to them? I thought I filter them out. Needs to be looked  
into too.), but at any rate I don't understand why they aren't being  
accepted.

Also, maybe we need a more verbose output here - Forrest, can you run  
this with adding a --printerror argument. (I'm embarrassed to find  
that this doesn't seem to be documented. Sigh.)

	-hilmar

On Sep 28, 2007, at 1:00 AM, Chris Fields wrote:

> If this is occurring using bioperl from CVS then I'll try taking a
> look at it.
>
> chris
>
> On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:
>
>> Hilmar,
>> 	I have already pre-loaded the NCBI taxonomy using
>> load_ncbi_taxonomy.pl yet. The error message show:
>>
>> --------------------- WARNING ---------------------
>> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I
>> was
>> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I
>> | rosids
>> | core eudicotyledons | eudicotyledons | Magnoliophyta |
>> Euphyllophyta |
>> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
>> ---------------------------------------------------
>> Could not store Q40784:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: create: object (Bio::Species) failed to insert or to be found
>> by unique
>> key
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:206
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: /usr/bin/bp_load_seqdatabase.pl:633
>> -----------------------------------------------------------
>> Sigh~~~~~~
>>
>> Forrest Zhang
>>
>>
>> -----Original Message-----
>> From: bioperl-l-bounces at lists.open-bio.org
>> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar  
>> Lapp
>> Sent: Friday, September 28, 2007 6:17 AM
>> To: Forrest
>> Cc: bioperl-l at bioperl.org
>> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>>
>> Forrest,
>>
>> have you preloaded the NCBI taxonomy as suggested in the BioSQL
>> installation guidelines? SwissProt format has NCBI taxon IDs, and the
>> code will try to use it to look up species and their lineage, rather
>> than inserting the lineage from whatever BioPerl parses out of the
>> sequence record.
>>
>> 	-hilmar
>>
>> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>>
>>> Hi, all
>>>     I install the biosql, and bioperl-db. I want to import
>>> swissport data.
>>> But the programe show some error as below:
>>> ==================================================================== 
>>> =
>>> =
>>> ======
>>> ===============================================
>>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver  
>>>> mysql
>>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>>> Could not store Q6DAH5:
>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>>> subsp.
>>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>>> Pectobacterium |
>>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>>> Proteobacteria | Bacteria')
>>> STACK: Error::throw
>>> STACK: Bio::Root::Root::throw
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>>> STACK: Bio::Species::classification
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:552
>>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:1305
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:973
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:852
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:182
>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:244
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:169
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:251
>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:271
>>> STACK: load_seqdatabase.pl:620
>>> -----------------------------------------------------------
>>>
>>>  at load_seqdatabase.pl line 633
>>> ==================================================================== 
>>> =
>>> =
>>> ======
>>> ===============================================
>>>
>>> How can I solve it, please help me, Thank you.
>>>
>>> Thanks
>>> Forrest zhang
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> -- 
>> ===========================================================
>> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
>> ===========================================================
>>
>>
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================






From cjfields at uiuc.edu  Fri Sep 28 12:04:08 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 11:04:08 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
Message-ID: <5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>

On Sep 28, 2007, at 10:36 AM, Hilmar Lapp wrote:

> You do have a point here. From a design perspective, it feels odd  
> if instantiating an object can fail with an I/O exception. But in  
> reality that's how it's done all the time, from Bio::SeqIO to  
> java.io.*, if I'm not mistaken. I also agree that asking a  
> conditional that we know will be false every time except once  
> violates the sense of elegance.

I agree with the lack of elegance from a design perspective on both  
counts, but when have we ever been worried about that? ;>

In general I don't think SeqIO classes generates actual output (like  
the GFF header information) in the constructor, they just initialize  
IO and other state data.  It makes sense to fail in this case if an  
error pops up.  Regardless, one could argue ad infinitum that either  
proposed fix has its benefits/deficiencies, however both will work,  
so I'm happy with either.

chris

> So upon second consideration, I think I agree with you. And a GFF3  
> file with zero features in it should still be a valid GFF3 file,  
> i.e., have the mandatory headers.
>
> Does that make sense?
>
> 	-hilmar
>
> On Sep 25, 2007, at 6:00 AM, Sendu Bala wrote:
>
>> Hilmar Lapp wrote:
>>> On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:
>>>> I think that'll work fine.  The other option would be call a
>>>> print_gff_header() function within write_feature() with the  
>>>> intent to
>>>> print the header only once, using a flag or similar:
>>>>
>>>> if (!$self->header_printed) {
>>>>      $self->print_gff_header;
>>>>      $self->header_printed(1);
>>>> }
>> >
>>> I'd lean toward this or a similar approach too. Writing stuff out  
>>> in the constructor doesn't feel like the best design.
>>
>> I'd argue that the alternative is just inefficient with no  
>> compensating benefit. You have something that must only be done  
>> once, and a method (_initialize) that is only called once. The  
>> constructor is used to set up the file, getting it into a state  
>> ready to add features. This involves opening it for writing with  
>> the correct filename and setting the desired GFF version. Why  
>> wouldn't it also output what ever else was necessary it initialize  
>> the file?
>>
>> Also, what do we expect should happen when we use Bioperl to  
>> create a GFF file and don't write any features to it? Should it be  
>> an empty file, or should it contain whatever GFF information the  
>> user had managed to supply (the version)?
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From cjfields at uiuc.edu  Fri Sep 28 12:10:59 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 11:10:59 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <9917490A-B7AF-4AE6-9C78-AD516700155B@gmx.net>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
	<9917490A-B7AF-4AE6-9C78-AD516700155B@gmx.net>
Message-ID: <EECC931E-C7B5-485E-B059-4A7A9A7C092E@uiuc.edu>

I'm actually getting some odd recursion issues again; not sure what's  
causing it, but a reinstall of both bioperl and bioperl-db fixed it  
last time.  It may be related to the rollback, just not sure yet.

I'll try tracking it down if it persists (bad pun).

t/04swiss....ok 3/52
--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------
t/04swiss....ok
All tests successful.
Files=1, Tests=52,  2 wallclock secs ( 1.33 cusr +  0.18 csys =  1.51  
CPU)

The specific error under verbose running is:

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:680
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:677
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:691
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:677
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:691
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:677
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:677
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:658
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store /Users/cjfields/ 
src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:252
STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
PrimarySeqAdaptor.pm:229
STACK Bio::DB::BioSQL::SeqAdaptor::store_children /Users/cjfields/src/ 
core/bioperl-db/blib/lib/Bio/DB/BioSQL/SeqAdaptor.pm:217
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create /Users/cjfields/ 
src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:213
STACK Bio::DB::Persistent::PersistentObject::create /Users/cjfields/ 
src/core/bioperl-db/blib/lib/Bio/DB/Persistent/PersistentObject.pm:244
STACK toplevel t/04swiss.t:37
---------------------------------------------------


chris

On Sep 28, 2007, at 10:53 AM, Hilmar Lapp wrote:

> Chris let me know if you get stumped. I'm surprised that the special
> ranks ('eurosids I' etc) show up in the lineage (has NCBI started to
> assign ranks to them? I thought I filter them out. Needs to be looked
> into too.), but at any rate I don't understand why they aren't being
> accepted.
>
> Also, maybe we need a more verbose output here - Forrest, can you run
> this with adding a --printerror argument. (I'm embarrassed to find
> that this doesn't seem to be documented. Sigh.)
>
> 	-hilmar
>
> On Sep 28, 2007, at 1:00 AM, Chris Fields wrote:
>
>> If this is occurring using bioperl from CVS then I'll try taking a
>> look at it.
>>
>> chris
>>
>> On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:
>>
>>> Hilmar,
>>> 	I have already pre-loaded the NCBI taxonomy using
>>> load_ncbi_taxonomy.pl yet. The error message show:
>>>
>>> --------------------- WARNING ---------------------
>>> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I
>>> was
>>> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I
>>> | rosids
>>> | core eudicotyledons | eudicotyledons | Magnoliophyta |
>>> Euphyllophyta |
>>> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
>>> ---------------------------------------------------
>>> Could not store Q40784:
>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>> MSG: create: object (Bio::Species) failed to insert or to be found
>>> by unique
>>> key
>>> STACK: Error::throw
>>> STACK: Bio::Root::Root::throw
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:206
>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:244
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:169
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:251
>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:271
>>> STACK: /usr/bin/bp_load_seqdatabase.pl:633
>>> -----------------------------------------------------------
>>> Sigh~~~~~~
>>>
>>> Forrest Zhang
>>>
>>>
>>> -----Original Message-----
>>> From: bioperl-l-bounces at lists.open-bio.org
>>> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar
>>> Lapp
>>> Sent: Friday, September 28, 2007 6:17 AM
>>> To: Forrest
>>> Cc: bioperl-l at bioperl.org
>>> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>>>
>>> Forrest,
>>>
>>> have you preloaded the NCBI taxonomy as suggested in the BioSQL
>>> installation guidelines? SwissProt format has NCBI taxon IDs, and  
>>> the
>>> code will try to use it to look up species and their lineage, rather
>>> than inserting the lineage from whatever BioPerl parses out of the
>>> sequence record.
>>>
>>> 	-hilmar
>>>
>>> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>>>
>>>> Hi, all
>>>>     I install the biosql, and bioperl-db. I want to import
>>>> swissport data.
>>>> But the programe show some error as below:
>>>> =================================================================== 
>>>> =
>>>> =
>>>> =
>>>> ======
>>>> ===============================================
>>>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver
>>>>> mysql
>>>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>>>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>>>> Could not store Q6DAH5:
>>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>>>> subsp.
>>>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>>>> Pectobacterium |
>>>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>>>> Proteobacteria | Bacteria')
>>>> STACK: Error::throw
>>>> STACK: Bio::Root::Root::throw
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>>>> STACK: Bio::Species::classification
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>>>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:552
>>>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:1305
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:973
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:852
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:182
>>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:244
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:169
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:251
>>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:271
>>>> STACK: load_seqdatabase.pl:620
>>>> -----------------------------------------------------------
>>>>
>>>>  at load_seqdatabase.pl line 633
>>>> =================================================================== 
>>>> =
>>>> =
>>>> =
>>>> ======
>>>> ===============================================
>>>>
>>>> How can I solve it, please help me, Thank you.
>>>>
>>>> Thanks
>>>> Forrest zhang
>>>>
>>>>
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>> -- 
>>> ===========================================================
>>> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
>>> ===========================================================
>>>
>>>
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From hlapp at gmx.net  Fri Sep 28 17:09:28 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 28 Sep 2007 17:09:28 -0400
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
Message-ID: <41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>


On Sep 28, 2007, at 12:04 PM, Chris Fields wrote:

> In general I don't think SeqIO classes generates actual output  
> (like the GFF header information) in the constructor

There's probably two reasons they don't (if really all of them  
don't): i) unless you explicitly test (how?) whether the file has  
been opened for writing, you actually don't know in the SeqIO  
constructor whether someone's going to write to the file or read from  
it. ii) off hand, I don't know of a sequence file format that would  
require a particular header being written just once.

Though thinking about this, I start asking myself whether i) wouldn't  
also apply to FeatureIO (are we not reading gff too in this class?),  
and I'm wondering that there must  be a header (or at least an  
enclosing tag) for SeqIO XML formats - so how is that dealt with there?

	-hilmar
-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================






From cjfields at uiuc.edu  Fri Sep 28 17:34:13 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 16:34:13 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
Message-ID: <530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>


On Sep 28, 2007, at 4:09 PM, Hilmar Lapp wrote:

>
> On Sep 28, 2007, at 12:04 PM, Chris Fields wrote:
>
>> In general I don't think SeqIO classes generates actual output
>> (like the GFF header information) in the constructor
>
> There's probably two reasons they don't (if really all of them
> don't): i) unless you explicitly test (how?) whether the file has
> been opened for writing, you actually don't know in the SeqIO
> constructor whether someone's going to write to the file or read from
> it. ii) off hand, I don't know of a sequence file format that would
> require a particular header being written just once.
>
> Though thinking about this, I start asking myself whether i) wouldn't
> also apply to FeatureIO (are we not reading gff too in this class?),
> and I'm wondering that there must  be a header (or at least an
> enclosing tag) for SeqIO XML formats - so how is that dealt with  
> there?
>
> 	-hilmar

Re: (i) and FeatureIO: I believe most FeatureIO classes read/write to/ 
from specific feature files (bed, gff, ptt, interpro, etc), which is  
one reason I thought everything I(nput) should go into next_feature 
(), everything O(utput) into write_feature().  The section writing  
the gff header info in _initialize() checks the file specifically for  
'>' prior to output; I think Sendu planned on changing that to use  
mode() instead.

Re: (ii): I'm not sure, actually; I wouldn't be surprised if XML  
output hasn't been tested very well.

If I could go to the Nov. GMOD meeting to help hammer out some of the  
GFF3/FeatureIO/SF::Annotated stuff I would, but I would be traveling  
on my own dime.  Maybe I'll see what I can come up with and stay at  
the no-tell motel...

chris

From cjfields at uiuc.edu  Fri Sep 28 18:03:06 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 17:03:06 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <EECC931E-C7B5-485E-B059-4A7A9A7C092E@uiuc.edu>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
	<9917490A-B7AF-4AE6-9C78-AD516700155B@gmx.net>
	<EECC931E-C7B5-485E-B059-4A7A9A7C092E@uiuc.edu>
Message-ID: <FD7C7306-92E1-49D9-93E4-EDFBF09E1A1A@uiuc.edu>

Okay, fixed the recursion (extra copy of a BasePersistentAdaptor  
module I was working which tripped it, so nothing in CVS).

Forrest, I get all tests passing.  I used a database without taxonomy  
loaded with bioperl-db and bioperl from cvs and it worked w/o  
problems.  I'll try working with your sequence when I have time this  
weekend.

chris

On Sep 28, 2007, at 11:10 AM, Chris Fields wrote:

> I'm actually getting some odd recursion issues again; not sure what's
> causing it, but a reinstall of both bioperl and bioperl-db fixed it
> last time.  It may be related to the rollback, just not sure yet.
>
> I'll try tracking it down if it persists (bad pun).
>
> t/04swiss....ok 3/52
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
> t/04swiss....ok
> All tests successful.
> Files=1, Tests=52,  2 wallclock secs ( 1.33 cusr +  0.18 csys =  1.51
> CPU)
>
> The specific error under verbose running is:
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:680
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:677
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:691
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:677
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:691
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:677
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:677
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:658
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store /Users/cjfields/
> src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:252
> STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> PrimarySeqAdaptor.pm:229
> STACK Bio::DB::BioSQL::SeqAdaptor::store_children /Users/cjfields/src/
> core/bioperl-db/blib/lib/Bio/DB/BioSQL/SeqAdaptor.pm:217
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create /Users/cjfields/
> src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:213
> STACK Bio::DB::Persistent::PersistentObject::create /Users/cjfields/
> src/core/bioperl-db/blib/lib/Bio/DB/Persistent/PersistentObject.pm:244
> STACK toplevel t/04swiss.t:37
> ---------------------------------------------------
>
>
> chris
>
> On Sep 28, 2007, at 10:53 AM, Hilmar Lapp wrote:
>
>> Chris let me know if you get stumped. I'm surprised that the special
>> ranks ('eurosids I' etc) show up in the lineage (has NCBI started to
>> assign ranks to them? I thought I filter them out. Needs to be looked
>> into too.), but at any rate I don't understand why they aren't being
>> accepted.
>>
>> Also, maybe we need a more verbose output here - Forrest, can you run
>> this with adding a --printerror argument. (I'm embarrassed to find
>> that this doesn't seem to be documented. Sigh.)
>>
>> 	-hilmar
>>
>> On Sep 28, 2007, at 1:00 AM, Chris Fields wrote:
>>
>>> If this is occurring using bioperl from CVS then I'll try taking a
>>> look at it.
>>>
>>> chris
>>>
>>> On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:
>>>
>>>> Hilmar,
>>>> 	I have already pre-loaded the NCBI taxonomy using
>>>> load_ncbi_taxonomy.pl yet. The error message show:
>>>>
>>>> --------------------- WARNING ---------------------
>>>> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I
>>>> was
>>>> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I
>>>> | rosids
>>>> | core eudicotyledons | eudicotyledons | Magnoliophyta |
>>>> Euphyllophyta |
>>>> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
>>>> ---------------------------------------------------
>>>> Could not store Q40784:
>>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>>> MSG: create: object (Bio::Species) failed to insert or to be found
>>>> by unique
>>>> key
>>>> STACK: Error::throw
>>>> STACK: Bio::Root::Root::throw
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:206
>>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:244
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:169
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:251
>>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:271
>>>> STACK: /usr/bin/bp_load_seqdatabase.pl:633
>>>> -----------------------------------------------------------
>>>> Sigh~~~~~~
>>>>
>>>> Forrest Zhang
>>>>
>>>>
>>>> -----Original Message-----
>>>> From: bioperl-l-bounces at lists.open-bio.org
>>>> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar
>>>> Lapp
>>>> Sent: Friday, September 28, 2007 6:17 AM
>>>> To: Forrest
>>>> Cc: bioperl-l at bioperl.org
>>>> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>>>>
>>>> Forrest,
>>>>
>>>> have you preloaded the NCBI taxonomy as suggested in the BioSQL
>>>> installation guidelines? SwissProt format has NCBI taxon IDs, and
>>>> the
>>>> code will try to use it to look up species and their lineage,  
>>>> rather
>>>> than inserting the lineage from whatever BioPerl parses out of the
>>>> sequence record.
>>>>
>>>> 	-hilmar
>>>>
>>>> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>>>>
>>>>> Hi, all
>>>>>     I install the biosql, and bioperl-db. I want to import
>>>>> swissport data.
>>>>> But the programe show some error as below:
>>>>> ================================================================== 
>>>>> =
>>>>> =
>>>>> =
>>>>> =
>>>>> ======
>>>>> ===============================================
>>>>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver
>>>>>> mysql
>>>>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>>>>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>>>>> Could not store Q6DAH5:
>>>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>>>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>>>>> subsp.
>>>>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>>>>> Pectobacterium |
>>>>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>>>>> Proteobacteria | Bacteria')
>>>>> STACK: Error::throw
>>>>> STACK: Bio::Root::Root::throw
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>>>>> STACK: Bio::Species::classification
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>>>>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>>> PersistentObject.pm:552
>>>>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:1305
>>>>> STACK:  
>>>>> Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:973
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:852
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:182
>>>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>>> PersistentObject.pm:244
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:169
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:251
>>>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>>> PersistentObject.pm:271
>>>>> STACK: load_seqdatabase.pl:620
>>>>> -----------------------------------------------------------
>>>>>
>>>>>  at load_seqdatabase.pl line 633
>>>>> ================================================================== 
>>>>> =
>>>>> =
>>>>> =
>>>>> =
>>>>> ======
>>>>> ===============================================
>>>>>
>>>>> How can I solve it, please help me, Thank you.
>>>>>
>>>>> Thanks
>>>>> Forrest zhang
>>>>>
>>>>>
>>>>>
>>>>> _______________________________________________
>>>>> Bioperl-l mailing list
>>>>> Bioperl-l at lists.open-bio.org
>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>> -- 
>>>> ===========================================================
>>>> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
>>>> ===========================================================
>>>>
>>>>
>>>>
>>>>
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>>
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>> Christopher Fields
>>> Postdoctoral Researcher
>>> Lab of Dr. Robert Switzer
>>> Dept of Biochemistry
>>> University of Illinois Urbana-Champaign
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> -- 
>> ===========================================================
>> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
>> ===========================================================
>>
>>
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From hlapp at gmx.net  Fri Sep 28 18:20:37 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 28 Sep 2007 18:20:37 -0400
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
	<530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
Message-ID: <5FC8F92C-42DD-4DAF-8008-0F8C545065B5@gmx.net>


On Sep 28, 2007, at 5:34 PM, Chris Fields wrote:

> The section writing the gff header info in _initialize() checks the  
> file specifically for '>' prior to output; I think Sendu planned on  
> changing that to use mode() instead.

What if we pass in a file handle?

	-hilmar
-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================






From cjfields at uiuc.edu  Fri Sep 28 19:04:21 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 18:04:21 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <5FC8F92C-42DD-4DAF-8008-0F8C545065B5@gmx.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
	<530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
	<5FC8F92C-42DD-4DAF-8008-0F8C545065B5@gmx.net>
Message-ID: <E351BFD9-57C8-4A62-986F-F5E674B28FC5@uiuc.edu>


On Sep 28, 2007, at 5:20 PM, Hilmar Lapp wrote:

>
> On Sep 28, 2007, at 5:34 PM, Chris Fields wrote:
>
>> The section writing the gff header info in _initialize() checks the
>> file specifically for '>' prior to output; I think Sendu planned on
>> changing that to use mode() instead.
>
> What if we pass in a file handle?
>
> 	-hilmar

The old way def. wouldn't work with filehandles.  Not sure if  
checking Root::IO::mode() would work as expected in this case, but  
it's certainly worth a try.

chris

From jay at jays.net  Fri Sep 28 18:50:29 2007
From: jay at jays.net (Jay Hannah)
Date: Fri, 28 Sep 2007 17:50:29 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
	<530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
Message-ID: <FAFE7FDD-5191-4500-894E-05A11E71D410@jays.net>

On Sep 28, 2007, at 4:34 PM, Chris Fields wrote:
> On Sep 28, 2007, at 4:09 PM, Hilmar Lapp wrote:
>> and I'm wondering that there must  be a header (or at least an
>> enclosing tag) for SeqIO XML formats - so how is that dealt with
>> there?
>
> Re: (ii): I'm not sure, actually; I wouldn't be surprised if XML
> output hasn't been tested very well.

For good or ill I stole what I found in other Bio/SeqIO/* classes  
when I started writing my Bio::SeqIO::solrxml. It is not ready, but  
you can poke it with a stick here if you like:

http://vc.jays.net/viewvc.cgi/SolrGene/solrxml.pm? 
revision=26&root=CLAB&view=markup

In _initialize() it sends XML header goo into $self->_print(), and it  
uses DESTROY to drop an XML closure tag into $self->_print().

Constructing it

$out_solr  = Bio::SeqIO->new(-file => ">seq.solr.xml",
                              -format => 'solrxml');

without writing any sequences to it created a seq.solr.xml file with  
the XML header and footer and nothing in the middle.

If this is not The Right Way I'm happy to change it to do whatever.  :)

> If I could go to the Nov. GMOD meeting to help hammer out some of the
> GFF3/FeatureIO/SF::Annotated stuff I would, but I would be traveling
> on my own dime.  Maybe I'll see what I can come up with and stay at
> the no-tell motel...

I've decided to spend many of my own dimes and make the trek. I hope  
to meet many BioPerl'ers. I'll buy you dinner if you show up.  :)

Take care,

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah




From cjfields at uiuc.edu  Sat Sep 29 14:28:16 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sat, 29 Sep 2007 13:28:16 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <FAFE7FDD-5191-4500-894E-05A11E71D410@jays.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
	<530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
	<FAFE7FDD-5191-4500-894E-05A11E71D410@jays.net>
Message-ID: <E6C9C3D8-9E3F-4740-B590-6F4E5A152C5E@uiuc.edu>


On Sep 28, 2007, at 5:50 PM, Jay Hannah wrote:

> On Sep 28, 2007, at 4:34 PM, Chris Fields wrote:
>> On Sep 28, 2007, at 4:09 PM, Hilmar Lapp wrote:
>>> and I'm wondering that there must  be a header (or at least an
>>> enclosing tag) for SeqIO XML formats - so how is that dealt with
>>> there?
>>
>> Re: (ii): I'm not sure, actually; I wouldn't be surprised if XML
>> output hasn't been tested very well.
>
> For good or ill I stole what I found in other Bio/SeqIO/* classes
> when I started writing my Bio::SeqIO::solrxml. It is not ready, but
> you can poke it with a stick here if you like:
>
> http://vc.jays.net/viewvc.cgi/SolrGene/solrxml.pm?
> revision=26&root=CLAB&view=markup
>
> In _initialize() it sends XML header goo into $self->_print(), and it
> uses DESTROY to drop an XML closure tag into $self->_print().
>
> Constructing it
>
> $out_solr  = Bio::SeqIO->new(-file => ">seq.solr.xml",
>                               -format => 'solrxml');
>
> without writing any sequences to it created a seq.solr.xml file with
> the XML header and footer and nothing in the middle.
>
> If this is not The Right Way I'm happy to change it to do  
> whatever.  :)

If you do it this way you should probably run a check on the mode()  
the object state is in ('r'=read, 'w'=write, '?'=unknown), and only  
_print() on write mode.  Might also be a good idea to implement a  
next_seq with an exception ('Module is write only').

>> If I could go to the Nov. GMOD meeting to help hammer out some of the
>> GFF3/FeatureIO/SF::Annotated stuff I would, but I would be traveling
>> on my own dime.  Maybe I'll see what I can come up with and stay at
>> the no-tell motel...
>
> I've decided to spend many of my own dimes and make the trek. I hope
> to meet many BioPerl'ers. I'll buy you dinner if you show up.  :)
>
> Take care,
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

I may see what I can scrape up myself but it doesn't look good (lab's  
closing down soon, so money's pretty tight).  If I knew about the  
meeting a while in advance I would probably have made it.  Oh well!

chris


From cjfields at uiuc.edu  Sun Sep 30 16:39:23 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 30 Sep 2007 15:39:23 -0500
Subject: [Bioperl-l] DB::SeqFeature::Store error
Message-ID: <A56E6D20-EF3E-4B5D-B3F2-9F2B7D0178EF@uiuc.edu>

I'm getting the following error on my local MySQL (v 5.0.41) with  
bp_seqfeature_load:

-------------------- EXCEPTION --------------------
MSG: The used table type doesn't support FULLTEXT indexes
STACK Bio::DB::SeqFeature::Store::DBI::mysql::_init_database /Library/ 
Perl/5.8.6/Bio/DB/SeqFeature/Store/DBI/mysql.pm:414
STACK Bio::DB::SeqFeature::Store::init_database /Library/Perl/5.8.6/ 
Bio/DB/SeqFeature/Store.pm:382
STACK Bio::DB::SeqFeature::Store::DBI::mysql::init /Library/Perl/ 
5.8.6/Bio/DB/SeqFeature/Store/DBI/mysql.pm:218
STACK Bio::DB::SeqFeature::Store::new /Library/Perl/5.8.6/Bio/DB/ 
SeqFeature/Store.pm:345
STACK toplevel /usr/local/bin/bp_seqfeature_load.pl:57
-------------------------------------------

The default setting for storage is InnoDB; switching to MyISAM fixes  
the issue.  Should we specify TYPE = MyISAM with the various CREATE  
TABLE queries in Bio::DB::SeqFeature::Store::DBI::mysql to be on the  
safe side?

chris

From alan at tll.org.sg  Sun Sep 30 21:53:07 2007
From: alan at tll.org.sg (alan)
Date: Mon, 1 Oct 2007 09:53:07 +0800
Subject: [Bioperl-l] exonerate
References: <034FB11C-B4E9-4E4E-B213-D4AC6A397B1B@tll.org.sg>
Message-ID: <29C4D729-6715-4C19-9872-3B1AF90EAFA3@tll.org.sg>

Hi,


>> I am calling exonerate.pm within my script while attempting to  
>> align cDNA  to multiple genomic fragments. After processing about  
>> 120+ genomic fragments my code crashes with the following error:
>>
>> ** ERROR **: Could not open [/tmp/tlInatbOED] : Too many open files
>> aborting...
>> MSG: Exonerate call (/usr/local/bin/exonerate   /tmp/8X9jQuHUGF / 
>> tmp/tlInatbOED  > /tmp/EolF5qCNLZ/cIf0HfIRf5) crashed: 34304
>> STACK Bio::Tools::Run::Alignment::Exonerate::_run /nfs1/alan/ 
>> cvs_src/bioperl-run/Bio/Tools/Run/Alignment/Exonerate.pm:214
>> STACK Bio::Tools::Run::Alignment::Exonerate::run /nfs1/alan/ 
>> cvs_src/bioperl-run/Bio/Tools/Run/Alignment/Exonerate.pm:174
>>
>> The code in Exonerate.pm closes the tmpfile at the end of the  
>> routine yet I get the error message about "too many open files".
>> Any suggestions on how I should be closing these files?
>>
>>
>> Extract from my code that runs exonerate is listed below.
>>
>> foreach my $f(@files) {
>>   next unless (-f  "$dir/$f");
>>   my $q_in = Bio::SeqIO->new(-file=>$query, -format=>"Fasta");
>>   my $query_obj = $q_in->next_seq();
>>   my $target_in = Bio::SeqIO->new(-file=>"$dir/$f", - 
>> format=>"Fasta");
>>   my $target_obj = $target_in->next_seq();
>>   my $run = Bio::Tools::Run::Alignment::Exonerate->new();
>>   my $exonerate_io = $run->run($query_obj, $target_obj);
>>
>>   [code for parsing the data.......]
>>
>>   $exonerate_io->close; #tried this line out of desperation but it  
>> did not help :-)
>> }
>>
>> thanks
>> alan
>>
>>
>>
>> Alan Christoffels
>> Computational Biology Group
>> Temasek LifeSciences Laboratory
>> 1 Research Link
>> National University of Singapore
>> Singapore
>> 117604
>> Tel: +65 68744945
>> Fax: +65 68727007
>> Lab webpage: http://www.tll.org.sg/alan.asp
>>
>>
>


From ewijaya at gmail.com  Sun Sep 30 10:10:25 2007
From: ewijaya at gmail.com (Edward Wijaya)
Date: Sun, 30 Sep 2007 22:10:25 +0800
Subject: [Bioperl-l] Bio::Graphics - Howto draw graded segments overlap with
	line track
Message-ID: <3521d3670709300710l4a41c47es1c72cc5a450a3736@mail.gmail.com>

Hi,

I want to draw a binding sites hits on sequence of various length.
What I have now is a graded segments only. Is there a way to draw
segments overlapping with the line ? (see attached figure).

--
Edward
-------------- next part --------------
A non-text attachment was scrubbed...
Name: hits.PNG
Type: image/png
Size: 15613 bytes
Desc: not available
Url : http://lists.open-bio.org/pipermail/bioperl-l/attachments/20070930/2402791e/attachment-0001.png 

From cjfields at uiuc.edu  Sun Sep  2 19:54:54 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 2 Sep 2007 18:54:54 -0500
Subject: [Bioperl-l] (no subject)
Message-ID: <CA6A55BB-BB63-4FCE-A0AA-FBB2392C778F@uiuc.edu>

Posted this to biosql-l already but felt it needed posting here as  
well.  Sorry if you get this twice.

I noticed some critical recursion issues with bioperl-db when working  
in Bio::Ontology changes.  This was using bioperl-live (post-feature/ 
annotation fixes).  Bug report is here:

http://bugzilla.open-bio.org/show_bug.cgi?id=2355

It seems to be Bio:Taxon related; this is from 03swiss.t:

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:681
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:692
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
...
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:587
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:253
STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
PrimarySeqAdaptor.pm:229
STACK Bio::DB::BioSQL::SeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
SeqAdaptor.pm:217
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:214
STACK Bio::DB::Persistent::PersistentObject::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/Persistent/ 
PersistentObject.pm:244
STACK toplevel t/04swiss.t:36
---------------------------------------------------

Also, seeing this with 13remove.t and 15.cluster.t, both of which  
appear to infinitely recurse:

Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 587, <GEN0> line 1.
Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 630, <GEN0> line 1.


chris



From cjfields at uiuc.edu  Sun Sep  2 19:57:59 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 2 Sep 2007 18:57:59 -0500
Subject: [Bioperl-l] recursion issues with bioperl-db
Message-ID: <2E14450C-C135-42DD-A9DE-EB47EB80E6AC@uiuc.edu>

Apologies if you get this more than once; the first post appeared to  
get sent w/o a proper subject line.  Posted this to biosql-l already  
but felt it needed posting here as well.

I noticed some critical recursion issues with bioperl-db when working  
in Bio::Ontology changes.  This was using bioperl-live (post-feature/ 
annotation fixes).  Bug report is here:

http://bugzilla.open-bio.org/show_bug.cgi?id=2355

It seems to be Bio:Taxon related; this is from 03swiss.t:

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:681
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:692
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
...
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:587
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:253
STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
PrimarySeqAdaptor.pm:229
STACK Bio::DB::BioSQL::SeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
SeqAdaptor.pm:217
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:214
STACK Bio::DB::Persistent::PersistentObject::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/Persistent/ 
PersistentObject.pm:244
STACK toplevel t/04swiss.t:36
---------------------------------------------------

Also, seeing this with 13remove.t and 15.cluster.t, both of which  
appear to infinitely recurse:

Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 587, <GEN0> line 1.
Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 630, <GEN0> line 1.


chris



From cjfields at uiuc.edu  Sun Sep  2 21:40:48 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 2 Sep 2007 20:40:48 -0500
Subject: [Bioperl-l] recursion issues with bioperl-db
In-Reply-To: <2E14450C-C135-42DD-A9DE-EB47EB80E6AC@uiuc.edu>
References: <2E14450C-C135-42DD-A9DE-EB47EB80E6AC@uiuc.edu>
Message-ID: <25CFD36D-D921-4F5F-BADF-D858A2FE76D4@uiuc.edu>

Okay, we can the previous posts!  Odd, but I started from scratch and  
can't reproduce the issue; there may have been some cross-talk with  
different bioperl installations on my laptop.  Anyway, everything  
passes now w/o recursion so I'll mark the bug as invalid.

chris

On Sep 2, 2007, at 6:57 PM, Chris Fields wrote:

> Apologies if you get this more than once; the first post appeared to
> get sent w/o a proper subject line.  Posted this to biosql-l already
> but felt it needed posting here as well.
>
> I noticed some critical recursion issues with bioperl-db when working
> in Bio::Ontology changes.  This was using bioperl-live (post-feature/
> annotation fixes).  Bug report is here:
>
> http://bugzilla.open-bio.org/show_bug.cgi?id=2355
>
> It seems to be Bio:Taxon related; this is from 03swiss.t:
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:681
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:630
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:692
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:630
> ...
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:587
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:253
> STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> PrimarySeqAdaptor.pm:229
> STACK Bio::DB::BioSQL::SeqAdaptor::store_children
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> SeqAdaptor.pm:217
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:214
> STACK Bio::DB::Persistent::PersistentObject::create
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/Persistent/
> PersistentObject.pm:244
> STACK toplevel t/04swiss.t:36
> ---------------------------------------------------
>
> Also, seeing this with 13remove.t and 15.cluster.t, both of which
> appear to infinitely recurse:
>
> Deep recursion on subroutine
> "Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent" at
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm
> line 587, <GEN0> line 1.
> Deep recursion on subroutine
> "Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child" at
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm
> line 630, <GEN0> line 1.
>
>
> chris
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From bernd.web at gmail.com  Mon Sep  3 08:43:26 2007
From: bernd.web at gmail.com (Bernd Web)
Date: Mon, 3 Sep 2007 14:43:26 +0200
Subject: [Bioperl-l] Fh::flush warning
Message-ID: <716af09c0709030543w79f83368gf0ac74d220a96f8c@mail.gmail.com>

Hi,

Sometimes with Bio::SimpleAlign/AlignIO, I get the following warning:
(in cleanup) Undefined subroutine Fh::flush, at
/lib/perl/Bio/Root/IO.pm line 541.

This occurs in a rather large script and have not been able to isolate
a small example where I also get this warning. Does someone know more
about this warning and why it is thrown?

Regards,
Bernd


From cjfields at uiuc.edu  Mon Sep  3 10:41:49 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 3 Sep 2007 09:41:49 -0500
Subject: [Bioperl-l] Fh::flush warning
In-Reply-To: <716af09c0709030543w79f83368gf0ac74d220a96f8c@mail.gmail.com>
References: <716af09c0709030543w79f83368gf0ac74d220a96f8c@mail.gmail.com>
Message-ID: <98A9D081-2570-4D4E-A8F8-D03282D41E0C@uiuc.edu>

Could you give a bit more info (bioperl version, OS, etc)?

I'm guessing a recent version as the error coincides with a call to  
flush() in Root::IO (which is probably called indirectly via DESTROY)  
and that you're probably using a tied filehandle somewhere for  
output, e.g. Bio::AlignIO::newFh() or Bio::AlignIO::fh(), so knowing  
the input/output formats could help.

chris

On Sep 3, 2007, at 7:43 AM, Bernd Web wrote:

> Hi,
>
> Sometimes with Bio::SimpleAlign/AlignIO, I get the following warning:
> (in cleanup) Undefined subroutine Fh::flush, at
> /lib/perl/Bio/Root/IO.pm line 541.
>
> This occurs in a rather large script and have not been able to isolate
> a small example where I also get this warning. Does someone know more
> about this warning and why it is thrown?
>
> Regards,
> Bernd
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From xianranli78 at yahoo.com.cn  Mon Sep  3 22:11:09 2007
From: xianranli78 at yahoo.com.cn (xianran li)
Date: Tue, 4 Sep 2007 10:11:09 +0800 (CST)
Subject: [Bioperl-l] question about Bio::DB::GFF
Message-ID: <361239.6752.qm@web15309.mail.cnb.yahoo.com>

 
  Hi,
   
  I tried to load the  gff3 file with load_gff.pl and extrac some information with Bio::DB::GFF. Althougth this code work properly under windows xp, the $seg got nothing when i run it under Linux. 
   
  Here is my code and the gff3 file,
  ####################################################################
   
    #!/usr/local/bin/perl -w
   
  use strict;
use Bio::SeqIO;
use Bio::DB::GFF; 
   
  my $in_gff = Bio::DB::GFF->new( -adaptor    => 'dbi::mysqlopt',
                                -dsn        => 'dbi:mysql:test',
                                -aggregator => ['coding'],
                                -user       => "lixr",
                                -pass       => "123456"
                                );                           
my $seg = $in_gff->segment'BGIOSIBCE000001.1');
print $seg->abs_start."\n"; 


  ##################################################################
  ##gff-version 3 
##sequence-region       Chr01   1       43037
Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1
Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
Chr01 bgf CDS 19344 20165 . + 0 Parent=BGIOSIBCE000001.1
Chr01 bgf mRNA 30220 36442 . + . ID=BGIOSIBCE000002.1
Chr01 bgf CDS 30220 30387 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 31128 31226 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 32228 32331 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 33907 34715 . + 1 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 34799 34921 . + 2 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 35003 35091 . + 2 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 35179 35379 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 35981 36442 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf mRNA 38143 39015 . - . ID=BGIOSIBCE000003.1
Chr01 bgf CDS 38143 38541 . - 0 Parent=BGIOSIBCE000003.1
Chr01 bgf CDS 38649 38813 . - 0 Parent=BGIOSIBCE000003.1
Chr01 bgf CDS 38917 39015 . - 0 Parent=BGIOSIBCE000003.1
Chr01 bgf mRNA 39545 42080 . + . ID=BGIOSIBCE000004.1
Chr01 bgf CDS 39545 40584 . + 0 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 40677 41042 . + 1 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 41130 41208 . + 1 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 41740 41920 . + 0 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 42037 42080 . + 2 Parent=BGIOSIBCE000004.1
  #################################################################
   
   
  I would appreaciate if any one can give me some clues/link to accomplish this. 
   
  thanks in advance ,

  Xianran Li

       
---------------------------------
???????????????????????????????????????????? 


From cjfields at uiuc.edu  Tue Sep  4 00:04:29 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 3 Sep 2007 23:04:29 -0500
Subject: [Bioperl-l] question about Bio::DB::GFF
In-Reply-To: <361239.6752.qm@web15309.mail.cnb.yahoo.com>
References: <361239.6752.qm@web15309.mail.cnb.yahoo.com>
Message-ID: <37BE6493-B49B-47DF-8047-37D616B669A8@uiuc.edu>

Not sure if the gff3 you show was modified for demonstration here but  
it should always be tab-delimited.  Also, I have had problems myself  
when using files with Windows/Mac Classic line endings on UNIX'y  
systems (Excel and a few other Mac OS X programs insist on adding \r  
instead of \n, which plays havoc with parsers sometimes even with  
readline fixes).

chris

On Sep 3, 2007, at 9:11 PM, xianran li wrote:

>
>   Hi,
>
>   I tried to load the  gff3 file with load_gff.pl and extrac some  
> information with Bio::DB::GFF. Althougth this code work properly  
> under windows xp, the $seg got nothing when i run it under Linux.
>
>   Here is my code and the gff3 file,
>   ####################################################################
>
>     #!/usr/local/bin/perl -w
>
>   use strict;
> use Bio::SeqIO;
> use Bio::DB::GFF;
>
>   my $in_gff = Bio::DB::GFF->new( -adaptor    => 'dbi::mysqlopt',
>                                 -dsn        => 'dbi:mysql:test',
>                                 -aggregator => ['coding'],
>                                 -user       => "lixr",
>                                 -pass       => "123456"
>                                 );
> my $seg = $in_gff->segment'BGIOSIBCE000001.1');
> print $seg->abs_start."\n";
>
>
>   ##################################################################
>   ##gff-version 3
> ##sequence-region       Chr01   1       43037
> Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1
> Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf CDS 19344 20165 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf mRNA 30220 36442 . + . ID=BGIOSIBCE000002.1
> Chr01 bgf CDS 30220 30387 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 31128 31226 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 32228 32331 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 33907 34715 . + 1 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 34799 34921 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35003 35091 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35179 35379 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35981 36442 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf mRNA 38143 39015 . - . ID=BGIOSIBCE000003.1
> Chr01 bgf CDS 38143 38541 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38649 38813 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38917 39015 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf mRNA 39545 42080 . + . ID=BGIOSIBCE000004.1
> Chr01 bgf CDS 39545 40584 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 40677 41042 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41130 41208 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41740 41920 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 42037 42080 . + 2 Parent=BGIOSIBCE000004.1
>   #################################################################
>
>
>   I would appreaciate if any one can give me some clues/link to  
> accomplish this.
>
>   thanks in advance ,
>
>   Xianran Li
>
>
> ---------------------------------
> ??????????????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign






From xianranli78 at yahoo.com.cn  Tue Sep  4 00:58:48 2007
From: xianranli78 at yahoo.com.cn (xianran li)
Date: Tue, 4 Sep 2007 12:58:48 +0800 (CST)
Subject: [Bioperl-l]
 =?gb2312?q?=BB=D8=B8=B4=A3=BA=20Re:=20=20question=20about=20Bi?=
 =?gb2312?q?o::DB::GFF?=
In-Reply-To: <37BE6493-B49B-47DF-8047-37D616B669A8@uiuc.edu>
Message-ID: <866169.66154.qm@web15309.mail.cnb.yahoo.com>

Hi, everybody,
   
  It looks like for the different perl version(5.8.8 of  windows and 5.8.5 for linux). And I fixed this problem by adding ";Name=XXXX" after each line with "mRNA"
  ##############################################################################
  Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1;Name=BGIOSIBCE000001.1
Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
    ##############################################################################

  This time my code works properly.
   
  Xianran

Chris Fields <cjfields at uiuc.edu> ??????
  Not sure if the gff3 you show was modified for demonstration here but 
it should always be tab-delimited. Also, I have had problems myself 
when using files with Windows/Mac Classic line endings on UNIX'y 
systems (Excel and a few other Mac OS X programs insist on adding \r 
instead of \n, which plays havoc with parsers sometimes even with 
readline fixes).

chris

On Sep 3, 2007, at 9:11 PM, xianran li wrote:

>
> Hi,
>
> I tried to load the gff3 file with load_gff.pl and extrac some 
> information with Bio::DB::GFF. Althougth this code work properly 
> under windows xp, the $seg got nothing when i run it under Linux.
>
> Here is my code and the gff3 file,
> ####################################################################
>
> #!/usr/local/bin/perl -w
>
> use strict;
> use Bio::SeqIO;
> use Bio::DB::GFF;
>
> my $in_gff = Bio::DB::GFF->new( -adaptor => 'dbi::mysqlopt',
> -dsn => 'dbi:mysql:test',
> -aggregator => ['coding'],
> -user => "lixr",
> -pass => "123456"
> );
> my $seg = $in_gff->segment'BGIOSIBCE000001.1');
> print $seg->abs_start."\n";
>
>
> ##################################################################
> ##gff-version 3
> ##sequence-region Chr01 1 43037
> Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1
> Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf CDS 19344 20165 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf mRNA 30220 36442 . + . ID=BGIOSIBCE000002.1
> Chr01 bgf CDS 30220 30387 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 31128 31226 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 32228 32331 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 33907 34715 . + 1 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 34799 34921 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35003 35091 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35179 35379 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35981 36442 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf mRNA 38143 39015 . - . ID=BGIOSIBCE000003.1
> Chr01 bgf CDS 38143 38541 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38649 38813 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38917 39015 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf mRNA 39545 42080 . + . ID=BGIOSIBCE000004.1
> Chr01 bgf CDS 39545 40584 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 40677 41042 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41130 41208 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41740 41920 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 42037 42080 . + 2 Parent=BGIOSIBCE000004.1
> #################################################################
>
>
> I would appreaciate if any one can give me some clues/link to 
> accomplish this.
>
> thanks in advance ,
>
> Xianran Li
>
>
> ---------------------------------
> ????????????????????????????????????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





       
---------------------------------
 ????????????????????????????????


From jay at jays.net  Tue Sep  4 10:31:36 2007
From: jay at jays.net (Jay Hannah)
Date: Tue, 4 Sep 2007 09:31:36 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
Message-ID: <96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>

On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> Probably a bit of a long shot but does anyone have code for
> displaying protein or CDS multiple sequence alignments with the exon
> boundaries of each gene in the alignment?
>
> Something in the bioperl world without funky external dependencies.  
> I think
> it would be an awesome addition to the howtos.
>
> Currently, the Bio::Graphics howto has cdna to genome mapping  
> scripts or
> blast output scripts, but
> I couldn't find code for dealing with multiple sequence alignments.

I'm currently under the (potentially uninformed) impression that  
Bio::Graphics and related tools only work with a single  coordinate  
system. I've never seen a multiple sequence alignment example.

(
   I Google'd for "gbrowse alignment" and hit this:
   http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi

   Click the second Example link and you'll see exons mapped out.

   But zooming all the way in with all the tracks turned on it looks  
like the AZM tracks are just the coding regions. I don't see any  
multiple sequence alignment...
)

I doubt that helped.  :)

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah




From cjfields at uiuc.edu  Tue Sep  4 11:28:01 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 4 Sep 2007 10:28:01 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
Message-ID: <59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>


On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:

> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>> Probably a bit of a long shot but does anyone have code for
>> displaying protein or CDS multiple sequence alignments with the exon
>> boundaries of each gene in the alignment?
>>
>> Something in the bioperl world without funky external dependencies.
>> I think
>> it would be an awesome addition to the howtos.
>>
>> Currently, the Bio::Graphics howto has cdna to genome mapping
>> scripts or
>> blast output scripts, but
>> I couldn't find code for dealing with multiple sequence alignments.
>
> I'm currently under the (potentially uninformed) impression that
> Bio::Graphics and related tools only work with a single  coordinate
> system. I've never seen a multiple sequence alignment example.
>
> (
>    I Google'd for "gbrowse alignment" and hit this:
>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>
>    Click the second Example link and you'll see exons mapped out.
>
>    But zooming all the way in with all the tracks turned on it looks
> like the AZM tracks are just the coding regions. I don't see any
> multiple sequence alignment...
> )
>
> I doubt that helped.  :)
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:

http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
Browser/docs/tutorial/tutorial.html

chris



From avilella at gmail.com  Wed Sep  5 05:42:37 2007
From: avilella at gmail.com (Albert Vilella)
Date: Wed, 5 Sep 2007 11:42:37 +0200
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
Message-ID: <358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>

A couple of examples:

http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041

treefam has exon boundary and PFAM domain mappings

http://www.ensembl.org/Homo_sapiens/genetreeview?gene=ENSG00000139618

here the tree is shown as well, but the idea would be to plot the alignment

So it's more "show me the multiple CDS/protein alignment" rather than "show
my aligned CDS/proteins wrt my reference genome"

I think it would be quite neat to have this as a bioperl howto,

Comments?

    Albert.

On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>
>
> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>
> > On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> >> Probably a bit of a long shot but does anyone have code for
> >> displaying protein or CDS multiple sequence alignments with the exon
> >> boundaries of each gene in the alignment?
> >>
> >> Something in the bioperl world without funky external dependencies.
> >> I think
> >> it would be an awesome addition to the howtos.
> >>
> >> Currently, the Bio::Graphics howto has cdna to genome mapping
> >> scripts or
> >> blast output scripts, but
> >> I couldn't find code for dealing with multiple sequence alignments.
> >
> > I'm currently under the (potentially uninformed) impression that
> > Bio::Graphics and related tools only work with a single  coordinate
> > system. I've never seen a multiple sequence alignment example.
> >
> > (
> >    I Google'd for "gbrowse alignment" and hit this:
> >    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
> >
> >    Click the second Example link and you'll see exons mapped out.
> >
> >    But zooming all the way in with all the tracks turned on it looks
> > like the AZM tracks are just the coding regions. I don't see any
> > multiple sequence alignment...
> > )
> >
> > I doubt that helped.  :)
> >
> > Jay Hannah
> > http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>
> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>
> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
> Browser/docs/tutorial/tutorial.html
>
> chris
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From alexl at users.sourceforge.net  Wed Sep  5 06:08:14 2007
From: alexl at users.sourceforge.net (Alex Lancaster)
Date: Wed, 05 Sep 2007 03:08:14 -0700
Subject: [Bioperl-l] Clarifying license of bioperl
In-Reply-To: <8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net> (Hilmar Lapp's
	message of "Sat\, 18 Aug 2007 12\:13\:28 -0400")
References: <cg3ayi39sn.fsf@allele2.localdomain>
	<nrsl6i1ub4.fsf@allele2.localdomain>
	<1A4207F8295607498283FE9E93B775B40390172E@EX02.asurite.ad.asu.edu>
	<n9ir7e18y2.fsf@allele2.localdomain>
	<3515AB25-9919-407B-93E9-352BC426AFA1@uiuc.edu>
	<8td4xlyt4h.fsf@allele2.localdomain>
	<8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net>
Message-ID: <s73axt5ss1.fsf@allele2.localdomain>

>>>>> "HL" == Hilmar Lapp  writes:

HL> On Aug 18, 2007, at 7:33 AM, Alex Lancaster wrote:

> I imagine the intent of the bioperl
>> contributors is that it should be under the same terms as Perl,
>> whatever that happens to be (which just happens to be GPL or
>> Artistic, which is fine).

HL> I fully agree.

>> A clarification to that effect would be useful.

HL> Agreed, too. Would you mind changing that language on the wiki,
HL> since you seem to have a fairly good grasp on the issue?

OK, I've updated the wiki in two places:

http://www.bioperl.org/wiki/Licensing_BioPerl

http://www.bioperl.org/wiki/FAQ#What_are_the_license_terms_for_BioPerl.3F

It would also be nice if the LICENSE and Build.PL files in CVS (so it
finds its way into the next release) were also updated to reflect the
dual-licensed status, currently they only mention the Artistic
license:

http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/LICENSE?rev=HEAD&content-type=text/vnd.viewcvs-markup

http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/Build.PL?rev=HEAD&content-type=text/vnd.viewcvs-markup

For Build.PL this is easy:

(e.g., license             => 'artistic', should be 
       license             => 'GPL or Artistic',)

Possible solutions for the LICENSE file include:

1) The GPL could be added to LICENSE file at the end (with a note at
   the top to indicate that GPL is also included);

2) LICENSE could be moved to LICENSE.Artistic and another file
   "LICENSE.GPL" added with the GPL (version 2+) conditions, and the
   contents of LICENSE would include a note about each license.

I don't have access to the bioperl CVS repository, so I can't make the
changes myself).  This would also apply to the Build.PL (and LICENSE
files if they are present) in bioperl-run and other modules.

Thanks,
Alex


From cjfields at uiuc.edu  Wed Sep  5 08:25:21 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 07:25:21 -0500
Subject: [Bioperl-l] Clarifying license of bioperl
In-Reply-To: <s73axt5ss1.fsf@allele2.localdomain>
References: <cg3ayi39sn.fsf@allele2.localdomain>
	<nrsl6i1ub4.fsf@allele2.localdomain>
	<1A4207F8295607498283FE9E93B775B40390172E@EX02.asurite.ad.asu.edu>
	<n9ir7e18y2.fsf@allele2.localdomain>
	<3515AB25-9919-407B-93E9-352BC426AFA1@uiuc.edu>
	<8td4xlyt4h.fsf@allele2.localdomain>
	<8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net>
	<s73axt5ss1.fsf@allele2.localdomain>
Message-ID: <EE93F2F5-A76B-40C6-8A95-3E1DDD3D8562@uiuc.edu>


On Sep 5, 2007, at 5:08 AM, Alex Lancaster wrote:
...
>
> OK, I've updated the wiki in two places:
>
> http://www.bioperl.org/wiki/Licensing_BioPerl
>
> http://www.bioperl.org/wiki/ 
> FAQ#What_are_the_license_terms_for_BioPerl.3F
>
> It would also be nice if the LICENSE and Build.PL files in CVS (so it
> finds its way into the next release) were also updated to reflect the
> dual-licensed status, currently they only mention the Artistic
> license:
>
> http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/LICENSE? 
> rev=HEAD&content-type=text/vnd.viewcvs-markup
>
> http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/Build.PL? 
> rev=HEAD&content-type=text/vnd.viewcvs-markup
>
> For Build.PL this is easy:
>
> (e.g., license             => 'artistic', should be
>        license             => 'GPL or Artistic',)
>
> Possible solutions for the LICENSE file include:
>
> 1) The GPL could be added to LICENSE file at the end (with a note at
>    the top to indicate that GPL is also included);
>
> 2) LICENSE could be moved to LICENSE.Artistic and another file
>    "LICENSE.GPL" added with the GPL (version 2+) conditions, and the
>    contents of LICENSE would include a note about each license.
>
> I don't have access to the bioperl CVS repository, so I can't make the
> changes myself).  This would also apply to the Build.PL (and LICENSE
> files if they are present) in bioperl-run and other modules.
>
> Thanks,
> Alex

Looks like Sendu has done that.  There have been recent troubling  
developments re: Artistic License:

http://use.perl.org/article.pl?sid=07/08/26/1541205&from=rss

but the case hasn't been conclusively decided yet.

chris


From bix at sendu.me.uk  Wed Sep  5 08:18:35 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Wed, 05 Sep 2007 13:18:35 +0100
Subject: [Bioperl-l] Clarifying license of bioperl
In-Reply-To: <s73axt5ss1.fsf@allele2.localdomain>
References: <cg3ayi39sn.fsf@allele2.localdomain>	<nrsl6i1ub4.fsf@allele2.localdomain>	<1A4207F8295607498283FE9E93B775B40390172E@EX02.asurite.ad.asu.edu>	<n9ir7e18y2.fsf@allele2.localdomain>	<3515AB25-9919-407B-93E9-352BC426AFA1@uiuc.edu>	<8td4xlyt4h.fsf@allele2.localdomain>	<8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net>
	<s73axt5ss1.fsf@allele2.localdomain>
Message-ID: <46DE9E9B.80107@sendu.me.uk>

Alex Lancaster wrote:
>>>>>> "HL" == Hilmar Lapp  writes:
> 
> HL> On Aug 18, 2007, at 7:33 AM, Alex Lancaster wrote:
> 
>>> I imagine the intent of the bioperl
>>> contributors is that it should be under the same terms as Perl,
>>> whatever that happens to be (which just happens to be GPL or
>>> Artistic, which is fine).
> 
> HL> I fully agree.
> 
>>> A clarification to that effect would be useful.
> 
> HL> Agreed, too. Would you mind changing that language on the wiki,
> HL> since you seem to have a fairly good grasp on the issue?
> 
> OK, I've updated the wiki in two places:
> 
> http://www.bioperl.org/wiki/Licensing_BioPerl
> 
> http://www.bioperl.org/wiki/FAQ#What_are_the_license_terms_for_BioPerl.3F

Thank you very much for that Alex.


> It would also be nice if the LICENSE and Build.PL files in CVS (so it
> finds its way into the next release) were also updated to reflect the
> dual-licensed status, currently they only mention the Artistic
> license:
[snip]
> For Build.PL this is easy:
> 
> (e.g., license             => 'artistic', should be 
>        license             => 'GPL or Artistic',)

As per the 'license' section of 
http://search.cpan.org/~kwilliams/Module-Build-0.2808/lib/Module/Build/API.pod, 
I've changed it to 'perl', which means Artistic or GPL.


> Possible solutions for the LICENSE file include:
> 
> 1) The GPL could be added to LICENSE file at the end (with a note at
>    the top to indicate that GPL is also included);

I took this approach, using your language for the explanation at the 
top, and including GPL 3.0 at the bottom.


I've made these changes for core (live), run, db and network.

Thanks again for your help and advice.


From cjfields at uiuc.edu  Wed Sep  5 08:53:25 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 07:53:25 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
Message-ID: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>

You mean something like this?

http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics

chris

On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:

> A couple of examples:
>
> http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
>
> treefam has exon boundary and PFAM domain mappings
>
> http://www.ensembl.org/Homo_sapiens/genetreeview?gene=ENSG00000139618
>
> here the tree is shown as well, but the idea would be to plot the  
> alignment
>
> So it's more "show me the multiple CDS/protein alignment" rather  
> than "show
> my aligned CDS/proteins wrt my reference genome"
>
> I think it would be quite neat to have this as a bioperl howto,
>
> Comments?
>
>     Albert.
>
> On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>
>>
>> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>>
>>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>>>> Probably a bit of a long shot but does anyone have code for
>>>> displaying protein or CDS multiple sequence alignments with the  
>>>> exon
>>>> boundaries of each gene in the alignment?
>>>>
>>>> Something in the bioperl world without funky external dependencies.
>>>> I think
>>>> it would be an awesome addition to the howtos.
>>>>
>>>> Currently, the Bio::Graphics howto has cdna to genome mapping
>>>> scripts or
>>>> blast output scripts, but
>>>> I couldn't find code for dealing with multiple sequence alignments.
>>>
>>> I'm currently under the (potentially uninformed) impression that
>>> Bio::Graphics and related tools only work with a single  coordinate
>>> system. I've never seen a multiple sequence alignment example.
>>>
>>> (
>>>    I Google'd for "gbrowse alignment" and hit this:
>>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>>>
>>>    Click the second Example link and you'll see exons mapped out.
>>>
>>>    But zooming all the way in with all the tracks turned on it looks
>>> like the AZM tracks are just the coding regions. I don't see any
>>> multiple sequence alignment...
>>> )
>>>
>>> I doubt that helped.  :)
>>>
>>> Jay Hannah
>>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>>
>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>>
>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
>> Browser/docs/tutorial/tutorial.html
>>
>> chris
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From avilella at gmail.com  Wed Sep  5 09:31:24 2007
From: avilella at gmail.com (Albert Vilella)
Date: Wed, 5 Sep 2007 15:31:24 +0200
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
Message-ID: <358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>

Awesome!!

Thanks Chris!

On 9/5/07, Chris Fields <cjfields at uiuc.edu> wrote:
>
> You mean something like this?
>
> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>
> chris
>
> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>
> > A couple of examples:
> >
> > http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
> >
> > treefam has exon boundary and PFAM domain mappings
> >
> > http://www.ensembl.org/Homo_sapiens/genetreeview?gene=ENSG00000139618
> >
> > here the tree is shown as well, but the idea would be to plot the
> > alignment
> >
> > So it's more "show me the multiple CDS/protein alignment" rather
> > than "show
> > my aligned CDS/proteins wrt my reference genome"
> >
> > I think it would be quite neat to have this as a bioperl howto,
> >
> > Comments?
> >
> >     Albert.
> >
> > On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
> >>
> >>
> >> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
> >>
> >>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> >>>> Probably a bit of a long shot but does anyone have code for
> >>>> displaying protein or CDS multiple sequence alignments with the
> >>>> exon
> >>>> boundaries of each gene in the alignment?
> >>>>
> >>>> Something in the bioperl world without funky external dependencies.
> >>>> I think
> >>>> it would be an awesome addition to the howtos.
> >>>>
> >>>> Currently, the Bio::Graphics howto has cdna to genome mapping
> >>>> scripts or
> >>>> blast output scripts, but
> >>>> I couldn't find code for dealing with multiple sequence alignments.
> >>>
> >>> I'm currently under the (potentially uninformed) impression that
> >>> Bio::Graphics and related tools only work with a single  coordinate
> >>> system. I've never seen a multiple sequence alignment example.
> >>>
> >>> (
> >>>    I Google'd for "gbrowse alignment" and hit this:
> >>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
> >>>
> >>>    Click the second Example link and you'll see exons mapped out.
> >>>
> >>>    But zooming all the way in with all the tracks turned on it looks
> >>> like the AZM tracks are just the coding regions. I don't see any
> >>> multiple sequence alignment...
> >>> )
> >>>
> >>> I doubt that helped.  :)
> >>>
> >>> Jay Hannah
> >>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
> >>
> >> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
> >>
> >> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
> >> Browser/docs/tutorial/tutorial.html
> >>
> >> chris
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
>


From cjfields at uiuc.edu  Wed Sep  5 10:17:51 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 09:17:51 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
Message-ID: <31E25B64-2043-4460-ADC8-9684D01C2468@uiuc.edu>

It would be nice to place the labels to the left of the segments.  I  
believe there is a way to do this, but can't remember; if I can find  
it I'll revise the script.

chris

On Sep 5, 2007, at 8:31 AM, Albert Vilella wrote:

> Awesome!!
>
> Thanks Chris!
>
> On 9/5/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>
>> You mean something like this?
>>
>> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>>
>> chris
>>
>> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>>
>>> A couple of examples:
>>>
>>> http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
>>>
>>> treefam has exon boundary and PFAM domain mappings
>>>
>>> http://www.ensembl.org/Homo_sapiens/genetreeview? 
>>> gene=ENSG00000139618
>>>
>>> here the tree is shown as well, but the idea would be to plot the
>>> alignment
>>>
>>> So it's more "show me the multiple CDS/protein alignment" rather
>>> than "show
>>> my aligned CDS/proteins wrt my reference genome"
>>>
>>> I think it would be quite neat to have this as a bioperl howto,
>>>
>>> Comments?
>>>
>>>     Albert.
>>>
>>> On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>>>
>>>>
>>>> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>>>>
>>>>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>>>>>> Probably a bit of a long shot but does anyone have code for
>>>>>> displaying protein or CDS multiple sequence alignments with the
>>>>>> exon
>>>>>> boundaries of each gene in the alignment?
>>>>>>
>>>>>> Something in the bioperl world without funky external  
>>>>>> dependencies.
>>>>>> I think
>>>>>> it would be an awesome addition to the howtos.
>>>>>>
>>>>>> Currently, the Bio::Graphics howto has cdna to genome mapping
>>>>>> scripts or
>>>>>> blast output scripts, but
>>>>>> I couldn't find code for dealing with multiple sequence  
>>>>>> alignments.
>>>>>
>>>>> I'm currently under the (potentially uninformed) impression that
>>>>> Bio::Graphics and related tools only work with a single   
>>>>> coordinate
>>>>> system. I've never seen a multiple sequence alignment example.
>>>>>
>>>>> (
>>>>>    I Google'd for "gbrowse alignment" and hit this:
>>>>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>>>>>
>>>>>    Click the second Example link and you'll see exons mapped out.
>>>>>
>>>>>    But zooming all the way in with all the tracks turned on it  
>>>>> looks
>>>>> like the AZM tracks are just the coding regions. I don't see any
>>>>> multiple sequence alignment...
>>>>> )
>>>>>
>>>>> I doubt that helped.  :)
>>>>>
>>>>> Jay Hannah
>>>>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>>>>
>>>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>>>>
>>>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
>>>> Browser/docs/tutorial/tutorial.html
>>>>
>>>> chris
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From n.haigh at sheffield.ac.uk  Wed Sep  5 10:22:44 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Wed, 05 Sep 2007 15:22:44 +0100
Subject: [Bioperl-l] Bio::Graphics support for floating point positions
In-Reply-To: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
Message-ID: <46DEBBB4.1030200@sheffield.ac.uk>

Chris Fields wrote:
> You mean something like this?
>
> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>
> chris
>
> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>
>   

Nice!

On a similar (well, related to Bio::Graphics) topic, I've written a
script that uses markers that have been mapped from a model organism to
linkage groups in related species in order to estimate the location of
"unknown" markers in those linkage groups.

I'm using the Bio::Map::* modules for much of this work and then I use
Bio::Graphics to display the linkage groups of the non-model organism
with the putative position of the "unknown" markers. However, I've had
to do a bit of fudging to get Bio::Graphics to draw this data. The
problems I encountered are described below. I also have an open bug:
http://bugzilla.open-bio.org/show_bug.cgi?id=2343

1) Linkage maps are measured in cM - which can and are likely to be
non-integer values. Bio::Graphics needs integer values, so I simply
scaled all my cM measurements prior to drawing by *1000. However, the
ruler now doesn't represent the "true scale" - can this be adjusted?

2) Some markers map to 0cM. However, Bio::Graphics requires positions
>0. To get round this I simply incremented these positions by 1
(post-scaling), so they display almost in the correct place.

Is it possible/likely/wise to support positions starting at zero and
float positions? Would such support simply be to internalise what I have
already done outside Bio::Graphics into the Bio::Graphics modules and
have it display the correctly scaled ruler?

Thoughts comments welcome.

Cheers,
Nath


From cjfields at uiuc.edu  Wed Sep  5 10:52:00 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 09:52:00 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
Message-ID: <A8815527-2027-4F9D-BC47-C16E351067AA@uiuc.edu>

Updated the page on the web site with the new script.

Figured it out; if you pass the parameter -label_position 'left' it  
will display the label to the left.  However it displays them right  
next to the segment (ala GBrowse).  I added a hack to  
Bio::Graphics::Glyph::generic in CVS which allows 'alignment_left' as  
an option, displaying it aligned to the far left of the panel; there  
is probably a way to use a callback here as well.

chris

On Sep 5, 2007, at 8:31 AM, Albert Vilella wrote:

> Awesome!!
>
> Thanks Chris!
>
> On 9/5/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>
>> You mean something like this?
>>
>> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>>
>> chris
>>
>> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>>
>>> A couple of examples:
>>>
>>> http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
>>>
>>> treefam has exon boundary and PFAM domain mappings
>>>
>>> http://www.ensembl.org/Homo_sapiens/genetreeview? 
>>> gene=ENSG00000139618
>>>
>>> here the tree is shown as well, but the idea would be to plot the
>>> alignment
>>>
>>> So it's more "show me the multiple CDS/protein alignment" rather
>>> than "show
>>> my aligned CDS/proteins wrt my reference genome"
>>>
>>> I think it would be quite neat to have this as a bioperl howto,
>>>
>>> Comments?
>>>
>>>     Albert.
>>>
>>> On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>>>
>>>>
>>>> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>>>>
>>>>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>>>>>> Probably a bit of a long shot but does anyone have code for
>>>>>> displaying protein or CDS multiple sequence alignments with the
>>>>>> exon
>>>>>> boundaries of each gene in the alignment?
>>>>>>
>>>>>> Something in the bioperl world without funky external  
>>>>>> dependencies.
>>>>>> I think
>>>>>> it would be an awesome addition to the howtos.
>>>>>>
>>>>>> Currently, the Bio::Graphics howto has cdna to genome mapping
>>>>>> scripts or
>>>>>> blast output scripts, but
>>>>>> I couldn't find code for dealing with multiple sequence  
>>>>>> alignments.
>>>>>
>>>>> I'm currently under the (potentially uninformed) impression that
>>>>> Bio::Graphics and related tools only work with a single   
>>>>> coordinate
>>>>> system. I've never seen a multiple sequence alignment example.
>>>>>
>>>>> (
>>>>>    I Google'd for "gbrowse alignment" and hit this:
>>>>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>>>>>
>>>>>    Click the second Example link and you'll see exons mapped out.
>>>>>
>>>>>    But zooming all the way in with all the tracks turned on it  
>>>>> looks
>>>>> like the AZM tracks are just the coding regions. I don't see any
>>>>> multiple sequence alignment...
>>>>> )
>>>>>
>>>>> I doubt that helped.  :)
>>>>>
>>>>> Jay Hannah
>>>>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>>>>
>>>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>>>>
>>>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
>>>> Browser/docs/tutorial/tutorial.html
>>>>
>>>> chris
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From cjfields at uiuc.edu  Wed Sep  5 12:47:46 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 11:47:46 -0500
Subject: [Bioperl-l] Bio::Graphics support for floating point positions
In-Reply-To: <46DEBBB4.1030200@sheffield.ac.uk>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<46DEBBB4.1030200@sheffield.ac.uk>
Message-ID: <C445D375-6B45-476F-B0A9-2B28851EE970@uiuc.edu>

On Sep 5, 2007, at 9:22 AM, Nathan Haigh wrote:

> ...
> On a similar (well, related to Bio::Graphics) topic, I've written a
> script that uses markers that have been mapped from a model  
> organism to
> linkage groups in related species in order to estimate the location of
> "unknown" markers in those linkage groups.
>
> I'm using the Bio::Map::* modules for much of this work and then I use
> Bio::Graphics to display the linkage groups of the non-model organism
> with the putative position of the "unknown" markers. However, I've had
> to do a bit of fudging to get Bio::Graphics to draw this data. The
> problems I encountered are described below. I also have an open bug:
> http://bugzilla.open-bio.org/show_bug.cgi?id=2343
>
> 1) Linkage maps are measured in cM - which can and are likely to be
> non-integer values. Bio::Graphics needs integer values, so I simply
> scaled all my cM measurements prior to drawing by *1000. However, the
> ruler now doesn't represent the "true scale" - can this be adjusted?
>
> 2) Some markers map to 0cM. However, Bio::Graphics requires positions
>> 0. To get round this I simply incremented these positions by 1
> (post-scaling), so they display almost in the correct place.
>
> Is it possible/likely/wise to support positions starting at zero and
> float positions? Would such support simply be to internalise what I  
> have
> already done outside Bio::Graphics into the Bio::Graphics modules and
> have it display the correctly scaled ruler?
>
> Thoughts comments welcome.
>
> Cheers,
> Nath

There is this section in the GBrowse configure doc, which to me  
suggests there is a way to do what you want in Bioperl; you may have  
to delve into the Bio::Graphics or GBrowse code to work it out,  
though.  I think the GBrowse mail list archives also have more on this.

chris

.....

F. DISPLAYING GENETIC AND RH MAPS

GBrowse can be tweaked to make it more suitable for displaying genetic
and radiation hybrid maps.

The main issue is that the Bio::DB::GFF database expects coordinates
to be positive integers, not fractions, but genetic and RH maps use
floating point numbers.  Working around this is a bit of an ugly hack.
Before loading your data you must multiply all your coordinates by a
constant power of 10 in order to convert them into integers.  For
example, if a genetic map uses Morgan units ranging from 0 to 1.80,
you would multiple by 100 to create a map in ranging from 0 to 180.

Create a GFF file containing the markers in modified coordinates and
load it as usual.  Now you must tell GBrowse to reverse these changes.
Enter the following options into the [GENERAL] section of the
configuration file:

  units = M
  unit_divider = 100

These two options tell GBrowse to use "M" (Morgan) units, and to
divide all coordinates by 100.  GBrowse will automatically display the
scale using the most appropriate units, so the displayed map will
typically be drawn using cM units.



From bernd.web at gmail.com  Wed Sep  5 13:44:26 2007
From: bernd.web at gmail.com (Bernd Web)
Date: Wed, 5 Sep 2007 19:44:26 +0200
Subject: [Bioperl-l] SearchIO ResultWriter
Message-ID: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>

Hi,

For SearchIO there are ResultWriters to write text, html and BSML
(BSMLResultWriter). However, is there also a BLAST xml writer, which
writes the original blast xml files. This may have come up before. If
there is not, is there interest in having this?


Regards,
Bernd


From sac at bioperl.org  Wed Sep  5 16:37:37 2007
From: sac at bioperl.org (Steve Chervitz)
Date: Wed, 5 Sep 2007 13:37:37 -0700
Subject: [Bioperl-l] SearchIO ResultWriter
In-Reply-To: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>
References: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>
Message-ID: <8f200b4c0709051337u532804d6r27712b05faaeea7d@mail.gmail.com>

Looks like there is no such functionality in the current repository. If you
have implemented such a beast and are willing to contribute it, go for it
(or coordinate with a developer if you lack CVS write access).

Steve

On 9/5/07, Bernd Web <bernd.web at gmail.com> wrote:
>
> Hi,
>
> For SearchIO there are ResultWriters to write text, html and BSML
> (BSMLResultWriter). However, is there also a BLAST xml writer, which
> writes the original blast xml files. This may have come up before. If
> there is not, is there interest in having this?
>
>
> Regards,
> Bernd
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From n.haigh at sheffield.ac.uk  Wed Sep  5 17:18:17 2007
From: n.haigh at sheffield.ac.uk (Nathan S. Haigh)
Date: Wed, 05 Sep 2007 22:18:17 +0100
Subject: [Bioperl-l] Bio::Graphics support for floating point positions
In-Reply-To: <C445D375-6B45-476F-B0A9-2B28851EE970@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<46DEBBB4.1030200@sheffield.ac.uk>
	<C445D375-6B45-476F-B0A9-2B28851EE970@uiuc.edu>
Message-ID: <46DF1D19.9010707@sheffield.ac.uk>

Chris Fields wrote:
> On Sep 5, 2007, at 9:22 AM, Nathan Haigh wrote:
>
>> ...
>> On a similar (well, related to Bio::Graphics) topic, I've written a
>> script that uses markers that have been mapped from a model organism to
>> linkage groups in related species in order to estimate the location of
>> "unknown" markers in those linkage groups.
>>
>> I'm using the Bio::Map::* modules for much of this work and then I use
>> Bio::Graphics to display the linkage groups of the non-model organism
>> with the putative position of the "unknown" markers. However, I've had
>> to do a bit of fudging to get Bio::Graphics to draw this data. The
>> problems I encountered are described below. I also have an open bug:
>> http://bugzilla.open-bio.org/show_bug.cgi?id=2343
>>
>> 1) Linkage maps are measured in cM - which can and are likely to be
>> non-integer values. Bio::Graphics needs integer values, so I simply
>> scaled all my cM measurements prior to drawing by *1000. However, the
>> ruler now doesn't represent the "true scale" - can this be adjusted?
>>
>> 2) Some markers map to 0cM. However, Bio::Graphics requires positions
>>> 0. To get round this I simply incremented these positions by 1
>> (post-scaling), so they display almost in the correct place.
>>
>> Is it possible/likely/wise to support positions starting at zero and
>> float positions? Would such support simply be to internalise what I have
>> already done outside Bio::Graphics into the Bio::Graphics modules and
>> have it display the correctly scaled ruler?
>>
>> Thoughts comments welcome.
>>
>> Cheers,
>> Nath
>
> There is this section in the GBrowse configure doc, which to me
> suggests there is a way to do what you want in Bioperl; you may have
> to delve into the Bio::Graphics or GBrowse code to work it out,
> though.  I think the GBrowse mail list archives also have more on this.
>
> chris
>
> .....
>
> F. DISPLAYING GENETIC AND RH MAPS
>
> GBrowse can be tweaked to make it more suitable for displaying genetic
> and radiation hybrid maps.
>
> The main issue is that the Bio::DB::GFF database expects coordinates
> to be positive integers, not fractions, but genetic and RH maps use
> floating point numbers.  Working around this is a bit of an ugly hack.
> Before loading your data you must multiply all your coordinates by a
> constant power of 10 in order to convert them into integers.  For
> example, if a genetic map uses Morgan units ranging from 0 to 1.80,
> you would multiple by 100 to create a map in ranging from 0 to 180.
>
> Create a GFF file containing the markers in modified coordinates and
> load it as usual.  Now you must tell GBrowse to reverse these changes.
> Enter the following options into the [GENERAL] section of the
> configuration file:
>
>  units = M
>  unit_divider = 100
>
> These two options tell GBrowse to use "M" (Morgan) units, and to
> divide all coordinates by 100.  GBrowse will automatically display the
> scale using the most appropriate units, so the displayed map will
> typically be drawn using cM units.
>


Thanks for for the pointer Chris!

>From what you've said, it appears they might have done a similar hack to
me - which is always nice to know! It seems then to me, that it may be
worth making the Bio::Graphic::* modules slightly more generic and
applicable for these situations. It's late, so does anyone have
suggestions before I start digging through Bio::Graphic::* modules in
the morning? Maybe you guys across the water have something to say by
the time I wake up in the morning!?

Thanks
Nath


From jason at bioperl.org  Wed Sep  5 17:33:44 2007
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 5 Sep 2007 14:33:44 -0700
Subject: [Bioperl-l] SearchIO ResultWriter
In-Reply-To: <8f200b4c0709051337u532804d6r27712b05faaeea7d@mail.gmail.com>
References: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>
	<8f200b4c0709051337u532804d6r27712b05faaeea7d@mail.gmail.com>
Message-ID: <AE9E4472-3424-49F6-AA93-6F05F14446AA@bioperl.org>

I think most ppl aren't that enamored with the NCBI XML Blast format  
but I guess it is standard if the NCBI puts it out...
It should be a pretty easy writer to make at any rate just follow  
along with what was done for BSMLWriter.

-jason
On Sep 5, 2007, at 1:37 PM, Steve Chervitz wrote:

> Looks like there is no such functionality in the current  
> repository. If you
> have implemented such a beast and are willing to contribute it, go  
> for it
> (or coordinate with a developer if you lack CVS write access).
>
> Steve
>
> On 9/5/07, Bernd Web <bernd.web at gmail.com> wrote:
>>
>> Hi,
>>
>> For SearchIO there are ResultWriters to write text, html and BSML
>> (BSMLResultWriter). However, is there also a BLAST xml writer, which
>> writes the original blast xml files. This may have come up before. If
>> there is not, is there interest in having this?
>>
>>
>> Regards,
>> Bernd
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
jason at bioperl.org



From jay at jays.net  Thu Sep  6 15:50:53 2007
From: jay at jays.net (Jay Hannah)
Date: Thu, 6 Sep 2007 15:50:53 -0400 (EDT)
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
 with exon boundaries
In-Reply-To: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
Message-ID: <Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>


On Wed, 5 Sep 2007, Chris Fields wrote:
> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics

Wow. That's slick.  :)   Is it possible to zoom in far enough to see the 
individual bases and gaps??

On Tue, 4 Sep 2007, Chris Fields wrote:
> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-Browser/docs/tutorial/tutorial.html

Yes, indeed. GBrowse graphs all sorts of amazing things. Specifically, 
this image might be what Albert is looking for:

http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-Browser/docs/tutorial/figures/segmented_features2.gif

He'd need to map his exon boundaries from whatever format he has into a 
GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to munch on.

On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> "Something in the bioperl world without funky external dependencies"

There are still things the long arm of BioPerl justice hasn't reached?   :)

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah



From cjfields at uiuc.edu  Thu Sep  6 19:39:07 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 6 Sep 2007 18:39:07 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
Message-ID: <9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>


On Sep 6, 2007, at 2:50 PM, Jay Hannah wrote:

>
> On Wed, 5 Sep 2007, Chris Fields wrote:
>> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>
> Wow. That's slick.  :)   Is it possible to zoom in far enough to  
> see the
> individual bases and gaps??

I'm not sure; you can do something like that with GBrowse with some  
features so there is probably a way to put something together which  
could do that.

> On Tue, 4 Sep 2007, Chris Fields wrote:
>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
>> Browser/docs/tutorial/tutorial.html
>
> Yes, indeed. GBrowse graphs all sorts of amazing things. Specifically,
> this image might be what Albert is looking for:
>
> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
> Browser/docs/tutorial/figures/segmented_features2.gif
>
> He'd need to map his exon boundaries from whatever format he has  
> into a
> GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to  
> munch on.

I use segmented SeqFeatures in my example.  The HOWTO also uses a  
variation ('graded_segments'):

http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output

The subseqfeatures are colored by score.  Feasibly one could hack  
this so that the exons/introns have a different 'score', thus  
displaying different colors.

> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>> "Something in the bioperl world without funky external dependencies"
>
> There are still things the long arm of BioPerl justice hasn't  
> reached?   :)
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

chris


From cain.cshl at gmail.com  Thu Sep  6 23:20:04 2007
From: cain.cshl at gmail.com (Scott Cain)
Date: Thu, 06 Sep 2007 23:20:04 -0400
Subject: [Bioperl-l] display protein/CDS multiple sequence
	alignments	with exon boundaries
In-Reply-To: <9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
Message-ID: <1189135204.2560.52.camel@localhost.localdomain>

On Thu, 2007-09-06 at 18:39 -0500, Chris Fields wrote:
> On Sep 6, 2007, at 2:50 PM, Jay Hannah wrote:
> 
> >
> > On Wed, 5 Sep 2007, Chris Fields wrote:
> >> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
> >
> > Wow. That's slick.  :)   Is it possible to zoom in far enough to  
> > see the
> > individual bases and gaps??
> 
> I'm not sure; you can do something like that with GBrowse with some  
> features so there is probably a way to put something together which  
> could do that.

Yeah, if it were me, I would install GBrowse, hack my data into GFF and
use gbrowse_img to generate pictures.  It would probably be easier than
starting from scratch.


> 
> > On Tue, 4 Sep 2007, Chris Fields wrote:
> >> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
> >> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
> >> Browser/docs/tutorial/tutorial.html
> >
> > Yes, indeed. GBrowse graphs all sorts of amazing things. Specifically,
> > this image might be what Albert is looking for:
> >
> > http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
> > Browser/docs/tutorial/figures/segmented_features2.gif
> >
> > He'd need to map his exon boundaries from whatever format he has  
> > into a
> > GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to  
> > munch on.
> 
> I use segmented SeqFeatures in my example.  The HOWTO also uses a  
> variation ('graded_segments'):
> 
> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
> 
> The subseqfeatures are colored by score.  Feasibly one could hack  
> this so that the exons/introns have a different 'score', thus  
> displaying different colors.
> 
> > On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> >> "Something in the bioperl world without funky external dependencies"
> >
> > There are still things the long arm of BioPerl justice hasn't  
> > reached?   :)
> >
> > Jay Hannah
> > http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
> 
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain at cshl.edu
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory
-------------- next part --------------
A non-text attachment was scrubbed...
Name: not available
Type: application/pgp-signature
Size: 189 bytes
Desc: This is a digitally signed message part
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20070906/6b2b9ea2/attachment-0002.bin>

From avilella at gmail.com  Fri Sep  7 05:20:01 2007
From: avilella at gmail.com (Albert Vilella)
Date: Fri, 7 Sep 2007 10:20:01 +0100
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
Message-ID: <358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>

>
> > He'd need to map his exon boundaries from whatever format he has
> > into a
> > GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to
> > munch on.
>
> I use segmented SeqFeatures in my example.  The HOWTO also uses a
> variation ('graded_segments'):
>
> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
>
> The subseqfeatures are colored by score.  Feasibly one could hack
> this so that the exons/introns have a different 'score', thus
> displaying different colors.


The exon boundary could be a vertical line or a triangular tick or
something. I don't know if there is a consensus on this kind of cartoons.
Does anybody know how exon boundaries are displayed in different
browsers/apps?


From yangmeng at genomics.org.cn  Fri Sep  7 03:57:14 2007
From: yangmeng at genomics.org.cn (=?ISO-8859-1?Q?=D1=EE=C3=CD=A3=A8=D6=D0=D0=C4=CA=B5=D1=E9=CA=D2?= )
Date: Fri,  7 Sep 2007 15:57:14 +0800
Subject: [Bioperl-l] a question
Message-ID: <200709071557.AA78971054@genomics.org.cn>

I am a student from China.During my learing the bioperl,I encounter a problem as follows:

I run the program,

use Bio::Perl;
$seq_object = get_sequence('swissprot',"ROA1_HUMAN");
write_sequence(">roa1.fasta",'fasta',$seq_object);

But It returns lots of mistake informatiom,

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: WebDBSeqI Request Error:
501 Protocol scheme '' is not supported
Content-Type: text/plain
Client-Date: Fri, 07 Sep 2007 07:26:06 GMT
Client-Warning: Internal response
501 Protocol scheme '' is not supported
STACK: Error::throw
STACK: Bio::Root::Root::throw D:/perl/site/lib/Bio/Root/Root.pm:359
STACK: Bio::DB::WebDBSeqI::_request D:/perl/site/lib/Bio/DB/WebDBSeqI.pm:685
STACK: Bio::DB::WebDBSeqI::get_seq_stream D:/perl/site/lib/Bio/DB/WebDBSeqI.pm:4
91
STACK: Bio::DB::WebDBSeqI::get_Stream_by_id D:/perl/site/lib/Bio/DB/WebDBSeqI.pm
:275
STACK: Bio::DB::WebDBSeqI::get_Seq_by_id D:/perl/site/lib/Bio/DB/WebDBSeqI.pm:14
5
STACK: Bio::Perl::get_sequence D:/perl/site/lib/Bio/Perl.pm:510
STACK: C:\DOCUME~1\yangmeng\LOCALS~1\Temp\dir13D.tmp\Untitled.pl:6
-----------------------------------------------------------

I don't know the reason of the problem.I have installed the addition perl modules such as bioperl-db,bioperl-network,bioperlgui and almost all "BioPerl Dependencies modules".My network is also OK. It's an annoying promleb to me.
I have consulted many experts but didn't got a reply. Could you vacuate in your mass business to give me a help?

Thank you!

Best regards!

YangMeng  




________________________________________________________________
Sent via the WebMail system at genomics.org.cn


 
                   


From cjfields at uiuc.edu  Fri Sep  7 10:09:18 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 7 Sep 2007 09:09:18 -0500
Subject: [Bioperl-l] a question
In-Reply-To: <200709071557.AA78971054@genomics.org.cn>
References: <200709071557.AA78971054@genomics.org.cn>
Message-ID: <7F176E39-18A6-4BF9-9247-863D6F3C167D@uiuc.edu>


On Sep 7, 2007, at 2:57 AM, ???????????????? wrote:

> I am a student from China.During my learing the bioperl,I encounter  
> a problem as follows:
>
> I run the program,
>
> use Bio::Perl;
> $seq_object = get_sequence('swissprot',"ROA1_HUMAN");
> write_sequence(">roa1.fasta",'fasta',$seq_object);
>
> But It returns lots of mistake informatiom,

First, always preface problems of this sort with the version of  
BioPerl you are using (there are quite a few versions still being used).

> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: WebDBSeqI Request Error:
> 501 Protocol scheme '' is not supported
> Content-Type: text/plain
> Client-Date: Fri, 07 Sep 2007 07:26:06 GMT
> Client-Warning: Internal response
> 501 Protocol scheme '' is not supported
> STACK: Error::throw
> STACK: Bio::Root::Root::throw D:/perl/site/lib/Bio/Root/Root.pm:359
> STACK: Bio::DB::WebDBSeqI::_request D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm:685
> STACK: Bio::DB::WebDBSeqI::get_seq_stream D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm:4
> 91
> STACK: Bio::DB::WebDBSeqI::get_Stream_by_id D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm
> :275
> STACK: Bio::DB::WebDBSeqI::get_Seq_by_id D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm:14
> 5
> STACK: Bio::Perl::get_sequence D:/perl/site/lib/Bio/Perl.pm:510
> STACK: C:\DOCUME~1\yangmeng\LOCALS~1\Temp\dir13D.tmp\Untitled.pl:6
> -----------------------------------------------------------

This works for me using bioperl from CVS.  There were a few remote  
DbFetch server changes if I recall correctly, so updating from CVS  
may be your best option.

> I don't know the reason of the problem.I have installed the  
> addition perl modules such as bioperl-db,bioperl-network,bioperlgui  
> and almost all "BioPerl Dependencies modules".My network is also  
> OK. It's an annoying promleb to me.
> I have consulted many experts but didn't got a reply. Could you  
> vacuate in your mass business to give me a help?
>
> Thank you!
>
> Best regards!
>
> YangMeng

I think my 'vacuating' is a private matter, let alone doing so in my  
mass business...

http://www.thefreedictionary.com/Vacuate

;>

chris


From cjfields at uiuc.edu  Mon Sep 10 18:04:14 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 10 Sep 2007 17:04:14 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
Message-ID: <3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>

On Sep 7, 2007, at 4:20 AM, Albert Vilella wrote:

>>> He'd need to map his exon boundaries from whatever format he has
>>> into a
>>> GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to
>>> munch on.
>>
>> I use segmented SeqFeatures in my example.  The HOWTO also uses a
>> variation ('graded_segments'):
>>
>> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
>>
>> The subseqfeatures are colored by score.  Feasibly one could hack
>> this so that the exons/introns have a different 'score', thus
>> displaying different colors.
>
>
> The exon boundary could be a vertical line or a triangular tick or
> something. I don't know if there is a consensus on this kind of  
> cartoons.
> Does anybody know how exon boundaries are displayed in different
> browsers/apps?

Don't know.  BTW, apparently there is something being cooked up as an  
alignment browser (among other things) for GBrowse:

https://www.nescent.org/wg_phyloinformatics/ 
PhyloSoC:Phylogenetic_and_Haplotype_Displays_for_GBrowse

Acc. to Lincoln (from his last GBrowse post) there will be a testable  
version within a few weeks or so.  You could always ask more  
questions about it on the GBrowse list.

chris


From lstein at cshl.edu  Mon Sep 10 18:09:41 2007
From: lstein at cshl.edu (Lincoln Stein)
Date: Mon, 10 Sep 2007 18:09:41 -0400
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
Message-ID: <6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>

You can view a simple multiple alignment now. Go to www.wormbase.org, turn
on some of the EST tracks and then zoom down to base pair level.

In bio::graphics, use the "segments" glyph and turn on the -draw_target
option. The features must have DNA attached to them.

What's coming soon is support for MAF format, which provides genome-level
alignments.

Lincoln

On 9/10/07, Chris Fields <cjfields at uiuc.edu> wrote:
>
> On Sep 7, 2007, at 4:20 AM, Albert Vilella wrote:
>
> >>> He'd need to map his exon boundaries from whatever format he has
> >>> into a
> >>> GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to
> >>> munch on.
> >>
> >> I use segmented SeqFeatures in my example.  The HOWTO also uses a
> >> variation ('graded_segments'):
> >>
> >> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
> >>
> >> The subseqfeatures are colored by score.  Feasibly one could hack
> >> this so that the exons/introns have a different 'score', thus
> >> displaying different colors.
> >
> >
> > The exon boundary could be a vertical line or a triangular tick or
> > something. I don't know if there is a consensus on this kind of
> > cartoons.
> > Does anybody know how exon boundaries are displayed in different
> > browsers/apps?
>
> Don't know.  BTW, apparently there is something being cooked up as an
> alignment browser (among other things) for GBrowse:
>
> https://www.nescent.org/wg_phyloinformatics/
> PhyloSoC:Phylogenetic_and_Haplotype_Displays_for_GBrowse
>
> Acc. to Lincoln (from his last GBrowse post) there will be a testable
> version within a few weeks or so.  You could always ask more
> questions about it on the GBrowse list.
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
(516) 367-8380 (voice)
(516) 367-8389 (fax)
FOR URGENT MESSAGES & SCHEDULING,
PLEASE CONTACT MY ASSISTANT,
SANDRA MICHELSEN, AT michelse at cshl.edu


From cjfields at uiuc.edu  Mon Sep 10 23:00:29 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 10 Sep 2007 22:00:29 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
	<6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
Message-ID: <885E5E3B-E2F7-4279-8EE3-FC21AF535D7E@uiuc.edu>

Doesn't that work only for SeqFeature::SimilarityPair and HSP-like  
(paired) alignments, or am I mistaken?

chris

On Sep 10, 2007, at 5:09 PM, Lincoln Stein wrote:

> You can view a simple multiple alignment now. Go to  
> www.wormbase.org, turn
> on some of the EST tracks and then zoom down to base pair level.
>
> In bio::graphics, use the "segments" glyph and turn on the - 
> draw_target
> option. The features must have DNA attached to them.
>
> What's coming soon is support for MAF format, which provides genome- 
> level
> alignments.
>
> Lincoln




From christoph.theunert at web.de  Tue Sep 11 06:37:49 2007
From: christoph.theunert at web.de (Christoph Theunert)
Date: Tue, 11 Sep 2007 03:37:49 -0700 (PDT)
Subject: [Bioperl-l] release of own projects
Message-ID: <12611951.post@talk.nabble.com>


Hi, I am a bioinformatics student from germany and I need your help 

Working with perl and bioperl is pretty new to me - 
currently I am working on a Bioperl project, and I don't know how to release
my project when i am finished with it.

I want to pack my modules so that other users can download it and install it
on their machines.

Do I use the command h2xs as to create cpan modules ( makefiles ...) or what
is the best way to solve my 
problem ?

thanks for help 

Christoph
-- 
View this message in context: http://www.nabble.com/release-of-own-projects-tf4421681.html#a12611951
Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.



From spiros at lokku.com  Tue Sep 11 06:57:14 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 11 Sep 2007 11:57:14 +0100
Subject: [Bioperl-l] release of own projects
In-Reply-To: <12611951.post@talk.nabble.com>
References: <12611951.post@talk.nabble.com>
Message-ID: <bba689ec0709110357o2fb66071w611a8598bef8134e@mail.gmail.com>

Hey,

Yes, IMHO the best way would be to create CPANesque modules that
people are able to download and install. The installation is pretty
straightforward, covers prerequisites  and more advanced features if
needed and as an approach it is widely supported. Also, it gives you
the ability to create and integrate tests seamlessly :)

Check out these URL's on how to do it:

http://search.cpan.org/~nwclark/perl-5.8.8/pod/perlnewmod.pod
http://www.perlmonks.org/?node_id=158999
http://www.perlmonks.org/?node_id=431702

Btw, more friendly and automated tools exist besides h2xs. Be sure to
have a look at:

http://search.cpan.org/perldoc?ExtUtils::ModuleMaker
http://search.cpan.org/perldoc?Module::Starter

Hope this helps,
Spiros

ps. i suggest since its your research work you are going to be handing
out to read a bit on the various software licenses which exist and
which you prefer to license your code under.


On 9/11/07, Christoph Theunert <christoph.theunert at web.de> wrote:
>
> Hi, I am a bioinformatics student from germany and I need your help
>
> Working with perl and bioperl is pretty new to me -
> currently I am working on a Bioperl project, and I don't know how to release
> my project when i am finished with it.
>
> I want to pack my modules so that other users can download it and install it
> on their machines.
>
> Do I use the command h2xs as to create cpan modules ( makefiles ...) or what
> is the best way to solve my
> problem ?
>
> thanks for help
>
> Christoph
> --
> View this message in context: http://www.nabble.com/release-of-own-projects-tf4421681.html#a12611951
> Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From bix at sendu.me.uk  Tue Sep 11 07:12:41 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 11 Sep 2007 12:12:41 +0100
Subject: [Bioperl-l] release of own projects
In-Reply-To: <12611951.post@talk.nabble.com>
References: <12611951.post@talk.nabble.com>
Message-ID: <46E67829.8060303@sendu.me.uk>

Christoph Theunert wrote:
> Hi, I am a bioinformatics student from germany and I need your help 
> 
> Working with perl and bioperl is pretty new to me - 
> currently I am working on a Bioperl project, and I don't know how to release
> my project when i am finished with it.
> 
> I want to pack my modules so that other users can download it and install it
> on their machines.
> 
> Do I use the command h2xs as to create cpan modules ( makefiles ...) or what
> is the best way to solve my 
> problem ?

You can do it however you like. You can just stick the modules in a 
folder, .tar.gz it and offer that to people. You can use h2xs to 
automate certain things. You can use Module::Build.

To make your work available via cpan, see
http://www.cpan.org/modules/04pause.html

If your modules are of general bioinformatic utility you might even 
consider making them a part of bioperl itself.


From jay at jays.net  Tue Sep 11 17:15:17 2007
From: jay at jays.net (Jay Hannah)
Date: Tue, 11 Sep 2007 16:15:17 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
 with exon boundaries
In-Reply-To: <6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>	
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>	
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>	
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>	
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>	
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
	<6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
Message-ID: <46E70565.5040503@jays.net>

Lincoln Stein wrote:
> You can view a simple multiple alignment now. Go to www.wormbase.org 
> <http://www.wormbase.org>, turn on some of the EST tracks and then 
> zoom down to base pair level.
>
> In bio::graphics, use the "segments" glyph and turn on the 
> -draw_target option. The features must have DNA attached to them.

Wow.  *http://tinyurl.com/yuz8bq*   I hadn't seen that done before.

> What's coming soon is support for MAF format, which provides 
> genome-level alignments.

I'm looking forward to trying to wrap my head around that.  :)

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah



From cjfields at uiuc.edu  Tue Sep 11 18:40:55 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 11 Sep 2007 17:40:55 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <46E70565.5040503@jays.net>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>	
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>	
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>	
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>	
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>	
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
	<6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
	<46E70565.5040503@jays.net>
Message-ID: <BC255B1A-EBB6-401B-BCDF-357A653A5972@uiuc.edu>


On Sep 11, 2007, at 4:15 PM, Jay Hannah wrote:

> Lincoln Stein wrote:
>> You can view a simple multiple alignment now. Go to www.wormbase.org
>> <http://www.wormbase.org>, turn on some of the EST tracks and then
>> zoom down to base pair level.
>>
>> In bio::graphics, use the "segments" glyph and turn on the
>> -draw_target option. The features must have DNA attached to them.
>
> Wow.  *http://tinyurl.com/yuz8bq*   I hadn't seen that done before.

There is a section detailing how this is done in the GBrowse tutorial  
(though it uses older GFF):

http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
Browser/docs/tutorial/tutorial.html

>> What's coming soon is support for MAF format, which provides
>> genome-level alignments.
>
> I'm looking forward to trying to wrap my head around that.  :)
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

It's easily parsible, which is nice!

chris


From stephan.roessner at gsf.de  Wed Sep 12 04:44:10 2007
From: stephan.roessner at gsf.de (Stephan Roessner)
Date: Wed, 12 Sep 2007 10:44:10 +0200
Subject: [Bioperl-l] bug in Bio::SearchIO?
Message-ID: <200709121044.11741.stephan.roessner@gsf.de>

Hi,

I am parsing a BlastN output with Bio::SearchIO and getting an error for some 
of the hits when retrieving the start and/or the end position with 
$hit->end('sbjct') , $hit->start('sbjct'). I want to filter for hits which 
are are of equal length (~ > 0.9) to the query sequences. 

SearchIO is retrieving the right results, but throws an exemption, in this 
case: MSG:Undefined sub-sequence (1633,760). Valid range = 693 - 760 .....

It seems to me valid range is parsed incorrectly, isn't it? Is this a bug?

Does anybody have a similar problem?

see code, error, and blastn output below.

thanks,
Stephan


Stephan Roessner
MIPS/IBI Inst. for Bioinformatics
GSF Research Center for Environment and Health
Ingolst?dter Landstr. 1
85764 Neuherberg; Germany
phone: +49 (0)89 3187 3583
fax: ? ? ? +49 (0)89 3187 3585
email: stephan.roessner at gsf.de


Here is the piece of code I am using:

my $blast_report = new Bio::SearchIO ('-format'=>'blast',
                                         '-file' => $source);
  	
while( my $result=$blast_report->next_result) {
		while( my $hit= $result->next_hit()) {
			print "Name: ".$hit->name."\n";
			print "S: ".$hit->start('sbjct')."\n";
			print "E: ".$hit->end('sbjct')."\n";
			print "L: ".$hit->length()."\n";
		}
 	}


Here's the message: 

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Undefined sub-sequence (1633,760). Valid range = 693 - 760
STACK: Error::throw
STACK: 
Bio::Root::Root::throw /usr/lib/perl5/vendor_perl/5.8.8/Bio/Root/Root.pm:359
STACK: 
Bio::Search::HSP::HSPI::matches /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/HSP/HSPI.pm:691
STACK: 
Bio::Search::SearchUtils::_adjust_contigs /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/SearchUtils.pm:489
STACK: 
Bio::Search::SearchUtils::tile_hsps /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/SearchUtils.pm:206
STACK: 
Bio::Search::Hit::GenericHit::start /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/Hit/GenericHit.pm:935
STACK: 
main::parse /home/users/roessner/workspace/GeneSimilarity/similarity_analysis.pl:82
STACK: /home/users/roessner/workspace/GeneSimilarity/similarity_analysis.pl:51
-----------------------------------------------------------

S: 635
E: 790
L: 2052

This is the BLASTN output I am parsing::

>LOC_Os11g37470.1 chr11_pseudomolecule_TIGR r_jap version0
            21623485-21621434 BestGuessTranscript
          Length = 2052

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 106/124 (85%), Gaps = 1/124 (0%)
 Strand = Plus / Plus

                                                                        
Query: 3191 tattaagcataattaatgtatcattagcacatgtagg-ttactgtagcatttaaggctaa 3249
            |||||||| |||||||| | ||||| ||||||||||| |||||||| || ||| ||||||
Sbjct: 635  tattaagcctaattaatctgtcattggcacatgtagggttactgtaacacttatggctaa 694

                                                                        
Query: 3250 tcatagagtaactagacttaaaagactcgtctcgcgattttcaaccaaactgtgtaatta 3309
            |||| || ||| |||||| |||||| || ||||||||||||||  ||||| ||| |||||
Sbjct: 695  tcatggactaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaatta 754

                
Query: 3310 gttt 3313
            ||||
Sbjct: 755  gttt 758



 Score = 48.1 bits (24), Expect = 0.002
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                        
Query: 2253 aaaaactaattacacaatttacctgtacatcgcgagatgaatcttttaagtttagttact 2312
            ||||||||||| |||  ||| | || | ||||||||||||||||||| ||| || ||| |
Sbjct: 760  aaaaactaattgcacggtttgcatgaaaatcgcgagatgaatcttttgagtctatttagt 701

                    
Query: 2313 ccatgatt 2320
            ||||||||
Sbjct: 700  ccatgatt 693



 Score = 44.1 bits (22), Expect = 0.038
 Identities = 76/94 (80%)
 Strand = Plus / Minus

                                                                        
Query: 1539 atgcatgtagtattaaatatagacgaaaataaaaactaattgcacagtttggtcgaaatt 1598
            ||||||| || |||||||||| |  |||  ||||||||||||||| |||||   |||| |
Sbjct: 790  atgcatggagcattaaatataaataaaatgaaaaactaattgcacggtttgcatgaaaat 731

                                              
Query: 1599 gtcgagacgaattttttgagtctagttaggccat 1632
              ||||| |||| ||||||||||| |||| ||||
Sbjct: 730  cgcgagatgaatcttttgagtctatttagtccat 697



 Score = 44.1 bits (22), Expect = 0.038
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 2026 actaactagaattaaaagattcgtctcgtcatttacagacaaactgtgtaattagttttt 2085
            ||||| |||| | ||||||||| |||||  |||| ||  ||||| ||| |||||||||||
Sbjct: 701  actaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaattagttttt 760

                                          
Query: 2086 gttttcgtctatatttaatgcttcatgcat 2115
              |||  | ||||||||||||| |||||||
Sbjct: 761  cattttatttatatttaatgctccatgcat 790







From cjfields at uiuc.edu  Wed Sep 12 10:57:22 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 12 Sep 2007 09:57:22 -0500
Subject: [Bioperl-l] bug in Bio::SearchIO?
In-Reply-To: <200709121044.11741.stephan.roessner@gsf.de>
References: <200709121044.11741.stephan.roessner@gsf.de>
Message-ID: <74CE1BB2-FCEB-43C3-B783-09706C7F55D8@uiuc.edu>

Try updating to bioperl from CVS.  I believe this issue was fixed but  
I don't believe it made the 1.5.2 release.

chris

On Sep 12, 2007, at 3:44 AM, Stephan Roessner wrote:

> Hi,
>
> I am parsing a BlastN output with Bio::SearchIO and getting an  
> error for some
> of the hits when retrieving the start and/or the end position with
> $hit->end('sbjct') , $hit->start('sbjct'). I want to filter for  
> hits which
> are are of equal length (~ > 0.9) to the query sequences.
>
> SearchIO is retrieving the right results, but throws an exemption,  
> in this
> case: MSG:Undefined sub-sequence (1633,760). Valid range = 693 -  
> 760 .....
>
> It seems to me valid range is parsed incorrectly, isn't it? Is this  
> a bug?
>
> Does anybody have a similar problem?
>
> see code, error, and blastn output below.
>
> thanks,
> Stephan
>
>
> Stephan Roessner
> MIPS/IBI Inst. for Bioinformatics
> GSF Research Center for Environment and Health
> Ingolst?dter Landstr. 1
> 85764 Neuherberg; Germany
> phone: +49 (0)89 3187 3583
> fax:       +49 (0)89 3187 3585
> email: stephan.roessner at gsf.de
>
>
> Here is the piece of code I am using:
>
> my $blast_report = new Bio::SearchIO ('-format'=>'blast',
>                                          '-file' => $source);
>   	
> while( my $result=$blast_report->next_result) {
> 		while( my $hit= $result->next_hit()) {
> 			print "Name: ".$hit->name."\n";
> 			print "S: ".$hit->start('sbjct')."\n";
> 			print "E: ".$hit->end('sbjct')."\n";
> 			print "L: ".$hit->length()."\n";
> 		}
>  	}
>
>
> Here's the message:
>
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: Undefined sub-sequence (1633,760). Valid range = 693 - 760
> STACK: Error::throw
> STACK:
> Bio::Root::Root::throw /usr/lib/perl5/vendor_perl/5.8.8/Bio/Root/ 
> Root.pm:359
> STACK:
> Bio::Search::HSP::HSPI::matches /usr/lib/perl5/vendor_perl/5.8.8/ 
> Bio/Search/HSP/HSPI.pm:691
> STACK:
> Bio::Search::SearchUtils::_adjust_contigs /usr/lib/perl5/ 
> vendor_perl/5.8.8/Bio/Search/SearchUtils.pm:489
> STACK:
> Bio::Search::SearchUtils::tile_hsps /usr/lib/perl5/vendor_perl/ 
> 5.8.8/Bio/Search/SearchUtils.pm:206
> STACK:
> Bio::Search::Hit::GenericHit::start /usr/lib/perl5/vendor_perl/ 
> 5.8.8/Bio/Search/Hit/GenericHit.pm:935
> STACK:
> main::parse /home/users/roessner/workspace/GeneSimilarity/ 
> similarity_analysis.pl:82
> STACK: /home/users/roessner/workspace/GeneSimilarity/ 
> similarity_analysis.pl:51
> -----------------------------------------------------------
>
> S: 635
> E: 790
> L: 2052
>
> This is the BLASTN output I am parsing::
>
>> LOC_Os11g37470.1 chr11_pseudomolecule_TIGR r_jap version0
>             21623485-21621434 BestGuessTranscript
>           Length = 2052
>
>  Score = 95.6 bits (48), Expect = 1e-17
>  Identities = 106/124 (85%), Gaps = 1/124 (0%)
>  Strand = Plus / Plus
>
>
> Query: 3191 tattaagcataattaatgtatcattagcacatgtagg- 
> ttactgtagcatttaaggctaa 3249
>             |||||||| |||||||| | ||||| ||||||||||| |||||||| || |||  
> ||||||
> Sbjct: 635   
> tattaagcctaattaatctgtcattggcacatgtagggttactgtaacacttatggctaa 694
>
>
> Query: 3250  
> tcatagagtaactagacttaaaagactcgtctcgcgattttcaaccaaactgtgtaatta 3309
>             |||| || ||| |||||| |||||| || ||||||||||||||  ||||| |||  
> |||||
> Sbjct: 695   
> tcatggactaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaatta 754
>
>
> Query: 3310 gttt 3313
>             ||||
> Sbjct: 755  gttt 758
>
>
>
>  Score = 48.1 bits (24), Expect = 0.002
>  Identities = 57/68 (83%)
>  Strand = Plus / Minus
>
>
> Query: 2253  
> aaaaactaattacacaatttacctgtacatcgcgagatgaatcttttaagtttagttact 2312
>             ||||||||||| |||  ||| | || | ||||||||||||||||||| ||| ||  
> ||| |
> Sbjct: 760   
> aaaaactaattgcacggtttgcatgaaaatcgcgagatgaatcttttgagtctatttagt 701
>
>
> Query: 2313 ccatgatt 2320
>             ||||||||
> Sbjct: 700  ccatgatt 693
>
>
>
>  Score = 44.1 bits (22), Expect = 0.038
>  Identities = 76/94 (80%)
>  Strand = Plus / Minus
>
>
> Query: 1539  
> atgcatgtagtattaaatatagacgaaaataaaaactaattgcacagtttggtcgaaatt 1598
>             ||||||| || |||||||||| |  |||  ||||||||||||||| |||||    
> |||| |
> Sbjct: 790   
> atgcatggagcattaaatataaataaaatgaaaaactaattgcacggtttgcatgaaaat 731
>
>
> Query: 1599 gtcgagacgaattttttgagtctagttaggccat 1632
>               ||||| |||| ||||||||||| |||| ||||
> Sbjct: 730  cgcgagatgaatcttttgagtctatttagtccat 697
>
>
>
>  Score = 44.1 bits (22), Expect = 0.038
>  Identities = 73/90 (81%)
>  Strand = Plus / Plus
>
>
> Query: 2026  
> actaactagaattaaaagattcgtctcgtcatttacagacaaactgtgtaattagttttt 2085
>             ||||| |||| | ||||||||| |||||  |||| ||  ||||| |||  
> |||||||||||
> Sbjct: 701   
> actaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaattagttttt 760
>
>
> Query: 2086 gttttcgtctatatttaatgcttcatgcat 2115
>               |||  | ||||||||||||| |||||||
> Sbjct: 761  cattttatttatatttaatgctccatgcat 790
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign






From n.haigh at sheffield.ac.uk  Wed Sep 12 12:34:26 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Wed, 12 Sep 2007 17:34:26 +0100
Subject: [Bioperl-l] Bio::Graphics transparent background
Message-ID: <46E81512.3090503@sheffield.ac.uk>

Is it possible to set the bg colour of glyphs and the panel background
to be transparent? If so, which output formats support transparency?

Cheers
Nath




From Kevin.M.Brown at asu.edu  Wed Sep 12 14:15:10 2007
From: Kevin.M.Brown at asu.edu (Kevin Brown)
Date: Wed, 12 Sep 2007 11:15:10 -0700
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <46E81512.3090503@sheffield.ac.uk>
References: <46E81512.3090503@sheffield.ac.uk>
Message-ID: <1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>

> Is it possible to set the bg colour of glyphs and the panel 
> background to be transparent? If so, which output formats 
> support transparency?

Not sure if you can, but SVG, PNG, Gif all support a transparent
background.



From bioperl-list at superfrink.net  Thu Sep 13 01:15:39 2007
From: bioperl-list at superfrink.net (bioperl-list at superfrink.net)
Date: Wed, 12 Sep 2007 23:15:39 -0600 (MDT)
Subject: [Bioperl-l]  Bio::Graphics transparent background
Message-ID: <Pine.LNX.4.64.0709122245450.8424@gurchecyrohssnyb.arg>

> Is it possible to set the bg colour of glyphs and the panel background
> to be transparent? If so, which output formats support transparency?

I had a look at the code and I don't believe it is possible.

You could produce a PNG file and knowing the red/green/blue values of the 
background colour run the following script to make an image with the bg 
colour transparent.

For example:
    ./make-transparent.pl 252 253 252 2004-11-22.png

will produce:  2004-11-22.png.new.png
with the RGB colour of (252, 253, 252) replaced with transparency.

Regards,
Chad


#!/usr/bin/perl -w
#
# file: make-transparent.pl
# purpose: make a single colour in a PNG file transparent
# author: chad c d clark
# $Id$

use strict;
use GD;

# -- subroutines -------------------------------------------------------
sub usage_message();


# -- main() ------------------------------------------------------------

if(scalar @ARGV < 4) {
     print usage_message();
     exit 1;
}

# get the colour and make sure it is valid
my @RGB = splice @ARGV, 0, 3;
for my $i (@RGB) {

     if ( ($i !~ /^[\d]+$/) or (255 < $i) ) {
 	print "Invalid colour '$i'.\n";
         print usage_message();
         exit 1;
     }
}
print "RGB: (@RGB)\n";

# process each file
FILE: while (my $filename = shift @ARGV) {

     # read the file
     my $image = GD::Image->new($filename);
     unless(defined $image) {
 	warn "Unable to read image from file.  Skipping '$filename'.\n";
 	next FILE;
     }

     # find the colour index
     my $index = $image->colorExact(@RGB);
     if(-1 == $index) {
 	warn "Colour not found in file.  Skipping '$filename'.\n";
 	next FILE;
     }

     # make the colour index transparent
     if(-1 == $image->transparent($index)) {
 	warn "Unable to make colour transparent.  Skipping '$filename'.\n";
 	next FILE;
     }

     # write the updated image file
     my $new_filename = $filename . ".new.png";
     # my $new_filename = $filename;  # use to over-write existing file
     open FH, ">" . $new_filename or die "can't open $new_filename";
     print FH $image->png;
     close FH;

     print "Found file '$filename'.\tCreated '$new_filename'.\n";
}

exit 0;


# -- subroutines -------------------------------------------------------

sub usage_message() {

return qq/
   Usage: $0 RED GREEN BLUE FILELIST

   Where:
       RED       - red   value in decimal (0 to 255)
       GREEN     - green value in decimal (0 to 255)
       BLUE      - blue  value in decimal (0 to 255)
       FILELIST  - list of files to convert

   Examples:
       $0 255 255 255 2004-11-22.png
       $0 252 253 252 2004-11-22.png second.png
       $0 1   1   200 2004-11-22.png second.png third.png

   Description:
   For each file "foo.png" a new file "foo.png.new.png" will be created (and
   over-written if it existed).  The new file will be the same as the original
   but the colour specified by the RED, GREEN, and BLUE value will be removed
   and replaced by transparent pixels.

/;
}


From n.haigh at sheffield.ac.uk  Thu Sep 13 06:07:46 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Thu, 13 Sep 2007 11:07:46 +0100
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
References: <46E81512.3090503@sheffield.ac.uk>
	<1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
Message-ID: <46E90BF2.5010607@sheffield.ac.uk>

Kevin Brown wrote:
>> Is it possible to set the bg colour of glyphs and the panel 
>> background to be transparent? If so, which output formats 
>> support transparency?
>>     
>
> Not sure if you can, but SVG, PNG, Gif all support a transparent
> background.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>   

Looking at the GD module documentation:
http://search.cpan.org/~lds/GD-2.30/GD.pm

It appears that you can set a colour as being transparent - so I think
it should be possible to get Bio::Graphics to do this = may require some
code to be written. Any one got ideas?

Cheers,
Nath


From n.haigh at sheffield.ac.uk  Thu Sep 13 07:59:20 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Thu, 13 Sep 2007 12:59:20 +0100
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <46E90BF2.5010607@sheffield.ac.uk>
References: <46E81512.3090503@sheffield.ac.uk>	<1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
	<46E90BF2.5010607@sheffield.ac.uk>
Message-ID: <46E92618.7050208@sheffield.ac.uk>

Nathan Haigh wrote:
> Kevin Brown wrote:
>   
>>> Is it possible to set the bg colour of glyphs and the panel 
>>> background to be transparent? If so, which output formats 
>>> support transparency?
>>>     
>>>       
>> Not sure if you can, but SVG, PNG, Gif all support a transparent
>> background.
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>   
>>     
>
> Looking at the GD module documentation:
> http://search.cpan.org/~lds/GD-2.30/GD.pm
>
> It appears that you can set a colour as being transparent - so I think
> it should be possible to get Bio::Graphics to do this = may require some
> code to be written. Any one got ideas?
>
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>   

I took a look and made a simple change to Bio::Graphics::Panel

Please see the following bug for a patch and explanation:
http://bugzilla.open-bio.org/show_bug.cgi?id=2365

I'd appreciate any comments, especially regarding the method name! If
there aren't any complaints I'll commit it later today.

Nath


From n.haigh at sheffield.ac.uk  Thu Sep 13 08:26:57 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Thu, 13 Sep 2007 13:26:57 +0100
Subject: [Bioperl-l] Bio::Graphics Resolution
Message-ID: <46E92C91.5020307@sheffield.ac.uk>

I want to be able to print my Bio::Graphics image on a poster with good
resolution. What can I do to ensure I don't get blocky graphics/text.

Altering the width/height of the panel simple increases the size of the
canvas on which to draw the image, but the text appears the same size
and thus relatively smaller to the rest of the image. So I don't think
this would work for printing on a poster.

Cheers,
Nath


From cjfields at uiuc.edu  Thu Sep 13 08:46:02 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 13 Sep 2007 07:46:02 -0500
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <69321A85-8715-43C0-BCB0-CEE8F42D7235@uiuc.edu>

Print to SVG instead of PNG (should be resolution-independent); I use  
Illustrator to fine-tune it but there are several other programs  
which can do the same.  You'll need to install GD::SVG for it to work.

The alignment example I posted previously about (http:// 
www.bioperl.org/wiki/HOWTO_Discussion:Graphics) shows essentially  
what you need to do:

my $panel = Bio::Graphics::Panel->new(
     -image_class => 'SVG',
     # and whatever else
);

# later...

print $panel->svg;

chris

On Sep 13, 2007, at 7:26 AM, Nathan Haigh wrote:

> I want to be able to print my Bio::Graphics image on a poster with  
> good
> resolution. What can I do to ensure I don't get blocky graphics/text.
>
> Altering the width/height of the panel simple increases the size of  
> the
> canvas on which to draw the image, but the text appears the same size
> and thus relatively smaller to the rest of the image. So I don't think
> this would work for printing on a poster.
>
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From jonathancrabtree at gmail.com  Thu Sep 13 09:09:56 2007
From: jonathancrabtree at gmail.com (Jonathan Crabtree)
Date: Thu, 13 Sep 2007 09:09:56 -0400
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <46E92618.7050208@sheffield.ac.uk>
References: <46E81512.3090503@sheffield.ac.uk>
	<1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
	<46E90BF2.5010607@sheffield.ac.uk> <46E92618.7050208@sheffield.ac.uk>
Message-ID: <8e5b8bf80709130609x4be19cf6y60f2440a1ac5d332@mail.gmail.com>

Hi Nathan-

One problem with your proposed solution is that it won't necessarily work
when GD::SVG is being used instead of GD (i.e., via the image_class method
of Bio::Graphics::Panel).  SVG doesn't handle transparency in the same way
as GD.  At least when you're compositing multiple SVG images/documents,
transparency is the default; if you superimpose one SVG image on another (
e.g., by merging the two into a single SVG document) then the bottom image
will be visible through any area of the top image that has not been drawn
on.  When I'm working in SVG with Bio::Graphics I get a "transparent"
background by simply not setting the bgcolor; this ensures that
Bio::Graphics::Panel will refrain from drawing a filled background rectangle
underneath the drawing area.  What I don't know is how to ensure that the
background is transparent when you're working with the various methods of
embedding SVG in web pages ( i.e., transparent with respect to whatever is
_underneath_ the SVG-rendered content); this is probably a slightly
different issue that's more a question of what the browser/plugin supports.

I'm not sure what to suggest as an alternative, but at the very least this
probably warrants a YMMV comment in the documentation for the new method, or
perhaps it could even throw a runtime error if called when the $gd object is
of type GD::SVG.  A final option would be to say that this (setting a
transparent background) is something that should get handled outside of
Bio::Graphics::Panel; I don't think there's any technical reason why the
calling code couldn't be responsible for this.  I don't think we can modify
your new method to unset the bgcolor when working with GD::SVG, because that
might affect the image in other ways.  I do it in my code but I'm not sure
it's 100% safe, since I think GD::SVG might actually _use_ the bgcolor in
some situations (e.g., drawing dashed lines) and I haven't checked the code
thoroughly to make sure that there are no unintended consequences.

Jonathan

p.s. I see that Chris has beaten me to the punch in mentioning SVG as a fix
to your blocky font problems.  All the more reason to think about how this
feature will work in that context!


On 9/13/07, Nathan Haigh <n.haigh at sheffield.ac.uk > wrote:
>
> Nathan Haigh wrote:
> > Kevin Brown wrote:
> >
> >>> Is it possible to set the bg colour of glyphs and the panel
> >>> background to be transparent? If so, which output formats
> >>> support transparency?
> >>>
> >>>
> >> Not sure if you can, but SVG, PNG, Gif all support a transparent
> >> background.
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>
> >>
> >
> > Looking at the GD module documentation:
> > http://search.cpan.org/~lds/GD-2.30/GD.pm
> <http://search.cpan.org/%7Elds/GD-2.30/GD.pm>
> >
> > It appears that you can set a colour as being transparent - so I think
> > it should be possible to get Bio::Graphics to do this = may require some
> > code to be written. Any one got ideas?
> >
> > Cheers,
> > Nath
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
>
> I took a look and made a simple change to Bio::Graphics::Panel
>
> Please see the following bug for a patch and explanation:
> http://bugzilla.open-bio.org/show_bug.cgi?id=2365
>
> I'd appreciate any comments, especially regarding the method name! If
> there aren't any complaints I'll commit it later today.
>
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From bix at sendu.me.uk  Thu Sep 13 09:03:46 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 13 Sep 2007 14:03:46 +0100
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <46E93532.6030505@sendu.me.uk>

Nathan Haigh wrote:
> I want to be able to print my Bio::Graphics image on a poster with good
> resolution. What can I do to ensure I don't get blocky graphics/text.

Output in SVG, which is a vector format == no blockiness.


From jonathancrabtree at gmail.com  Thu Sep 13 09:20:43 2007
From: jonathancrabtree at gmail.com (Jonathan Crabtree)
Date: Thu, 13 Sep 2007 09:20:43 -0400
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <8e5b8bf80709130620r4a24fe8fi5171539f50735bf3@mail.gmail.com>

Nathan-

As Chris said, you'll want to use GD::SVG instead of GD.  However, you're
still going to have the issue that you raised that the fonts will be
proportionally small with respect to your figure (particularly if you're
printing a large region at poster size.)  From what I remember GD only gives
you a few font sizes to choose from, so even at the largest size you may
still have problems.  I've worked around this in the past by using scripts
to post-process the resulting SVG.  I do a global search and replace to
increase the font sizes (and, in many cases, to adjust the y-offset of the
text accordingly.)  You may also need to tweak the amount of vertical
whitespace in the image (e.g., between adjacent rows of features) to give
yourself space to increase the font size.  The same caveat applies to the
horizontal dimension, since with a larger font you may have collisions
between labels (assuming that the features in your figure are labeled.)  To
fix this you need to trick Bio::Graphics into thinking the feature labels
are longer than they actually are.  I forget whether I did this by padding
the labels with extra whitespace or actually modifying the code that
computes the feature bounding boxes, but something along those lines should
work.  Essentially you have to trick Bio::Graphics into leaving extra
whitespace so that everything looks OK when you bump up the font sizes.
Unfortunately I don't have a generic script that does this; after generating
a couple of posters this way I switched to direct SVG generation to avoid
the constraints imposed by going through GD.

Jonathan


On 9/13/07, Nathan Haigh <n.haigh at sheffield.ac.uk> wrote:
>
> I want to be able to print my Bio::Graphics image on a poster with good
> resolution. What can I do to ensure I don't get blocky graphics/text.
>
> Altering the width/height of the panel simple increases the size of the
> canvas on which to draw the image, but the text appears the same size
> and thus relatively smaller to the rest of the image. So I don't think
> this would work for printing on a poster.
>
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From arareko at campus.iztacala.unam.mx  Thu Sep 13 10:59:31 2007
From: arareko at campus.iztacala.unam.mx (Mauricio Herrera Cuadra)
Date: Thu, 13 Sep 2007 09:59:31 -0500
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <46E95053.8090300@campus.iztacala.unam.mx>

Try saving the output of your Bio::Graphics image as SVG (with the 
desired proportions between text & graphics), then, at the moment of 
printing, set the desired output size (from the SVG file) and everything 
should be scaled accordingly. That can probably work.

Cheers,
Mauricio.

Nathan Haigh wrote:
> I want to be able to print my Bio::Graphics image on a poster with good
> resolution. What can I do to ensure I don't get blocky graphics/text.
> 
> Altering the width/height of the panel simple increases the size of the
> canvas on which to draw the image, but the text appears the same size
> and thus relatively smaller to the rest of the image. So I don't think
> this would work for printing on a poster.
> 
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 

-- 
MAURICIO HERRERA CUADRA
arareko at campus.iztacala.unam.mx
Laboratorio de Gen?tica
Unidad de Morfofisiolog?a y Funci?n
Facultad de Estudios Superiores Iztacala, UNAM



From jay at jays.net  Fri Sep 14 10:27:38 2007
From: jay at jays.net (Jay Hannah)
Date: Fri, 14 Sep 2007 09:27:38 -0500
Subject: [Bioperl-l] [patch] getGenBank.pl
Message-ID: <1088BA7F-009A-482E-B15E-80D4D59218BE@jays.net>

http://cvs.bioperl.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/ 
examples/db/getGenBank.pl

Using this:
my $seqio = $gb->get_Stream_by_batch([ qw( 124430577 )]);

Throws this warning:
$ ./fetch.pl > 124430577.gbk
get_Stream_by_batch() is deprecated; use get_Stream_by_id() instead
STACK Bio::DB::NCBIHelper::__ANON__ /usr/lib/perl5/Bio/DB/ 
NCBIHelper.pm:261
STACK toplevel ./fetch.pl:17


Can someone with commit access please change getGenBank.pl?

24,25c24,25
< # if you want to get a bunch of sequences use the batch method
< my $seqio = $gb->get_Stream_by_batch([ qw(J00522 AF303112 2981014)]);
---
 > # feel free to pull multiple sequences
 > my $seqio = $gb->get_Stream_by_id([ qw(J00522 AF303112 2981014)]);


The tweaked version works fine for me and the warning goes away.

Thanks,

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah




From cjfields at uiuc.edu  Fri Sep 14 12:36:56 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 14 Sep 2007 11:36:56 -0500
Subject: [Bioperl-l] [patch] getGenBank.pl
In-Reply-To: <1088BA7F-009A-482E-B15E-80D4D59218BE@jays.net>
References: <1088BA7F-009A-482E-B15E-80D4D59218BE@jays.net>
Message-ID: <5255407E-F19E-45B6-9F66-3DC1AB25C0AC@uiuc.edu>

Done.  Thanks for the heads up!

chris

On Sep 14, 2007, at 9:27 AM, Jay Hannah wrote:

> http://cvs.bioperl.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/
> examples/db/getGenBank.pl
>
> Using this:
> my $seqio = $gb->get_Stream_by_batch([ qw( 124430577 )]);
>
> Throws this warning:
> $ ./fetch.pl > 124430577.gbk
> get_Stream_by_batch() is deprecated; use get_Stream_by_id() instead
> STACK Bio::DB::NCBIHelper::__ANON__ /usr/lib/perl5/Bio/DB/
> NCBIHelper.pm:261
> STACK toplevel ./fetch.pl:17
>
>
> Can someone with commit access please change getGenBank.pl?
>
> 24,25c24,25
> < # if you want to get a bunch of sequences use the batch method
> < my $seqio = $gb->get_Stream_by_batch([ qw(J00522 AF303112  
> 2981014)]);
> ---
>> # feel free to pull multiple sequences
>> my $seqio = $gb->get_Stream_by_id([ qw(J00522 AF303112 2981014)]);
>
>
> The tweaked version works fine for me and the warning goes away.
>
> Thanks,
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From MEC at stowers-institute.org  Mon Sep 17 16:15:39 2007
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Mon, 17 Sep 2007 15:15:39 -0500
Subject: [Bioperl-l] Bioperl -- why so old? ... or ...
	Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
Message-ID: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>

Sometime ago, in the ensembl-dev mailing list, mdr wrote:

> > I'm always running into bugs in bioperl that have been fixed in more
recent
> > versions than the version 1-2-3 that the installation document
specifies.  
> > 
> > Just wondering, are there plans to try to move to 1-5 any time soon,
or is that
> > not possible for some reason?  Or, by any chance, is Ensembl
actually compatible
> > with 1-5 and it's just a documentation issue?
> 
> "Ewan Birney" replied
> Ensembl doesn't make heavy use of Bioperl anymore - most of the
critical things
> we re-wrote, mainly due to speed/memory issues. I think the short
answer is that
> it _probably_ works with 1.5, but we don't have a strong desire to
move up
> as certainly there are no problems with the 1.2.3 release we are
using.

FWIW, I have just discovered that the round of bioperl changes in
service of http://www.bioperl.org/wiki/Feature_Annotation_rollback
introduce (additional?) incompatibilities between current bioperl and
the Ensembl Core API.  The changes bring me to obtain and use Bioperl
version 1.2.3 for use in conjunction with Ensemble API application (as
is recommended by Ensembl).

Until now, the ways I have used the Ensembl API appear not to have
been effected by changes in Bioperl; I have successfully used it
in conjunction with the bioperl's leading edge.  Of course there may be
other incompatibilities that I have just not noticed yet.

Evidence of the new incompatibility is present in this back trace,
which bridges between code in current bioperl-live and current
ensembl/modules/Bio:

-------------------- EXCEPTION --------------------
MSG: Operator overloading of AnnotationI is deprecated
STACK Bio::Annotation::DBLink::__ANON__
/home/mec/cvs/bioperl-live/Bio/Annotation/DBLink.pm:59
STACK Bio::EnsEMBL::DBSQL::DBEntryAdaptor::_fetch_by_object_type
/home/mec/cvs/foo/ensembl/modules/Bio/EnsEMBL/DBSQL/DBEntryAdaptor.pm:77
8


Obtaining version 1.2.3 fixes the issue for me.  

This is just a warning to others....

Your milage may vary....

--

Malcolm Cook
Stowers Institute for Medical Research - Kansas City, Missouri
 



From cjfields at uiuc.edu  Mon Sep 17 17:52:55 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 17 Sep 2007 16:52:55 -0500
Subject: [Bioperl-l] Bioperl -- why so old? ... or ...
	Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
In-Reply-To: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>
References: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>
Message-ID: <1CAA1977-45AE-4A8F-815C-4C726DB0E6E4@uiuc.edu>

Malcolm,

I have removed the Bio::Annotation overloading exceptions from  
bioperl-live; they're just more trouble than they're worth right  
now.  Could you try it out and see if that suffices, and drop us a  
note if it doesn't or if you run into other odd issues?  I'll be busy  
until the end of the month but I'll do the best I can to help out.

The rollbacks were fairly simple and essentially reversed, corrected,  
or simplified many changes made prior to the 1.5 release (most of  
which were undocumented and not completely implemented).  They pass  
all current tests and should make BioPerl classes (particularly  
Annotations and SeqFeatures) behave more like 1.4.  Beyond the now- 
removed exceptions it should be fine unless it is in an area of  
already-known incompatibility between BioPerl and Ensembl, some of  
which you've already outlined.

chris

On Sep 17, 2007, at 3:15 PM, Cook, Malcolm wrote:

> ...
> FWIW, I have just discovered that the round of bioperl changes in
> service of http://www.bioperl.org/wiki/Feature_Annotation_rollback
> introduce (additional?) incompatibilities between current bioperl and
> the Ensembl Core API.  The changes bring me to obtain and use Bioperl
> version 1.2.3 for use in conjunction with Ensemble API application (as
> is recommended by Ensembl).
>
> Until now, the ways I have used the Ensembl API appear not to have
> been effected by changes in Bioperl; I have successfully used it
> in conjunction with the bioperl's leading edge.  Of course there  
> may be
> other incompatibilities that I have just not noticed yet.
>
> Evidence of the new incompatibility is present in this back trace,
> which bridges between code in current bioperl-live and current
> ensembl/modules/Bio:
>
> -------------------- EXCEPTION --------------------
> MSG: Operator overloading of AnnotationI is deprecated
> STACK Bio::Annotation::DBLink::__ANON__
> /home/mec/cvs/bioperl-live/Bio/Annotation/DBLink.pm:59
> STACK Bio::EnsEMBL::DBSQL::DBEntryAdaptor::_fetch_by_object_type
> /home/mec/cvs/foo/ensembl/modules/Bio/EnsEMBL/DBSQL/ 
> DBEntryAdaptor.pm:77
> 8
>
>
> Obtaining version 1.2.3 fixes the issue for me.
>
> This is just a warning to others....
>
> Your milage may vary....
>
> --
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri




From MEC at stowers-institute.org  Mon Sep 17 18:14:41 2007
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Mon, 17 Sep 2007 17:14:41 -0500
Subject: [Bioperl-l] Bioperl -- why so old? ... or ...
	Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
In-Reply-To: <1CAA1977-45AE-4A8F-815C-4C726DB0E6E4@uiuc.edu>
References: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>
	<1CAA1977-45AE-4A8F-815C-4C726DB0E6E4@uiuc.edu>
Message-ID: <CED81D34E37D5043A1211565277A51E509514EB3@exchkc02.stowers-institute.org>

Chris,

Removing those exceptions makes my application work with current
bioperl-live again.  Hooray!  Thanks.

But!  I have been warned!

Regards,

Malcolm Cook
Stowers Institute for Medical Research - Kansas City, Missouri
  

> -----Original Message-----
> From: Chris Fields [mailto:cjfields at uiuc.edu] 
> Sent: Monday, September 17, 2007 4:53 PM
> To: Cook, Malcolm
> Cc: bioperl list; ensembl-dev at ebi.ac.uk
> Subject: Re: [Bioperl-l] Bioperl -- why so old? ... or ... 
> Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
> 
> Malcolm,
> 
> I have removed the Bio::Annotation overloading exceptions 
> from bioperl-live; they're just more trouble than they're 
> worth right now.  Could you try it out and see if that 
> suffices, and drop us a note if it doesn't or if you run into 
> other odd issues?  I'll be busy until the end of the month 
> but I'll do the best I can to help out.
> 
> The rollbacks were fairly simple and essentially reversed, 
> corrected, or simplified many changes made prior to the 1.5 
> release (most of which were undocumented and not completely 
> implemented).  They pass all current tests and should make 
> BioPerl classes (particularly Annotations and SeqFeatures) 
> behave more like 1.4.  Beyond the now- removed exceptions it 
> should be fine unless it is in an area of already-known 
> incompatibility between BioPerl and Ensembl, some of which 
> you've already outlined.
> 
> chris
> 
> On Sep 17, 2007, at 3:15 PM, Cook, Malcolm wrote:
> 
> > ...
> > FWIW, I have just discovered that the round of bioperl changes in 
> > service of http://www.bioperl.org/wiki/Feature_Annotation_rollback
> > introduce (additional?) incompatibilities between current 
> bioperl and 
> > the Ensembl Core API.  The changes bring me to obtain and 
> use Bioperl 
> > version 1.2.3 for use in conjunction with Ensemble API 
> application (as 
> > is recommended by Ensembl).
> >
> > Until now, the ways I have used the Ensembl API appear not to have 
> > been effected by changes in Bioperl; I have successfully used it in 
> > conjunction with the bioperl's leading edge.  Of course 
> there may be 
> > other incompatibilities that I have just not noticed yet.
> >
> > Evidence of the new incompatibility is present in this back trace, 
> > which bridges between code in current bioperl-live and current
> > ensembl/modules/Bio:
> >
> > -------------------- EXCEPTION --------------------
> > MSG: Operator overloading of AnnotationI is deprecated STACK 
> > Bio::Annotation::DBLink::__ANON__
> > /home/mec/cvs/bioperl-live/Bio/Annotation/DBLink.pm:59
> > STACK Bio::EnsEMBL::DBSQL::DBEntryAdaptor::_fetch_by_object_type
> > /home/mec/cvs/foo/ensembl/modules/Bio/EnsEMBL/DBSQL/
> > DBEntryAdaptor.pm:77
> > 8
> >
> >
> > Obtaining version 1.2.3 fixes the issue for me.
> >
> > This is just a warning to others....
> >
> > Your milage may vary....
> >
> > --
> >
> > Malcolm Cook
> > Stowers Institute for Medical Research - Kansas City, Missouri
> 
> 
> 



From neetisomaiya at gmail.com  Tue Sep 18 06:30:34 2007
From: neetisomaiya at gmail.com (neeti somaiya)
Date: Tue, 18 Sep 2007 16:00:34 +0530
Subject: [Bioperl-l] A perl regex query
Message-ID: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>

Hi,

This isnt really a bioperl query.
But does anyone know how I can substitute all special characters (+ some
other things) in a string with nothing in perl?
I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.

-- 
-Neeti
Even my blood says, B positive


From spiros at lokku.com  Tue Sep 18 06:57:18 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 18 Sep 2007 11:57:18 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
Message-ID: <bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>

Heya, seperate the items you want to remove by a pipe and add the g
regex flag. For example:

spiros$ echo Cyclic-2,3-bisphospho-D-glycerate | perl -ne ' $_ =~
s at -D-|Cyclic\-@@g ; print $_ ;'
2,3-bisphosphoglycerate

IMHO this is ugly. Best to make an array of all the elements you want
to remove and then iterate through the array, calling the regex each
time with a different element. This way it will be much more easy to
read, debug and maintain.

For example

my $ra_bad_terms = [  '-D-', 'Cyclic-' ] ;

foreach (@$ra_bad_terms) {
   $string =~ s@$_@@g ;
}

etc.

Dont forget escaping and \Q \E if needed.

Spiros



On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
> Hi,
>
> This isnt really a bioperl query.
> But does anyone know how I can substitute all special characters (+ some
> other things) in a string with nothing in perl?
> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
>
> --
> -Neeti
> Even my blood says, B positive
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From n.haigh at sheffield.ac.uk  Tue Sep 18 07:44:14 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Tue, 18 Sep 2007 12:44:14 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
Message-ID: <46EFBA0E.4030104@sheffield.ac.uk>

An even better way is to use the array as Spiros suggested, but you
should then be able to use that in the regex like this:

my @ra_bad_terms = (  '-D-', 'Cyclic-' );
$string =~ s/@ra_bad_terms//g;

Again you might need escaping with \Q and \E - can't remember off hand.

You might also want to look here:
http://www.perl.com/pub/a/2002/06/04/apo5.html?page=15

Cheers
Nath



Spiros Denaxas wrote:
> Heya, seperate the items you want to remove by a pipe and add the g
> regex flag. For example:
>
> spiros$ echo Cyclic-2,3-bisphospho-D-glycerate | perl -ne ' $_ =~
> s at -D-|Cyclic\-@@g ; print $_ ;'
> 2,3-bisphosphoglycerate
>
> IMHO this is ugly. Best to make an array of all the elements you want
> to remove and then iterate through the array, calling the regex each
> time with a different element. This way it will be much more easy to
> read, debug and maintain.
>
> For example
>
> my $ra_bad_terms = [  '-D-', 'Cyclic-' ] ;
>
> foreach (@$ra_bad_terms) {
>    $string =~ s@$_@@g ;
> }
>
> etc.
>
> Dont forget escaping and \Q \E if needed.
>
> Spiros
>
>
>
> On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
>   
>> Hi,
>>
>> This isnt really a bioperl query.
>> But does anyone know how I can substitute all special characters (+ some
>> other things) in a string with nothing in perl?
>> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
>> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
>>
>> --
>> -Neeti
>> Even my blood says, B positive
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>     
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>   



From neetisomaiya at gmail.com  Tue Sep 18 08:13:42 2007
From: neetisomaiya at gmail.com (neeti somaiya)
Date: Tue, 18 Sep 2007 17:43:42 +0530
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFBE8A.6080402@cam.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
Message-ID: <764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>

Thanks.
It might work, but not always, because the string could be somthing like
Cyclic-2,3-Bisphospho-D-Glycerate.
Here I will first convert the full thing to a lower case and would then try
to get what I want.

Nothing seems to work, when I try to substitute -D- with nothing, "D" and
"-" when occuring separately also get substituted with nothing.

On 9/18/07, Roy Chaudhuri <rrc22 at cam.ac.uk> wrote:
>
> > This isnt really a bioperl query.
> > But does anyone know how I can substitute all special characters (+ some
> > other things) in a string with nothing in perl?
> > I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I
> want
> > ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
> >
>
> A more general approach that might work is to keep lower case words (I
> don't know if that will be true for all your cases):
>
> $_='Cyclic-2,3-bisphospho-D-glycerate';
> print join '', /\b[a-z]+\b/g;
>
> Roy.
> --
> Dr. Roy Chaudhuri
> Department of Veterinary Medicine
> University of Cambridge, U.K.
>



-- 
-Neeti
Even my blood says, B positive


From ak at ebi.ac.uk  Tue Sep 18 08:20:32 2007
From: ak at ebi.ac.uk (Andreas Kahari)
Date: Tue, 18 Sep 2007 13:20:32 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
Message-ID: <20070918122032.GV14066@ebi.ac.uk>

On Tue, Sep 18, 2007 at 04:00:34PM +0530, neeti somaiya wrote:
> Hi,
> 
> This isnt really a bioperl query.
> But does anyone know how I can substitute all special characters (+ some
> other things) in a string with nothing in perl?
> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.

This is in additions to the suggestions you've already had.

If you always want to concatenate the 3rd and 5th part of the string, as
delimited by dashes, then you could do this:

  my $string = 'Cyclic-2,3-bisphospho-D-glycerate';
  my $newstring = join( '', ( split( /-/, $string ) )[ 2, 4 ] );


Cheers,
Andreas

-- 
Andreas K?h?ri :: Ensembl Software Developer
European Bioinformatics Institute (EMBL-EBI)
--------------------------------------------


From spiros at lokku.com  Tue Sep 18 08:23:49 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 18 Sep 2007 13:23:49 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
Message-ID: <bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>

Its not impossibe, you just have to use \b to denote the word boundaries :)

echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'

this-is-a_teststring-D

It only gets rid of -D- , all other occurrences of D and - remain intact.

Spiros


On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
> Thanks.
> It might work, but not always, because the string could be somthing like
> Cyclic-2,3-Bisphospho-D-Glycerate.
> Here I will first convert the full thing to a lower case and would then try
> to get what I want.
>
> Nothing seems to work, when I try to substitute -D- with nothing, "D" and
> "-" when occuring separately also get substituted with nothing.
>
> On 9/18/07, Roy Chaudhuri <rrc22 at cam.ac.uk> wrote:
> >
> > > This isnt really a bioperl query.
> > > But does anyone know how I can substitute all special characters (+ some
> > > other things) in a string with nothing in perl?
> > > I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I
> > want
> > > ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
> > >
> >
> > A more general approach that might work is to keep lower case words (I
> > don't know if that will be true for all your cases):
> >
> > $_='Cyclic-2,3-bisphospho-D-glycerate';
> > print join '', /\b[a-z]+\b/g;
> >
> > Roy.
> > --
> > Dr. Roy Chaudhuri
> > Department of Veterinary Medicine
> > University of Cambridge, U.K.
> >
>
>
>
> --
> -Neeti
> Even my blood says, B positive
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From rrc22 at cam.ac.uk  Tue Sep 18 08:03:22 2007
From: rrc22 at cam.ac.uk (Roy Chaudhuri)
Date: Tue, 18 Sep 2007 13:03:22 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
Message-ID: <46EFBE8A.6080402@cam.ac.uk>

> This isnt really a bioperl query.
> But does anyone know how I can substitute all special characters (+ some
> other things) in a string with nothing in perl?
> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
> 

A more general approach that might work is to keep lower case words (I 
don't know if that will be true for all your cases):

$_='Cyclic-2,3-bisphospho-D-glycerate';
print join '', /\b[a-z]+\b/g;

Roy.
--
Dr. Roy Chaudhuri
Department of Veterinary Medicine
University of Cambridge, U.K.


From neetisomaiya at gmail.com  Tue Sep 18 08:47:18 2007
From: neetisomaiya at gmail.com (neeti somaiya)
Date: Tue, 18 Sep 2007 18:17:18 +0530
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
Message-ID: <764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>

My actual problem is a bit more complicated.
It is not just one string, nut lakhs of them, they are actually names of
chemical compounds.

THe problem is there are 2 different data sources, I need to match the
compond names between them, but the problem is though the compound may be
the same in the two, they use different naming formats for them.

eg 1 : Glucose
DB1 : D-glucose
DB2 : alpha-D-Glucose

eg2 : 2,3-bisphosphoglycerate
DB1 : Cyclic-2,3-bisphospho-D-Glycerate
DB2 : 2,3 bisphoshpglycerate

And there are some simple examples, there are even more complicated ones,
with many digits, alhas, betas, hyphens, S, R, cis, trans etc etc.

I just want to see if the basic compond is the same, i.e. the first one will
be glucose and second one will be 2,3-biphosphoglycerate (can't take just
bisphosphoglycerate because 1,3-bisphosphoglycerate would mean something
else).

Anyone has any suggestions how to tackle this?

Thanks.

On 9/18/07, Spiros Denaxas <spiros at lokku.com> wrote:
>
> Its not impossibe, you just have to use \b to denote the word boundaries
> :)
>
> echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'
>
> this-is-a_teststring-D
>
> It only gets rid of -D- , all other occurrences of D and - remain intact.
>
> Spiros
>
>
> On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
> > Thanks.
> > It might work, but not always, because the string could be somthing like
> > Cyclic-2,3-Bisphospho-D-Glycerate.
> > Here I will first convert the full thing to a lower case and would then
> try
> > to get what I want.
> >
> > Nothing seems to work, when I try to substitute -D- with nothing, "D"
> and
> > "-" when occuring separately also get substituted with nothing.
> >
> > On 9/18/07, Roy Chaudhuri <rrc22 at cam.ac.uk> wrote:
> > >
> > > > This isnt really a bioperl query.
> > > > But does anyone know how I can substitute all special characters (+
> some
> > > > other things) in a string with nothing in perl?
> > > > I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and
> I
> > > want
> > > > ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3-
> etc.
> > > >
> > >
> > > A more general approach that might work is to keep lower case words (I
> > > don't know if that will be true for all your cases):
> > >
> > > $_='Cyclic-2,3-bisphospho-D-glycerate';
> > > print join '', /\b[a-z]+\b/g;
> > >
> > > Roy.
> > > --
> > > Dr. Roy Chaudhuri
> > > Department of Veterinary Medicine
> > > University of Cambridge, U.K.
> > >
> >
> >
> >
> > --
> > -Neeti
> > Even my blood says, B positive
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
>



-- 
-Neeti
Even my blood says, B positive


From spiros at lokku.com  Tue Sep 18 08:56:44 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 18 Sep 2007 13:56:44 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFCA4E.5090605@sendu.me.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<46EFCA4E.5090605@sendu.me.uk>
Message-ID: <bba689ec0709180556q5f23e8a7ub50302891e0c3849@mail.gmail.com>

On 9/18/07, Sendu Bala <bix at sendu.me.uk> wrote:
> Spiros Denaxas wrote:
> > Its not impossibe, you just have to use \b to denote the word boundaries :)
> >
> > echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'
> >
> > this-is-a_teststring-D
> >
> > It only gets rid of -D- , all other occurrences of D and - remain intact.
>
> I'm confused. The simpler:
>
> echo 'this-is-a_test-D-string-D' | perl -ne ' s/-D-//g ; print ;'
>
> gives the same answer. You'd have to something very strange for a regex
> on -D- to match D or - alone.
>

Its the same thing. He was just mixing up character classes in the regex.

Spiros


From bix at sendu.me.uk  Tue Sep 18 08:53:34 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 18 Sep 2007 13:53:34 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<46EFBE8A.6080402@cam.ac.uk>	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
Message-ID: <46EFCA4E.5090605@sendu.me.uk>

Spiros Denaxas wrote:
> Its not impossibe, you just have to use \b to denote the word boundaries :)
> 
> echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'
> 
> this-is-a_teststring-D
> 
> It only gets rid of -D- , all other occurrences of D and - remain intact.

I'm confused. The simpler:

echo 'this-is-a_test-D-string-D' | perl -ne ' s/-D-//g ; print ;'

gives the same answer. You'd have to something very strange for a regex 
on -D- to match D or - alone.


From rrc22 at cam.ac.uk  Tue Sep 18 09:26:47 2007
From: rrc22 at cam.ac.uk (Roy Chaudhuri)
Date: Tue, 18 Sep 2007 14:26:47 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	
	<46EFBE8A.6080402@cam.ac.uk>	
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>	
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
Message-ID: <46EFD217.1030103@cam.ac.uk>

> My actual problem is a bit more complicated.
> It is not just one string, nut lakhs of them, they are actually names of 
> chemical compounds.
> 
> THe problem is there are 2 different data sources, I need to match the 
> compond names between them, but the problem is though the compound may 
> be the same in the two, they use different naming formats for them.

Unless you can define in simple and precise terms exactly which parts of 
the string you need then there is no way that you will be able to code a 
solution in Perl.

Maybe you could look for a database that contains the synonyms for each 
molecule? A quick Google finds ChEBI (http://www.ebi.ac.uk/chebi), which 
is available to download as flat files.

Roy.
--
Dr. Roy Chaudhuri
Department of Veterinary Medicine
University of Cambridge, U.K.


From js5 at sanger.ac.uk  Tue Sep 18 08:58:36 2007
From: js5 at sanger.ac.uk (James Smith)
Date: Tue, 18 Sep 2007 13:58:36 +0100 (BST)
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <20070918122032.GV14066@ebi.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<20070918122032.GV14066@ebi.ac.uk>
Message-ID: <Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>


Neeti,

This isn't really a bioperl query - but I will try and explain a simple
solution...

warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );

sub simplify {
   local $_ = "-$_[0]-";
         ## Quick hack add -'s at start and end! as always match "-string-"
   s/-(
     Cyclic | # The prefix "cyclic"
     \d+    | # a single number between two "-"s
     \d+,\d+| # number,number between two "-"s
     \w       # a single letter between two "-"s
   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
         ## 0-width +ve lookahead assertion - so can match
         ## multiple consecutive -x- constructions in same regexp!
   s/-//g;
         ## remove remaining "-"s from string...
}

Not sure what other test strings you may want - but most should be able to
fit in the () brackets in the first regexp of simplify

James

On Tue, 18 Sep 2007, Andreas Kahari wrote:

> On Tue, Sep 18, 2007 at 04:00:34PM +0530, neeti somaiya wrote:
>> Hi,
>>
>> This isnt really a bioperl query.
>> But does anyone know how I can substitute all special characters (+ some
>> other things) in a string with nothing in perl?
>> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
>> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
>
> This is in additions to the suggestions you've already had.
>
> If you always want to concatenate the 3rd and 5th part of the string, as
> delimited by dashes, then you could do this:
>
>  my $string = 'Cyclic-2,3-bisphospho-D-glycerate';
>  my $newstring = join( '', ( split( /-/, $string ) )[ 2, 4 ] );
>
>
> Cheers,
> Andreas
>
> -- 
> Andreas K?h?ri :: Ensembl Software Developer
> European Bioinformatics Institute (EMBL-EBI)
> --------------------------------------------
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 


From stefan.kirov at bms.com  Tue Sep 18 09:05:16 2007
From: stefan.kirov at bms.com (Stefan Kirov)
Date: Tue, 18 Sep 2007 09:05:16 -0400
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
Message-ID: <46EFCD0C.3010306@bms.com>

neeti somaiya wrote:
> My actual problem is a bit more complicated.
> It is not just one string, nut lakhs of them, they are actually names of
> chemical compounds.
>
> THe problem is there are 2 different data sources, I need to match the
> compond names between them, but the problem is though the compound may be
> the same in the two, they use different naming formats for them.
>
> eg 1 : Glucose
> DB1 : D-glucose
> DB2 : alpha-D-Glucose
>
> eg2 : 2,3-bisphosphoglycerate
> DB1 : Cyclic-2,3-bisphospho-D-Glycerate
> DB2 : 2,3 bisphoshpglycerate
>   
It seems to me you are trying to match 2 collections of chemical
compounds. If you need to do this reliably you need to use canonical
smiles (perhaps there are other solutions but I am not aware of them).
There are many resources for that, including open-source:
http://openbabel.sourceforge.net/wiki/Main_Page
It is not really bioperl's cup of tea, this is much more a
chemi-informatics problem. I am not sure if there is a need for bioperl
to be extended this way- any thoughts on that?
Hope this helps, regards
Stefan
> And there are some simple examples, there are even more complicated ones,
> with many digits, alhas, betas, hyphens, S, R, cis, trans etc etc.
>
> I just want to see if the basic compond is the same, i.e. the first one will
> be glucose and second one will be 2,3-biphosphoglycerate (can't take just
> bisphosphoglycerate because 1,3-bisphosphoglycerate would mean something
> else).
>
> Anyone has any suggestions how to tackle this?
>
> Thanks.
>
> On 9/18/07, Spiros Denaxas <spiros at lokku.com> wrote:
>   
>> Its not impossibe, you just have to use \b to denote the word boundaries
>> :)
>>
>> echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'
>>
>> this-is-a_teststring-D
>>
>> It only gets rid of -D- , all other occurrences of D and - remain intact.
>>
>> Spiros
>>
>>
>> On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
>>     
>>> Thanks.
>>> It might work, but not always, because the string could be somthing like
>>> Cyclic-2,3-Bisphospho-D-Glycerate.
>>> Here I will first convert the full thing to a lower case and would then
>>>       
>> try
>>     
>>> to get what I want.
>>>
>>> Nothing seems to work, when I try to substitute -D- with nothing, "D"
>>>       
>> and
>>     
>>> "-" when occuring separately also get substituted with nothing.
>>>
>>> On 9/18/07, Roy Chaudhuri <rrc22 at cam.ac.uk> wrote:
>>>       
>>>>> This isnt really a bioperl query.
>>>>> But does anyone know how I can substitute all special characters (+
>>>>>           
>> some
>>     
>>>>> other things) in a string with nothing in perl?
>>>>> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and
>>>>>           
>> I
>>     
>>>> want
>>>>         
>>>>> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3-
>>>>>           
>> etc.
>>     
>>>> A more general approach that might work is to keep lower case words (I
>>>> don't know if that will be true for all your cases):
>>>>
>>>> $_='Cyclic-2,3-bisphospho-D-glycerate';
>>>> print join '', /\b[a-z]+\b/g;
>>>>
>>>> Roy.
>>>> --
>>>> Dr. Roy Chaudhuri
>>>> Department of Veterinary Medicine
>>>> University of Cambridge, U.K.
>>>>
>>>>         
>>>
>>> --
>>> -Neeti
>>> Even my blood says, B positive
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>       
>
>
>
>   



From stephane.teletchea at jouy.inra.fr  Tue Sep 18 09:48:05 2007
From: stephane.teletchea at jouy.inra.fr (=?ISO-8859-1?Q?St=E9phane_T=E9letch=E9a?=)
Date: Tue, 18 Sep 2007 15:48:05 +0200
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<46EFBE8A.6080402@cam.ac.uk>	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
Message-ID: <46EFD715.4060308@jouy.inra.fr>

neeti somaiya a ?crit :
> My actual problem is a bit more complicated.
> It is not just one string, nut lakhs of them, they are actually names of
> chemical compounds.
> 
> THe problem is there are 2 different data sources, I need to match the
> compond names between them, but the problem is though the compound may be
> the same in the two, they use different naming formats for them.
> 
> eg 1 : Glucose
> DB1 : D-glucose
> DB2 : alpha-D-Glucose
> 
> eg2 : 2,3-bisphosphoglycerate
> DB1 : Cyclic-2,3-bisphospho-D-Glycerate
> DB2 : 2,3 bisphoshpglycerate
> 
> And there are some simple examples, there are even more complicated ones,
> with many digits, alhas, betas, hyphens, S, R, cis, trans etc etc.
> 
> I just want to see if the basic compond is the same, i.e. the first one will
> be glucose and second one will be 2,3-biphosphoglycerate (can't take just
> bisphosphoglycerate because 1,3-bisphosphoglycerate would mean something
> else).
> 
> Anyone has any suggestions how to tackle this?
> 

I would use a two step approach :
1 - filter the entries, use a convention, for instance translata all '+' 
into their 'plus' literal equivalent, change spaces by '_', change all 
'-' for '_' also, etc
2 - try matching the result, if the match does not work, try to match 
some characters (for instance, try to remove all non alphabetical 
characters and see if the resulting produces a match).

That's theory, now, you have some time for errors and trials, but i 
think there is not essay, one shot solution, neither a bioperl facility 
for handling (bio)chemical compounds.

Cheers,
St?phane

-- 
St?phane T?letch?a, PhD.                  http://www.steletch.org
Unit? Math?matique Informatique et G?nome http://migale.jouy.inra.fr/mig
INRA, Domaine de Vilvert                  T?l : (33) 134 652 891
78352 Jouy-en-Josas cedex, France         Fax : (33) 134 652 901


From puetz at mpipsykl.mpg.de  Tue Sep 18 10:12:47 2007
From: puetz at mpipsykl.mpg.de (Benno Puetz)
Date: Tue, 18 Sep 2007 16:12:47 +0200
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<20070918122032.GV14066@ebi.ac.uk>
	<Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
Message-ID: <46EFDCDF.6030309@mpipsykl.mpg.de>

James Smith wrote:
>
> Neeti,
>
> This isn't really a bioperl query - but I will try and explain a simple
> solution...
>
> warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );
>
> sub simplify {
>   local $_ = "-$_[0]-";
>         ## Quick hack add -'s at start and end! as always match 
> "-string-"
>   s/-(
>     Cyclic | # The prefix "cyclic"
>     \d+    | # a single number between two "-"s
>     \d+,\d+| # number,number between two "-"s
>     \w       # a single letter between two "-"s
>   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
>         ## 0-width +ve lookahead assertion - so can match
>         ## multiple consecutive -x- constructions in same regexp!
>   s/-//g;
>         ## remove remaining "-"s from string...
> }
>
> Not sure what other test strings you may want - but most should be 
> able to
> fit in the () brackets in the first regexp of simplify
>
> James
Along the same line

# some test for most of the removals below
my $string = "Alpha-Cyclic-2,3-bi-sphos-1,2,5-pho-D-beta-glycerate";
my @ra_bad_terms = (  '-?(D|R|S)-',
                      '-?([aA]lpha|[bB]eta|[gG]amma)-',
                      '-?([cC]is|[tT]rans)-',
                      '-?[cC]yclic-',
                    # '-?\d+(,\d+)+-',   # uncomment to remove numbers, too
                      '(?<!\d)-' );          # '-' following number
print "$string\n";
foreach ( @ra_bad_terms ){

  eval { $string =~ s/$_//g; };
  print "$_:$string\n";   # for feedback only
}
#$string =~ s/<@ra_bad_terms>//g;

print lc($string),"\n";


-- 
Benno P?tz
Statistische Genetik
Max-Planck-Institut f. Psychiatrie            Tel.: +49-89-30622-222
Kraepelinstr. 10                              Fax : +49-89-30622-601
80804 M?nchen, Germany



From spiros at lokku.com  Tue Sep 18 10:41:20 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 18 Sep 2007 15:41:20 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFDCDF.6030309@mpipsykl.mpg.de>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<20070918122032.GV14066@ebi.ac.uk>
	<Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
	<46EFDCDF.6030309@mpipsykl.mpg.de>
Message-ID: <bba689ec0709180741s13b358e3l1b326a47700259a6@mail.gmail.com>

On 9/18/07, Benno Puetz <puetz at mpipsykl.mpg.de> wrote:
> James Smith wrote:
> >
> > Neeti,
> >
> > This isn't really a bioperl query - but I will try and explain a simple
> > solution...
> >
> > warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );
> >
> > sub simplify {
> >   local $_ = "-$_[0]-";
> >         ## Quick hack add -'s at start and end! as always match
> > "-string-"
> >   s/-(
> >     Cyclic | # The prefix "cyclic"
> >     \d+    | # a single number between two "-"s
> >     \d+,\d+| # number,number between two "-"s
> >     \w       # a single letter between two "-"s
> >   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
> >         ## 0-width +ve lookahead assertion - so can match
> >         ## multiple consecutive -x- constructions in same regexp!
> >   s/-//g;
> >         ## remove remaining "-"s from string...
> > }
> >
> > Not sure what other test strings you may want - but most should be
> > able to
> > fit in the () brackets in the first regexp of simplify
> >
> > James
> Along the same line
>
> # some test for most of the removals below
> my $string = "Alpha-Cyclic-2,3-bi-sphos-1,2,5-pho-D-beta-glycerate";
> my @ra_bad_terms = (  '-?(D|R|S)-',
>                       '-?([aA]lpha|[bB]eta|[gG]amma)-',
>                       '-?([cC]is|[tT]rans)-',
>                       '-?[cC]yclic-',
>                     # '-?\d+(,\d+)+-',   # uncomment to remove numbers, too
>                       '(?<!\d)-' );          # '-' following number
> print "$string\n";
> foreach ( @ra_bad_terms ){
>
>   eval { $string =~ s/$_//g; };
>   print "$_:$string\n";   # for feedback only
> }
> #$string =~ s/<@ra_bad_terms>//g;
>
> print lc($string),"\n";
>
>
> --
> Benno P?tz

My humble opinion would be to avoid using regular expressions to do
your task and try and locate a more valid and centralized information
repository to use, be it a database of synonyms or some other indexing
code. This will add the required domain knowledge in your solution.
Using regular expressions will almost certainly lead to problems and
bugs which will be very hard to resolve.
Should you decide to go forward and treat everything simply as strings
and compare them, I feel this is more of an NLP problem.

Spiros



From cjfields at uiuc.edu  Tue Sep 18 11:24:52 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 10:24:52 -0500
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFD217.1030103@cam.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	
	<46EFBE8A.6080402@cam.ac.uk>	
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>	
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
	<46EFD217.1030103@cam.ac.uk>
Message-ID: <155C67C0-1F81-4A1C-AD68-A21B4E6918C9@uiuc.edu>


On Sep 18, 2007, at 8:26 AM, Roy Chaudhuri wrote:

>> My actual problem is a bit more complicated.
>> It is not just one string, nut lakhs of them, they are actually  
>> names of
>> chemical compounds.
>>
>> THe problem is there are 2 different data sources, I need to match  
>> the
>> compond names between them, but the problem is though the compound  
>> may
>> be the same in the two, they use different naming formats for them.
>
> Unless you can define in simple and precise terms exactly which  
> parts of
> the string you need then there is no way that you will be able to  
> code a
> solution in Perl.
>
> Maybe you could look for a database that contains the synonyms for  
> each
> molecule? A quick Google finds ChEBI (http://www.ebi.ac.uk/chebi),  
> which
> is available to download as flat files.
>
> Roy.
> --
> Dr. Roy Chaudhuri
> Department of Veterinary Medicine
> University of Cambridge, U.K.

D'oh!  Roy beat me to it; that's what I was going to suggest.  I  
agree; don't trust simple word munging to always get you the correct  
answer in this case, it's just too complicated to try and catch every  
case.

ChEBI is a good choice; Stefan's suggestion of OpenBabel is also a  
good one.  I would also try not to reinvent the wheel; there may be  
some modules available via CPAN which do what you need, such as these:

http://search.cpan.org/search?query=chem&mode=module

or this:

http://search.cpan.org/~ghutchis/Chemistry-OpenBabel-1.2.0/

chris


From shameer at ncbs.res.in  Tue Sep 18 10:57:55 2007
From: shameer at ncbs.res.in (Shameer Khadar)
Date: Tue, 18 Sep 2007 20:27:55 +0530 (IST)
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFDCDF.6030309@mpipsykl.mpg.de>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<20070918122032.GV14066@ebi.ac.uk>
	<Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
	<46EFDCDF.6030309@mpipsykl.mpg.de>
Message-ID: <53713.192.168.1.1.1190127475.squirrel@mail.ncbs.res.in>

I used this module for my simple chemoinformatics tasks,

http://www.perlmol.org/ - PerlMol - Perl Modules for Molecular Chemistry
Please explore, you may find something useful.

-- 



> James Smith wrote:
>>
>> Neeti,
>>
>> This isn't really a bioperl query - but I will try and explain a simple
>> solution...
>>
>> warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );
>>
>> sub simplify {
>>   local $_ = "-$_[0]-";
>>         ## Quick hack add -'s at start and end! as always match
>> "-string-"
>>   s/-(
>>     Cyclic | # The prefix "cyclic"
>>     \d+    | # a single number between two "-"s
>>     \d+,\d+| # number,number between two "-"s
>>     \w       # a single letter between two "-"s
>>   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
>>         ## 0-width +ve lookahead assertion - so can match
>>         ## multiple consecutive -x- constructions in same regexp!
>>   s/-//g;
>>         ## remove remaining "-"s from string...
>> }
>>
>> Not sure what other test strings you may want - but most should be
>> able to
>> fit in the () brackets in the first regexp of simplify
>>
>> James
> Along the same line
>
> # some test for most of the removals below
> my $string = "Alpha-Cyclic-2,3-bi-sphos-1,2,5-pho-D-beta-glycerate";
> my @ra_bad_terms = (  '-?(D|R|S)-',
>                       '-?([aA]lpha|[bB]eta|[gG]amma)-',
>                       '-?([cC]is|[tT]rans)-',
>                       '-?[cC]yclic-',
>                     # '-?\d+(,\d+)+-',   # uncomment to remove numbers,
> too
>                       '(?<!\d)-' );          # '-' following number
> print "$string\n";
> foreach ( @ra_bad_terms ){
>
>   eval { $string =~ s/$_//g; };
>   print "$_:$string\n";   # for feedback only
> }
> #$string =~ s/<@ra_bad_terms>//g;
>
> print lc($string),"\n";
>
>
> --
> Benno P?tz
> Statistische Genetik
> Max-Planck-Institut f. Psychiatrie            Tel.: +49-89-30622-222
> Kraepelinstr. 10                              Fax : +49-89-30622-601
> 80804 M?nchen, Germany
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


-- 
Shameer Khadar
Prof. R. Sowdhamini's Lab (# 25) The Computational Biology Group
National Centre for Biological Sciences (TIFR)
GKVK Campus, Bellary Road, Bangalore - 65, Karnataka - India
T - 91-080-23666001 EXT - 6251
W - http://www.ncbs.res.in



From js5 at sanger.ac.uk  Tue Sep 18 11:37:57 2007
From: js5 at sanger.ac.uk (James Smith)
Date: Tue, 18 Sep 2007 16:37:57 +0100 (BST)
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <bba689ec0709180741s13b358e3l1b326a47700259a6@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<20070918122032.GV14066@ebi.ac.uk>
	<Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
	<46EFDCDF.6030309@mpipsykl.mpg.de>
	<bba689ec0709180741s13b358e3l1b326a47700259a6@mail.gmail.com>
Message-ID: <Pine.LNX.4.64.0709181632450.28437@cbi4a.internal.sanger.ac.uk>



On Tue, 18 Sep 2007, Spiros Denaxas wrote:

> On 9/18/07, Benno Puetz <puetz at mpipsykl.mpg.de> wrote:
> James Smith wrote:
> >
> > Neeti,
> >
> > This isn't really a bioperl query - but I will try and explain a simple
> > solution...
> >
> > warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );
> >
> > sub simplify {
> >   local $_ = "-$_[0]-";
> >         ## Quick hack add -'s at start and end! as always match
> > "-string-"
> >   s/-(
> >     Cyclic | # The prefix "cyclic"
> >     \d+    | # a single number between two "-"s
> >     \d+,\d+| # number,number between two "-"s
> >     \w       # a single letter between two "-"s
> >   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
> >         ## 0-width +ve lookahead assertion - so can match
> >         ## multiple consecutive -x- constructions in same regexp!
> >   s/-//g;
> >         ## remove remaining "-"s from string...
> > }
> >
> > Not sure what other test strings you may want - but most should be
> > able to
> > fit in the () brackets in the first regexp of simplify
> >
> > James
> Along the same line
>

But the point is you don't need to loop over things....


Updated regexp...


sub simplify {
   local $_ = "-$_[0]-";             # Add '-' at start and end!
   s{-(
     [cC]yclic                     | # The prefix "cyclic"
     [aA]lpha | [bB]eta | [gG]amma | # Alpha/beta/gamma
     [tT]rans | [cC]is             | # Trans/cis
     [DRS]                         | # Single letter "D","R" or "S"
#    \d+(,\d+)*                   | # list of 1 or more "," separated nos
   )(?=-)}{}xg;                      # No. list currently commented out!
   s/-//g;                           # remove all "-"
   s/([^\d,])([\d,])/\1-\2/g;        # re-introduce "-" between number/
   s/([\d,])([^\d,])/\1-\2/g;        #  comma and letters
   s/--/-/g;                         # remove duplicate "-" signs..
   return $_;
}




-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 


From cjfields at uiuc.edu  Tue Sep 18 11:38:04 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 10:38:04 -0500
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFCD0C.3010306@bms.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
	<46EFCD0C.3010306@bms.com>
Message-ID: <68EC5D58-9D84-4692-BD99-F53FC75FD0E7@uiuc.edu>


On Sep 18, 2007, at 8:05 AM, Stefan Kirov wrote:

> neeti somaiya wrote:
>> ...
> It seems to me you are trying to match 2 collections of chemical
> compounds. If you need to do this reliably you need to use canonical
> smiles (perhaps there are other solutions but I am not aware of them).
> There are many resources for that, including open-source:
> http://openbabel.sourceforge.net/wiki/Main_Page
> It is not really bioperl's cup of tea, this is much more a
> chemi-informatics problem. I am not sure if there is a need for  
> bioperl
> to be extended this way- any thoughts on that?
> Hope this helps, regards
> Stefan

I would vote nyet myself unless I was convinced that this would be  
beneficial to bioperl core.  Right now I'm not yet there, primarily b/ 
c of the already available OpenBabel (with available CPAN interface)  
and other resources, not to mention there are too many areas in  
bioperl which need more focus (tests, documentation, etc).

However, if we do want to incorporate chemi-informatics at some point  
it could be something which is not integrated into the core  
architecture and can be installed separately (like network, ext, db,  
etc).

chris


From bioperl-list at superfrink.net  Tue Sep 18 12:16:48 2007
From: bioperl-list at superfrink.net (bioperl-list at superfrink.net)
Date: Tue, 18 Sep 2007 10:16:48 -0600 (MDT)
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFBA0E.4030104@sheffield.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
	<46EFBA0E.4030104@sheffield.ac.uk>
Message-ID: <Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>

On Tue, 18 Sep 2007, Nathan Haigh wrote:

> An even better way is to use the array as Spiros suggested, but you
> should then be able to use that in the regex like this:
>
> my @ra_bad_terms = (  '-D-', 'Cyclic-' );
> $string =~ s/@ra_bad_terms//g;

I didn't know one could do that.  I couldn't get it to work so I asked 
around.  In case anyone else read it and thought about using that code it 
might only work in Perl 6.

Regards,
Chad


From bix at sendu.me.uk  Tue Sep 18 13:21:06 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 18 Sep 2007 18:21:06 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>
	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
Message-ID: <46F00902.9070401@sendu.me.uk>

bioperl-list at superfrink.net wrote:
> On Tue, 18 Sep 2007, Nathan Haigh wrote:
> 
>> An even better way is to use the array as Spiros suggested, but you
>> should then be able to use that in the regex like this:
>>
>> my @ra_bad_terms = (  '-D-', 'Cyclic-' );
>> $string =~ s/@ra_bad_terms//g;
> 
> I didn't know one could do that.  I couldn't get it to work so I asked 
> around.  In case anyone else read it and thought about using that code it 
> might only work in Perl 6.

I assumed it was a typo. You can get it to work by adding

$" = '|';

before the regex;


From cjfields at uiuc.edu  Tue Sep 18 13:52:00 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 12:52:00 -0500
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
	<46EFBA0E.4030104@sheffield.ac.uk>
	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
Message-ID: <F7ADCFDC-D065-4401-AF1F-F53D6958CF37@uiuc.edu>


On Sep 18, 2007, at 11:16 AM, bioperl-list at superfrink.net wrote:

> On Tue, 18 Sep 2007, Nathan Haigh wrote:
>
>> An even better way is to use the array as Spiros suggested, but you
>> should then be able to use that in the regex like this:
>>
>> my @ra_bad_terms = (  '-D-', 'Cyclic-' );
>> $string =~ s/@ra_bad_terms//g;
>
> I didn't know one could do that.  I couldn't get it to work so I asked
> around.  In case anyone else read it and thought about using that  
> code it
> might only work in Perl 6.
>
> Regards,
> Chad

I think the problem is what s/@terms//g means.  To most it means  
group substitutions, which you can get by using s/(?:a|b|c|d)//g; to  
others it means stepwise 's/$old//g for $old (@terms)'.

To go from an array of terms to an optimized group regex, use  
Regexp::List (CPAN to the rescue!):

http://search.cpan.org/~dankogai/Regexp-Optimizer-0.15/lib/Regexp/ 
List.pm

chris


From cjfields at uiuc.edu  Tue Sep 18 14:23:37 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 13:23:37 -0500
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46F00902.9070401@sendu.me.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>
	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
	<46F00902.9070401@sendu.me.uk>
Message-ID: <5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>


On Sep 18, 2007, at 12:21 PM, Sendu Bala wrote:

> bioperl-list at superfrink.net wrote:
>> On Tue, 18 Sep 2007, Nathan Haigh wrote:
>>
>>> An even better way is to use the array as Spiros suggested, but you
>>> should then be able to use that in the regex like this:
>>>
>>> my @ra_bad_terms = (  '-D-', 'Cyclic-' );
>>> $string =~ s/@ra_bad_terms//g;
>>
>> I didn't know one could do that.  I couldn't get it to work so I  
>> asked
>> around.  In case anyone else read it and thought about using that  
>> code it
>> might only work in Perl 6.
>
> I assumed it was a typo. You can get it to work by adding
>
> $" = '|';
>
> before the regex;

Ah, didn't know that one.  Nice, though shouldn't it be localized?

The (supposed) advantage of Regexp::List is the regex is optimized  
for speed; I haven't tried it out myself, so YMMV.

chris


From stefan.kirov at bms.com  Tue Sep 18 14:54:49 2007
From: stefan.kirov at bms.com (Stefan Kirov)
Date: Tue, 18 Sep 2007 14:54:49 -0400
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <155C67C0-1F81-4A1C-AD68-A21B4E6918C9@uiuc.edu>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
	<46EFD217.1030103@cam.ac.uk>
	<155C67C0-1F81-4A1C-AD68-A21B4E6918C9@uiuc.edu>
Message-ID: <46F01EF9.80003@bms.com>

Actually, smiles can be tricky too- you can easily generate
non-canonical keys, where InChi is unique (as I understand it at least).
It is promoted by IUAPC:
http://www.iupac.org/inchi/
and can be generated by OpenBabel.
My take is that if you need to map between small molecules InChi might
be the best way..
Stefan

Chris Fields wrote:
> On Sep 18, 2007, at 8:26 AM, Roy Chaudhuri wrote:
>
>   
>>> My actual problem is a bit more complicated.
>>> It is not just one string, nut lakhs of them, they are actually  
>>> names of
>>> chemical compounds.
>>>
>>> THe problem is there are 2 different data sources, I need to match  
>>> the
>>> compond names between them, but the problem is though the compound  
>>> may
>>> be the same in the two, they use different naming formats for them.
>>>       
>> Unless you can define in simple and precise terms exactly which  
>> parts of
>> the string you need then there is no way that you will be able to  
>> code a
>> solution in Perl.
>>
>> Maybe you could look for a database that contains the synonyms for  
>> each
>> molecule? A quick Google finds ChEBI (http://www.ebi.ac.uk/chebi),  
>> which
>> is available to download as flat files.
>>
>> Roy.
>> --
>> Dr. Roy Chaudhuri
>> Department of Veterinary Medicine
>> University of Cambridge, U.K.
>>     
>
> D'oh!  Roy beat me to it; that's what I was going to suggest.  I  
> agree; don't trust simple word munging to always get you the correct  
> answer in this case, it's just too complicated to try and catch every  
> case.
>
> ChEBI is a good choice; Stefan's suggestion of OpenBabel is also a  
> good one.  I would also try not to reinvent the wheel; there may be  
> some modules available via CPAN which do what you need, such as these:
>
> http://search.cpan.org/search?query=chem&mode=module
>
> or this:
>
> http://search.cpan.org/~ghutchis/Chemistry-OpenBabel-1.2.0/
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>   



From jason at bioperl.org  Tue Sep 18 20:04:05 2007
From: jason at bioperl.org (Jason Stajich)
Date: Tue, 18 Sep 2007 17:04:05 -0700
Subject: [Bioperl-l] bioperl + GFF3 audit
Message-ID: <C7895984-E679-4079-A584-9EB013F22EB5@bioperl.org>

Something to throw out there for discussion with GFF3 gurus.  Maybe  
we can have a little STATE-OF-GFF3 and compliance at the GMOD  
workshop after Genome Informatics in Nov?

I propose after we get the next stable release out we consider doing  
a systematic code audit to insure that we can really generate proper  
GFF3 compliant data from all of our parsers.  This would include both  
good ID/Parent as well as .  I'd be happy to also think about making  
sure we can generate proper GTF/GFF2.5 - whether this means we have a  
translator that works on these objects or we have to code this into  
the parser software that creating the sequence features, not sure.   
The whole Bio::Tools mishmash is a little unsettling when trying to  
generate standardized output.  I'm not really clear if Bio::FeatureIO  
actually tries to do this properly, but 'gene_id'/'transcript_id' for  
GTF and ID/Parent 3-level Features for gene->transcript->exon/CDS  
doesn't really come out properly and I end up writing workarounds on  
the downstream data.

One aspect that is biting is the flat versus multi-level features  
(genes -> transcripts -> exons) and how we handle them.  I think this  
ought to get fleshed out better so we can really support .  A lot of  
the Bio::Tools parsers are generally pretty laissez fair here about  
things and we have a variety of non-standard and non-compliant aspects.

For example, I am playing with tRNA parsing and I assume that proper  
GFF3 here is three levels of :
gene -> tRNA -> exon
with those being the primary_tag names that correspond to the  
Sequence Ontology.

I have modified the code locally to report generic features but which  
have sub-features that must be extracted.  In addition the ID/Parent  
fields are explicitly filled in and I wonder if we want to do a  
better job insuring these are meaningfully entered?

So if there are interested people out there we can try and hammer out  
a todo list on the wiki and see if we're generating proper GFF3 in  
the first place and trying to make sure all the features that get fed  
out to Bio::FeatureIO or Bio::Tools::GFF can get properly transformed  
into GFF3 and GTF output.

Comments/Volunteers?

-jason

--
Jason Stajich
jason at bioperl.org



From cjfields at uiuc.edu  Tue Sep 18 23:37:30 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 22:37:30 -0500
Subject: [Bioperl-l] bioperl + GFF3 audit
In-Reply-To: <C7895984-E679-4079-A584-9EB013F22EB5@bioperl.org>
References: <C7895984-E679-4079-A584-9EB013F22EB5@bioperl.org>
Message-ID: <D6630AE3-B968-462C-9CED-D09C90BE786B@uiuc.edu>

On Sep 18, 2007, at 7:04 PM, Jason Stajich wrote:

> Something to throw out there for discussion with GFF3 gurus.  Maybe
> we can have a little STATE-OF-GFF3 and compliance at the GMOD
> workshop after Genome Informatics in Nov?
>
> I propose after we get the next stable release out we consider doing
> a systematic code audit to insure that we can really generate proper
> GFF3 compliant data from all of our parsers.  This would include both
> good ID/Parent as well as .  I'd be happy to also think about making
> sure we can generate proper GTF/GFF2.5 - whether this means we have a
> translator that works on these objects or we have to code this into
> the parser software that creating the sequence features, not sure.
> The whole Bio::Tools mishmash is a little unsettling when trying to
> generate standardized output.  I'm not really clear if Bio::FeatureIO
> actually tries to do this properly, but 'gene_id'/'transcript_id' for
> GTF and ID/Parent 3-level Features for gene->transcript->exon/CDS
> doesn't really come out properly and I end up writing workarounds on
> the downstream data.

This suggests we should try to get a stable out fairly quickly and  
work on the next dev straight away.  I'm okay with that, though it  
would be nice to finish up a few loose ends first, the svn move  
foremost.

The Feature/Annotation stuff has been pretty much rolled back so  
maybe a stable release can be done fairly quickly.  My main concern  
was that any rollback would break FeatureIO or SF::Annotated, but so  
far FeatureIO and SF::Annotated both pass tests.  However, I think  
both also need better documentation and possibly more/better test  
coverage.

> One aspect that is biting is the flat versus multi-level features
> (genes -> transcripts -> exons) and how we handle them.  I think this
> ought to get fleshed out better so we can really support .  A lot of
> the Bio::Tools parsers are generally pretty laissez fair here about
> things and we have a variety of non-standard and non-compliant  
> aspects.

Agreed.

> For example, I am playing with tRNA parsing and I assume that proper
> GFF3 here is three levels of :
> gene -> tRNA -> exon
> with those being the primary_tag names that correspond to the
> Sequence Ontology.
>
> I have modified the code locally to report generic features but which
> have sub-features that must be extracted.  In addition the ID/Parent
> fields are explicitly filled in and I wonder if we want to do a
> better job insuring these are meaningfully entered?

Would a factory approach work here?  For instance, have a Factory  
which generates the SeqFeature type you want on the fly if passed  
appropriate parameters and location, say flattened vs unflattened,  
strictly typed vs lightweight, etc.  For that matter, maybe we could  
reimplement FTHelper in SeqIO to do the same...

> So if there are interested people out there we can try and hammer out
> a todo list on the wiki and see if we're generating proper GFF3 in
> the first place and trying to make sure all the features that get fed
> out to Bio::FeatureIO or Bio::Tools::GFF can get properly transformed
> into GFF3 and GTF output.
>
> Comments/Volunteers?
>
> -jason
>
> --
> Jason Stajich
> jason at bioperl.org

I'll be busy 'til mid-Oct but I'll chip in.  I'll keep tabs on the wiki.

chris


From harryzs1981 at yahoo.com.cn  Fri Sep 21 10:40:55 2007
From: harryzs1981 at yahoo.com.cn (sheng zhao)
Date: Fri, 21 Sep 2007 22:40:55 +0800 (CST)
Subject: [Bioperl-l] Help for extracting CDS sequences from FASTA form
Message-ID: <815154.22486.qm@web15901.mail.cnb.yahoo.com>

              Dear all:      
I have got a set of DAN sequences in FASTA form as following: 
   
  >gnl|UG|Bt#S37443275 Bos taurus cathelicidin 4, mRNA (cDNA clone MGC:157131 IMAGE:8442308), complete cds /cds=p(18,452) /gb=BC133480 /gi=126717494 /ug=Bt.3 /len=572
  TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................................
  >gnl|UG|Bt#S11932596 B.taurus mRNA for interleukin-5 /cds=p(1,405) /gb=Z67872 /gi=1113120 /ug=Bt.5 /len=405
  TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC...................................
  >gnl|UG|Bt#S29311270 Hw_Loin_11_0520_C11 Bos taurus CF-24-HW loin cDNA library Bos taurus cDNA, mRNA sequence /gb=DV796078 /gi=82648993 /ug=Bt.10 /len=1332
  AACCGGGAGCACGCCGTGTACCCGCCAGTGGGGCTTCTGAGGACATGGGGGCCACCGTCA...................................
   
  I would like to know how to extract CDS sequences from them? Or a Perl program?
   
  Thank you for your reply and help.
   
  Sincerely yours,
  Best wishes,
  Harry 




       
---------------------------------
 @yahoo.cn ??????????????????????????


From bix at sendu.me.uk  Fri Sep 21 11:28:30 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 21 Sep 2007 16:28:30 +0100
Subject: [Bioperl-l] Help for extracting CDS sequences from FASTA form
In-Reply-To: <815154.22486.qm@web15901.mail.cnb.yahoo.com>
References: <815154.22486.qm@web15901.mail.cnb.yahoo.com>
Message-ID: <46F3E31E.2010606@sendu.me.uk>

sheng zhao wrote:
> >gnl|UG|Bt#S37443275 [snip] /gb=BC133480 /gi=126717494 /ug=Bt.3 /len=572
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGC
[snip]
> I would like to know how to extract CDS sequences from them? Or a Perl program?

Where did you get the fasta sequences from? It would be easiest to go to 
the source that originally generated them and get it to give you the CDS 
coordinates as well.

Failing that you can get them from the NCBI database using the gb or gi ids.

Someone else will be along to give you the Bioperl code to do that, I'm 
sure :)


From harryzs1981 at yahoo.com.cn  Fri Sep 21 12:30:45 2007
From: harryzs1981 at yahoo.com.cn (sheng zhao)
Date: Sat, 22 Sep 2007 00:30:45 +0800 (CST)
Subject: [Bioperl-l]  Help for extracting CDS sequences from FASTA form
Message-ID: <352861.19969.qm@web15909.mail.cnb.yahoo.com>

Dear sir:
   
  Thank you for your relp.
   
  I got these sequences from NCBI(ftp.ncbi.nlm.nih.gov/repository/UniGene/Bos_taurus/Bt.seq.uniq.gz).
   
  Would you mind to tell me how to get gb or gi ids from this form?
  Thank you again.
   
  Best wishes.
  Harry
  


Sendu Bala <bix at sendu.me.uk> ??????
    sheng zhao wrote:
> >gnl|UG|Bt#S37443275 [snip] /gb=BC133480 /gi=126717494 /ug=Bt.3 /len=572
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGC
[snip]
> I would like to know how to extract CDS sequences from them? Or a Perl program?

Where did you get the fasta sequences from? It would be easiest to go to 
the source that originally generated them and get it to give you the CDS 
coordinates as well.

Failing that you can get them from the NCBI database using the gb or gi ids.

Someone else will be along to give you the Bioperl code to do that, I'm 
sure :)
   


       
---------------------------------
???????????????????? 


From harryzs1981 at yahoo.com.cn  Fri Sep 21 12:32:21 2007
From: harryzs1981 at yahoo.com.cn (sheng zhao)
Date: Sat, 22 Sep 2007 00:32:21 +0800 (CST)
Subject: [Bioperl-l]
 =?gb2312?q?=BB=D8=B8=B4=A3=BA=20Re:=20=20Help=20for=20extracti?=
 =?gb2312?q?ng=20CDS=20sequences=20from=20FASTA=20form?=
In-Reply-To: <C319614A.FB06%bosborne11@verizon.net>
Message-ID: <548016.71302.qm@web15914.mail.cnb.yahoo.com>

Dear Brian O.:
   
   Thank you for your reple.
  I just want to get CDS sequences (DNA sequence) from them according to the CDS information in the title for each sequence. 
   
  For example, for the first sequence, the information is "complete cds /cds=p(18,452)" .

  Thank you again!
   
  Best wishes!
  Harry



Brian Osborne <bosborne11 at verizon.net> ??????
  Harry,

Do you mean find an ORF starting at the first initiation codon and translate
that? Or some other approach?

Take a look at the translate() method:

http://www.bioperl.org/wiki/Bptutorial.pl#Translating


Brian O.


On 9/21/07 10:40 AM, "sheng zhao" wrote:

> Dear all:
> I have got a set of DAN sequences in FASTA form as following:
> 
>> gnl|UG|Bt#S37443275 Bos taurus cathelicidin 4, mRNA (cDNA clone MGC:157131
>> IMAGE:8442308), complete cds /cds=p(18,452) /gb=BC133480 /gi=126717494
>> /ug=Bt.3 /len=572
> 
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................
> ................
>> gnl|UG|Bt#S11932596 B.taurus mRNA for interleukin-5 /cds=p(1,405) /gb=Z67872
>> /gi=1113120 /ug=Bt.5 /len=405
> 
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................
> .................
>> gnl|UG|Bt#S29311270 Hw_Loin_11_0520_C11 Bos taurus CF-24-HW loin cDNA library
>> Bos taurus cDNA, mRNA sequence /gb=DV796078 /gi=82648993 /ug=Bt.10 /len=1332
> 
> AACCGGGAGCACGCCGTGTACCCGCCAGTGGGGCTTCTGAGGACATGGGGGCCACCGTCA..................
> .................
> 
> I would like to know how to extract CDS sequences from them? Or a Perl
> program?
> 
> Thank you for your reply and help.
> 
> Sincerely yours,
> Best wishes,
> Harry 
> 
> 
> 
> 
> 
> ---------------------------------
> @yahoo.cn ??????????????????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




       
---------------------------------
???????????????????? 


From bosborne11 at verizon.net  Fri Sep 21 11:53:46 2007
From: bosborne11 at verizon.net (Brian Osborne)
Date: Fri, 21 Sep 2007 11:53:46 -0400
Subject: [Bioperl-l] Help for extracting CDS sequences from FASTA form
In-Reply-To: <815154.22486.qm@web15901.mail.cnb.yahoo.com>
Message-ID: <C319614A.FB06%bosborne11@verizon.net>

Harry,

Do you mean find an ORF starting at the first initiation codon and translate
that? Or some other approach?

Take a look at the translate() method:

http://www.bioperl.org/wiki/Bptutorial.pl#Translating


Brian O.


On 9/21/07 10:40 AM, "sheng zhao" <harryzs1981 at yahoo.com.cn> wrote:

>               Dear all:
> I have got a set of DAN sequences in FASTA form as following:
>    
>> gnl|UG|Bt#S37443275 Bos taurus cathelicidin 4, mRNA (cDNA clone MGC:157131
>> IMAGE:8442308), complete cds /cds=p(18,452) /gb=BC133480 /gi=126717494
>> /ug=Bt.3 /len=572
>   
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................
> ................
>> gnl|UG|Bt#S11932596 B.taurus mRNA for interleukin-5 /cds=p(1,405) /gb=Z67872
>> /gi=1113120 /ug=Bt.5 /len=405
>   
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................
> .................
>> gnl|UG|Bt#S29311270 Hw_Loin_11_0520_C11 Bos taurus CF-24-HW loin cDNA library
>> Bos taurus cDNA, mRNA sequence /gb=DV796078 /gi=82648993 /ug=Bt.10 /len=1332
>   
> AACCGGGAGCACGCCGTGTACCCGCCAGTGGGGCTTCTGAGGACATGGGGGCCACCGTCA..................
> .................
>    
>   I would like to know how to extract CDS sequences from them? Or a Perl
> program?
>    
>   Thank you for your reply and help.
>    
>   Sincerely yours,
>   Best wishes,
>   Harry 
> 
> 
> 
> 
>        
> ---------------------------------
>  @yahoo.cn ??????????????????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l





From florent.angly at gmail.com  Sat Sep 22 01:02:28 2007
From: florent.angly at gmail.com (Florent Angly)
Date: Fri, 21 Sep 2007 22:02:28 -0700
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
Message-ID: <46F4A1E4.7020002@gmail.com>

Hi,
I need to quantify how good some overlaps in contigs are. I have 
extracted the alignment of the overlapping region and only need to score 
it. I noticed the Bio::Tools::dpAlign has a scoring function.
Is it the right tool for the right tool? Is there anything else?
Thank you,
Florent


From florent.angly at gmail.com  Sat Sep 22 21:41:40 2007
From: florent.angly at gmail.com (Florent Angly)
Date: Sat, 22 Sep 2007 18:41:40 -0700
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <46F4A1E4.7020002@gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com>
Message-ID: <46F5C454.3050005@gmail.com>

Eventually, I gave Bio::Tools::dpAlign a try. I had no luck running it 
when installing its dependency, bioperl-ext v1.4 or v1.5.1. However all 
the tests passed when installing the CVS version.
So finally, here I am trying to score my alignments. For alignments of 2 
small sequences, it works, but as soon as the sequences get bigger than 
a few dozen nucleotides, it crashes:
Segmentation fault (core dumped)

I did not find any help in the documentation...

Can I fix this? Is this a bug?

Thanks for your help,

Florent

Florent Angly wrote:
> Hi,
> I need to quantify how good some overlaps in contigs are. I have 
> extracted the alignment of the overlapping region and only need to 
> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
> Is it the right tool for the right tool? Is there anything else?
> Thank you,
> Florent
>



From bioperl-list at superfrink.net  Sun Sep 23 12:21:44 2007
From: bioperl-list at superfrink.net (Chad Clark)
Date: Sun, 23 Sep 2007 10:21:44 -0600 (MDT)
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <46F5C454.3050005@gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
	<46EFBA0E.4030104@sheffield.ac.uk>
	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
Message-ID: <Pine.LNX.4.64.0709231013340.21280@gurchecyrohssnyb.arg>

On Sat, 22 Sep 2007, Florent Angly wrote:

> So finally, here I am trying to score my alignments. For alignments of 2
> small sequences, it works, but as soon as the sequences get bigger than
> a few dozen nucleotides, it crashes:
> Segmentation fault (core dumped)

In my experience if a program runs on small sets of data and segfaults on 
larger sets it is likely running out of stack space.  You can try changing 
the allowed stack size with "ulimit" before running your program and see 
if it works with more data.

   [chad at water ~]$ ulimit -a | grep -i stack
   stack size              (kbytes, -s) 10240
   [chad at water ~]$ ulimit -s 40960
   [chad at water ~]$ ulimit -a | grep -i stack
   stack size              (kbytes, -s) 40960

I don't know the code / algorithm in question but it might require 
significantly more stack space as the data set grows in size so this 
change might not help enough.

Good luck,
Chad


From bix at sendu.me.uk  Mon Sep 24 05:35:39 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Mon, 24 Sep 2007 10:35:39 +0100
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
Message-ID: <46F784EB.9050507@sendu.me.uk>

Hi,

I'm finding that when writing GFF files the version header line gets 
printed out twice. This is because:

sub _initialize {
   # [snip]

   if ($arg{-file} =~ /^>.*/ ) {
     $self->_print("##gff-version " . $self->version() . "\n");
   }
   else {
     my $directive;
     while(($directive = $self->_readline()) && ( $directive =~ /^##/ || 
$directive =~ /^>/)){
       $self->_handle_directive($directive);
     }
     $self->_pushback($directive);
   }

   if ($arg{-file} =~ /^>.*/ ) {
     $self->_print("##gff-version " . $self->version() . "\n");
   }

   # [snip]
}

Does it make sense for if ($arg{-file} =~ /^>.*/ ) to appear twice like 
that? If not, which one should be removed? The independent one, or the 
if/else one?


Cheers,
Sendu.


From awitney at sgul.ac.uk  Mon Sep 24 08:40:07 2007
From: awitney at sgul.ac.uk (Adam Witney)
Date: Mon, 24 Sep 2007 13:40:07 +0100
Subject: [Bioperl-l] Minor docs discrepancy?
In-Reply-To: <E8CEAD6A-9F6B-43B8-94A3-95A1C96E872D@duke.edu>
Message-ID: <C31D6EB7.1A1BD%awitney@sgul.ac.uk>


Hi,

I was just going through the BlastHSP.pm POD and lines 23-24 say

"For Bio::SearchIO BLAST parsing usage examples, see the
"examples/search-blast" directory of the Bioperl distribution."

However in the distribution (1.4 and 1.5.2_102) it looks to be
"examples/searchio"

Is this in need of updating, or am I looking in the wrong place?

Thanks

Adam




From cjfields at uiuc.edu  Mon Sep 24 09:09:46 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 08:09:46 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <46F784EB.9050507@sendu.me.uk>
References: <46F784EB.9050507@sendu.me.uk>
Message-ID: <7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>

It looks like the first is a cut-and-paste revision of the second, so  
I would say the second independent if block is redundant.

Should we be printing output in _initialize()?  I would think any  
output would be handled in a write_* method of some sort and not in a  
common method used for initializing both input and output stream  
data.  What happens here if you use '-fh' and want output redirected  
to STDOUT?

chris

On Sep 24, 2007, at 4:35 AM, Sendu Bala wrote:

> Hi,
>
> I'm finding that when writing GFF files the version header line gets
> printed out twice. This is because:
>
> sub _initialize {
>    # [snip]
>
>    if ($arg{-file} =~ /^>.*/ ) {
>      $self->_print("##gff-version " . $self->version() . "\n");
>    }
>    else {
>      my $directive;
>      while(($directive = $self->_readline()) && ( $directive =~ / 
> ^##/ ||
> $directive =~ /^>/)){
>        $self->_handle_directive($directive);
>      }
>      $self->_pushback($directive);
>    }
>
>    if ($arg{-file} =~ /^>.*/ ) {
>      $self->_print("##gff-version " . $self->version() . "\n");
>    }
>
>    # [snip]
> }
>
> Does it make sense for if ($arg{-file} =~ /^>.*/ ) to appear twice  
> like
> that? If not, which one should be removed? The independent one, or the
> if/else one?
>
>
> Cheers,
> Sendu.



From cjfields at uiuc.edu  Mon Sep 24 09:13:53 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 08:13:53 -0500
Subject: [Bioperl-l] Minor docs discrepancy?
In-Reply-To: <C31D6EB7.1A1BD%awitney@sgul.ac.uk>
References: <C31D6EB7.1A1BD%awitney@sgul.ac.uk>
Message-ID: <B692F0F5-7CA3-4D32-B588-78087B25D193@uiuc.edu>

I have updated that in CVS.  Thanks for pointing that out!

chris

On Sep 24, 2007, at 7:40 AM, Adam Witney wrote:

>
> Hi,
>
> I was just going through the BlastHSP.pm POD and lines 23-24 say
>
> "For Bio::SearchIO BLAST parsing usage examples, see the
> "examples/search-blast" directory of the Bioperl distribution."
>
> However in the distribution (1.4 and 1.5.2_102) it looks to be
> "examples/searchio"
>
> Is this in need of updating, or am I looking in the wrong place?
>
> Thanks
>
> Adam


From bix at sendu.me.uk  Mon Sep 24 09:20:33 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Mon, 24 Sep 2007 14:20:33 +0100
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
Message-ID: <46F7B9A1.9080206@sendu.me.uk>

Chris Fields wrote:
> It looks like the first is a cut-and-paste revision of the second, so I 
> would say the second independent if block is redundant.

I agree. I'll make that change.


> Should we be printing output in _initialize()?  I would think any output 
> would be handled in a write_* method of some sort and not in a common 
> method used for initializing both input and output stream data.  What 
> happens here if you use '-fh' and want output redirected to STDOUT?

I think the problem is that the method is write_feature(), which can be 
called many times for a single output file, but the version should only 
be printed once at the very start of the file.

I suppose it just needs better capturing of when we're intending to 
write... Hmmm... didn't I fix a method related to that?...

Yes, yes I did:
Bio::Root::IO->mode
;)

Any objections to me replacing the if clause with one using that method?


From cjfields at uiuc.edu  Mon Sep 24 09:35:22 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 08:35:22 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <46F7B9A1.9080206@sendu.me.uk>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
Message-ID: <EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>


On Sep 24, 2007, at 8:20 AM, Sendu Bala wrote:

> Chris Fields wrote:
>> It looks like the first is a cut-and-paste revision of the second,  
>> so I would say the second independent if block is redundant.
>
> I agree. I'll make that change.
>
>
>> Should we be printing output in _initialize()?  I would think any  
>> output would be handled in a write_* method of some sort and not  
>> in a common method used for initializing both input and output  
>> stream data.  What happens here if you use '-fh' and want output  
>> redirected to STDOUT?
>
> I think the problem is that the method is write_feature(), which  
> can be called many times for a single output file, but the version  
> should only be printed once at the very start of the file.
>
> I suppose it just needs better capturing of when we're intending to  
> write... Hmmm... didn't I fix a method related to that?...
>
> Yes, yes I did:
> Bio::Root::IO->mode
> ;)
>
> Any objections to me replacing the if clause with one using that  
> method?

I think that'll work fine.  The other option would be call a  
print_gff_header() function within write_feature() with the intent to  
print the header only once, using a flag or similar:

if (!$self->header_printed) {
     $self->print_gff_header;
     $self->header_printed(1);
}

chris


From hlapp at gmx.net  Mon Sep 24 13:41:34 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Mon, 24 Sep 2007 13:41:34 -0400
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
Message-ID: <234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>

I'd lean toward this or a similar approach too. Writing stuff out in  
the constructor doesn't feel like the best design.

	-hilmar

On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:

>
> On Sep 24, 2007, at 8:20 AM, Sendu Bala wrote:
>
>> Chris Fields wrote:
>>> It looks like the first is a cut-and-paste revision of the second,
>>> so I would say the second independent if block is redundant.
>>
>> I agree. I'll make that change.
>>
>>
>>> Should we be printing output in _initialize()?  I would think any
>>> output would be handled in a write_* method of some sort and not
>>> in a common method used for initializing both input and output
>>> stream data.  What happens here if you use '-fh' and want output
>>> redirected to STDOUT?
>>
>> I think the problem is that the method is write_feature(), which
>> can be called many times for a single output file, but the version
>> should only be printed once at the very start of the file.
>>
>> I suppose it just needs better capturing of when we're intending to
>> write... Hmmm... didn't I fix a method related to that?...
>>
>> Yes, yes I did:
>> Bio::Root::IO->mode
>> ;)
>>
>> Any objections to me replacing the if clause with one using that
>> method?
>
> I think that'll work fine.  The other option would be call a
> print_gff_header() function within write_feature() with the intent to
> print the header only once, using a flag or similar:
>
> if (!$self->header_printed) {
>      $self->print_gff_header;
>      $self->header_printed(1);
> }
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From cjfields at uiuc.edu  Mon Sep 24 14:11:47 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 13:11:47 -0500
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <46F5C454.3050005@gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
Message-ID: <9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>

As Chad mentioned it could be a stack issue, but it might be worth  
filing a bug on.  I will note that bioperl-ext has seen very little  
use in the last few years, so don't expect it to be fixed unless you  
can contact the ext module author.

chris

On Sep 22, 2007, at 8:41 PM, Florent Angly wrote:

> Eventually, I gave Bio::Tools::dpAlign a try. I had no luck running it
> when installing its dependency, bioperl-ext v1.4 or v1.5.1. However  
> all
> the tests passed when installing the CVS version.
> So finally, here I am trying to score my alignments. For alignments  
> of 2
> small sequences, it works, but as soon as the sequences get bigger  
> than
> a few dozen nucleotides, it crashes:
> Segmentation fault (core dumped)
>
> I did not find any help in the documentation...
>
> Can I fix this? Is this a bug?
>
> Thanks for your help,
>
> Florent
>
> Florent Angly wrote:
>> Hi,
>> I need to quantify how good some overlaps in contigs are. I have
>> extracted the alignment of the overlapping region and only need to
>> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
>> Is it the right tool for the right tool? Is there anything else?
>> Thank you,
>> Florent
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From florent.angly at gmail.com  Mon Sep 24 15:07:35 2007
From: florent.angly at gmail.com (Florent Angly)
Date: Mon, 24 Sep 2007 12:07:35 -0700
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
	<9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>
Message-ID: <46F80AF7.4090109@gmail.com>

I see... Thanks for the replies Chad and Chris. Then I have two more 
questions!
1/ Do you know how to get a core dump that could help debug my 
segmentation fault? I have produced dumps of binary C programs before 
with gdb. I have used the Perl debugger for Perl scripts. But how to 
deal with C functions called by Perl?
2/ Is there an easier method to calculate an alignment score in BioPerl 
than using Bio::Tools::dpAlign? I didn't seem to locate something else, 
but who knows...
I have workarounds for quantifying the quality of the overlap, so 
calculating a score is not critical for me (though I believe this would 
be the most accurate/adapted method).
Florent

Chris Fields wrote:
> As Chad mentioned it could be a stack issue, but it might be worth 
> filing a bug on.  I will note that bioperl-ext has seen very little 
> use in the last few years, so don't expect it to be fixed unless you 
> can contact the ext module author.
>
> chris
>
> On Sep 22, 2007, at 8:41 PM, Florent Angly wrote:
>
>> Eventually, I gave Bio::Tools::dpAlign a try. I had no luck running it
>> when installing its dependency, bioperl-ext v1.4 or v1.5.1. However all
>> the tests passed when installing the CVS version.
>> So finally, here I am trying to score my alignments. For alignments of 2
>> small sequences, it works, but as soon as the sequences get bigger than
>> a few dozen nucleotides, it crashes:
>> Segmentation fault (core dumped)
>>
>> I did not find any help in the documentation...
>>
>> Can I fix this? Is this a bug?
>>
>> Thanks for your help,
>>
>> Florent
>>
>> Florent Angly wrote:
>>> Hi,
>>> I need to quantify how good some overlaps in contigs are. I have
>>> extracted the alignment of the overlapping region and only need to
>>> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
>>> Is it the right tool for the right tool? Is there anything else?
>>> Thank you,
>>> Florent
>>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
>



From cjfields at uiuc.edu  Mon Sep 24 15:26:46 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 14:26:46 -0500
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <46F80AF7.4090109@gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
	<9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>
	<46F80AF7.4090109@gmail.com>
Message-ID: <0C6508FB-4765-4E4E-AFD1-6E5BFE8F9368@uiuc.edu>

I suppose if you can find a way to export the contig data into a  
Bio::SimpleAlign you look at the methods in  
Bio::Align::DNAStatistics.  SimpleAlign also has some builtin methods  
like average_percentage_identity, percentage_identity, etc, which may  
be worth a look.

chris

On Sep 24, 2007, at 2:07 PM, Florent Angly wrote:

> I see... Thanks for the replies Chad and Chris. Then I have two more
> questions!
> 1/ Do you know how to get a core dump that could help debug my
> segmentation fault? I have produced dumps of binary C programs before
> with gdb. I have used the Perl debugger for Perl scripts. But how to
> deal with C functions called by Perl?
> 2/ Is there an easier method to calculate an alignment score in  
> BioPerl
> than using Bio::Tools::dpAlign? I didn't seem to locate something  
> else,
> but who knows...
> I have workarounds for quantifying the quality of the overlap, so
> calculating a score is not critical for me (though I believe this  
> would
> be the most accurate/adapted method).
> Florent
>
> Chris Fields wrote:
>> As Chad mentioned it could be a stack issue, but it might be worth
>> filing a bug on.  I will note that bioperl-ext has seen very little
>> use in the last few years, so don't expect it to be fixed unless you
>> can contact the ext module author.
>>
>> chris
>>
>> On Sep 22, 2007, at 8:41 PM, Florent Angly wrote:
>>
>>> Eventually, I gave Bio::Tools::dpAlign a try. I had no luck  
>>> running it
>>> when installing its dependency, bioperl-ext v1.4 or v1.5.1.  
>>> However all
>>> the tests passed when installing the CVS version.
>>> So finally, here I am trying to score my alignments. For  
>>> alignments of 2
>>> small sequences, it works, but as soon as the sequences get  
>>> bigger than
>>> a few dozen nucleotides, it crashes:
>>> Segmentation fault (core dumped)
>>>
>>> I did not find any help in the documentation...
>>>
>>> Can I fix this? Is this a bug?
>>>
>>> Thanks for your help,
>>>
>>> Florent
>>>
>>> Florent Angly wrote:
>>>> Hi,
>>>> I need to quantify how good some overlaps in contigs are. I have
>>>> extracted the alignment of the overlapping region and only need to
>>>> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
>>>> Is it the right tool for the right tool? Is there anything else?
>>>> Thank you,
>>>> Florent
>>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From florent.angly at gmail.com  Mon Sep 24 15:46:36 2007
From: florent.angly at gmail.com (Florent Angly)
Date: Mon, 24 Sep 2007 12:46:36 -0700
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <0C6508FB-4765-4E4E-AFD1-6E5BFE8F9368@uiuc.edu>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
	<9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>
	<46F80AF7.4090109@gmail.com>
	<0C6508FB-4765-4E4E-AFD1-6E5BFE8F9368@uiuc.edu>
Message-ID: <46F8141C.8010507@gmail.com>

Yes, right! That's the methods I use as my workarounds. =)
Thanks for suggesting.
Florent

Chris Fields wrote:
> I suppose if you can find a way to export the contig data into a 
> Bio::SimpleAlign you look at the methods in 
> Bio::Align::DNAStatistics.  SimpleAlign also has some builtin methods 
> like average_percentage_identity, percentage_identity, etc, which may 
> be worth a look.
>
> chris
>
> On Sep 24, 2007, at 2:07 PM, Florent Angly wrote:
>
>> I see... Thanks for the replies Chad and Chris. Then I have two more
>> questions!
>> 1/ Do you know how to get a core dump that could help debug my
>> segmentation fault? I have produced dumps of binary C programs before
>> with gdb. I have used the Perl debugger for Perl scripts. But how to
>> deal with C functions called by Perl?
>> 2/ Is there an easier method to calculate an alignment score in BioPerl
>> than using Bio::Tools::dpAlign? I didn't seem to locate something else,
>> but who knows...
>> I have workarounds for quantifying the quality of the overlap, so
>> calculating a score is not critical for me (though I believe this would
>> be the most accurate/adapted method).
>> Florent
>>
>> Chris Fields wrote:
>>> As Chad mentioned it could be a stack issue, but it might be worth
>>> filing a bug on.  I will note that bioperl-ext has seen very little
>>> use in the last few years, so don't expect it to be fixed unless you
>>> can contact the ext module author.
>>>
>>> chris
>>>
>>> On Sep 22, 2007, at 8:41 PM, Florent Angly wrote:
>>>
>>>> Eventually, I gave Bio::Tools::dpAlign a try. I had no luck running it
>>>> when installing its dependency, bioperl-ext v1.4 or v1.5.1. However 
>>>> all
>>>> the tests passed when installing the CVS version.
>>>> So finally, here I am trying to score my alignments. For alignments 
>>>> of 2
>>>> small sequences, it works, but as soon as the sequences get bigger 
>>>> than
>>>> a few dozen nucleotides, it crashes:
>>>> Segmentation fault (core dumped)
>>>>
>>>> I did not find any help in the documentation...
>>>>
>>>> Can I fix this? Is this a bug?
>>>>
>>>> Thanks for your help,
>>>>
>>>> Florent
>>>>
>>>> Florent Angly wrote:
>>>>> Hi,
>>>>> I need to quantify how good some overlaps in contigs are. I have
>>>>> extracted the alignment of the overlapping region and only need to
>>>>> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
>>>>> Is it the right tool for the right tool? Is there anything else?
>>>>> Thank you,
>>>>> Florent
>>>>>
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>> Christopher Fields
>>> Postdoctoral Researcher
>>> Lab of Dr. Robert Switzer
>>> Dept of Biochemistry
>>> University of Illinois Urbana-Champaign
>>>
>>>
>>>
>>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
>



From bix at sendu.me.uk  Tue Sep 25 06:00:20 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 25 Sep 2007 11:00:20 +0100
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
Message-ID: <46F8DC34.6020908@sendu.me.uk>

Hilmar Lapp wrote:
> On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:
>> I think that'll work fine.  The other option would be call a
>> print_gff_header() function within write_feature() with the intent to
>> print the header only once, using a flag or similar:
>>
>> if (!$self->header_printed) {
>>      $self->print_gff_header;
>>      $self->header_printed(1);
>> }
 >
> I'd lean toward this or a similar approach too. Writing stuff out in the 
> constructor doesn't feel like the best design.

I'd argue that the alternative is just inefficient with no compensating 
benefit. You have something that must only be done once, and a method 
(_initialize) that is only called once. The constructor is used to set 
up the file, getting it into a state ready to add features. This 
involves opening it for writing with the correct filename and setting 
the desired GFF version. Why wouldn't it also output what ever else was 
necessary it initialize the file?

Also, what do we expect should happen when we use Bioperl to create a 
GFF file and don't write any features to it? Should it be an empty file, 
or should it contain whatever GFF information the user had managed to 
supply (the version)?


From cjfields at uiuc.edu  Tue Sep 25 10:14:04 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 25 Sep 2007 09:14:04 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <46F8DC34.6020908@sendu.me.uk>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
Message-ID: <22FB7AE5-2E1C-450C-A48C-6014CC5EB786@uiuc.edu>


On Sep 25, 2007, at 5:00 AM, Sendu Bala wrote:

> Hilmar Lapp wrote:
>> On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:
>>> I think that'll work fine.  The other option would be call a
>>> print_gff_header() function within write_feature() with the  
>>> intent to
>>> print the header only once, using a flag or similar:
>>>
>>> if (!$self->header_printed) {
>>>      $self->print_gff_header;
>>>      $self->header_printed(1);
>>> }
>>
>> I'd lean toward this or a similar approach too. Writing stuff out  
>> in the
>> constructor doesn't feel like the best design.
>
> I'd argue that the alternative is just inefficient with no  
> compensating
> benefit. You have something that must only be done once, and a method
> (_initialize) that is only called once. The constructor is used to set
> up the file, getting it into a state ready to add features. This
> involves opening it for writing with the correct filename and setting
> the desired GFF version. Why wouldn't it also output what ever else  
> was
> necessary it initialize the file?

It's great to have someone picking this up, so anything that works is  
fine by me, to tell the truth.  I'll state my piece, though, and  
stand out of the way.

In my opinion there are a couple of compensating benefits.  One is  
long-term maintenance, primarily being all calls to generate output  
are contained within the write_features method and are thus easier to  
find and more maintainable.  The logic goes, if there were a bug I  
would expect to find output in a write_* method or a method called  
from within write_* method, not in the constructor or something  
called from the constructor, like _initialize().  I've always been  
told the constructor in any OO language is typically limited to  
setting state data and behavior, not generating new data (i.e.  
generating output).

Related to that, the other benefit is expected behavior when calling  
a method.  I don't know of cases in other IO classes in Bioperl which  
generate output when a new() instance is created; output is expected  
specifically when calling a particular write_* method.  Therefore I  
wouldn't expect any output be generated until write_feature() were  
called (or calling similarly named methods where output would be  
expected, like a print_* method).

Saying all that, I'm probably not the best one to bang the 'best  
practices' drum right now as I haven't had time to finish up several  
modules I've been working on!  Speaking of (going back to work...)

> Also, what do we expect should happen when we use Bioperl to create a
> GFF file and don't write any features to it? Should it be an empty  
> file,
> or should it contain whatever GFF information the user had managed to
> supply (the version)?

As mentioned above, I would expect no output generated at all unless  
explicitly calling write_features(), just like any of the other IOs;  
the header info would be generated then.  BioPerl has traditionally  
been for whatever works though, which is fine by me.

chris


From forrest_zhang at 163.com  Thu Sep 27 03:41:44 2007
From: forrest_zhang at 163.com (Forrest)
Date: Thu, 27 Sep 2007 15:41:44 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
Message-ID: <000501c800d9$dc9c8e90$95d5abb0$@com>

Hi, all
    I install the biosql, and bioperl-db. I want to import swissport data.
But the programe show some error as below:
============================================================================
===============================================
>perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
-namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
Loading /home/forrest/uniprot/uniprot_sprot.dat ...
Could not store Q6DAH5:
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: The supplied lineage does not start near 'Erwinia carotovora subsp.
atroseptica' (I was supplied 'Erwinia carotovora subsp. | Pectobacterium |
Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
Proteobacteria | Bacteria')
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
STACK: Bio::Species::classification
/usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:552
STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:1305
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:973
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:852
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:182
STACK: Bio::DB::Persistent::PersistentObject::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:244
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:169
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:251
STACK: Bio::DB::Persistent::PersistentObject::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:271
STACK: load_seqdatabase.pl:620
-----------------------------------------------------------

 at load_seqdatabase.pl line 633
============================================================================
===============================================

How can I solve it, please help me, Thank you.

Thanks
Forrest zhang





From bix at sendu.me.uk  Thu Sep 27 04:38:00 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 27 Sep 2007 09:38:00 +0100
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000501c800d9$dc9c8e90$95d5abb0$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
Message-ID: <46FB6BE8.9050203@sendu.me.uk>

Forrest wrote:
> Hi, all
>     I install the biosql, and bioperl-db. I want to import swissport data.
> But the programe show some error as below:
> ============================================================================
> ===============================================
>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
> Could not store Q6DAH5:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: The supplied lineage does not start near 'Erwinia carotovora subsp.
> atroseptica' (I was supplied 'Erwinia carotovora subsp. | Pectobacterium |
> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
> Proteobacteria | Bacteria')

From:
OS   Erwinia carotovora subsp. atroseptica (Pectobacterium atrosepticum).
OC   Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales;
OC   Enterobacteriaceae; Pectobacterium.

I'm guessing some oddity in the Swissprot parser where in one place it 
truncates the OS to the first '.', and in another it doesn't?

Can someone confirm this with CVS versions of bioperl-live and -db in 
case Chris already fixed it in recent parser changes?


From cjfields at uiuc.edu  Thu Sep 27 08:47:00 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 07:47:00 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <46FB6BE8.9050203@sendu.me.uk>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<46FB6BE8.9050203@sendu.me.uk>
Message-ID: <AB3D3A39-0B66-4C22-9EE1-98429A958598@uiuc.edu>


On Sep 27, 2007, at 3:38 AM, Sendu Bala wrote:

> Forrest wrote:
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import  
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora  
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |  
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>
> From:
> OS   Erwinia carotovora subsp. atroseptica (Pectobacterium  
> atrosepticum).
> OC   Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales;
> OC   Enterobacteriaceae; Pectobacterium.
>
> I'm guessing some oddity in the Swissprot parser where in one place it
> truncates the OS to the first '.', and in another it doesn't?
>
> Can someone confirm this with CVS versions of bioperl-live and -db in
> case Chris already fixed it in recent parser changes?

It looks suspiciously like he isn't using bioperl-live code (I  
changed the exception to a warning a while back, and I think the '.'  
truncation was fixed).  This is still an outstanding issue with  
bioperl-db which hasn't been fully fixed yet, though; we may have to  
move the priority up on this one.

chris


From bix at sendu.me.uk  Thu Sep 27 09:47:06 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 27 Sep 2007 14:47:06 +0100
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
Message-ID: <46FBB45A.10505@sendu.me.uk>

I want to create a Bio::SeqFeature::Annotated object where the 'type' is 
'conserved_region'.

I got the idea that 'conserved_region' might be ok from here:
http://song.sourceforge.net/SOterm_tables.html#SO:0000330

However, this doesn't work since:

------------- EXCEPTION -------------
MSG: couldn't find a SOFA term matching type 'conserved_region'.
STACK Bio::SeqFeature::Annotated::type 
/data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/Annotated.pm:371
[snip]


I'm guessing Bio::Ontology::OntologyStore is getting its allowed SOFA 
terms from:
http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition


I don't know much about this area. Can someone offer a little guidance 
as to what the significance of these two different files is, why they 
don't contain the same terms, and why I can't use 'conserved_region'?

What's the closest alternative term?


From cain.cshl at gmail.com  Thu Sep 27 10:20:50 2007
From: cain.cshl at gmail.com (Scott Cain)
Date: Thu, 27 Sep 2007 10:20:50 -0400
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
In-Reply-To: <46FBB45A.10505@sendu.me.uk>
References: <46FBB45A.10505@sendu.me.uk>
Message-ID: <1190902850.12078.26.camel@localhost.localdomain>

Hi Sendu,

I believe that BSFA uses SOFA but the growing consensus is that SOFA
should be pitched and all of SO should be used where SOFA was being
used.  I also suspect that BioPerl is using a very old version of SOFA,
since at the time BSFA was written, BioPerl couldn't parse OBO files
(can it now?), so it was using the very old file format (whose name I
can't even remember now) and that file hasn't been updated in a long
time (which is why it isn't finding conserved_region).

If BioPerl can parse OBO files, we should switch BSFA to validate
against 

http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo

Scott


On Thu, 2007-09-27 at 14:47 +0100, Sendu Bala wrote:
> I want to create a Bio::SeqFeature::Annotated object where the 'type' is 
> 'conserved_region'.
> 
> I got the idea that 'conserved_region' might be ok from here:
> http://song.sourceforge.net/SOterm_tables.html#SO:0000330
> 
> However, this doesn't work since:
> 
> ------------- EXCEPTION -------------
> MSG: couldn't find a SOFA term matching type 'conserved_region'.
> STACK Bio::SeqFeature::Annotated::type 
> /data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/Annotated.pm:371
> [snip]
> 
> 
> I'm guessing Bio::Ontology::OntologyStore is getting its allowed SOFA 
> terms from:
> http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition
> 
> 
> I don't know much about this area. Can someone offer a little guidance 
> as to what the significance of these two different files is, why they 
> don't contain the same terms, and why I can't use 'conserved_region'?
> 
> What's the closest alternative term?
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain at cshl.edu
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory



From cjfields at uiuc.edu  Thu Sep 27 11:25:13 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 10:25:13 -0500
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
In-Reply-To: <1190902850.12078.26.camel@localhost.localdomain>
References: <46FBB45A.10505@sendu.me.uk>
	<1190902850.12078.26.camel@localhost.localdomain>
Message-ID: <29DFE331-33F5-47ED-9A6D-AF488E5F0689@uiuc.edu>


On Sep 27, 2007, at 9:20 AM, Scott Cain wrote:

> Hi Sendu,
>
> I believe that BSFA uses SOFA but the growing consensus is that SOFA
> should be pitched and all of SO should be used where SOFA was being
> used.  I also suspect that BioPerl is using a very old version of  
> SOFA,
> since at the time BSFA was written, BioPerl couldn't parse OBO files
> (can it now?), so it was using the very old file format (whose name I
> can't even remember now) and that file hasn't been updated in a long
> time (which is why it isn't finding conserved_region).
>
> If BioPerl can parse OBO files, we should switch BSFA to validate
> against
>
> http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo
>
> Scott

I agree, this would definitely be for the best.  BioPerl can parse  
obo; not sure how often it's used or what the tests are like, but  
switching to SO should give it a good workout and might wring out any  
issues.

chris

> On Thu, 2007-09-27 at 14:47 +0100, Sendu Bala wrote:
>> I want to create a Bio::SeqFeature::Annotated object where the  
>> 'type' is
>> 'conserved_region'.
>>
>> I got the idea that 'conserved_region' might be ok from here:
>> http://song.sourceforge.net/SOterm_tables.html#SO:0000330
>>
>> However, this doesn't work since:
>>
>> ------------- EXCEPTION -------------
>> MSG: couldn't find a SOFA term matching type 'conserved_region'.
>> STACK Bio::SeqFeature::Annotated::type
>> /data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/ 
>> Annotated.pm:371
>> [snip]
>>
>>
>> I'm guessing Bio::Ontology::OntologyStore is getting its allowed SOFA
>> terms from:
>> http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition
>>
>>
>> I don't know much about this area. Can someone offer a little  
>> guidance
>> as to what the significance of these two different files is, why they
>> don't contain the same terms, and why I can't use 'conserved_region'?
>>
>> What's the closest alternative term?
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> -- 
> ---------------------------------------------------------------------- 
> --
> Scott Cain, Ph. D.                                          
> cain at cshl.edu
> GMOD Coordinator (http://www.gmod.org/)                      
> 216-392-3087
> Cold Spring Harbor Laboratory
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Research Associate
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From cain.cshl at gmail.com  Thu Sep 27 11:34:57 2007
From: cain.cshl at gmail.com (Scott Cain)
Date: Thu, 27 Sep 2007 11:34:57 -0400
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
In-Reply-To: <29DFE331-33F5-47ED-9A6D-AF488E5F0689@uiuc.edu>
References: <46FBB45A.10505@sendu.me.uk>
	<1190902850.12078.26.camel@localhost.localdomain>
	<29DFE331-33F5-47ED-9A6D-AF488E5F0689@uiuc.edu>
Message-ID: <1190907297.12078.32.camel@localhost.localdomain>

OK--while I would normal volunteer to do this, I don't think I am going
to have time until after the Genome Informatics and GMOD meetings in
November :-/  If it is still not done then, somebody poke me and remind
me that I said that.

Scott


On Thu, 2007-09-27 at 10:25 -0500, Chris Fields wrote:
> On Sep 27, 2007, at 9:20 AM, Scott Cain wrote:
> 
> > Hi Sendu,
> >
> > I believe that BSFA uses SOFA but the growing consensus is that SOFA
> > should be pitched and all of SO should be used where SOFA was being
> > used.  I also suspect that BioPerl is using a very old version of  
> > SOFA,
> > since at the time BSFA was written, BioPerl couldn't parse OBO files
> > (can it now?), so it was using the very old file format (whose name I
> > can't even remember now) and that file hasn't been updated in a long
> > time (which is why it isn't finding conserved_region).
> >
> > If BioPerl can parse OBO files, we should switch BSFA to validate
> > against
> >
> > http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo
> >
> > Scott
> 
> I agree, this would definitely be for the best.  BioPerl can parse  
> obo; not sure how often it's used or what the tests are like, but  
> switching to SO should give it a good workout and might wring out any  
> issues.
> 
> chris
> 
> > On Thu, 2007-09-27 at 14:47 +0100, Sendu Bala wrote:
> >> I want to create a Bio::SeqFeature::Annotated object where the  
> >> 'type' is
> >> 'conserved_region'.
> >>
> >> I got the idea that 'conserved_region' might be ok from here:
> >> http://song.sourceforge.net/SOterm_tables.html#SO:0000330
> >>
> >> However, this doesn't work since:
> >>
> >> ------------- EXCEPTION -------------
> >> MSG: couldn't find a SOFA term matching type 'conserved_region'.
> >> STACK Bio::SeqFeature::Annotated::type
> >> /data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/ 
> >> Annotated.pm:371
> >> [snip]
> >>
> >>
> >> I'm guessing Bio::Ontology::OntologyStore is getting its allowed SOFA
> >> terms from:
> >> http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition
> >>
> >>
> >> I don't know much about this area. Can someone offer a little  
> >> guidance
> >> as to what the significance of these two different files is, why they
> >> don't contain the same terms, and why I can't use 'conserved_region'?
> >>
> >> What's the closest alternative term?
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > -- 
> > ---------------------------------------------------------------------- 
> > --
> > Scott Cain, Ph. D.                                          
> > cain at cshl.edu
> > GMOD Coordinator (http://www.gmod.org/)                      
> > 216-392-3087
> > Cold Spring Harbor Laboratory
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> Christopher Fields
> Research Associate
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
> 
> 
> 
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   cain.cshl at gmail.com
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory




From cjfields at uiuc.edu  Thu Sep 27 11:43:06 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 10:43:06 -0500
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
In-Reply-To: <1190907297.12078.32.camel@localhost.localdomain>
References: <46FBB45A.10505@sendu.me.uk>
	<1190902850.12078.26.camel@localhost.localdomain>
	<29DFE331-33F5-47ED-9A6D-AF488E5F0689@uiuc.edu>
	<1190907297.12078.32.camel@localhost.localdomain>
Message-ID: <FE3DC3B9-E202-4C92-9618-90D0BF4E3B52@uiuc.edu>

Actually, I just added 'Sequence Ontology OBO' to  
Bio::Ontology::DocumentRegistry and switched BSFA over to use that in  
bioperl-live.  So far it still passes tests checking SO using obo.   
Sendu, does that work or crash-and-burn?

chris

On Sep 27, 2007, at 10:34 AM, Scott Cain wrote:

> OK--while I would normal volunteer to do this, I don't think I am  
> going
> to have time until after the Genome Informatics and GMOD meetings in
> November :-/  If it is still not done then, somebody poke me and  
> remind
> me that I said that.
>
> Scott
>
>
> On Thu, 2007-09-27 at 10:25 -0500, Chris Fields wrote:
>> On Sep 27, 2007, at 9:20 AM, Scott Cain wrote:
>>
>>> Hi Sendu,
>>>
>>> I believe that BSFA uses SOFA but the growing consensus is that SOFA
>>> should be pitched and all of SO should be used where SOFA was being
>>> used.  I also suspect that BioPerl is using a very old version of
>>> SOFA,
>>> since at the time BSFA was written, BioPerl couldn't parse OBO files
>>> (can it now?), so it was using the very old file format (whose  
>>> name I
>>> can't even remember now) and that file hasn't been updated in a long
>>> time (which is why it isn't finding conserved_region).
>>>
>>> If BioPerl can parse OBO files, we should switch BSFA to validate
>>> against
>>>
>>> http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo
>>>
>>> Scott
>>
>> I agree, this would definitely be for the best.  BioPerl can parse
>> obo; not sure how often it's used or what the tests are like, but
>> switching to SO should give it a good workout and might wring out any
>> issues.
>>
>> chris
>>
>>> On Thu, 2007-09-27 at 14:47 +0100, Sendu Bala wrote:
>>>> I want to create a Bio::SeqFeature::Annotated object where the
>>>> 'type' is
>>>> 'conserved_region'.
>>>>
>>>> I got the idea that 'conserved_region' might be ok from here:
>>>> http://song.sourceforge.net/SOterm_tables.html#SO:0000330
>>>>
>>>> However, this doesn't work since:
>>>>
>>>> ------------- EXCEPTION -------------
>>>> MSG: couldn't find a SOFA term matching type 'conserved_region'.
>>>> STACK Bio::SeqFeature::Annotated::type
>>>> /data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/
>>>> Annotated.pm:371
>>>> [snip]
>>>>
>>>>
>>>> I'm guessing Bio::Ontology::OntologyStore is getting its allowed  
>>>> SOFA
>>>> terms from:
>>>> http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition
>>>>
>>>>
>>>> I don't know much about this area. Can someone offer a little
>>>> guidance
>>>> as to what the significance of these two different files is, why  
>>>> they
>>>> don't contain the same terms, and why I can't use  
>>>> 'conserved_region'?
>>>>
>>>> What's the closest alternative term?
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>> -- 
>>> -------------------------------------------------------------------- 
>>> --
>>> --
>>> Scott Cain, Ph. D.
>>> cain at cshl.edu
>>> GMOD Coordinator (http://www.gmod.org/)
>>> 216-392-3087
>>> Cold Spring Harbor Laboratory
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Research Associate
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
> -- 
> ---------------------------------------------------------------------- 
> --
> Scott Cain, Ph. D.                                    
> cain.cshl at gmail.com
> GMOD Coordinator (http://www.gmod.org/)                      
> 216-392-3087
> Cold Spring Harbor Laboratory
>
>

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From hlapp at gmx.net  Thu Sep 27 18:17:16 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu, 27 Sep 2007 18:17:16 -0400
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000501c800d9$dc9c8e90$95d5abb0$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
Message-ID: <2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>

Forrest,

have you preloaded the NCBI taxonomy as suggested in the BioSQL  
installation guidelines? SwissProt format has NCBI taxon IDs, and the  
code will try to use it to look up species and their lineage, rather  
than inserting the lineage from whatever BioPerl parses out of the  
sequence record.

	-hilmar

On Sep 27, 2007, at 3:41 AM, Forrest wrote:

> Hi, all
>     I install the biosql, and bioperl-db. I want to import  
> swissport data.
> But the programe show some error as below:
> ====================================================================== 
> ======
> ===============================================
>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
> Could not store Q6DAH5:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: The supplied lineage does not start near 'Erwinia carotovora  
> subsp.
> atroseptica' (I was supplied 'Erwinia carotovora subsp. |  
> Pectobacterium |
> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
> Proteobacteria | Bacteria')
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
> STACK: Bio::Species::classification
> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:552
> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:1305
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:973
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:852
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:182
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: load_seqdatabase.pl:620
> -----------------------------------------------------------
>
>  at load_seqdatabase.pl line 633
> ====================================================================== 
> ======
> ===============================================
>
> How can I solve it, please help me, Thank you.
>
> Thanks
> Forrest zhang
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From wcnelson at usc.edu  Thu Sep 27 15:20:47 2007
From: wcnelson at usc.edu (William C. Nelson)
Date: Thu, 27 Sep 2007 15:20:47 -0400
Subject: [Bioperl-l] cpan install
Message-ID: <46FC028F.3050000@usc.edu>

Hello,

I tried to install v1.5.2 using cpan.

My urllist looks like:

cpan[2]> o conf urllist
    urllist
        0 [ftp://cpan.cs.utah.edu/pub/CPAN/]
        1 [ftp://cpan.mirrors.tds.net/pub/CPAN]
        2 [ftp://ftp.open-bio.org/pub/bioperl/DIST/]
Type 'o conf' to view all configuration items


And when I look for bioperl, I see:

cpan[1]> d /bioperl/
CPAN: Storable loaded ok (v2.16)
Going to read /root/.cpan/Metadata
  Database was generated on Thu, 27 Sep 2007 18:36:44 GMT
Distribution    BIRNEY/bioperl-1.2.1.tar.gz
Distribution    BIRNEY/bioperl-1.2.2.tar.gz
Distribution    BIRNEY/bioperl-1.2.3.tar.gz
Distribution    BIRNEY/bioperl-1.2.tar.gz
Distribution    BIRNEY/bioperl-1.4.tar.gz
Distribution    BIRNEY/bioperl-db-0.1.tar.gz
Distribution    BIRNEY/bioperl-ext-1.4.tar.gz
Distribution    BIRNEY/bioperl-gui-0.7.tar.gz
Distribution    BIRNEY/bioperl-run-1.2.2.tar.gz
Distribution    BIRNEY/bioperl-run-1.4.tar.gz
Distribution    BOZO/Fry-Lib-BioPerl-0.15.tar.gz
Distribution    CRAFFI/Bundle-BioPerl-2.1.8.tar.gz
12 items found


No v 1.5.2.  This may be because it can't see the distribution at 
ftp://ftp.open-bio.org/pub/bioperl/DIST/. When I try to reload the 
index, I get messages saying cpan can't find the files 
ftp://ftp.open-bio.org/pub/bioperl/DIST/authors/01mailrc.txt.gz or 
ftp://ftp.open-bio.org/pub/bioperl/DIST/modules/02packages.details.txt.gz 
or ftp://ftp.open-bio.org/pub/bioperl/DIST/modules/03modlist.data.gz.

Am I doing something wrong?
Does the FTP site need to be updated?

Thanks,
Bill

-- 
-----------------------------------------------------
William C. Nelson, PhD
Research Asst Professor
Wrigely Institute for Environmental Studies
University of Southern California LAS/MEB
310-510-4097
wcnelson at usc.edu



From wgallin at ualberta.ca  Thu Sep 27 22:51:12 2007
From: wgallin at ualberta.ca (Warren Gallin)
Date: Thu, 27 Sep 2007 20:51:12 -0600
Subject: [Bioperl-l] A couple Eutilities questions
Message-ID: <98B80D80-AF6F-424B-81B7-5B0CFD8D6CB2@ualberta.ca>

I've just started using Bio::DB::Eutilities and I have encountered  
two things that seem like problems.

I am using the latest (retrieved Wednesday September 26, 2007) CVS  
version, running in an Apple Xserver.

Problem 1:  When I execute the following code:


#Create new EUTILS object for retrieving sets of entries, given an  
array of accession numbers
	my $gpeptfactory = Bio::DB::EUtilities -> new(	-eutil => 'efetch',
													-db => 'protein',
													-rettype =>'genbank',
													-id => \@pro_acc) ;
	my $file = 'temp_hold.gb';
	
	$gpeptfactory -> get_Response(-file => $file);
	
	my $retr_seq = Bio::SeqIO->new(	-file => $file,
                             		-format => 'genbank');


I get the following warning, consistently:

Use of uninitialized value in concatenation (.) or string at /Library/ 
Perl/5.8.1/Bio/DB/GenericWebAgent.pm line 92.


Also, about half the time I get a crash with the following error  
message:


------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Response Error
Bad Gateway
STACK: Error::throw
STACK: Bio::Root::Root::throw /Library/Perl/5.8.1/Bio/Root/Root.pm:357
STACK: Bio::DB::GenericWebAgent::get_Response /Library/Perl/5.8.1/Bio/ 
DB/GenericWebAgent.pm:184
STACK: gb_update_v4.pl:118
-----------------------------------------------------------



The other half of the time the script runs fine through to the end.   
I have no idea whether the crash is related to the warning or not.  I  
looked at the line where the warning is generated, and it appears to  
be the "new" method for the GenericWebAgent.pm  .  I can't see how  
the call to Eutilities is can be passing an undefined value through  
to this method.


Problem #2:

When the code runs, I retrieve an incorrect record.  I am retrieving  
using accessions, and accession I51532 retrieves two records.  One is  
the record I am after, an ion channel protein, the other comes from a  
patent application; the problem is that, although the accession  
number for the unwanted record is AAB76204, the LOCUS entry in the  
record is I51532.

So, is it possible that the efetch function is collecting on the  
basis of LOCUS, not ACCESSION?  I realize that the two are almost  
always the same, but not apparently in this case.

Any advice and/or explanation is appreciated.

Warren Gallin


From forrest_zhang at 163.com  Thu Sep 27 22:50:53 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 10:50:53 +0800
Subject: [Bioperl-l] cpan install
In-Reply-To: <46FC028F.3050000@usc.edu>
References: <46FC028F.3050000@usc.edu>
Message-ID: <000001c8017a$6384bae0$2a8e30a0$@com>

Try 
cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz

other question you should browse
http://www.bioperl.org/wiki/Installing_Bioperl_for_Unix

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of William C. Nelson
Sent: Friday, September 28, 2007 3:21 AM
To: bioperl-l at bioperl.org
Subject: [Bioperl-l] cpan install

Hello,

I tried to install v1.5.2 using cpan.

My urllist looks like:

cpan[2]> o conf urllist
    urllist
        0 [ftp://cpan.cs.utah.edu/pub/CPAN/]
        1 [ftp://cpan.mirrors.tds.net/pub/CPAN]
        2 [ftp://ftp.open-bio.org/pub/bioperl/DIST/]
Type 'o conf' to view all configuration items


And when I look for bioperl, I see:

cpan[1]> d /bioperl/
CPAN: Storable loaded ok (v2.16)
Going to read /root/.cpan/Metadata
  Database was generated on Thu, 27 Sep 2007 18:36:44 GMT
Distribution    BIRNEY/bioperl-1.2.1.tar.gz
Distribution    BIRNEY/bioperl-1.2.2.tar.gz
Distribution    BIRNEY/bioperl-1.2.3.tar.gz
Distribution    BIRNEY/bioperl-1.2.tar.gz
Distribution    BIRNEY/bioperl-1.4.tar.gz
Distribution    BIRNEY/bioperl-db-0.1.tar.gz
Distribution    BIRNEY/bioperl-ext-1.4.tar.gz
Distribution    BIRNEY/bioperl-gui-0.7.tar.gz
Distribution    BIRNEY/bioperl-run-1.2.2.tar.gz
Distribution    BIRNEY/bioperl-run-1.4.tar.gz
Distribution    BOZO/Fry-Lib-BioPerl-0.15.tar.gz
Distribution    CRAFFI/Bundle-BioPerl-2.1.8.tar.gz
12 items found


No v 1.5.2.  This may be because it can't see the distribution at 
ftp://ftp.open-bio.org/pub/bioperl/DIST/. When I try to reload the 
index, I get messages saying cpan can't find the files 
ftp://ftp.open-bio.org/pub/bioperl/DIST/authors/01mailrc.txt.gz or 
ftp://ftp.open-bio.org/pub/bioperl/DIST/modules/02packages.details.txt.gz 
or ftp://ftp.open-bio.org/pub/bioperl/DIST/modules/03modlist.data.gz.

Am I doing something wrong?
Does the FTP site need to be updated?

Thanks,
Bill

-- 
-----------------------------------------------------
William C. Nelson, PhD
Research Asst Professor
Wrigely Institute for Environmental Studies
University of Southern California LAS/MEB
310-510-4097
wcnelson at usc.edu

_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





From forrest_zhang at 163.com  Thu Sep 27 23:15:03 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 11:15:03 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
Message-ID: <000101c8017d$c4643360$4d2c9a20$@com>

Hilmar,
	I have already pre-loaded the NCBI taxonomy using
load_ncbi_taxonomy.pl yet. The error message show:

--------------------- WARNING ---------------------
MSG: The supplied lineage does not start near 'Phaseolus aureus' (I was
supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I | rosids
| core eudicotyledons | eudicotyledons | Magnoliophyta | Euphyllophyta |
Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
---------------------------------------------------
Could not store Q40784: 
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: create: object (Bio::Species) failed to insert or to be found by unique
key
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:206
STACK: Bio::DB::Persistent::PersistentObject::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:244
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:169
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:251
STACK: Bio::DB::Persistent::PersistentObject::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:271
STACK: /usr/bin/bp_load_seqdatabase.pl:633
-----------------------------------------------------------
Sigh~~~~~~

Forrest Zhang


-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
Sent: Friday, September 28, 2007 6:17 AM
To: Forrest
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

Forrest,

have you preloaded the NCBI taxonomy as suggested in the BioSQL  
installation guidelines? SwissProt format has NCBI taxon IDs, and the  
code will try to use it to look up species and their lineage, rather  
than inserting the lineage from whatever BioPerl parses out of the  
sequence record.

	-hilmar

On Sep 27, 2007, at 3:41 AM, Forrest wrote:

> Hi, all
>     I install the biosql, and bioperl-db. I want to import  
> swissport data.
> But the programe show some error as below:
> ====================================================================== 
> ======
> ===============================================
>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
> Could not store Q6DAH5:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: The supplied lineage does not start near 'Erwinia carotovora  
> subsp.
> atroseptica' (I was supplied 'Erwinia carotovora subsp. |  
> Pectobacterium |
> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
> Proteobacteria | Bacteria')
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
> STACK: Bio::Species::classification
> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:552
> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:1305
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:973
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:852
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:182
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: load_seqdatabase.pl:620
> -----------------------------------------------------------
>
>  at load_seqdatabase.pl line 633
> ====================================================================== 
> ======
> ===============================================
>
> How can I solve it, please help me, Thank you.
>
> Thanks
> Forrest zhang
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================





_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





From forrest_zhang at 163.com  Thu Sep 27 23:33:21 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 11:33:21 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000101c8017d$c4643360$4d2c9a20$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
Message-ID: <000201c80180$54762650$fd6272f0$@com>

I reinstall the bioperl-db, I found some error.

t/01dbadaptor.....ok

t/02species.......FAILED tests 66-95

        Failed 30/65 tests, 53.85% okay
t/03simpleseq.....ok

t/04swiss.........ok

t/05seqfeature....ok

t/06comment.......ok

t/07dblink........ok

t/08genbank.......ok

t/09fuzzy2........ok

t/10ensembl.......ok

t/11locuslink.....ok

t/12ontology......ok

t/13remove........ok

t/14query.........ok

t/15cluster.......ok 9/160

--------------------- WARNING ---------------------
MSG: failed to store one or more child objects for an instance of class
Bio::Cluster::UniGene (PK=320)
---------------------------------------------------
t/15cluster.......ok

t/16obda..........ok

Failed Test   Stat Wstat Total Fail  List of Failed
----------------------------------------------------------------------------
---
t/02species.t               65   30  66-95
Failed 1/16 test scripts. -30/1423 subtests failed.
Files=16, Tests=1423, 35 wallclock secs (16.67 cusr +  0.63 csys = 17.30
CPU)
Failed 1/16 test programs. -30/1423 subtests failed.
make: *** [test] Error 255

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Forrest Zhang
Sent: Friday, September 28, 2007 11:15 AM
To: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

Hilmar,
	I have already pre-loaded the NCBI taxonomy using
load_ncbi_taxonomy.pl yet. The error message show:

--------------------- WARNING ---------------------
MSG: The supplied lineage does not start near 'Phaseolus aureus' (I was
supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I | rosids
| core eudicotyledons | eudicotyledons | Magnoliophyta | Euphyllophyta |
Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
---------------------------------------------------
Could not store Q40784: 
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: create: object (Bio::Species) failed to insert or to be found by unique
key
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:206
STACK: Bio::DB::Persistent::PersistentObject::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:244
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:169
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:251
STACK: Bio::DB::Persistent::PersistentObject::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:271
STACK: /usr/bin/bp_load_seqdatabase.pl:633
-----------------------------------------------------------
Sigh~~~~~~

Forrest Zhang


-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
Sent: Friday, September 28, 2007 6:17 AM
To: Forrest
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

Forrest,

have you preloaded the NCBI taxonomy as suggested in the BioSQL  
installation guidelines? SwissProt format has NCBI taxon IDs, and the  
code will try to use it to look up species and their lineage, rather  
than inserting the lineage from whatever BioPerl parses out of the  
sequence record.

	-hilmar

On Sep 27, 2007, at 3:41 AM, Forrest wrote:

> Hi, all
>     I install the biosql, and bioperl-db. I want to import  
> swissport data.
> But the programe show some error as below:
> ====================================================================== 
> ======
> ===============================================
>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
> Could not store Q6DAH5:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: The supplied lineage does not start near 'Erwinia carotovora  
> subsp.
> atroseptica' (I was supplied 'Erwinia carotovora subsp. |  
> Pectobacterium |
> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
> Proteobacteria | Bacteria')
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
> STACK: Bio::Species::classification
> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:552
> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:1305
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:973
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:852
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:182
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: load_seqdatabase.pl:620
> -----------------------------------------------------------
>
>  at load_seqdatabase.pl line 633
> ====================================================================== 
> ======
> ===============================================
>
> How can I solve it, please help me, Thank you.
>
> Thanks
> Forrest zhang
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================





_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l



_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





From cjfields at uiuc.edu  Fri Sep 28 00:58:27 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 23:58:27 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000201c80180$54762650$fd6272f0$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
	<000201c80180$54762650$fd6272f0$@com>
Message-ID: <9535284F-2DC5-4361-81A2-0B739A7E89E4@uiuc.edu>

Bio::Species will have problems if you test on a database with  
taxonomy loaded (it's mentioned in the install docs I think).

The UniGene warning has always popped up and isn't anything to worry  
about.

chris

On Sep 27, 2007, at 10:33 PM, Forrest Zhang wrote:

> I reinstall the bioperl-db, I found some error.
>
> t/01dbadaptor.....ok
>
> t/02species.......FAILED tests 66-95
>
>         Failed 30/65 tests, 53.85% okay
> t/03simpleseq.....ok
>
> t/04swiss.........ok
>
> t/05seqfeature....ok
>
> t/06comment.......ok
>
> t/07dblink........ok
>
> t/08genbank.......ok
>
> t/09fuzzy2........ok
>
> t/10ensembl.......ok
>
> t/11locuslink.....ok
>
> t/12ontology......ok
>
> t/13remove........ok
>
> t/14query.........ok
>
> t/15cluster.......ok 9/160
>
> --------------------- WARNING ---------------------
> MSG: failed to store one or more child objects for an instance of  
> class
> Bio::Cluster::UniGene (PK=320)
> ---------------------------------------------------
> t/15cluster.......ok
>
> t/16obda..........ok
>
> Failed Test   Stat Wstat Total Fail  List of Failed
> ---------------------------------------------------------------------- 
> ------
> ---
> t/02species.t               65   30  66-95
> Failed 1/16 test scripts. -30/1423 subtests failed.
> Files=16, Tests=1423, 35 wallclock secs (16.67 cusr +  0.63 csys =  
> 17.30
> CPU)
> Failed 1/16 test programs. -30/1423 subtests failed.
> make: *** [test] Error 255
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Forrest  
> Zhang
> Sent: Friday, September 28, 2007 11:15 AM
> To: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From cjfields at uiuc.edu  Fri Sep 28 00:57:55 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 23:57:55 -0500
Subject: [Bioperl-l] A couple Eutilities questions
In-Reply-To: <98B80D80-AF6F-424B-81B7-5B0CFD8D6CB2@ualberta.ca>
References: <98B80D80-AF6F-424B-81B7-5B0CFD8D6CB2@ualberta.ca>
Message-ID: <A8E3D712-1159-43F7-91A6-16BA6103AB7B@uiuc.edu>


On Sep 27, 2007, at 9:51 PM, Warren Gallin wrote:

> I've just started using Bio::DB::Eutilities and I have encountered
> two things that seem like problems.
>
> I am using the latest (retrieved Wednesday September 26, 2007) CVS
> version, running in an Apple Xserver.
>
> Problem 1:  When I execute the following code:
>
>
> #Create new EUTILS object for retrieving sets of entries, given an
> array of accession numbers
> 	my $gpeptfactory = Bio::DB::EUtilities -> new(	-eutil => 'efetch',
> 													-db => 'protein',
> 													-rettype =>'genbank',
> 													-id => \@pro_acc) ;
> 	my $file = 'temp_hold.gb';
> 	
> 	$gpeptfactory -> get_Response(-file => $file);
> 	
> 	my $retr_seq = Bio::SeqIO->new(	-file => $file,
>                              		-format => 'genbank');
>
>
> I get the following warning, consistently:
>
> Use of uninitialized value in concatenation (.) or string at /Library/
> Perl/5.8.1/Bio/DB/GenericWebAgent.pm line 92.

The above works for me w/o problems.  The error itself doesn't make  
much sense; the line is:

     $self->ua(LWP::UserAgent->new(env_proxy => 1,
             agent => ref($self).':'.$self->VERSION));

so either $self isn't a ref (which it appears to be) or there is no  
version (which is odd but may be a perl bug).  What happens if you  
hard-code the version number to something simple?

Also, I noticed you're using perl 5.8.1; which version of Mac OS X  
are you using?  I remember something was off about that perl version  
but I can't remember what it was...

> Also, about half the time I get a crash with the following error
> message:
>
>
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: Response Error
> Bad Gateway
> STACK: Error::throw
> STACK: Bio::Root::Root::throw /Library/Perl/5.8.1/Bio/Root/Root.pm:357
> STACK: Bio::DB::GenericWebAgent::get_Response /Library/Perl/5.8.1/Bio/
> DB/GenericWebAgent.pm:184
> STACK: gb_update_v4.pl:118
> -----------------------------------------------------------

I have seen it sometimes pop up when the NCBI server is under heavy  
server load.  It may also be related to your local ISP or setup; see  
here:

http://www.checkupdown.com/status/E502.html

Supposedly this may pop up with mod_perl but I haven't seen/heard  
anything myself related to this.

> The other half of the time the script runs fine through to the end.
> I have no idea whether the crash is related to the warning or not.  I
> looked at the line where the warning is generated, and it appears to
> be the "new" method for the GenericWebAgent.pm  .  I can't see how
> the call to Eutilities is can be passing an undefined value through
> to this method.

EUtilities is-a GenericWebAgent; the new() constructors are chained  
using SUPER::new().  Also, you can call VERSION from any variable so  
it could be a problem there if VERSION is undef, though again I can't  
think why this would fail.  Regardless, the 'Use of undefined'  
warning is not a fatal error.

> Problem #2:
>
> When the code runs, I retrieve an incorrect record.  I am retrieving
> using accessions, and accession I51532 retrieves two records.  One is
> the record I am after, an ion channel protein, the other comes from a
> patent application; the problem is that, although the accession
> number for the unwanted record is AAB76204, the LOCUS entry in the
> record is I51532.
>
> So, is it possible that the efetch function is collecting on the
> basis of LOCUS, not ACCESSION?  I realize that the two are almost
> always the same, but not apparently in this case.
>
> Any advice and/or explanation is appreciated.
>
> Warren Gallin

The only means NCBI guarantees to retrieve a unique record every time  
is by using the primary ID, which for sequence records is the GI.   
The accession works most of the time, and efetch accepts accs in the  
place of GI (it's the only eutil that does).  However, every once in  
a while you get stung and retrieve multiple seqs.

BTW, I entered your sequence into Entrez and it popped up as  
discontinued (which could be part of the problem); the current acc is  
Q91781.

chris


From cjfields at uiuc.edu  Fri Sep 28 01:00:18 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 00:00:18 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000101c8017d$c4643360$4d2c9a20$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
Message-ID: <8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>

If this is occurring using bioperl from CVS then I'll try taking a  
look at it.

chris

On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:

> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From forrest_zhang at 163.com  Fri Sep 28 01:34:21 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 13:34:21 +0800
Subject: [Bioperl-l] FW:  load_seqdatabase.pl error
Message-ID: <000101c80191$3b300e70$b1902b50$@com>

Oh, my God!  I am tring reinstall bioperl-live using CVS, so many error
shown below.

biocc bioperl-live # perl Build.PL 
Checking whether your kit is complete...
Looks good

Checking prerequisites...
Looks good

Checking features:
  BioDBGFF.................enabled
  BioDBSeqFeature_mysql....enabled
  Network..................enabled
  BioDBSeqFeature_BDB......enabled

Install [a]ll Bioperl scripts, [n]one, or choose groups [i]nteractively? [a]

  - will install all scripts

Do you want to run the BioDBGFF live database tests? y/n [n] y
Which database should I use for testing the mysql driver? [test] 
On which host is database 'test' running (hostname, ip address or host:port)
[localhost] 
User name for connecting to database 'test'? [undef] root
Password for connecting to database 'test'? [undef] 
  - will run the BioDBGFF tests with database driver 'mysql' and these
settings:
    Database test
    Host     localhost
    DSN      dbi:mysql:database=test
    User     root
    Password undef

Do you want to run tests that require connection to servers across the
internet
(likely to cause some failures)? y/n [n] y
  - will run internet-requiring tests
Deleting Build
Removed previous script 'Build'

Creating new 'Build' script for 'bioperl' version '1.0050021'
biocc bioperl-live # ./Build test
Copying Bio/Align/Utilities.pm -> blib/lib/Bio/Align/Utilities.pm
Copying Bio/Search/HSP/ModelHSP.pm -> blib/lib/Bio/Search/HSP/ModelHSP.pm
Copying Bio/Ontology/DocumentRegistry.pm ->
blib/lib/Bio/Ontology/DocumentRegistry.pm
Copying Bio/SeqFeature/Annotated.pm -> blib/lib/Bio/SeqFeature/Annotated.pm
Copying Bio/SimpleAlign.pm -> blib/lib/Bio/SimpleAlign.pm
Copying Bio/AlignIO/stockholm.pm -> blib/lib/Bio/AlignIO/stockholm.pm
Copying scripts/utilities/bp_sreformat.PLS -> blib/script/bp_sreformat.PLS
Deleting blib/script/bp_sreformat.PLS.bak
blib/script/bp_sreformat.PLS -> blib/script/bp_sreformat.pl
Copying scripts/graphics/contig_draw.PLS -> blib/script/contig_draw.PLS
Deleting blib/script/contig_draw.PLS.bak
blib/script/contig_draw.PLS -> blib/script/bp_contig_draw.pl
Copying scripts/Bio-DB-GFF/meta_gff.PLS -> blib/script/meta_gff.PLS
Deleting blib/script/meta_gff.PLS.bak
blib/script/meta_gff.PLS -> blib/script/bp_meta_gff.pl
Copying scripts/tree/tree2pag.PLS -> blib/script/tree2pag.PLS
Deleting blib/script/tree2pag.PLS.bak
blib/script/tree2pag.PLS -> blib/script/bp_tree2pag.pl
Copying scripts/Bio-SeqFeature-Store/bp_seqfeature_gff3.PLS ->
blib/script/bp_seqfeature_gff3.PLS
blib/script/bp_seqfeature_gff3.PLS -> blib/script/bp_seqfeature_gff3.pl
Copying scripts/popgen/heterogeneity_test.PLS ->
blib/script/heterogeneity_test.PLS
Deleting blib/script/heterogeneity_test.PLS.bak
blib/script/heterogeneity_test.PLS -> blib/script/bp_heterogeneity_test.pl
Copying scripts/DB/flanks.PLS -> blib/script/flanks.PLS
Deleting blib/script/flanks.PLS.bak
blib/script/flanks.PLS -> blib/script/bp_flanks.pl
Copying scripts/graphics/feature_draw.PLS -> blib/script/feature_draw.PLS
Deleting blib/script/feature_draw.PLS.bak
blib/script/feature_draw.PLS -> blib/script/bp_feature_draw.pl
Copying scripts/DB/biogetseq.PLS -> blib/script/biogetseq.PLS
Deleting blib/script/biogetseq.PLS.bak
blib/script/biogetseq.PLS -> blib/script/bp_biogetseq.pl
Copying scripts/Bio-SeqFeature-Store/bp_seqfeature_load.PLS ->
blib/script/bp_seqfeature_load.PLS
Deleting blib/script/bp_seqfeature_load.PLS.bak
blib/script/bp_seqfeature_load.PLS -> blib/script/bp_seqfeature_load.pl
Copying scripts/searchio/fastam9_to_table.PLS ->
blib/script/fastam9_to_table.PLS
Deleting blib/script/fastam9_to_table.PLS.bak
blib/script/fastam9_to_table.PLS -> blib/script/bp_fastam9_to_table.pl
Copying scripts/utilities/seq_length.PLS -> blib/script/seq_length.PLS
Deleting blib/script/seq_length.PLS.bak
blib/script/seq_length.PLS -> blib/script/bp_seq_length.pl
Copying scripts/Bio-DB-GFF/genbank2gff.PLS -> blib/script/genbank2gff.PLS
Deleting blib/script/genbank2gff.PLS.bak
blib/script/genbank2gff.PLS -> blib/script/bp_genbank2gff.pl
Copying scripts/taxa/taxid4species.PLS -> blib/script/taxid4species.PLS
Deleting blib/script/taxid4species.PLS.bak
blib/script/taxid4species.PLS -> blib/script/bp_taxid4species.pl
Copying scripts/biographics/bp_glyphs1-demo.PLS ->
blib/script/bp_glyphs1-demo.PLS
Deleting blib/script/bp_glyphs1-demo.PLS.bak
blib/script/bp_glyphs1-demo.PLS -> blib/script/bp_glyphs1-demo.pl
Copying scripts/tree/blast2tree.PLS -> blib/script/blast2tree.PLS
Deleting blib/script/blast2tree.PLS.bak
blib/script/blast2tree.PLS -> blib/script/bp_blast2tree.pl
Copying scripts/graphics/frend.PLS -> blib/script/frend.PLS
Deleting blib/script/frend.PLS.bak
blib/script/frend.PLS -> blib/script/bp_frend.pl
Copying scripts/taxa/query_entrez_taxa.PLS ->
blib/script/query_entrez_taxa.PLS
Deleting blib/script/query_entrez_taxa.PLS.bak
blib/script/query_entrez_taxa.PLS -> blib/script/bp_query_entrez_taxa.pl
Copying scripts/biographics/bp_glyphs2-demo.PLS ->
blib/script/bp_glyphs2-demo.PLS
Deleting blib/script/bp_glyphs2-demo.PLS.bak
blib/script/bp_glyphs2-demo.PLS -> blib/script/bp_glyphs2-demo.pl
Copying scripts/taxa/taxonomy2tree.PLS -> blib/script/taxonomy2tree.PLS
Deleting blib/script/taxonomy2tree.PLS.bak
blib/script/taxonomy2tree.PLS -> blib/script/bp_taxonomy2tree.pl
Copying scripts/utilities/search2alnblocks.PLS ->
blib/script/search2alnblocks.PLS
Deleting blib/script/search2alnblocks.PLS.bak
blib/script/search2alnblocks.PLS -> blib/script/bp_search2alnblocks.pl
Copying scripts/utilities/mask_by_search.PLS ->
blib/script/mask_by_search.PLS
Deleting blib/script/mask_by_search.PLS.bak
blib/script/mask_by_search.PLS -> blib/script/bp_mask_by_search.pl
Copying scripts/seqstats/gccalc.PLS -> blib/script/gccalc.PLS
Deleting blib/script/gccalc.PLS.bak
blib/script/gccalc.PLS -> blib/script/bp_gccalc.pl
Copying scripts/popgen/composite_LD.PLS -> blib/script/composite_LD.PLS
Deleting blib/script/composite_LD.PLS.bak
blib/script/composite_LD.PLS -> blib/script/bp_composite_LD.pl
Copying scripts/seqstats/aacomp.PLS -> blib/script/aacomp.PLS
Deleting blib/script/aacomp.PLS.bak
blib/script/aacomp.PLS -> blib/script/bp_aacomp.pl
Copying scripts/Bio-DB-GFF/process_wormbase.PLS ->
blib/script/process_wormbase.PLS
Deleting blib/script/process_wormbase.PLS.bak
blib/script/process_wormbase.PLS -> blib/script/bp_process_wormbase.pl
Copying scripts/taxa/local_taxonomydb_query.PLS ->
blib/script/local_taxonomydb_query.PLS
Deleting blib/script/local_taxonomydb_query.PLS.bak
blib/script/local_taxonomydb_query.PLS ->
blib/script/bp_local_taxonomydb_query.pl
Copying scripts/biblio/biblio.PLS -> blib/script/biblio.PLS
Deleting blib/script/biblio.PLS.bak
blib/script/biblio.PLS -> blib/script/bp_biblio.pl
Copying scripts/biographics/bp_embl2picture.PLS ->
blib/script/bp_embl2picture.PLS
Deleting blib/script/bp_embl2picture.PLS.bak
blib/script/bp_embl2picture.PLS -> blib/script/bp_embl2picture.pl
Copying scripts/Bio-DB-GFF/genbank2gff3.PLS -> blib/script/genbank2gff3.PLS
Deleting blib/script/genbank2gff3.PLS.bak
blib/script/genbank2gff3.PLS -> blib/script/bp_genbank2gff3.pl
Copying scripts/utilities/search2BSML.PLS -> blib/script/search2BSML.PLS
Deleting blib/script/search2BSML.PLS.bak
blib/script/search2BSML.PLS -> blib/script/bp_search2BSML.pl
Copying scripts/seq/seqconvert.PLS -> blib/script/seqconvert.PLS
Deleting blib/script/seqconvert.PLS.bak
blib/script/seqconvert.PLS -> blib/script/bp_seqconvert.pl
Copying scripts/searchio/parse_hmmsearch.PLS ->
blib/script/parse_hmmsearch.PLS
Deleting blib/script/parse_hmmsearch.PLS.bak
blib/script/parse_hmmsearch.PLS -> blib/script/bp_parse_hmmsearch.pl
Copying scripts/index/bp_seqret.PLS -> blib/script/bp_seqret.PLS
Deleting blib/script/bp_seqret.PLS.bak
blib/script/bp_seqret.PLS -> blib/script/bp_seqret.pl
Copying scripts/searchio/filter_search.PLS -> blib/script/filter_search.PLS
Deleting blib/script/filter_search.PLS.bak
blib/script/filter_search.PLS -> blib/script/bp_filter_search.pl
Copying scripts/tree/nexus2nh.PLS -> blib/script/nexus2nh.PLS
Deleting blib/script/nexus2nh.PLS.bak
blib/script/nexus2nh.PLS -> blib/script/bp_nexus2nh.pl
Copying scripts/Bio-DB-GFF/generate_histogram.PLS ->
blib/script/generate_histogram.PLS
Deleting blib/script/generate_histogram.PLS.bak
blib/script/generate_histogram.PLS -> blib/script/bp_generate_histogram.pl
Copying scripts/seq/split_seq.PLS -> blib/script/split_seq.PLS
Deleting blib/script/split_seq.PLS.bak
blib/script/split_seq.PLS -> blib/script/bp_split_seq.pl
Copying scripts/Bio-DB-GFF/load_gff.PLS -> blib/script/load_gff.PLS
Deleting blib/script/load_gff.PLS.bak
blib/script/load_gff.PLS -> blib/script/bp_load_gff.pl
Copying scripts/index/bp_fetch.PLS -> blib/script/bp_fetch.PLS
Deleting blib/script/bp_fetch.PLS.bak
blib/script/bp_fetch.PLS -> blib/script/bp_fetch.pl
Copying scripts/utilities/mutate.PLS -> blib/script/mutate.PLS
Deleting blib/script/mutate.PLS.bak
blib/script/mutate.PLS -> blib/script/bp_mutate.pl
Copying scripts/Bio-DB-GFF/process_sgd.PLS -> blib/script/process_sgd.PLS
Deleting blib/script/process_sgd.PLS.bak
blib/script/process_sgd.PLS -> blib/script/bp_process_sgd.pl
Copying scripts/index/bp_index.PLS -> blib/script/bp_index.PLS
Deleting blib/script/bp_index.PLS.bak
blib/script/bp_index.PLS -> blib/script/bp_index.pl
Copying scripts/utilities/dbsplit.PLS -> blib/script/dbsplit.PLS
Deleting blib/script/dbsplit.PLS.bak
blib/script/dbsplit.PLS -> blib/script/bp_dbsplit.pl
Copying scripts/seqstats/oligo_count.PLS -> blib/script/oligo_count.PLS
Deleting blib/script/oligo_count.PLS.bak
blib/script/oligo_count.PLS -> blib/script/bp_oligo_count.pl
Copying scripts/searchio/hmmer_to_table.PLS ->
blib/script/hmmer_to_table.PLS
Deleting blib/script/hmmer_to_table.PLS.bak
blib/script/hmmer_to_table.PLS -> blib/script/bp_hmmer_to_table.pl
Copying scripts/Bio-DB-GFF/process_gadfly.PLS ->
blib/script/process_gadfly.PLS
Deleting blib/script/process_gadfly.PLS.bak
blib/script/process_gadfly.PLS -> blib/script/bp_process_gadfly.pl
Copying scripts/DB/biofetch_genbank_proxy.PLS ->
blib/script/biofetch_genbank_proxy.PLS
Deleting blib/script/biofetch_genbank_proxy.PLS.bak
blib/script/biofetch_genbank_proxy.PLS ->
blib/script/bp_biofetch_genbank_proxy.pl
Copying scripts/seq/extract_feature_seq.PLS ->
blib/script/extract_feature_seq.PLS
Deleting blib/script/extract_feature_seq.PLS.bak
blib/script/extract_feature_seq.PLS -> blib/script/bp_extract_feature_seq.pl
Copying scripts/Bio-DB-GFF/bulk_load_gff.PLS ->
blib/script/bulk_load_gff.PLS
Deleting blib/script/bulk_load_gff.PLS.bak
blib/script/bulk_load_gff.PLS -> blib/script/bp_bulk_load_gff.pl
Copying scripts/utilities/search2gff.PLS -> blib/script/search2gff.PLS
Deleting blib/script/search2gff.PLS.bak
blib/script/search2gff.PLS -> blib/script/bp_search2gff.pl
Copying scripts/seq/make_mrna_protein.PLS ->
blib/script/make_mrna_protein.PLS
Deleting blib/script/make_mrna_protein.PLS.bak
blib/script/make_mrna_protein.PLS -> blib/script/bp_make_mrna_protein.pl
Copying scripts/seq/unflatten_seq.PLS -> blib/script/unflatten_seq.PLS
Deleting blib/script/unflatten_seq.PLS.bak
blib/script/unflatten_seq.PLS -> blib/script/bp_unflatten_seq.pl
Copying scripts/utilities/search2tribe.PLS -> blib/script/search2tribe.PLS
Deleting blib/script/search2tribe.PLS.bak
blib/script/search2tribe.PLS -> blib/script/bp_search2tribe.pl
Copying scripts/DB/bioflat_index.PLS -> blib/script/bioflat_index.PLS
Deleting blib/script/bioflat_index.PLS.bak
blib/script/bioflat_index.PLS -> blib/script/bp_bioflat_index.pl
Copying scripts/utilities/pairwise_kaks.PLS -> blib/script/pairwise_kaks.PLS
Deleting blib/script/pairwise_kaks.PLS.bak
blib/script/pairwise_kaks.PLS -> blib/script/bp_pairwise_kaks.pl
Copying scripts/Bio-DB-GFF/fast_load_gff.PLS ->
blib/script/fast_load_gff.PLS
Deleting blib/script/fast_load_gff.PLS.bak
blib/script/fast_load_gff.PLS -> blib/script/bp_fast_load_gff.pl
Copying scripts/seqstats/chaos_plot.PLS -> blib/script/chaos_plot.PLS
Deleting blib/script/chaos_plot.PLS.bak
blib/script/chaos_plot.PLS -> blib/script/bp_chaos_plot.pl
Copying scripts/utilities/bp_mrtrans.PLS -> blib/script/bp_mrtrans.PLS
Deleting blib/script/bp_mrtrans.PLS.bak
blib/script/bp_mrtrans.PLS -> blib/script/bp_mrtrans.pl
Copying scripts/utilities/bp_nrdb.PLS -> blib/script/bp_nrdb.PLS
Deleting blib/script/bp_nrdb.PLS.bak
blib/script/bp_nrdb.PLS -> blib/script/bp_nrdb.pl
Copying scripts/taxa/classify_hits_kingdom.PLS ->
blib/script/classify_hits_kingdom.PLS
Deleting blib/script/classify_hits_kingdom.PLS.bak
blib/script/classify_hits_kingdom.PLS ->
blib/script/bp_classify_hits_kingdom.pl
Copying scripts/utilities/remote_blast.PLS -> blib/script/remote_blast.PLS
Deleting blib/script/remote_blast.PLS.bak
blib/script/remote_blast.PLS -> blib/script/bp_remote_blast.pl
Copying scripts/searchio/search2table.PLS -> blib/script/search2table.PLS
Deleting blib/script/search2table.PLS.bak
blib/script/search2table.PLS -> blib/script/bp_search2table.pl
Copying scripts/seq/translate_seq.PLS -> blib/script/translate_seq.PLS
Deleting blib/script/translate_seq.PLS.bak
blib/script/translate_seq.PLS -> blib/script/bp_translate_seq.pl
Copying scripts/graphics/search_overview.PLS ->
blib/script/search_overview.PLS
Deleting blib/script/search_overview.PLS.bak
blib/script/search_overview.PLS -> blib/script/bp_search_overview.pl
t/AAChange...................ok

t/AAReverseMutate............ok

t/AlignIO....................ok

t/AlignStats.................ok

t/AlignUtil..................ok

t/Allele.....................ok

t/Alphabet...................ok

t/Annotation.................ok 1/112

#   Failed (TODO) test 'The object isa Bio::Annotation::Comment'
#   at t/Annotation.t line 214.
#     The object isn't a 'Bio::Annotation::Comment' it's a
'Bio::Annotation::OntologyTerm'
t/Annotation.................ok

        1/112 unexpectedly succeeded
TODO PASSED test 96

t/AnnotationAdaptor..........ok

t/Assembly...................ok 1/35

#   Failed (TODO) test 'get_nof_singlets'
#   at t/Assembly.t line 44.
#          got: '0'
#     expected: '1'

#   Failed (TODO) test 'get_seq_ids'
#   at t/Assembly.t line 48.
#          got: '0'
#     expected: '2'

#   Failed (TODO) test at t/Assembly.t line 53.
#     '0'
#         ne
#     '0'

#   Failed test at t/Assembly.t line 145.
#          got: '_main_contig_feature:106'
#     expected: '_aligned_coord:sdsu|SDSU_RFPERU_006_E04.x01.phd.1'
t/Assembly...................NOK 31/35# Looks like you failed 1 test of 35.

t/Assembly...................dubious

        Test returned status 1 (wstat 256, 0x100)
DIED. FAILED test 31
        Failed 1/35 tests, 97.14% okay
t/Biblio.....................ok

t/BiblioReferences...........ok

t/Biblio_biofetch............ok

t/Biblio_eutils..............ok

t/BioDBGFF...................ok

        3/277 skipped: various reasons
t/BioDBSeqFeature............ok

t/BioDBSeqFeature_BDB........ok

t/BioDBSeqFeature_mysql......ok

t/BioFetch_DB................ok

t/BioGraphics................ok

t/BlastIndex.................ok

t/Chain......................ok

t/ClusterIO..................ok

t/Coalescent.................ok

t/CodonTable.................ok

t/Compatible.................ok

t/CoordinateGraph............ok

t/CoordinateMapper...........ok

t/Correlate..................ok

t/CytoMap....................ok

t/DB.........................ok 104/116Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 491.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 565.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 565.
t/DB.........................ok 107/116Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 565.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 565.
t/DB.........................ok

t/DBCUTG.....................ok

t/DBFasta....................ok

t/DNAMutation................ok

t/Domcut.....................ok

t/ECnumber...................ok

t/ELM........................ok

t/EMBL_DB....................ok

t/EMBOSS_Tools...............ok

t/ESEfinder..................ok

t/EUtilities.................skipped
        all skipped: Must set BIOPERLDEBUG=1 for network tests
t/EncodedSeq.................ok

t/Exception..................ok

t/Exonerate..................ok

        4/45 skipped: various reasons
t/FeatureIO..................ok

t/FootPrinter................ok

t/GDB........................ok

t/GFF........................ok

t/GOR4.......................ok

t/GOterm.....................ok

t/GbrowseGFF.................ok

t/Gel........................ok

t/GeneCoordinateMapper.......ok

t/Geneid.....................ok

t/Genewise...................ok 1/53

#   Failed (TODO) test at t/Genewise.t line 79.
#          got: 'Scaffold_2042.1'
#     expected: 'SINFRUP00000067802'

#   Failed (TODO) test at t/Genewise.t line 80.
#          got: 'SINFRUP00000067802'
#     expected: 'Scaffold_2042.1'
t/Genewise...................NOK 37/53

#   Failed test at t/Genewise.t line 82.
#          got: ''
#     expected: '2054.68'
t/Genewise...................NOK 41/53

#   Failed test at t/Genewise.t line 88.
#          got: ''
#     expected: '2054.68'
t/Genewise...................NOK 45/53

#   Failed test at t/Genewise.t line 93.
#          got: ''
#     expected: '2054.68'
# Looks like you failed 3 tests of 53.
t/Genewise...................dubious

        Test returned status 3 (wstat 768, 0x300)
DIED. FAILED tests 37, 41, 45
        Failed 3/53 tests, 94.34% okay
t/Genomewise.................ok

t/Genpred....................ok 1/157Argument "<1" isn't numeric in numeric
gt (>) at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/Tools/Glimmer.pm line
519, <GEN11> line 2.
t/Genpred....................ok

t/GraphAdaptor...............ok

t/GuessSeqFormat.............ok

t/HNN........................ok

t/Handler....................ok 288/545

#   Failed (TODO) test at t/Handler.t line 696.
t/Handler....................ok

t/HtSNP......................ok

t/IUPAC......................ok

t/Index......................ok

t/InstanceSite...............ok

t/InterProParser.............ok

t/LargeLocatableSeq..........ok

t/LinkageMap.................ok

t/LiveSeq....................ok

t/LocatableSeq...............ok

t/Location...................ok

t/LocationFactory............ok

t/LocusLink..................ok

t/MK.........................ok

        4/46 skipped: various reasons
t/Map........................ok

t/MapIO......................ok

t/Matrix.....................ok

t/MeSH.......................ok

t/Measure....................ok

t/MetaSeq....................ok

t/MicrosatelliteMarker.......ok

t/MiniMIMentry...............ok

t/MitoProt...................ok

t/Molphy.....................ok

t/MultiFile..................ok

t/Mutation...................ok

t/Mutator....................ok

t/NetPhos....................ok

t/Node.......................ok

t/OMIMentry..................ok

t/OMIMentryAllelicVariant....ok

t/OMIMparser.................ok

t/OddCodes...................ok

t/Ontology...................ok

t/OntologyEngine.............ok

t/OntologyStore..............ok

t/PAML.......................ok

t/Perl.......................ok

t/Phenotype..................ok

t/PhylipDist.................ok

t/PhysicalMap................ok

t/Pictogram..................ok

t/PodSyntax..................skipped
        all skipped: Test::Pod 1.00 required for testing POD
t/PopGen.....................ok 1/99

#   Failed (TODO) test at t/PopGen.t line 242.
t/PopGen.....................ok

        2/99 unexpectedly succeeded
TODO PASSED tests 97-98

t/PopGenSims.................ok

t/PrimarySeq.................ok

t/Primer.....................ok

t/Promoterwise...............ok

t/ProtDist...................ok

t/ProtMatrix.................ok

t/ProtPsm....................ok

        10/14 skipped: various reasons
t/Pseudowise.................ok

t/QRNA.......................ok

t/RNAChange..................ok

t/RNA_SearchIO...............ok 2/496

#   Failed (TODO) test 'HSP meta'
#   at t/RNA_SearchIO.t line 798.
#     undef
#         ne
#     undef

#   Failed (TODO) test at t/RNA_SearchIO.t line 800.
#     undef
#         ne
#     undef

#   Failed (TODO) test at t/RNA_SearchIO.t line 802.
#     undef
#         ne
#     undef

#   Failed (TODO) test 'HSP meta'
#   at t/RNA_SearchIO.t line 848.
#     undef
#         ne
#     undef

#   Failed (TODO) test at t/RNA_SearchIO.t line 850.
#     undef
#         ne
#     undef

#   Failed (TODO) test at t/RNA_SearchIO.t line 852.
#     undef
#         ne
#     undef
t/RNA_SearchIO...............ok

t/RandDistFunctions..........ok

t/RandomTreeFactory..........ok

t/Range......................ok

t/RangeI.....................ok

t/RefSeq.....................ok

t/Registry...................ok 1/14

--------------------- WARNING ---------------------
MSG: Couldn't call new_from_registry() on [Bio::DB::Flat]

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: you must specify an indexing scheme
STACK: Error::throw
STACK: Bio::Root::Root::throw
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/Root/Root.pm:357
STACK: Bio::DB::Flat::new
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/DB/Flat.pm:160
STACK: Bio::DB::Flat::new_from_registry
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/DB/Flat.pm:252
STACK: Bio::DB::Registry::_load_registry
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/DB/Registry.pm:164
STACK: Bio::DB::Registry::new
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/DB/Registry.pm:95
STACK: t/Registry.t:51
-----------------------------------------------------------

---------------------------------------------------
t/Registry...................ok

        6/14 skipped: various reasons
t/Relationship...............ok

t/RelationshipType...........ok

t/RemoteBlast................ok

t/RepeatMasker...............ok

t/RestrictionAnalysis........ok

t/RestrictionIO..............ok 1/15

#   Failed (TODO) test at t/RestrictionIO.t line 31.
t/RestrictionIO..............ok

t/Root-Utilities.............ok 1/50

--------------------- WARNING ---------------------
MSG: Not owner of file t/data/test.txt. Compressing to temp file
/tmp/MBKEv1uzJB.tmp.bioperl.gz.
---------------------------------------------------
t/Root-Utilities.............ok

t/RootI......................ok

t/RootIO.....................ok

t/RootStorable...............ok

t/SNP........................ok

t/Scansite...................ok

        5/14 skipped: various reasons
t/SearchDist.................skipped
        all skipped: The optional module Bio::Ext::Align (or dependencies
thereof) was not installed
t/SearchIO...................ok 529/1449

#   Failed (TODO) test at t/SearchIO.t line 989.
#     '0.852'
#         >
#     '0.9'

#   Failed (TODO) test at t/SearchIO.t line 990.
#     '1.599'
#         <=
#     '1'
t/SearchIO...................ok

t/Seg........................ok

t/Seq........................ok

t/SeqAnalysisParser..........ok

t/SeqBuilder.................ok

t/SeqDiff....................ok

t/SeqEvolution...............ok

t/SeqFeatAnnotated...........ok

t/SeqFeatCollection..........ok

t/SeqFeature.................ok

t/SeqHound_DB................ok

t/SeqIO......................ok

t/SeqPattern.................ok

t/SeqStats...................ok

t/SeqUtils...................ok

t/SeqVersion.................ok

t/SeqWords...................ok

t/SequenceFamily.............ok

t/Sigcleave..................ok

t/Signalp....................ok

t/Signalp2...................ok

t/Sim4.......................ok

t/SimilarityPair.............ok

t/SimpleAlign................ok

t/SiteMatrix.................ok

t/Sopma......................ok

t/Species....................ok

t/Spidey.....................ok

t/StandAloneBlast............ok

        11/45 skipped: various reasons
t/StructIO...................ok

t/Structure..................ok

t/Symbol.....................ok

t/TagHaplotype...............ok

t/TandemRepeatsFinder........ok

t/TaxonTree..................skipped
        all skipped: All tests are being skipped, probably because the
module(s) being tested here are now deprecated
t/Taxonomy...................ok

t/Tempfile...................ok

t/Term.......................ok

t/Tmhmm......................ok

t/Tools......................ok

t/Tree.......................ok

t/TreeBuild..................ok

t/TreeIO.....................ok

t/UCSCParsers................ok

t/Unflattener................ok

t/Unflattener2...............ok

t/UniGene....................ok

t/Variation_IO...............ok

t/WABA.......................ok

t/WrapperBase................ok

t/abi........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
t/ace........................ok

t/alignUtilities.............ok

t/asciitree..................ok

t/blast_pull.................ok 1/287

#   Failed (TODO) test at t/blast_pull.t line 258.
#          got: '0.946'
#     expected: '0.943'
t/blast_pull.................ok

t/bsml_sax...................ok

t/chaosxml...................ok

t/cigarstring................ok

t/consed.....................ok

t/ctf........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
t/dblink.....................ok

t/ePCR.......................ok

t/embl.......................ok

t/entrezgene.................ok 542/1422Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/SeqIO/entrezgene.pm line
491.
t/entrezgene.................ok 966/1422Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/SeqIO/entrezgene.pm line
491.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/SeqIO/entrezgene.pm line
491.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/SeqIO/entrezgene.pm line
491.
t/entrezgene.................ok

t/est2genome.................ok

t/exp........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
t/fasta......................ok

t/flat.......................ok

t/game.......................ok

t/gcg........................ok

t/genbank....................ok

t/hmmer......................ok

t/hmmer_pull.................ok

t/interpro...................ok

t/kegg.......................ok

t/largefasta.................ok

t/largepseq..................ok

t/lasergene..................ok

t/lucy.......................ok

t/masta......................ok

t/metafasta..................ok

t/multiple_fasta.............ok

t/obo_parser.................ok

t/pICalculator...............ok

t/phd........................ok

t/pir........................ok

t/pln........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
t/primaryqual................ok

t/primedseq..................ok

t/primer3....................ok

t/protgraph..................ok 1/70

#   Failed (TODO) test at t/protgraph.t line 55.

#   Failed (TODO) test at t/protgraph.t line 56.
#          got: '13'
#     expected: '14'
t/protgraph..................ok 49/70

#   Failed (TODO) test at t/protgraph.t line 248.
#          got: 'Helicobacter pylori'
#     expected: 'Helicobacter pylori 26695'
t/protgraph..................ok

t/psm........................ok

t/qual.......................ok

t/raw........................ok

t/rnamotif...................ok

t/scf........................ok

t/seq_quality................ok

t/seqfeaturePrimer...........ok

t/seqread_fail...............ok

t/sequencetrace..............ok

t/seqwithquality.............ok

t/simpleGOparser.............ok

t/singlet....................ok

t/sirna......................ok

t/splicedseq.................ok

t/swiss......................ok 1/239

#   Failed (TODO) test at t/swiss.t line 47.
t/swiss......................ok

t/tRNAscanSE.................ok

t/tab........................ok

t/table......................ok

t/targetp....................ok

t/tigrxml....................ok

t/tinyseq....................ok

t/trim.......................ok

t/ztr........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
Failed Test  Stat Wstat Total Fail  List of Failed
----------------------------------------------------------------------------
---
t/Assembly.t    1   256    35    1  31
t/Genewise.t    3   768    53    3  37 41 45
 (3 subtests UNEXPECTEDLY SUCCEEDED), 9 tests and 43 subtests skipped.
Failed 2/248 test scripts. 4/15415 subtests failed.
Files=248, Tests=15415, 973 wallclock secs (123.75 cusr +  8.58 csys =
132.33 CPU)
Failed 2/248 test programs. 4/15415 subtests failed.



-----Original Message-----
From: Chris Fields [mailto:cjfields at uiuc.edu] 
Sent: Friday, September 28, 2007 1:00 PM
To: Forrest Zhang
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

If this is occurring using bioperl from CVS then I'll try taking a  
look at it.

chris

On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:

> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign








From bix at sendu.me.uk  Fri Sep 28 02:46:48 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 28 Sep 2007 07:46:48 +0100
Subject: [Bioperl-l] FW:  load_seqdatabase.pl error
In-Reply-To: <000101c80191$3b300e70$b1902b50$@com>
References: <000101c80191$3b300e70$b1902b50$@com>
Message-ID: <46FCA358.9070202@sendu.me.uk>

Forrest Zhang wrote:
> Oh, my God!  I am tring reinstall bioperl-live using CVS, so many error
> shown below.
[snip]
> t/Assembly.t    1   256    35    1  31
> t/Genewise.t    3   768    53    3  37 41 45

You failed 4 tests, and this is CVS. Don't worry about the failures if 
they're in tests of modules you're not using. Do you use the Assembly or 
Genewise modules?


From bix at sendu.me.uk  Fri Sep 28 02:40:04 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 28 Sep 2007 07:40:04 +0100
Subject: [Bioperl-l] cpan install
In-Reply-To: <000001c8017a$6384bae0$2a8e30a0$@com>
References: <46FC028F.3050000@usc.edu> <000001c8017a$6384bae0$2a8e30a0$@com>
Message-ID: <46FCA1C4.7030101@sendu.me.uk>

Forrest Zhang wrote:
> Try 
> cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
> 
> other question you should browse
> http://www.bioperl.org/wiki/Installing_Bioperl_for_Unix

Yes, the explanation for 1.5.2 not showing up in d /bioperl/ being 'only 
stable versions appear in that list'.


From forrest_zhang at 163.com  Fri Sep 28 07:26:56 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 19:26:56 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
Message-ID: <000301c801c2$7deb6080$79c22180$@com>

Yes, it is happened using CVS.

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Chris Fields
Sent: Friday, September 28, 2007 1:00 PM
To: Forrest Zhang
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

If this is occurring using bioperl from CVS then I'll try taking a  
look at it.

chris

On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:

> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign



_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





From forrest_zhang at 163.com  Fri Sep 28 07:28:41 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 19:28:41 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
Message-ID: <000401c801c2$ba0bae30$2e230a90$@com>

Message using CVS.

biocc bioperl-db # ./Build test
Copying scripts/biosql/terms/importrelation.pl ->
blib/script/importrelation.pl
blib/script/importrelation.pl -> blib/script/bp_importrelation.pl
Copying scripts/biosql/merge-unique-ann.pl ->
blib/script/merge-unique-ann.pl
blib/script/merge-unique-ann.pl -> blib/script/bp_merge-unique-ann.pl
Copying scripts/biosql/update-on-new-date.pl ->
blib/script/update-on-new-date.pl
blib/script/update-on-new-date.pl -> blib/script/bp_update-on-new-date.pl
Copying scripts/biosql/terms/add-term-annot.pl ->
blib/script/add-term-annot.pl
Deleting blib/script/add-term-annot.pl.bak
blib/script/add-term-annot.pl -> blib/script/bp_add-term-annot.pl
Copying scripts/corba/caching_corba_server.pl ->
blib/script/caching_corba_server.pl
Deleting blib/script/caching_corba_server.pl.bak
blib/script/caching_corba_server.pl ->
blib/script/bp_caching_corba_server.pl
Copying scripts/biosql/load_ontology.pl -> blib/script/load_ontology.pl
Deleting blib/script/load_ontology.pl.bak
blib/script/load_ontology.pl -> blib/script/bp_load_ontology.pl
Copying scripts/biosql/load_seqdatabase.pl ->
blib/script/load_seqdatabase.pl
Deleting blib/script/load_seqdatabase.pl.bak
blib/script/load_seqdatabase.pl -> blib/script/bp_load_seqdatabase.pl
Copying scripts/biosql/terms/interpro2go.pl -> blib/script/interpro2go.pl
blib/script/interpro2go.pl -> blib/script/bp_interpro2go.pl
Copying scripts/biosql/clean_ontology.pl -> blib/script/clean_ontology.pl
blib/script/clean_ontology.pl -> blib/script/bp_clean_ontology.pl
Copying scripts/corba/test_bioenv.pl -> blib/script/test_bioenv.pl
Deleting blib/script/test_bioenv.pl.bak
blib/script/test_bioenv.pl -> blib/script/bp_test_bioenv.pl
Copying scripts/biosql/update-on-new-version.pl ->
blib/script/update-on-new-version.pl
blib/script/update-on-new-version.pl ->
blib/script/bp_update-on-new-version.pl
Copying scripts/biosql/bioentry2flat.pl -> blib/script/bioentry2flat.pl
Deleting blib/script/bioentry2flat.pl.bak
blib/script/bioentry2flat.pl -> blib/script/bp_bioentry2flat.pl
Copying scripts/corba/bioenv_server.pl -> blib/script/bioenv_server.pl
Deleting blib/script/bioenv_server.pl.bak
blib/script/bioenv_server.pl -> blib/script/bp_bioenv_server.pl
Copying scripts/biosql/load_interpro.pl -> blib/script/load_interpro.pl
blib/script/load_interpro.pl -> blib/script/bp_load_interpro.pl
Copying scripts/biosql/cgi-bin/getentry.pl -> blib/script/getentry.pl
Deleting blib/script/getentry.pl.bak
blib/script/getentry.pl -> blib/script/bp_getentry.pl
Copying scripts/biosql/del-assocs-sql.pl -> blib/script/del-assocs-sql.pl
blib/script/del-assocs-sql.pl -> blib/script/bp_del-assocs-sql.pl
Copying scripts/biosql/freshen-annot.pl -> blib/script/freshen-annot.pl
blib/script/freshen-annot.pl -> blib/script/bp_freshen-annot.pl
t/01dbadaptor.....ok

t/02species.......FAILED tests 66-95

        Failed 30/65 tests, 53.85% okay
t/03simpleseq.....ok

t/04swiss.........ok

t/05seqfeature....ok

t/06comment.......ok

t/07dblink........ok

t/08genbank.......ok

t/09fuzzy2........ok

t/10ensembl.......ok

t/11locuslink.....ok

t/12ontology......ok

t/13remove........ok

t/14query.........ok

t/15cluster.......ok 9/160

--------------------- WARNING ---------------------
MSG: failed to store one or more child objects for an instance of class
Bio::Cluster::UniGene (PK=366)
---------------------------------------------------
t/15cluster.......ok

t/16obda..........ok

Failed Test   Stat Wstat Total Fail  List of Failed
----------------------------------------------------------------------------
---
t/02species.t               65   30  66-95
Failed 1/16 test scripts. -30/1423 subtests failed.
Files=16, Tests=1423, 36 wallclock secs (16.64 cusr +  0.65 csys = 17.29
CPU)
Failed 1/16 test programs. -30/1423 subtests failed.

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Chris Fields
Sent: Friday, September 28, 2007 1:00 PM
To: Forrest Zhang
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

If this is occurring using bioperl from CVS then I'll try taking a  
look at it.

chris

On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:

> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign



_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





From hlapp at gmx.net  Fri Sep 28 11:36:39 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 28 Sep 2007 11:36:39 -0400
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <46F8DC34.6020908@sendu.me.uk>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
Message-ID: <8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>

You do have a point here. From a design perspective, it feels odd if  
instantiating an object can fail with an I/O exception. But in  
reality that's how it's done all the time, from Bio::SeqIO to  
java.io.*, if I'm not mistaken. I also agree that asking a  
conditional that we know will be false every time except once  
violates the sense of elegance.

So upon second consideration, I think I agree with you. And a GFF3  
file with zero features in it should still be a valid GFF3 file,  
i.e., have the mandatory headers.

Does that make sense?

	-hilmar

On Sep 25, 2007, at 6:00 AM, Sendu Bala wrote:

> Hilmar Lapp wrote:
>> On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:
>>> I think that'll work fine.  The other option would be call a
>>> print_gff_header() function within write_feature() with the  
>>> intent to
>>> print the header only once, using a flag or similar:
>>>
>>> if (!$self->header_printed) {
>>>      $self->print_gff_header;
>>>      $self->header_printed(1);
>>> }
> >
>> I'd lean toward this or a similar approach too. Writing stuff out  
>> in the constructor doesn't feel like the best design.
>
> I'd argue that the alternative is just inefficient with no  
> compensating benefit. You have something that must only be done  
> once, and a method (_initialize) that is only called once. The  
> constructor is used to set up the file, getting it into a state  
> ready to add features. This involves opening it for writing with  
> the correct filename and setting the desired GFF version. Why  
> wouldn't it also output what ever else was necessary it initialize  
> the file?
>
> Also, what do we expect should happen when we use Bioperl to create  
> a GFF file and don't write any features to it? Should it be an  
> empty file, or should it contain whatever GFF information the user  
> had managed to supply (the version)?

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From hlapp at gmx.net  Fri Sep 28 11:53:33 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 28 Sep 2007 11:53:33 -0400
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
Message-ID: <9917490A-B7AF-4AE6-9C78-AD516700155B@gmx.net>

Chris let me know if you get stumped. I'm surprised that the special  
ranks ('eurosids I' etc) show up in the lineage (has NCBI started to  
assign ranks to them? I thought I filter them out. Needs to be looked  
into too.), but at any rate I don't understand why they aren't being  
accepted.

Also, maybe we need a more verbose output here - Forrest, can you run  
this with adding a --printerror argument. (I'm embarrassed to find  
that this doesn't seem to be documented. Sigh.)

	-hilmar

On Sep 28, 2007, at 1:00 AM, Chris Fields wrote:

> If this is occurring using bioperl from CVS then I'll try taking a
> look at it.
>
> chris
>
> On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:
>
>> Hilmar,
>> 	I have already pre-loaded the NCBI taxonomy using
>> load_ncbi_taxonomy.pl yet. The error message show:
>>
>> --------------------- WARNING ---------------------
>> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I
>> was
>> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I
>> | rosids
>> | core eudicotyledons | eudicotyledons | Magnoliophyta |
>> Euphyllophyta |
>> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
>> ---------------------------------------------------
>> Could not store Q40784:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: create: object (Bio::Species) failed to insert or to be found
>> by unique
>> key
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:206
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: /usr/bin/bp_load_seqdatabase.pl:633
>> -----------------------------------------------------------
>> Sigh~~~~~~
>>
>> Forrest Zhang
>>
>>
>> -----Original Message-----
>> From: bioperl-l-bounces at lists.open-bio.org
>> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar  
>> Lapp
>> Sent: Friday, September 28, 2007 6:17 AM
>> To: Forrest
>> Cc: bioperl-l at bioperl.org
>> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>>
>> Forrest,
>>
>> have you preloaded the NCBI taxonomy as suggested in the BioSQL
>> installation guidelines? SwissProt format has NCBI taxon IDs, and the
>> code will try to use it to look up species and their lineage, rather
>> than inserting the lineage from whatever BioPerl parses out of the
>> sequence record.
>>
>> 	-hilmar
>>
>> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>>
>>> Hi, all
>>>     I install the biosql, and bioperl-db. I want to import
>>> swissport data.
>>> But the programe show some error as below:
>>> ==================================================================== 
>>> =
>>> =
>>> ======
>>> ===============================================
>>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver  
>>>> mysql
>>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>>> Could not store Q6DAH5:
>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>>> subsp.
>>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>>> Pectobacterium |
>>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>>> Proteobacteria | Bacteria')
>>> STACK: Error::throw
>>> STACK: Bio::Root::Root::throw
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>>> STACK: Bio::Species::classification
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:552
>>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:1305
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:973
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:852
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:182
>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:244
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:169
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:251
>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:271
>>> STACK: load_seqdatabase.pl:620
>>> -----------------------------------------------------------
>>>
>>>  at load_seqdatabase.pl line 633
>>> ==================================================================== 
>>> =
>>> =
>>> ======
>>> ===============================================
>>>
>>> How can I solve it, please help me, Thank you.
>>>
>>> Thanks
>>> Forrest zhang
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> -- 
>> ===========================================================
>> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
>> ===========================================================
>>
>>
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From cjfields at uiuc.edu  Fri Sep 28 12:04:08 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 11:04:08 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
Message-ID: <5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>

On Sep 28, 2007, at 10:36 AM, Hilmar Lapp wrote:

> You do have a point here. From a design perspective, it feels odd  
> if instantiating an object can fail with an I/O exception. But in  
> reality that's how it's done all the time, from Bio::SeqIO to  
> java.io.*, if I'm not mistaken. I also agree that asking a  
> conditional that we know will be false every time except once  
> violates the sense of elegance.

I agree with the lack of elegance from a design perspective on both  
counts, but when have we ever been worried about that? ;>

In general I don't think SeqIO classes generates actual output (like  
the GFF header information) in the constructor, they just initialize  
IO and other state data.  It makes sense to fail in this case if an  
error pops up.  Regardless, one could argue ad infinitum that either  
proposed fix has its benefits/deficiencies, however both will work,  
so I'm happy with either.

chris

> So upon second consideration, I think I agree with you. And a GFF3  
> file with zero features in it should still be a valid GFF3 file,  
> i.e., have the mandatory headers.
>
> Does that make sense?
>
> 	-hilmar
>
> On Sep 25, 2007, at 6:00 AM, Sendu Bala wrote:
>
>> Hilmar Lapp wrote:
>>> On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:
>>>> I think that'll work fine.  The other option would be call a
>>>> print_gff_header() function within write_feature() with the  
>>>> intent to
>>>> print the header only once, using a flag or similar:
>>>>
>>>> if (!$self->header_printed) {
>>>>      $self->print_gff_header;
>>>>      $self->header_printed(1);
>>>> }
>> >
>>> I'd lean toward this or a similar approach too. Writing stuff out  
>>> in the constructor doesn't feel like the best design.
>>
>> I'd argue that the alternative is just inefficient with no  
>> compensating benefit. You have something that must only be done  
>> once, and a method (_initialize) that is only called once. The  
>> constructor is used to set up the file, getting it into a state  
>> ready to add features. This involves opening it for writing with  
>> the correct filename and setting the desired GFF version. Why  
>> wouldn't it also output what ever else was necessary it initialize  
>> the file?
>>
>> Also, what do we expect should happen when we use Bioperl to  
>> create a GFF file and don't write any features to it? Should it be  
>> an empty file, or should it contain whatever GFF information the  
>> user had managed to supply (the version)?
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From cjfields at uiuc.edu  Fri Sep 28 12:10:59 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 11:10:59 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <9917490A-B7AF-4AE6-9C78-AD516700155B@gmx.net>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
	<9917490A-B7AF-4AE6-9C78-AD516700155B@gmx.net>
Message-ID: <EECC931E-C7B5-485E-B059-4A7A9A7C092E@uiuc.edu>

I'm actually getting some odd recursion issues again; not sure what's  
causing it, but a reinstall of both bioperl and bioperl-db fixed it  
last time.  It may be related to the rollback, just not sure yet.

I'll try tracking it down if it persists (bad pun).

t/04swiss....ok 3/52
--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------
t/04swiss....ok
All tests successful.
Files=1, Tests=52,  2 wallclock secs ( 1.33 cusr +  0.18 csys =  1.51  
CPU)

The specific error under verbose running is:

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:680
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:677
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:691
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:677
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:691
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:677
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:677
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:658
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store /Users/cjfields/ 
src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:252
STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
PrimarySeqAdaptor.pm:229
STACK Bio::DB::BioSQL::SeqAdaptor::store_children /Users/cjfields/src/ 
core/bioperl-db/blib/lib/Bio/DB/BioSQL/SeqAdaptor.pm:217
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create /Users/cjfields/ 
src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:213
STACK Bio::DB::Persistent::PersistentObject::create /Users/cjfields/ 
src/core/bioperl-db/blib/lib/Bio/DB/Persistent/PersistentObject.pm:244
STACK toplevel t/04swiss.t:37
---------------------------------------------------


chris

On Sep 28, 2007, at 10:53 AM, Hilmar Lapp wrote:

> Chris let me know if you get stumped. I'm surprised that the special
> ranks ('eurosids I' etc) show up in the lineage (has NCBI started to
> assign ranks to them? I thought I filter them out. Needs to be looked
> into too.), but at any rate I don't understand why they aren't being
> accepted.
>
> Also, maybe we need a more verbose output here - Forrest, can you run
> this with adding a --printerror argument. (I'm embarrassed to find
> that this doesn't seem to be documented. Sigh.)
>
> 	-hilmar
>
> On Sep 28, 2007, at 1:00 AM, Chris Fields wrote:
>
>> If this is occurring using bioperl from CVS then I'll try taking a
>> look at it.
>>
>> chris
>>
>> On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:
>>
>>> Hilmar,
>>> 	I have already pre-loaded the NCBI taxonomy using
>>> load_ncbi_taxonomy.pl yet. The error message show:
>>>
>>> --------------------- WARNING ---------------------
>>> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I
>>> was
>>> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I
>>> | rosids
>>> | core eudicotyledons | eudicotyledons | Magnoliophyta |
>>> Euphyllophyta |
>>> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
>>> ---------------------------------------------------
>>> Could not store Q40784:
>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>> MSG: create: object (Bio::Species) failed to insert or to be found
>>> by unique
>>> key
>>> STACK: Error::throw
>>> STACK: Bio::Root::Root::throw
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:206
>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:244
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:169
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:251
>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:271
>>> STACK: /usr/bin/bp_load_seqdatabase.pl:633
>>> -----------------------------------------------------------
>>> Sigh~~~~~~
>>>
>>> Forrest Zhang
>>>
>>>
>>> -----Original Message-----
>>> From: bioperl-l-bounces at lists.open-bio.org
>>> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar
>>> Lapp
>>> Sent: Friday, September 28, 2007 6:17 AM
>>> To: Forrest
>>> Cc: bioperl-l at bioperl.org
>>> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>>>
>>> Forrest,
>>>
>>> have you preloaded the NCBI taxonomy as suggested in the BioSQL
>>> installation guidelines? SwissProt format has NCBI taxon IDs, and  
>>> the
>>> code will try to use it to look up species and their lineage, rather
>>> than inserting the lineage from whatever BioPerl parses out of the
>>> sequence record.
>>>
>>> 	-hilmar
>>>
>>> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>>>
>>>> Hi, all
>>>>     I install the biosql, and bioperl-db. I want to import
>>>> swissport data.
>>>> But the programe show some error as below:
>>>> =================================================================== 
>>>> =
>>>> =
>>>> =
>>>> ======
>>>> ===============================================
>>>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver
>>>>> mysql
>>>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>>>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>>>> Could not store Q6DAH5:
>>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>>>> subsp.
>>>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>>>> Pectobacterium |
>>>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>>>> Proteobacteria | Bacteria')
>>>> STACK: Error::throw
>>>> STACK: Bio::Root::Root::throw
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>>>> STACK: Bio::Species::classification
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>>>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:552
>>>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:1305
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:973
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:852
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:182
>>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:244
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:169
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:251
>>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:271
>>>> STACK: load_seqdatabase.pl:620
>>>> -----------------------------------------------------------
>>>>
>>>>  at load_seqdatabase.pl line 633
>>>> =================================================================== 
>>>> =
>>>> =
>>>> =
>>>> ======
>>>> ===============================================
>>>>
>>>> How can I solve it, please help me, Thank you.
>>>>
>>>> Thanks
>>>> Forrest zhang
>>>>
>>>>
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>> -- 
>>> ===========================================================
>>> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
>>> ===========================================================
>>>
>>>
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From hlapp at gmx.net  Fri Sep 28 17:09:28 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 28 Sep 2007 17:09:28 -0400
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
Message-ID: <41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>


On Sep 28, 2007, at 12:04 PM, Chris Fields wrote:

> In general I don't think SeqIO classes generates actual output  
> (like the GFF header information) in the constructor

There's probably two reasons they don't (if really all of them  
don't): i) unless you explicitly test (how?) whether the file has  
been opened for writing, you actually don't know in the SeqIO  
constructor whether someone's going to write to the file or read from  
it. ii) off hand, I don't know of a sequence file format that would  
require a particular header being written just once.

Though thinking about this, I start asking myself whether i) wouldn't  
also apply to FeatureIO (are we not reading gff too in this class?),  
and I'm wondering that there must  be a header (or at least an  
enclosing tag) for SeqIO XML formats - so how is that dealt with there?

	-hilmar
-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From cjfields at uiuc.edu  Fri Sep 28 17:34:13 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 16:34:13 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
Message-ID: <530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>


On Sep 28, 2007, at 4:09 PM, Hilmar Lapp wrote:

>
> On Sep 28, 2007, at 12:04 PM, Chris Fields wrote:
>
>> In general I don't think SeqIO classes generates actual output
>> (like the GFF header information) in the constructor
>
> There's probably two reasons they don't (if really all of them
> don't): i) unless you explicitly test (how?) whether the file has
> been opened for writing, you actually don't know in the SeqIO
> constructor whether someone's going to write to the file or read from
> it. ii) off hand, I don't know of a sequence file format that would
> require a particular header being written just once.
>
> Though thinking about this, I start asking myself whether i) wouldn't
> also apply to FeatureIO (are we not reading gff too in this class?),
> and I'm wondering that there must  be a header (or at least an
> enclosing tag) for SeqIO XML formats - so how is that dealt with  
> there?
>
> 	-hilmar

Re: (i) and FeatureIO: I believe most FeatureIO classes read/write to/ 
from specific feature files (bed, gff, ptt, interpro, etc), which is  
one reason I thought everything I(nput) should go into next_feature 
(), everything O(utput) into write_feature().  The section writing  
the gff header info in _initialize() checks the file specifically for  
'>' prior to output; I think Sendu planned on changing that to use  
mode() instead.

Re: (ii): I'm not sure, actually; I wouldn't be surprised if XML  
output hasn't been tested very well.

If I could go to the Nov. GMOD meeting to help hammer out some of the  
GFF3/FeatureIO/SF::Annotated stuff I would, but I would be traveling  
on my own dime.  Maybe I'll see what I can come up with and stay at  
the no-tell motel...

chris


From cjfields at uiuc.edu  Fri Sep 28 18:03:06 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 17:03:06 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <EECC931E-C7B5-485E-B059-4A7A9A7C092E@uiuc.edu>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
	<9917490A-B7AF-4AE6-9C78-AD516700155B@gmx.net>
	<EECC931E-C7B5-485E-B059-4A7A9A7C092E@uiuc.edu>
Message-ID: <FD7C7306-92E1-49D9-93E4-EDFBF09E1A1A@uiuc.edu>

Okay, fixed the recursion (extra copy of a BasePersistentAdaptor  
module I was working which tripped it, so nothing in CVS).

Forrest, I get all tests passing.  I used a database without taxonomy  
loaded with bioperl-db and bioperl from cvs and it worked w/o  
problems.  I'll try working with your sequence when I have time this  
weekend.

chris

On Sep 28, 2007, at 11:10 AM, Chris Fields wrote:

> I'm actually getting some odd recursion issues again; not sure what's
> causing it, but a reinstall of both bioperl and bioperl-db fixed it
> last time.  It may be related to the rollback, just not sure yet.
>
> I'll try tracking it down if it persists (bad pun).
>
> t/04swiss....ok 3/52
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
> t/04swiss....ok
> All tests successful.
> Files=1, Tests=52,  2 wallclock secs ( 1.33 cusr +  0.18 csys =  1.51
> CPU)
>
> The specific error under verbose running is:
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:680
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:677
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:691
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:677
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:691
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:677
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:677
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:658
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store /Users/cjfields/
> src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:252
> STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> PrimarySeqAdaptor.pm:229
> STACK Bio::DB::BioSQL::SeqAdaptor::store_children /Users/cjfields/src/
> core/bioperl-db/blib/lib/Bio/DB/BioSQL/SeqAdaptor.pm:217
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create /Users/cjfields/
> src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:213
> STACK Bio::DB::Persistent::PersistentObject::create /Users/cjfields/
> src/core/bioperl-db/blib/lib/Bio/DB/Persistent/PersistentObject.pm:244
> STACK toplevel t/04swiss.t:37
> ---------------------------------------------------
>
>
> chris
>
> On Sep 28, 2007, at 10:53 AM, Hilmar Lapp wrote:
>
>> Chris let me know if you get stumped. I'm surprised that the special
>> ranks ('eurosids I' etc) show up in the lineage (has NCBI started to
>> assign ranks to them? I thought I filter them out. Needs to be looked
>> into too.), but at any rate I don't understand why they aren't being
>> accepted.
>>
>> Also, maybe we need a more verbose output here - Forrest, can you run
>> this with adding a --printerror argument. (I'm embarrassed to find
>> that this doesn't seem to be documented. Sigh.)
>>
>> 	-hilmar
>>
>> On Sep 28, 2007, at 1:00 AM, Chris Fields wrote:
>>
>>> If this is occurring using bioperl from CVS then I'll try taking a
>>> look at it.
>>>
>>> chris
>>>
>>> On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:
>>>
>>>> Hilmar,
>>>> 	I have already pre-loaded the NCBI taxonomy using
>>>> load_ncbi_taxonomy.pl yet. The error message show:
>>>>
>>>> --------------------- WARNING ---------------------
>>>> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I
>>>> was
>>>> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I
>>>> | rosids
>>>> | core eudicotyledons | eudicotyledons | Magnoliophyta |
>>>> Euphyllophyta |
>>>> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
>>>> ---------------------------------------------------
>>>> Could not store Q40784:
>>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>>> MSG: create: object (Bio::Species) failed to insert or to be found
>>>> by unique
>>>> key
>>>> STACK: Error::throw
>>>> STACK: Bio::Root::Root::throw
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:206
>>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:244
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:169
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:251
>>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:271
>>>> STACK: /usr/bin/bp_load_seqdatabase.pl:633
>>>> -----------------------------------------------------------
>>>> Sigh~~~~~~
>>>>
>>>> Forrest Zhang
>>>>
>>>>
>>>> -----Original Message-----
>>>> From: bioperl-l-bounces at lists.open-bio.org
>>>> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar
>>>> Lapp
>>>> Sent: Friday, September 28, 2007 6:17 AM
>>>> To: Forrest
>>>> Cc: bioperl-l at bioperl.org
>>>> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>>>>
>>>> Forrest,
>>>>
>>>> have you preloaded the NCBI taxonomy as suggested in the BioSQL
>>>> installation guidelines? SwissProt format has NCBI taxon IDs, and
>>>> the
>>>> code will try to use it to look up species and their lineage,  
>>>> rather
>>>> than inserting the lineage from whatever BioPerl parses out of the
>>>> sequence record.
>>>>
>>>> 	-hilmar
>>>>
>>>> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>>>>
>>>>> Hi, all
>>>>>     I install the biosql, and bioperl-db. I want to import
>>>>> swissport data.
>>>>> But the programe show some error as below:
>>>>> ================================================================== 
>>>>> =
>>>>> =
>>>>> =
>>>>> =
>>>>> ======
>>>>> ===============================================
>>>>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver
>>>>>> mysql
>>>>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>>>>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>>>>> Could not store Q6DAH5:
>>>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>>>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>>>>> subsp.
>>>>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>>>>> Pectobacterium |
>>>>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>>>>> Proteobacteria | Bacteria')
>>>>> STACK: Error::throw
>>>>> STACK: Bio::Root::Root::throw
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>>>>> STACK: Bio::Species::classification
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>>>>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>>> PersistentObject.pm:552
>>>>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:1305
>>>>> STACK:  
>>>>> Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:973
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:852
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:182
>>>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>>> PersistentObject.pm:244
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:169
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:251
>>>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>>> PersistentObject.pm:271
>>>>> STACK: load_seqdatabase.pl:620
>>>>> -----------------------------------------------------------
>>>>>
>>>>>  at load_seqdatabase.pl line 633
>>>>> ================================================================== 
>>>>> =
>>>>> =
>>>>> =
>>>>> =
>>>>> ======
>>>>> ===============================================
>>>>>
>>>>> How can I solve it, please help me, Thank you.
>>>>>
>>>>> Thanks
>>>>> Forrest zhang
>>>>>
>>>>>
>>>>>
>>>>> _______________________________________________
>>>>> Bioperl-l mailing list
>>>>> Bioperl-l at lists.open-bio.org
>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>> -- 
>>>> ===========================================================
>>>> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
>>>> ===========================================================
>>>>
>>>>
>>>>
>>>>
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>>
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>> Christopher Fields
>>> Postdoctoral Researcher
>>> Lab of Dr. Robert Switzer
>>> Dept of Biochemistry
>>> University of Illinois Urbana-Champaign
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> -- 
>> ===========================================================
>> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
>> ===========================================================
>>
>>
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From hlapp at gmx.net  Fri Sep 28 18:20:37 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 28 Sep 2007 18:20:37 -0400
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
	<530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
Message-ID: <5FC8F92C-42DD-4DAF-8008-0F8C545065B5@gmx.net>


On Sep 28, 2007, at 5:34 PM, Chris Fields wrote:

> The section writing the gff header info in _initialize() checks the  
> file specifically for '>' prior to output; I think Sendu planned on  
> changing that to use mode() instead.

What if we pass in a file handle?

	-hilmar
-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From cjfields at uiuc.edu  Fri Sep 28 19:04:21 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 18:04:21 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <5FC8F92C-42DD-4DAF-8008-0F8C545065B5@gmx.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
	<530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
	<5FC8F92C-42DD-4DAF-8008-0F8C545065B5@gmx.net>
Message-ID: <E351BFD9-57C8-4A62-986F-F5E674B28FC5@uiuc.edu>


On Sep 28, 2007, at 5:20 PM, Hilmar Lapp wrote:

>
> On Sep 28, 2007, at 5:34 PM, Chris Fields wrote:
>
>> The section writing the gff header info in _initialize() checks the
>> file specifically for '>' prior to output; I think Sendu planned on
>> changing that to use mode() instead.
>
> What if we pass in a file handle?
>
> 	-hilmar

The old way def. wouldn't work with filehandles.  Not sure if  
checking Root::IO::mode() would work as expected in this case, but  
it's certainly worth a try.

chris


From jay at jays.net  Fri Sep 28 18:50:29 2007
From: jay at jays.net (Jay Hannah)
Date: Fri, 28 Sep 2007 17:50:29 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
	<530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
Message-ID: <FAFE7FDD-5191-4500-894E-05A11E71D410@jays.net>

On Sep 28, 2007, at 4:34 PM, Chris Fields wrote:
> On Sep 28, 2007, at 4:09 PM, Hilmar Lapp wrote:
>> and I'm wondering that there must  be a header (or at least an
>> enclosing tag) for SeqIO XML formats - so how is that dealt with
>> there?
>
> Re: (ii): I'm not sure, actually; I wouldn't be surprised if XML
> output hasn't been tested very well.

For good or ill I stole what I found in other Bio/SeqIO/* classes  
when I started writing my Bio::SeqIO::solrxml. It is not ready, but  
you can poke it with a stick here if you like:

http://vc.jays.net/viewvc.cgi/SolrGene/solrxml.pm? 
revision=26&root=CLAB&view=markup

In _initialize() it sends XML header goo into $self->_print(), and it  
uses DESTROY to drop an XML closure tag into $self->_print().

Constructing it

$out_solr  = Bio::SeqIO->new(-file => ">seq.solr.xml",
                              -format => 'solrxml');

without writing any sequences to it created a seq.solr.xml file with  
the XML header and footer and nothing in the middle.

If this is not The Right Way I'm happy to change it to do whatever.  :)

> If I could go to the Nov. GMOD meeting to help hammer out some of the
> GFF3/FeatureIO/SF::Annotated stuff I would, but I would be traveling
> on my own dime.  Maybe I'll see what I can come up with and stay at
> the no-tell motel...

I've decided to spend many of my own dimes and make the trek. I hope  
to meet many BioPerl'ers. I'll buy you dinner if you show up.  :)

Take care,

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah





From cjfields at uiuc.edu  Sat Sep 29 14:28:16 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sat, 29 Sep 2007 13:28:16 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <FAFE7FDD-5191-4500-894E-05A11E71D410@jays.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
	<530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
	<FAFE7FDD-5191-4500-894E-05A11E71D410@jays.net>
Message-ID: <E6C9C3D8-9E3F-4740-B590-6F4E5A152C5E@uiuc.edu>


On Sep 28, 2007, at 5:50 PM, Jay Hannah wrote:

> On Sep 28, 2007, at 4:34 PM, Chris Fields wrote:
>> On Sep 28, 2007, at 4:09 PM, Hilmar Lapp wrote:
>>> and I'm wondering that there must  be a header (or at least an
>>> enclosing tag) for SeqIO XML formats - so how is that dealt with
>>> there?
>>
>> Re: (ii): I'm not sure, actually; I wouldn't be surprised if XML
>> output hasn't been tested very well.
>
> For good or ill I stole what I found in other Bio/SeqIO/* classes
> when I started writing my Bio::SeqIO::solrxml. It is not ready, but
> you can poke it with a stick here if you like:
>
> http://vc.jays.net/viewvc.cgi/SolrGene/solrxml.pm?
> revision=26&root=CLAB&view=markup
>
> In _initialize() it sends XML header goo into $self->_print(), and it
> uses DESTROY to drop an XML closure tag into $self->_print().
>
> Constructing it
>
> $out_solr  = Bio::SeqIO->new(-file => ">seq.solr.xml",
>                               -format => 'solrxml');
>
> without writing any sequences to it created a seq.solr.xml file with
> the XML header and footer and nothing in the middle.
>
> If this is not The Right Way I'm happy to change it to do  
> whatever.  :)

If you do it this way you should probably run a check on the mode()  
the object state is in ('r'=read, 'w'=write, '?'=unknown), and only  
_print() on write mode.  Might also be a good idea to implement a  
next_seq with an exception ('Module is write only').

>> If I could go to the Nov. GMOD meeting to help hammer out some of the
>> GFF3/FeatureIO/SF::Annotated stuff I would, but I would be traveling
>> on my own dime.  Maybe I'll see what I can come up with and stay at
>> the no-tell motel...
>
> I've decided to spend many of my own dimes and make the trek. I hope
> to meet many BioPerl'ers. I'll buy you dinner if you show up.  :)
>
> Take care,
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

I may see what I can scrape up myself but it doesn't look good (lab's  
closing down soon, so money's pretty tight).  If I knew about the  
meeting a while in advance I would probably have made it.  Oh well!

chris



From cjfields at uiuc.edu  Sun Sep 30 16:39:23 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 30 Sep 2007 15:39:23 -0500
Subject: [Bioperl-l] DB::SeqFeature::Store error
Message-ID: <A56E6D20-EF3E-4B5D-B3F2-9F2B7D0178EF@uiuc.edu>

I'm getting the following error on my local MySQL (v 5.0.41) with  
bp_seqfeature_load:

-------------------- EXCEPTION --------------------
MSG: The used table type doesn't support FULLTEXT indexes
STACK Bio::DB::SeqFeature::Store::DBI::mysql::_init_database /Library/ 
Perl/5.8.6/Bio/DB/SeqFeature/Store/DBI/mysql.pm:414
STACK Bio::DB::SeqFeature::Store::init_database /Library/Perl/5.8.6/ 
Bio/DB/SeqFeature/Store.pm:382
STACK Bio::DB::SeqFeature::Store::DBI::mysql::init /Library/Perl/ 
5.8.6/Bio/DB/SeqFeature/Store/DBI/mysql.pm:218
STACK Bio::DB::SeqFeature::Store::new /Library/Perl/5.8.6/Bio/DB/ 
SeqFeature/Store.pm:345
STACK toplevel /usr/local/bin/bp_seqfeature_load.pl:57
-------------------------------------------

The default setting for storage is InnoDB; switching to MyISAM fixes  
the issue.  Should we specify TYPE = MyISAM with the various CREATE  
TABLE queries in Bio::DB::SeqFeature::Store::DBI::mysql to be on the  
safe side?

chris


From alan at tll.org.sg  Sun Sep 30 21:53:07 2007
From: alan at tll.org.sg (alan)
Date: Mon, 1 Oct 2007 09:53:07 +0800
Subject: [Bioperl-l] exonerate
References: <034FB11C-B4E9-4E4E-B213-D4AC6A397B1B@tll.org.sg>
Message-ID: <29C4D729-6715-4C19-9872-3B1AF90EAFA3@tll.org.sg>

Hi,


>> I am calling exonerate.pm within my script while attempting to  
>> align cDNA  to multiple genomic fragments. After processing about  
>> 120+ genomic fragments my code crashes with the following error:
>>
>> ** ERROR **: Could not open [/tmp/tlInatbOED] : Too many open files
>> aborting...
>> MSG: Exonerate call (/usr/local/bin/exonerate   /tmp/8X9jQuHUGF / 
>> tmp/tlInatbOED  > /tmp/EolF5qCNLZ/cIf0HfIRf5) crashed: 34304
>> STACK Bio::Tools::Run::Alignment::Exonerate::_run /nfs1/alan/ 
>> cvs_src/bioperl-run/Bio/Tools/Run/Alignment/Exonerate.pm:214
>> STACK Bio::Tools::Run::Alignment::Exonerate::run /nfs1/alan/ 
>> cvs_src/bioperl-run/Bio/Tools/Run/Alignment/Exonerate.pm:174
>>
>> The code in Exonerate.pm closes the tmpfile at the end of the  
>> routine yet I get the error message about "too many open files".
>> Any suggestions on how I should be closing these files?
>>
>>
>> Extract from my code that runs exonerate is listed below.
>>
>> foreach my $f(@files) {
>>   next unless (-f  "$dir/$f");
>>   my $q_in = Bio::SeqIO->new(-file=>$query, -format=>"Fasta");
>>   my $query_obj = $q_in->next_seq();
>>   my $target_in = Bio::SeqIO->new(-file=>"$dir/$f", - 
>> format=>"Fasta");
>>   my $target_obj = $target_in->next_seq();
>>   my $run = Bio::Tools::Run::Alignment::Exonerate->new();
>>   my $exonerate_io = $run->run($query_obj, $target_obj);
>>
>>   [code for parsing the data.......]
>>
>>   $exonerate_io->close; #tried this line out of desperation but it  
>> did not help :-)
>> }
>>
>> thanks
>> alan
>>
>>
>>
>> Alan Christoffels
>> Computational Biology Group
>> Temasek LifeSciences Laboratory
>> 1 Research Link
>> National University of Singapore
>> Singapore
>> 117604
>> Tel: +65 68744945
>> Fax: +65 68727007
>> Lab webpage: http://www.tll.org.sg/alan.asp
>>
>>
>



From ewijaya at gmail.com  Sun Sep 30 10:10:25 2007
From: ewijaya at gmail.com (Edward Wijaya)
Date: Sun, 30 Sep 2007 22:10:25 +0800
Subject: [Bioperl-l] Bio::Graphics - Howto draw graded segments overlap with
	line track
Message-ID: <3521d3670709300710l4a41c47es1c72cc5a450a3736@mail.gmail.com>

Hi,

I want to draw a binding sites hits on sequence of various length.
What I have now is a graded segments only. Is there a way to draw
segments overlapping with the line ? (see attached figure).

--
Edward
-------------- next part --------------
A non-text attachment was scrubbed...
Name: hits.PNG
Type: image/png
Size: 15613 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20070930/2402791e/attachment-0002.png>

From cjfields at uiuc.edu  Sun Sep  2 19:54:54 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 2 Sep 2007 18:54:54 -0500
Subject: [Bioperl-l] (no subject)
Message-ID: <CA6A55BB-BB63-4FCE-A0AA-FBB2392C778F@uiuc.edu>

Posted this to biosql-l already but felt it needed posting here as  
well.  Sorry if you get this twice.

I noticed some critical recursion issues with bioperl-db when working  
in Bio::Ontology changes.  This was using bioperl-live (post-feature/ 
annotation fixes).  Bug report is here:

http://bugzilla.open-bio.org/show_bug.cgi?id=2355

It seems to be Bio:Taxon related; this is from 03swiss.t:

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:681
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:692
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
...
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:587
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:253
STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
PrimarySeqAdaptor.pm:229
STACK Bio::DB::BioSQL::SeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
SeqAdaptor.pm:217
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:214
STACK Bio::DB::Persistent::PersistentObject::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/Persistent/ 
PersistentObject.pm:244
STACK toplevel t/04swiss.t:36
---------------------------------------------------

Also, seeing this with 13remove.t and 15.cluster.t, both of which  
appear to infinitely recurse:

Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 587, <GEN0> line 1.
Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 630, <GEN0> line 1.


chris



From cjfields at uiuc.edu  Sun Sep  2 19:57:59 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 2 Sep 2007 18:57:59 -0500
Subject: [Bioperl-l] recursion issues with bioperl-db
Message-ID: <2E14450C-C135-42DD-A9DE-EB47EB80E6AC@uiuc.edu>

Apologies if you get this more than once; the first post appeared to  
get sent w/o a proper subject line.  Posted this to biosql-l already  
but felt it needed posting here as well.

I noticed some critical recursion issues with bioperl-db when working  
in Bio::Ontology changes.  This was using bioperl-live (post-feature/ 
annotation fixes).  Bug report is here:

http://bugzilla.open-bio.org/show_bug.cgi?id=2355

It seems to be Bio:Taxon related; this is from 03swiss.t:

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:681
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:692
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
...
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:587
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:253
STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
PrimarySeqAdaptor.pm:229
STACK Bio::DB::BioSQL::SeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
SeqAdaptor.pm:217
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:214
STACK Bio::DB::Persistent::PersistentObject::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/Persistent/ 
PersistentObject.pm:244
STACK toplevel t/04swiss.t:36
---------------------------------------------------

Also, seeing this with 13remove.t and 15.cluster.t, both of which  
appear to infinitely recurse:

Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 587, <GEN0> line 1.
Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 630, <GEN0> line 1.


chris



From cjfields at uiuc.edu  Sun Sep  2 21:40:48 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 2 Sep 2007 20:40:48 -0500
Subject: [Bioperl-l] recursion issues with bioperl-db
In-Reply-To: <2E14450C-C135-42DD-A9DE-EB47EB80E6AC@uiuc.edu>
References: <2E14450C-C135-42DD-A9DE-EB47EB80E6AC@uiuc.edu>
Message-ID: <25CFD36D-D921-4F5F-BADF-D858A2FE76D4@uiuc.edu>

Okay, we can the previous posts!  Odd, but I started from scratch and  
can't reproduce the issue; there may have been some cross-talk with  
different bioperl installations on my laptop.  Anyway, everything  
passes now w/o recursion so I'll mark the bug as invalid.

chris

On Sep 2, 2007, at 6:57 PM, Chris Fields wrote:

> Apologies if you get this more than once; the first post appeared to
> get sent w/o a proper subject line.  Posted this to biosql-l already
> but felt it needed posting here as well.
>
> I noticed some critical recursion issues with bioperl-db when working
> in Bio::Ontology changes.  This was using bioperl-live (post-feature/
> annotation fixes).  Bug report is here:
>
> http://bugzilla.open-bio.org/show_bug.cgi?id=2355
>
> It seems to be Bio:Taxon related; this is from 03swiss.t:
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:681
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:630
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:692
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:630
> ...
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:587
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:253
> STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> PrimarySeqAdaptor.pm:229
> STACK Bio::DB::BioSQL::SeqAdaptor::store_children
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> SeqAdaptor.pm:217
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:214
> STACK Bio::DB::Persistent::PersistentObject::create
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/Persistent/
> PersistentObject.pm:244
> STACK toplevel t/04swiss.t:36
> ---------------------------------------------------
>
> Also, seeing this with 13remove.t and 15.cluster.t, both of which
> appear to infinitely recurse:
>
> Deep recursion on subroutine
> "Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent" at
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm
> line 587, <GEN0> line 1.
> Deep recursion on subroutine
> "Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child" at
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm
> line 630, <GEN0> line 1.
>
>
> chris
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From bernd.web at gmail.com  Mon Sep  3 08:43:26 2007
From: bernd.web at gmail.com (Bernd Web)
Date: Mon, 3 Sep 2007 14:43:26 +0200
Subject: [Bioperl-l] Fh::flush warning
Message-ID: <716af09c0709030543w79f83368gf0ac74d220a96f8c@mail.gmail.com>

Hi,

Sometimes with Bio::SimpleAlign/AlignIO, I get the following warning:
(in cleanup) Undefined subroutine Fh::flush, at
/lib/perl/Bio/Root/IO.pm line 541.

This occurs in a rather large script and have not been able to isolate
a small example where I also get this warning. Does someone know more
about this warning and why it is thrown?

Regards,
Bernd


From cjfields at uiuc.edu  Mon Sep  3 10:41:49 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 3 Sep 2007 09:41:49 -0500
Subject: [Bioperl-l] Fh::flush warning
In-Reply-To: <716af09c0709030543w79f83368gf0ac74d220a96f8c@mail.gmail.com>
References: <716af09c0709030543w79f83368gf0ac74d220a96f8c@mail.gmail.com>
Message-ID: <98A9D081-2570-4D4E-A8F8-D03282D41E0C@uiuc.edu>

Could you give a bit more info (bioperl version, OS, etc)?

I'm guessing a recent version as the error coincides with a call to  
flush() in Root::IO (which is probably called indirectly via DESTROY)  
and that you're probably using a tied filehandle somewhere for  
output, e.g. Bio::AlignIO::newFh() or Bio::AlignIO::fh(), so knowing  
the input/output formats could help.

chris

On Sep 3, 2007, at 7:43 AM, Bernd Web wrote:

> Hi,
>
> Sometimes with Bio::SimpleAlign/AlignIO, I get the following warning:
> (in cleanup) Undefined subroutine Fh::flush, at
> /lib/perl/Bio/Root/IO.pm line 541.
>
> This occurs in a rather large script and have not been able to isolate
> a small example where I also get this warning. Does someone know more
> about this warning and why it is thrown?
>
> Regards,
> Bernd
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From xianranli78 at yahoo.com.cn  Mon Sep  3 22:11:09 2007
From: xianranli78 at yahoo.com.cn (xianran li)
Date: Tue, 4 Sep 2007 10:11:09 +0800 (CST)
Subject: [Bioperl-l] question about Bio::DB::GFF
Message-ID: <361239.6752.qm@web15309.mail.cnb.yahoo.com>

 
  Hi,
   
  I tried to load the  gff3 file with load_gff.pl and extrac some information with Bio::DB::GFF. Althougth this code work properly under windows xp, the $seg got nothing when i run it under Linux. 
   
  Here is my code and the gff3 file,
  ####################################################################
   
    #!/usr/local/bin/perl -w
   
  use strict;
use Bio::SeqIO;
use Bio::DB::GFF; 
   
  my $in_gff = Bio::DB::GFF->new( -adaptor    => 'dbi::mysqlopt',
                                -dsn        => 'dbi:mysql:test',
                                -aggregator => ['coding'],
                                -user       => "lixr",
                                -pass       => "123456"
                                );                           
my $seg = $in_gff->segment'BGIOSIBCE000001.1');
print $seg->abs_start."\n"; 


  ##################################################################
  ##gff-version 3 
##sequence-region       Chr01   1       43037
Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1
Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
Chr01 bgf CDS 19344 20165 . + 0 Parent=BGIOSIBCE000001.1
Chr01 bgf mRNA 30220 36442 . + . ID=BGIOSIBCE000002.1
Chr01 bgf CDS 30220 30387 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 31128 31226 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 32228 32331 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 33907 34715 . + 1 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 34799 34921 . + 2 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 35003 35091 . + 2 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 35179 35379 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 35981 36442 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf mRNA 38143 39015 . - . ID=BGIOSIBCE000003.1
Chr01 bgf CDS 38143 38541 . - 0 Parent=BGIOSIBCE000003.1
Chr01 bgf CDS 38649 38813 . - 0 Parent=BGIOSIBCE000003.1
Chr01 bgf CDS 38917 39015 . - 0 Parent=BGIOSIBCE000003.1
Chr01 bgf mRNA 39545 42080 . + . ID=BGIOSIBCE000004.1
Chr01 bgf CDS 39545 40584 . + 0 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 40677 41042 . + 1 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 41130 41208 . + 1 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 41740 41920 . + 0 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 42037 42080 . + 2 Parent=BGIOSIBCE000004.1
  #################################################################
   
   
  I would appreaciate if any one can give me some clues/link to accomplish this. 
   
  thanks in advance ,

  Xianran Li

       
---------------------------------
???????????????????????????????????????????? 


From cjfields at uiuc.edu  Tue Sep  4 00:04:29 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 3 Sep 2007 23:04:29 -0500
Subject: [Bioperl-l] question about Bio::DB::GFF
In-Reply-To: <361239.6752.qm@web15309.mail.cnb.yahoo.com>
References: <361239.6752.qm@web15309.mail.cnb.yahoo.com>
Message-ID: <37BE6493-B49B-47DF-8047-37D616B669A8@uiuc.edu>

Not sure if the gff3 you show was modified for demonstration here but  
it should always be tab-delimited.  Also, I have had problems myself  
when using files with Windows/Mac Classic line endings on UNIX'y  
systems (Excel and a few other Mac OS X programs insist on adding \r  
instead of \n, which plays havoc with parsers sometimes even with  
readline fixes).

chris

On Sep 3, 2007, at 9:11 PM, xianran li wrote:

>
>   Hi,
>
>   I tried to load the  gff3 file with load_gff.pl and extrac some  
> information with Bio::DB::GFF. Althougth this code work properly  
> under windows xp, the $seg got nothing when i run it under Linux.
>
>   Here is my code and the gff3 file,
>   ####################################################################
>
>     #!/usr/local/bin/perl -w
>
>   use strict;
> use Bio::SeqIO;
> use Bio::DB::GFF;
>
>   my $in_gff = Bio::DB::GFF->new( -adaptor    => 'dbi::mysqlopt',
>                                 -dsn        => 'dbi:mysql:test',
>                                 -aggregator => ['coding'],
>                                 -user       => "lixr",
>                                 -pass       => "123456"
>                                 );
> my $seg = $in_gff->segment'BGIOSIBCE000001.1');
> print $seg->abs_start."\n";
>
>
>   ##################################################################
>   ##gff-version 3
> ##sequence-region       Chr01   1       43037
> Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1
> Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf CDS 19344 20165 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf mRNA 30220 36442 . + . ID=BGIOSIBCE000002.1
> Chr01 bgf CDS 30220 30387 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 31128 31226 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 32228 32331 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 33907 34715 . + 1 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 34799 34921 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35003 35091 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35179 35379 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35981 36442 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf mRNA 38143 39015 . - . ID=BGIOSIBCE000003.1
> Chr01 bgf CDS 38143 38541 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38649 38813 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38917 39015 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf mRNA 39545 42080 . + . ID=BGIOSIBCE000004.1
> Chr01 bgf CDS 39545 40584 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 40677 41042 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41130 41208 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41740 41920 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 42037 42080 . + 2 Parent=BGIOSIBCE000004.1
>   #################################################################
>
>
>   I would appreaciate if any one can give me some clues/link to  
> accomplish this.
>
>   thanks in advance ,
>
>   Xianran Li
>
>
> ---------------------------------
> ??????????????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign






From xianranli78 at yahoo.com.cn  Tue Sep  4 00:58:48 2007
From: xianranli78 at yahoo.com.cn (xianran li)
Date: Tue, 4 Sep 2007 12:58:48 +0800 (CST)
Subject: [Bioperl-l]
 =?gb2312?q?=BB=D8=B8=B4=A3=BA=20Re:=20=20question=20about=20Bi?=
 =?gb2312?q?o::DB::GFF?=
In-Reply-To: <37BE6493-B49B-47DF-8047-37D616B669A8@uiuc.edu>
Message-ID: <866169.66154.qm@web15309.mail.cnb.yahoo.com>

Hi, everybody,
   
  It looks like for the different perl version(5.8.8 of  windows and 5.8.5 for linux). And I fixed this problem by adding ";Name=XXXX" after each line with "mRNA"
  ##############################################################################
  Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1;Name=BGIOSIBCE000001.1
Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
    ##############################################################################

  This time my code works properly.
   
  Xianran

Chris Fields <cjfields at uiuc.edu> ??????
  Not sure if the gff3 you show was modified for demonstration here but 
it should always be tab-delimited. Also, I have had problems myself 
when using files with Windows/Mac Classic line endings on UNIX'y 
systems (Excel and a few other Mac OS X programs insist on adding \r 
instead of \n, which plays havoc with parsers sometimes even with 
readline fixes).

chris

On Sep 3, 2007, at 9:11 PM, xianran li wrote:

>
> Hi,
>
> I tried to load the gff3 file with load_gff.pl and extrac some 
> information with Bio::DB::GFF. Althougth this code work properly 
> under windows xp, the $seg got nothing when i run it under Linux.
>
> Here is my code and the gff3 file,
> ####################################################################
>
> #!/usr/local/bin/perl -w
>
> use strict;
> use Bio::SeqIO;
> use Bio::DB::GFF;
>
> my $in_gff = Bio::DB::GFF->new( -adaptor => 'dbi::mysqlopt',
> -dsn => 'dbi:mysql:test',
> -aggregator => ['coding'],
> -user => "lixr",
> -pass => "123456"
> );
> my $seg = $in_gff->segment'BGIOSIBCE000001.1');
> print $seg->abs_start."\n";
>
>
> ##################################################################
> ##gff-version 3
> ##sequence-region Chr01 1 43037
> Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1
> Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf CDS 19344 20165 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf mRNA 30220 36442 . + . ID=BGIOSIBCE000002.1
> Chr01 bgf CDS 30220 30387 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 31128 31226 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 32228 32331 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 33907 34715 . + 1 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 34799 34921 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35003 35091 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35179 35379 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35981 36442 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf mRNA 38143 39015 . - . ID=BGIOSIBCE000003.1
> Chr01 bgf CDS 38143 38541 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38649 38813 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38917 39015 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf mRNA 39545 42080 . + . ID=BGIOSIBCE000004.1
> Chr01 bgf CDS 39545 40584 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 40677 41042 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41130 41208 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41740 41920 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 42037 42080 . + 2 Parent=BGIOSIBCE000004.1
> #################################################################
>
>
> I would appreaciate if any one can give me some clues/link to 
> accomplish this.
>
> thanks in advance ,
>
> Xianran Li
>
>
> ---------------------------------
> ????????????????????????????????????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





       
---------------------------------
 ????????????????????????????????


From jay at jays.net  Tue Sep  4 10:31:36 2007
From: jay at jays.net (Jay Hannah)
Date: Tue, 4 Sep 2007 09:31:36 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
Message-ID: <96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>

On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> Probably a bit of a long shot but does anyone have code for
> displaying protein or CDS multiple sequence alignments with the exon
> boundaries of each gene in the alignment?
>
> Something in the bioperl world without funky external dependencies.  
> I think
> it would be an awesome addition to the howtos.
>
> Currently, the Bio::Graphics howto has cdna to genome mapping  
> scripts or
> blast output scripts, but
> I couldn't find code for dealing with multiple sequence alignments.

I'm currently under the (potentially uninformed) impression that  
Bio::Graphics and related tools only work with a single  coordinate  
system. I've never seen a multiple sequence alignment example.

(
   I Google'd for "gbrowse alignment" and hit this:
   http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi

   Click the second Example link and you'll see exons mapped out.

   But zooming all the way in with all the tracks turned on it looks  
like the AZM tracks are just the coding regions. I don't see any  
multiple sequence alignment...
)

I doubt that helped.  :)

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah




From cjfields at uiuc.edu  Tue Sep  4 11:28:01 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 4 Sep 2007 10:28:01 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
Message-ID: <59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>


On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:

> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>> Probably a bit of a long shot but does anyone have code for
>> displaying protein or CDS multiple sequence alignments with the exon
>> boundaries of each gene in the alignment?
>>
>> Something in the bioperl world without funky external dependencies.
>> I think
>> it would be an awesome addition to the howtos.
>>
>> Currently, the Bio::Graphics howto has cdna to genome mapping
>> scripts or
>> blast output scripts, but
>> I couldn't find code for dealing with multiple sequence alignments.
>
> I'm currently under the (potentially uninformed) impression that
> Bio::Graphics and related tools only work with a single  coordinate
> system. I've never seen a multiple sequence alignment example.
>
> (
>    I Google'd for "gbrowse alignment" and hit this:
>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>
>    Click the second Example link and you'll see exons mapped out.
>
>    But zooming all the way in with all the tracks turned on it looks
> like the AZM tracks are just the coding regions. I don't see any
> multiple sequence alignment...
> )
>
> I doubt that helped.  :)
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:

http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
Browser/docs/tutorial/tutorial.html

chris



From avilella at gmail.com  Wed Sep  5 05:42:37 2007
From: avilella at gmail.com (Albert Vilella)
Date: Wed, 5 Sep 2007 11:42:37 +0200
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
Message-ID: <358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>

A couple of examples:

http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041

treefam has exon boundary and PFAM domain mappings

http://www.ensembl.org/Homo_sapiens/genetreeview?gene=ENSG00000139618

here the tree is shown as well, but the idea would be to plot the alignment

So it's more "show me the multiple CDS/protein alignment" rather than "show
my aligned CDS/proteins wrt my reference genome"

I think it would be quite neat to have this as a bioperl howto,

Comments?

    Albert.

On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>
>
> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>
> > On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> >> Probably a bit of a long shot but does anyone have code for
> >> displaying protein or CDS multiple sequence alignments with the exon
> >> boundaries of each gene in the alignment?
> >>
> >> Something in the bioperl world without funky external dependencies.
> >> I think
> >> it would be an awesome addition to the howtos.
> >>
> >> Currently, the Bio::Graphics howto has cdna to genome mapping
> >> scripts or
> >> blast output scripts, but
> >> I couldn't find code for dealing with multiple sequence alignments.
> >
> > I'm currently under the (potentially uninformed) impression that
> > Bio::Graphics and related tools only work with a single  coordinate
> > system. I've never seen a multiple sequence alignment example.
> >
> > (
> >    I Google'd for "gbrowse alignment" and hit this:
> >    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
> >
> >    Click the second Example link and you'll see exons mapped out.
> >
> >    But zooming all the way in with all the tracks turned on it looks
> > like the AZM tracks are just the coding regions. I don't see any
> > multiple sequence alignment...
> > )
> >
> > I doubt that helped.  :)
> >
> > Jay Hannah
> > http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>
> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>
> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
> Browser/docs/tutorial/tutorial.html
>
> chris
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From alexl at users.sourceforge.net  Wed Sep  5 06:08:14 2007
From: alexl at users.sourceforge.net (Alex Lancaster)
Date: Wed, 05 Sep 2007 03:08:14 -0700
Subject: [Bioperl-l] Clarifying license of bioperl
In-Reply-To: <8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net> (Hilmar Lapp's
	message of "Sat\, 18 Aug 2007 12\:13\:28 -0400")
References: <cg3ayi39sn.fsf@allele2.localdomain>
	<nrsl6i1ub4.fsf@allele2.localdomain>
	<1A4207F8295607498283FE9E93B775B40390172E@EX02.asurite.ad.asu.edu>
	<n9ir7e18y2.fsf@allele2.localdomain>
	<3515AB25-9919-407B-93E9-352BC426AFA1@uiuc.edu>
	<8td4xlyt4h.fsf@allele2.localdomain>
	<8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net>
Message-ID: <s73axt5ss1.fsf@allele2.localdomain>

>>>>> "HL" == Hilmar Lapp  writes:

HL> On Aug 18, 2007, at 7:33 AM, Alex Lancaster wrote:

> I imagine the intent of the bioperl
>> contributors is that it should be under the same terms as Perl,
>> whatever that happens to be (which just happens to be GPL or
>> Artistic, which is fine).

HL> I fully agree.

>> A clarification to that effect would be useful.

HL> Agreed, too. Would you mind changing that language on the wiki,
HL> since you seem to have a fairly good grasp on the issue?

OK, I've updated the wiki in two places:

http://www.bioperl.org/wiki/Licensing_BioPerl

http://www.bioperl.org/wiki/FAQ#What_are_the_license_terms_for_BioPerl.3F

It would also be nice if the LICENSE and Build.PL files in CVS (so it
finds its way into the next release) were also updated to reflect the
dual-licensed status, currently they only mention the Artistic
license:

http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/LICENSE?rev=HEAD&content-type=text/vnd.viewcvs-markup

http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/Build.PL?rev=HEAD&content-type=text/vnd.viewcvs-markup

For Build.PL this is easy:

(e.g., license             => 'artistic', should be 
       license             => 'GPL or Artistic',)

Possible solutions for the LICENSE file include:

1) The GPL could be added to LICENSE file at the end (with a note at
   the top to indicate that GPL is also included);

2) LICENSE could be moved to LICENSE.Artistic and another file
   "LICENSE.GPL" added with the GPL (version 2+) conditions, and the
   contents of LICENSE would include a note about each license.

I don't have access to the bioperl CVS repository, so I can't make the
changes myself).  This would also apply to the Build.PL (and LICENSE
files if they are present) in bioperl-run and other modules.

Thanks,
Alex


From cjfields at uiuc.edu  Wed Sep  5 08:25:21 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 07:25:21 -0500
Subject: [Bioperl-l] Clarifying license of bioperl
In-Reply-To: <s73axt5ss1.fsf@allele2.localdomain>
References: <cg3ayi39sn.fsf@allele2.localdomain>
	<nrsl6i1ub4.fsf@allele2.localdomain>
	<1A4207F8295607498283FE9E93B775B40390172E@EX02.asurite.ad.asu.edu>
	<n9ir7e18y2.fsf@allele2.localdomain>
	<3515AB25-9919-407B-93E9-352BC426AFA1@uiuc.edu>
	<8td4xlyt4h.fsf@allele2.localdomain>
	<8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net>
	<s73axt5ss1.fsf@allele2.localdomain>
Message-ID: <EE93F2F5-A76B-40C6-8A95-3E1DDD3D8562@uiuc.edu>


On Sep 5, 2007, at 5:08 AM, Alex Lancaster wrote:
...
>
> OK, I've updated the wiki in two places:
>
> http://www.bioperl.org/wiki/Licensing_BioPerl
>
> http://www.bioperl.org/wiki/ 
> FAQ#What_are_the_license_terms_for_BioPerl.3F
>
> It would also be nice if the LICENSE and Build.PL files in CVS (so it
> finds its way into the next release) were also updated to reflect the
> dual-licensed status, currently they only mention the Artistic
> license:
>
> http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/LICENSE? 
> rev=HEAD&content-type=text/vnd.viewcvs-markup
>
> http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/Build.PL? 
> rev=HEAD&content-type=text/vnd.viewcvs-markup
>
> For Build.PL this is easy:
>
> (e.g., license             => 'artistic', should be
>        license             => 'GPL or Artistic',)
>
> Possible solutions for the LICENSE file include:
>
> 1) The GPL could be added to LICENSE file at the end (with a note at
>    the top to indicate that GPL is also included);
>
> 2) LICENSE could be moved to LICENSE.Artistic and another file
>    "LICENSE.GPL" added with the GPL (version 2+) conditions, and the
>    contents of LICENSE would include a note about each license.
>
> I don't have access to the bioperl CVS repository, so I can't make the
> changes myself).  This would also apply to the Build.PL (and LICENSE
> files if they are present) in bioperl-run and other modules.
>
> Thanks,
> Alex

Looks like Sendu has done that.  There have been recent troubling  
developments re: Artistic License:

http://use.perl.org/article.pl?sid=07/08/26/1541205&from=rss

but the case hasn't been conclusively decided yet.

chris


From bix at sendu.me.uk  Wed Sep  5 08:18:35 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Wed, 05 Sep 2007 13:18:35 +0100
Subject: [Bioperl-l] Clarifying license of bioperl
In-Reply-To: <s73axt5ss1.fsf@allele2.localdomain>
References: <cg3ayi39sn.fsf@allele2.localdomain>	<nrsl6i1ub4.fsf@allele2.localdomain>	<1A4207F8295607498283FE9E93B775B40390172E@EX02.asurite.ad.asu.edu>	<n9ir7e18y2.fsf@allele2.localdomain>	<3515AB25-9919-407B-93E9-352BC426AFA1@uiuc.edu>	<8td4xlyt4h.fsf@allele2.localdomain>	<8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net>
	<s73axt5ss1.fsf@allele2.localdomain>
Message-ID: <46DE9E9B.80107@sendu.me.uk>

Alex Lancaster wrote:
>>>>>> "HL" == Hilmar Lapp  writes:
> 
> HL> On Aug 18, 2007, at 7:33 AM, Alex Lancaster wrote:
> 
>>> I imagine the intent of the bioperl
>>> contributors is that it should be under the same terms as Perl,
>>> whatever that happens to be (which just happens to be GPL or
>>> Artistic, which is fine).
> 
> HL> I fully agree.
> 
>>> A clarification to that effect would be useful.
> 
> HL> Agreed, too. Would you mind changing that language on the wiki,
> HL> since you seem to have a fairly good grasp on the issue?
> 
> OK, I've updated the wiki in two places:
> 
> http://www.bioperl.org/wiki/Licensing_BioPerl
> 
> http://www.bioperl.org/wiki/FAQ#What_are_the_license_terms_for_BioPerl.3F

Thank you very much for that Alex.


> It would also be nice if the LICENSE and Build.PL files in CVS (so it
> finds its way into the next release) were also updated to reflect the
> dual-licensed status, currently they only mention the Artistic
> license:
[snip]
> For Build.PL this is easy:
> 
> (e.g., license             => 'artistic', should be 
>        license             => 'GPL or Artistic',)

As per the 'license' section of 
http://search.cpan.org/~kwilliams/Module-Build-0.2808/lib/Module/Build/API.pod, 
I've changed it to 'perl', which means Artistic or GPL.


> Possible solutions for the LICENSE file include:
> 
> 1) The GPL could be added to LICENSE file at the end (with a note at
>    the top to indicate that GPL is also included);

I took this approach, using your language for the explanation at the 
top, and including GPL 3.0 at the bottom.


I've made these changes for core (live), run, db and network.

Thanks again for your help and advice.


From cjfields at uiuc.edu  Wed Sep  5 08:53:25 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 07:53:25 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
Message-ID: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>

You mean something like this?

http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics

chris

On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:

> A couple of examples:
>
> http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
>
> treefam has exon boundary and PFAM domain mappings
>
> http://www.ensembl.org/Homo_sapiens/genetreeview?gene=ENSG00000139618
>
> here the tree is shown as well, but the idea would be to plot the  
> alignment
>
> So it's more "show me the multiple CDS/protein alignment" rather  
> than "show
> my aligned CDS/proteins wrt my reference genome"
>
> I think it would be quite neat to have this as a bioperl howto,
>
> Comments?
>
>     Albert.
>
> On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>
>>
>> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>>
>>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>>>> Probably a bit of a long shot but does anyone have code for
>>>> displaying protein or CDS multiple sequence alignments with the  
>>>> exon
>>>> boundaries of each gene in the alignment?
>>>>
>>>> Something in the bioperl world without funky external dependencies.
>>>> I think
>>>> it would be an awesome addition to the howtos.
>>>>
>>>> Currently, the Bio::Graphics howto has cdna to genome mapping
>>>> scripts or
>>>> blast output scripts, but
>>>> I couldn't find code for dealing with multiple sequence alignments.
>>>
>>> I'm currently under the (potentially uninformed) impression that
>>> Bio::Graphics and related tools only work with a single  coordinate
>>> system. I've never seen a multiple sequence alignment example.
>>>
>>> (
>>>    I Google'd for "gbrowse alignment" and hit this:
>>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>>>
>>>    Click the second Example link and you'll see exons mapped out.
>>>
>>>    But zooming all the way in with all the tracks turned on it looks
>>> like the AZM tracks are just the coding regions. I don't see any
>>> multiple sequence alignment...
>>> )
>>>
>>> I doubt that helped.  :)
>>>
>>> Jay Hannah
>>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>>
>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>>
>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
>> Browser/docs/tutorial/tutorial.html
>>
>> chris
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From avilella at gmail.com  Wed Sep  5 09:31:24 2007
From: avilella at gmail.com (Albert Vilella)
Date: Wed, 5 Sep 2007 15:31:24 +0200
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
Message-ID: <358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>

Awesome!!

Thanks Chris!

On 9/5/07, Chris Fields <cjfields at uiuc.edu> wrote:
>
> You mean something like this?
>
> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>
> chris
>
> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>
> > A couple of examples:
> >
> > http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
> >
> > treefam has exon boundary and PFAM domain mappings
> >
> > http://www.ensembl.org/Homo_sapiens/genetreeview?gene=ENSG00000139618
> >
> > here the tree is shown as well, but the idea would be to plot the
> > alignment
> >
> > So it's more "show me the multiple CDS/protein alignment" rather
> > than "show
> > my aligned CDS/proteins wrt my reference genome"
> >
> > I think it would be quite neat to have this as a bioperl howto,
> >
> > Comments?
> >
> >     Albert.
> >
> > On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
> >>
> >>
> >> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
> >>
> >>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> >>>> Probably a bit of a long shot but does anyone have code for
> >>>> displaying protein or CDS multiple sequence alignments with the
> >>>> exon
> >>>> boundaries of each gene in the alignment?
> >>>>
> >>>> Something in the bioperl world without funky external dependencies.
> >>>> I think
> >>>> it would be an awesome addition to the howtos.
> >>>>
> >>>> Currently, the Bio::Graphics howto has cdna to genome mapping
> >>>> scripts or
> >>>> blast output scripts, but
> >>>> I couldn't find code for dealing with multiple sequence alignments.
> >>>
> >>> I'm currently under the (potentially uninformed) impression that
> >>> Bio::Graphics and related tools only work with a single  coordinate
> >>> system. I've never seen a multiple sequence alignment example.
> >>>
> >>> (
> >>>    I Google'd for "gbrowse alignment" and hit this:
> >>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
> >>>
> >>>    Click the second Example link and you'll see exons mapped out.
> >>>
> >>>    But zooming all the way in with all the tracks turned on it looks
> >>> like the AZM tracks are just the coding regions. I don't see any
> >>> multiple sequence alignment...
> >>> )
> >>>
> >>> I doubt that helped.  :)
> >>>
> >>> Jay Hannah
> >>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
> >>
> >> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
> >>
> >> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
> >> Browser/docs/tutorial/tutorial.html
> >>
> >> chris
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
>


From cjfields at uiuc.edu  Wed Sep  5 10:17:51 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 09:17:51 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
Message-ID: <31E25B64-2043-4460-ADC8-9684D01C2468@uiuc.edu>

It would be nice to place the labels to the left of the segments.  I  
believe there is a way to do this, but can't remember; if I can find  
it I'll revise the script.

chris

On Sep 5, 2007, at 8:31 AM, Albert Vilella wrote:

> Awesome!!
>
> Thanks Chris!
>
> On 9/5/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>
>> You mean something like this?
>>
>> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>>
>> chris
>>
>> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>>
>>> A couple of examples:
>>>
>>> http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
>>>
>>> treefam has exon boundary and PFAM domain mappings
>>>
>>> http://www.ensembl.org/Homo_sapiens/genetreeview? 
>>> gene=ENSG00000139618
>>>
>>> here the tree is shown as well, but the idea would be to plot the
>>> alignment
>>>
>>> So it's more "show me the multiple CDS/protein alignment" rather
>>> than "show
>>> my aligned CDS/proteins wrt my reference genome"
>>>
>>> I think it would be quite neat to have this as a bioperl howto,
>>>
>>> Comments?
>>>
>>>     Albert.
>>>
>>> On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>>>
>>>>
>>>> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>>>>
>>>>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>>>>>> Probably a bit of a long shot but does anyone have code for
>>>>>> displaying protein or CDS multiple sequence alignments with the
>>>>>> exon
>>>>>> boundaries of each gene in the alignment?
>>>>>>
>>>>>> Something in the bioperl world without funky external  
>>>>>> dependencies.
>>>>>> I think
>>>>>> it would be an awesome addition to the howtos.
>>>>>>
>>>>>> Currently, the Bio::Graphics howto has cdna to genome mapping
>>>>>> scripts or
>>>>>> blast output scripts, but
>>>>>> I couldn't find code for dealing with multiple sequence  
>>>>>> alignments.
>>>>>
>>>>> I'm currently under the (potentially uninformed) impression that
>>>>> Bio::Graphics and related tools only work with a single   
>>>>> coordinate
>>>>> system. I've never seen a multiple sequence alignment example.
>>>>>
>>>>> (
>>>>>    I Google'd for "gbrowse alignment" and hit this:
>>>>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>>>>>
>>>>>    Click the second Example link and you'll see exons mapped out.
>>>>>
>>>>>    But zooming all the way in with all the tracks turned on it  
>>>>> looks
>>>>> like the AZM tracks are just the coding regions. I don't see any
>>>>> multiple sequence alignment...
>>>>> )
>>>>>
>>>>> I doubt that helped.  :)
>>>>>
>>>>> Jay Hannah
>>>>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>>>>
>>>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>>>>
>>>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
>>>> Browser/docs/tutorial/tutorial.html
>>>>
>>>> chris
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From n.haigh at sheffield.ac.uk  Wed Sep  5 10:22:44 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Wed, 05 Sep 2007 15:22:44 +0100
Subject: [Bioperl-l] Bio::Graphics support for floating point positions
In-Reply-To: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
Message-ID: <46DEBBB4.1030200@sheffield.ac.uk>

Chris Fields wrote:
> You mean something like this?
>
> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>
> chris
>
> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>
>   

Nice!

On a similar (well, related to Bio::Graphics) topic, I've written a
script that uses markers that have been mapped from a model organism to
linkage groups in related species in order to estimate the location of
"unknown" markers in those linkage groups.

I'm using the Bio::Map::* modules for much of this work and then I use
Bio::Graphics to display the linkage groups of the non-model organism
with the putative position of the "unknown" markers. However, I've had
to do a bit of fudging to get Bio::Graphics to draw this data. The
problems I encountered are described below. I also have an open bug:
http://bugzilla.open-bio.org/show_bug.cgi?id=2343

1) Linkage maps are measured in cM - which can and are likely to be
non-integer values. Bio::Graphics needs integer values, so I simply
scaled all my cM measurements prior to drawing by *1000. However, the
ruler now doesn't represent the "true scale" - can this be adjusted?

2) Some markers map to 0cM. However, Bio::Graphics requires positions
>0. To get round this I simply incremented these positions by 1
(post-scaling), so they display almost in the correct place.

Is it possible/likely/wise to support positions starting at zero and
float positions? Would such support simply be to internalise what I have
already done outside Bio::Graphics into the Bio::Graphics modules and
have it display the correctly scaled ruler?

Thoughts comments welcome.

Cheers,
Nath


From cjfields at uiuc.edu  Wed Sep  5 10:52:00 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 09:52:00 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
Message-ID: <A8815527-2027-4F9D-BC47-C16E351067AA@uiuc.edu>

Updated the page on the web site with the new script.

Figured it out; if you pass the parameter -label_position 'left' it  
will display the label to the left.  However it displays them right  
next to the segment (ala GBrowse).  I added a hack to  
Bio::Graphics::Glyph::generic in CVS which allows 'alignment_left' as  
an option, displaying it aligned to the far left of the panel; there  
is probably a way to use a callback here as well.

chris

On Sep 5, 2007, at 8:31 AM, Albert Vilella wrote:

> Awesome!!
>
> Thanks Chris!
>
> On 9/5/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>
>> You mean something like this?
>>
>> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>>
>> chris
>>
>> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>>
>>> A couple of examples:
>>>
>>> http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
>>>
>>> treefam has exon boundary and PFAM domain mappings
>>>
>>> http://www.ensembl.org/Homo_sapiens/genetreeview? 
>>> gene=ENSG00000139618
>>>
>>> here the tree is shown as well, but the idea would be to plot the
>>> alignment
>>>
>>> So it's more "show me the multiple CDS/protein alignment" rather
>>> than "show
>>> my aligned CDS/proteins wrt my reference genome"
>>>
>>> I think it would be quite neat to have this as a bioperl howto,
>>>
>>> Comments?
>>>
>>>     Albert.
>>>
>>> On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>>>
>>>>
>>>> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>>>>
>>>>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>>>>>> Probably a bit of a long shot but does anyone have code for
>>>>>> displaying protein or CDS multiple sequence alignments with the
>>>>>> exon
>>>>>> boundaries of each gene in the alignment?
>>>>>>
>>>>>> Something in the bioperl world without funky external  
>>>>>> dependencies.
>>>>>> I think
>>>>>> it would be an awesome addition to the howtos.
>>>>>>
>>>>>> Currently, the Bio::Graphics howto has cdna to genome mapping
>>>>>> scripts or
>>>>>> blast output scripts, but
>>>>>> I couldn't find code for dealing with multiple sequence  
>>>>>> alignments.
>>>>>
>>>>> I'm currently under the (potentially uninformed) impression that
>>>>> Bio::Graphics and related tools only work with a single   
>>>>> coordinate
>>>>> system. I've never seen a multiple sequence alignment example.
>>>>>
>>>>> (
>>>>>    I Google'd for "gbrowse alignment" and hit this:
>>>>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>>>>>
>>>>>    Click the second Example link and you'll see exons mapped out.
>>>>>
>>>>>    But zooming all the way in with all the tracks turned on it  
>>>>> looks
>>>>> like the AZM tracks are just the coding regions. I don't see any
>>>>> multiple sequence alignment...
>>>>> )
>>>>>
>>>>> I doubt that helped.  :)
>>>>>
>>>>> Jay Hannah
>>>>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>>>>
>>>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>>>>
>>>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
>>>> Browser/docs/tutorial/tutorial.html
>>>>
>>>> chris
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From cjfields at uiuc.edu  Wed Sep  5 12:47:46 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 11:47:46 -0500
Subject: [Bioperl-l] Bio::Graphics support for floating point positions
In-Reply-To: <46DEBBB4.1030200@sheffield.ac.uk>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<46DEBBB4.1030200@sheffield.ac.uk>
Message-ID: <C445D375-6B45-476F-B0A9-2B28851EE970@uiuc.edu>

On Sep 5, 2007, at 9:22 AM, Nathan Haigh wrote:

> ...
> On a similar (well, related to Bio::Graphics) topic, I've written a
> script that uses markers that have been mapped from a model  
> organism to
> linkage groups in related species in order to estimate the location of
> "unknown" markers in those linkage groups.
>
> I'm using the Bio::Map::* modules for much of this work and then I use
> Bio::Graphics to display the linkage groups of the non-model organism
> with the putative position of the "unknown" markers. However, I've had
> to do a bit of fudging to get Bio::Graphics to draw this data. The
> problems I encountered are described below. I also have an open bug:
> http://bugzilla.open-bio.org/show_bug.cgi?id=2343
>
> 1) Linkage maps are measured in cM - which can and are likely to be
> non-integer values. Bio::Graphics needs integer values, so I simply
> scaled all my cM measurements prior to drawing by *1000. However, the
> ruler now doesn't represent the "true scale" - can this be adjusted?
>
> 2) Some markers map to 0cM. However, Bio::Graphics requires positions
>> 0. To get round this I simply incremented these positions by 1
> (post-scaling), so they display almost in the correct place.
>
> Is it possible/likely/wise to support positions starting at zero and
> float positions? Would such support simply be to internalise what I  
> have
> already done outside Bio::Graphics into the Bio::Graphics modules and
> have it display the correctly scaled ruler?
>
> Thoughts comments welcome.
>
> Cheers,
> Nath

There is this section in the GBrowse configure doc, which to me  
suggests there is a way to do what you want in Bioperl; you may have  
to delve into the Bio::Graphics or GBrowse code to work it out,  
though.  I think the GBrowse mail list archives also have more on this.

chris

.....

F. DISPLAYING GENETIC AND RH MAPS

GBrowse can be tweaked to make it more suitable for displaying genetic
and radiation hybrid maps.

The main issue is that the Bio::DB::GFF database expects coordinates
to be positive integers, not fractions, but genetic and RH maps use
floating point numbers.  Working around this is a bit of an ugly hack.
Before loading your data you must multiply all your coordinates by a
constant power of 10 in order to convert them into integers.  For
example, if a genetic map uses Morgan units ranging from 0 to 1.80,
you would multiple by 100 to create a map in ranging from 0 to 180.

Create a GFF file containing the markers in modified coordinates and
load it as usual.  Now you must tell GBrowse to reverse these changes.
Enter the following options into the [GENERAL] section of the
configuration file:

  units = M
  unit_divider = 100

These two options tell GBrowse to use "M" (Morgan) units, and to
divide all coordinates by 100.  GBrowse will automatically display the
scale using the most appropriate units, so the displayed map will
typically be drawn using cM units.



From bernd.web at gmail.com  Wed Sep  5 13:44:26 2007
From: bernd.web at gmail.com (Bernd Web)
Date: Wed, 5 Sep 2007 19:44:26 +0200
Subject: [Bioperl-l] SearchIO ResultWriter
Message-ID: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>

Hi,

For SearchIO there are ResultWriters to write text, html and BSML
(BSMLResultWriter). However, is there also a BLAST xml writer, which
writes the original blast xml files. This may have come up before. If
there is not, is there interest in having this?


Regards,
Bernd


From sac at bioperl.org  Wed Sep  5 16:37:37 2007
From: sac at bioperl.org (Steve Chervitz)
Date: Wed, 5 Sep 2007 13:37:37 -0700
Subject: [Bioperl-l] SearchIO ResultWriter
In-Reply-To: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>
References: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>
Message-ID: <8f200b4c0709051337u532804d6r27712b05faaeea7d@mail.gmail.com>

Looks like there is no such functionality in the current repository. If you
have implemented such a beast and are willing to contribute it, go for it
(or coordinate with a developer if you lack CVS write access).

Steve

On 9/5/07, Bernd Web <bernd.web at gmail.com> wrote:
>
> Hi,
>
> For SearchIO there are ResultWriters to write text, html and BSML
> (BSMLResultWriter). However, is there also a BLAST xml writer, which
> writes the original blast xml files. This may have come up before. If
> there is not, is there interest in having this?
>
>
> Regards,
> Bernd
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From n.haigh at sheffield.ac.uk  Wed Sep  5 17:18:17 2007
From: n.haigh at sheffield.ac.uk (Nathan S. Haigh)
Date: Wed, 05 Sep 2007 22:18:17 +0100
Subject: [Bioperl-l] Bio::Graphics support for floating point positions
In-Reply-To: <C445D375-6B45-476F-B0A9-2B28851EE970@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<46DEBBB4.1030200@sheffield.ac.uk>
	<C445D375-6B45-476F-B0A9-2B28851EE970@uiuc.edu>
Message-ID: <46DF1D19.9010707@sheffield.ac.uk>

Chris Fields wrote:
> On Sep 5, 2007, at 9:22 AM, Nathan Haigh wrote:
>
>> ...
>> On a similar (well, related to Bio::Graphics) topic, I've written a
>> script that uses markers that have been mapped from a model organism to
>> linkage groups in related species in order to estimate the location of
>> "unknown" markers in those linkage groups.
>>
>> I'm using the Bio::Map::* modules for much of this work and then I use
>> Bio::Graphics to display the linkage groups of the non-model organism
>> with the putative position of the "unknown" markers. However, I've had
>> to do a bit of fudging to get Bio::Graphics to draw this data. The
>> problems I encountered are described below. I also have an open bug:
>> http://bugzilla.open-bio.org/show_bug.cgi?id=2343
>>
>> 1) Linkage maps are measured in cM - which can and are likely to be
>> non-integer values. Bio::Graphics needs integer values, so I simply
>> scaled all my cM measurements prior to drawing by *1000. However, the
>> ruler now doesn't represent the "true scale" - can this be adjusted?
>>
>> 2) Some markers map to 0cM. However, Bio::Graphics requires positions
>>> 0. To get round this I simply incremented these positions by 1
>> (post-scaling), so they display almost in the correct place.
>>
>> Is it possible/likely/wise to support positions starting at zero and
>> float positions? Would such support simply be to internalise what I have
>> already done outside Bio::Graphics into the Bio::Graphics modules and
>> have it display the correctly scaled ruler?
>>
>> Thoughts comments welcome.
>>
>> Cheers,
>> Nath
>
> There is this section in the GBrowse configure doc, which to me
> suggests there is a way to do what you want in Bioperl; you may have
> to delve into the Bio::Graphics or GBrowse code to work it out,
> though.  I think the GBrowse mail list archives also have more on this.
>
> chris
>
> .....
>
> F. DISPLAYING GENETIC AND RH MAPS
>
> GBrowse can be tweaked to make it more suitable for displaying genetic
> and radiation hybrid maps.
>
> The main issue is that the Bio::DB::GFF database expects coordinates
> to be positive integers, not fractions, but genetic and RH maps use
> floating point numbers.  Working around this is a bit of an ugly hack.
> Before loading your data you must multiply all your coordinates by a
> constant power of 10 in order to convert them into integers.  For
> example, if a genetic map uses Morgan units ranging from 0 to 1.80,
> you would multiple by 100 to create a map in ranging from 0 to 180.
>
> Create a GFF file containing the markers in modified coordinates and
> load it as usual.  Now you must tell GBrowse to reverse these changes.
> Enter the following options into the [GENERAL] section of the
> configuration file:
>
>  units = M
>  unit_divider = 100
>
> These two options tell GBrowse to use "M" (Morgan) units, and to
> divide all coordinates by 100.  GBrowse will automatically display the
> scale using the most appropriate units, so the displayed map will
> typically be drawn using cM units.
>


Thanks for for the pointer Chris!

>From what you've said, it appears they might have done a similar hack to
me - which is always nice to know! It seems then to me, that it may be
worth making the Bio::Graphic::* modules slightly more generic and
applicable for these situations. It's late, so does anyone have
suggestions before I start digging through Bio::Graphic::* modules in
the morning? Maybe you guys across the water have something to say by
the time I wake up in the morning!?

Thanks
Nath


From jason at bioperl.org  Wed Sep  5 17:33:44 2007
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 5 Sep 2007 14:33:44 -0700
Subject: [Bioperl-l] SearchIO ResultWriter
In-Reply-To: <8f200b4c0709051337u532804d6r27712b05faaeea7d@mail.gmail.com>
References: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>
	<8f200b4c0709051337u532804d6r27712b05faaeea7d@mail.gmail.com>
Message-ID: <AE9E4472-3424-49F6-AA93-6F05F14446AA@bioperl.org>

I think most ppl aren't that enamored with the NCBI XML Blast format  
but I guess it is standard if the NCBI puts it out...
It should be a pretty easy writer to make at any rate just follow  
along with what was done for BSMLWriter.

-jason
On Sep 5, 2007, at 1:37 PM, Steve Chervitz wrote:

> Looks like there is no such functionality in the current  
> repository. If you
> have implemented such a beast and are willing to contribute it, go  
> for it
> (or coordinate with a developer if you lack CVS write access).
>
> Steve
>
> On 9/5/07, Bernd Web <bernd.web at gmail.com> wrote:
>>
>> Hi,
>>
>> For SearchIO there are ResultWriters to write text, html and BSML
>> (BSMLResultWriter). However, is there also a BLAST xml writer, which
>> writes the original blast xml files. This may have come up before. If
>> there is not, is there interest in having this?
>>
>>
>> Regards,
>> Bernd
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
jason at bioperl.org



From jay at jays.net  Thu Sep  6 15:50:53 2007
From: jay at jays.net (Jay Hannah)
Date: Thu, 6 Sep 2007 15:50:53 -0400 (EDT)
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
 with exon boundaries
In-Reply-To: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
Message-ID: <Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>


On Wed, 5 Sep 2007, Chris Fields wrote:
> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics

Wow. That's slick.  :)   Is it possible to zoom in far enough to see the 
individual bases and gaps??

On Tue, 4 Sep 2007, Chris Fields wrote:
> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-Browser/docs/tutorial/tutorial.html

Yes, indeed. GBrowse graphs all sorts of amazing things. Specifically, 
this image might be what Albert is looking for:

http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-Browser/docs/tutorial/figures/segmented_features2.gif

He'd need to map his exon boundaries from whatever format he has into a 
GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to munch on.

On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> "Something in the bioperl world without funky external dependencies"

There are still things the long arm of BioPerl justice hasn't reached?   :)

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah



From cjfields at uiuc.edu  Thu Sep  6 19:39:07 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 6 Sep 2007 18:39:07 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
Message-ID: <9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>


On Sep 6, 2007, at 2:50 PM, Jay Hannah wrote:

>
> On Wed, 5 Sep 2007, Chris Fields wrote:
>> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>
> Wow. That's slick.  :)   Is it possible to zoom in far enough to  
> see the
> individual bases and gaps??

I'm not sure; you can do something like that with GBrowse with some  
features so there is probably a way to put something together which  
could do that.

> On Tue, 4 Sep 2007, Chris Fields wrote:
>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
>> Browser/docs/tutorial/tutorial.html
>
> Yes, indeed. GBrowse graphs all sorts of amazing things. Specifically,
> this image might be what Albert is looking for:
>
> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
> Browser/docs/tutorial/figures/segmented_features2.gif
>
> He'd need to map his exon boundaries from whatever format he has  
> into a
> GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to  
> munch on.

I use segmented SeqFeatures in my example.  The HOWTO also uses a  
variation ('graded_segments'):

http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output

The subseqfeatures are colored by score.  Feasibly one could hack  
this so that the exons/introns have a different 'score', thus  
displaying different colors.

> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>> "Something in the bioperl world without funky external dependencies"
>
> There are still things the long arm of BioPerl justice hasn't  
> reached?   :)
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

chris


From cain.cshl at gmail.com  Thu Sep  6 23:20:04 2007
From: cain.cshl at gmail.com (Scott Cain)
Date: Thu, 06 Sep 2007 23:20:04 -0400
Subject: [Bioperl-l] display protein/CDS multiple sequence
	alignments	with exon boundaries
In-Reply-To: <9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
Message-ID: <1189135204.2560.52.camel@localhost.localdomain>

On Thu, 2007-09-06 at 18:39 -0500, Chris Fields wrote:
> On Sep 6, 2007, at 2:50 PM, Jay Hannah wrote:
> 
> >
> > On Wed, 5 Sep 2007, Chris Fields wrote:
> >> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
> >
> > Wow. That's slick.  :)   Is it possible to zoom in far enough to  
> > see the
> > individual bases and gaps??
> 
> I'm not sure; you can do something like that with GBrowse with some  
> features so there is probably a way to put something together which  
> could do that.

Yeah, if it were me, I would install GBrowse, hack my data into GFF and
use gbrowse_img to generate pictures.  It would probably be easier than
starting from scratch.


> 
> > On Tue, 4 Sep 2007, Chris Fields wrote:
> >> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
> >> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
> >> Browser/docs/tutorial/tutorial.html
> >
> > Yes, indeed. GBrowse graphs all sorts of amazing things. Specifically,
> > this image might be what Albert is looking for:
> >
> > http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
> > Browser/docs/tutorial/figures/segmented_features2.gif
> >
> > He'd need to map his exon boundaries from whatever format he has  
> > into a
> > GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to  
> > munch on.
> 
> I use segmented SeqFeatures in my example.  The HOWTO also uses a  
> variation ('graded_segments'):
> 
> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
> 
> The subseqfeatures are colored by score.  Feasibly one could hack  
> this so that the exons/introns have a different 'score', thus  
> displaying different colors.
> 
> > On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> >> "Something in the bioperl world without funky external dependencies"
> >
> > There are still things the long arm of BioPerl justice hasn't  
> > reached?   :)
> >
> > Jay Hannah
> > http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
> 
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain at cshl.edu
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory
-------------- next part --------------
A non-text attachment was scrubbed...
Name: not available
Type: application/pgp-signature
Size: 189 bytes
Desc: This is a digitally signed message part
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20070906/6b2b9ea2/attachment-0003.bin>

From avilella at gmail.com  Fri Sep  7 05:20:01 2007
From: avilella at gmail.com (Albert Vilella)
Date: Fri, 7 Sep 2007 10:20:01 +0100
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
Message-ID: <358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>

>
> > He'd need to map his exon boundaries from whatever format he has
> > into a
> > GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to
> > munch on.
>
> I use segmented SeqFeatures in my example.  The HOWTO also uses a
> variation ('graded_segments'):
>
> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
>
> The subseqfeatures are colored by score.  Feasibly one could hack
> this so that the exons/introns have a different 'score', thus
> displaying different colors.


The exon boundary could be a vertical line or a triangular tick or
something. I don't know if there is a consensus on this kind of cartoons.
Does anybody know how exon boundaries are displayed in different
browsers/apps?


From yangmeng at genomics.org.cn  Fri Sep  7 03:57:14 2007
From: yangmeng at genomics.org.cn (=?ISO-8859-1?Q?=D1=EE=C3=CD=A3=A8=D6=D0=D0=C4=CA=B5=D1=E9=CA=D2?= )
Date: Fri,  7 Sep 2007 15:57:14 +0800
Subject: [Bioperl-l] a question
Message-ID: <200709071557.AA78971054@genomics.org.cn>

I am a student from China.During my learing the bioperl,I encounter a problem as follows:

I run the program,

use Bio::Perl;
$seq_object = get_sequence('swissprot',"ROA1_HUMAN");
write_sequence(">roa1.fasta",'fasta',$seq_object);

But It returns lots of mistake informatiom,

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: WebDBSeqI Request Error:
501 Protocol scheme '' is not supported
Content-Type: text/plain
Client-Date: Fri, 07 Sep 2007 07:26:06 GMT
Client-Warning: Internal response
501 Protocol scheme '' is not supported
STACK: Error::throw
STACK: Bio::Root::Root::throw D:/perl/site/lib/Bio/Root/Root.pm:359
STACK: Bio::DB::WebDBSeqI::_request D:/perl/site/lib/Bio/DB/WebDBSeqI.pm:685
STACK: Bio::DB::WebDBSeqI::get_seq_stream D:/perl/site/lib/Bio/DB/WebDBSeqI.pm:4
91
STACK: Bio::DB::WebDBSeqI::get_Stream_by_id D:/perl/site/lib/Bio/DB/WebDBSeqI.pm
:275
STACK: Bio::DB::WebDBSeqI::get_Seq_by_id D:/perl/site/lib/Bio/DB/WebDBSeqI.pm:14
5
STACK: Bio::Perl::get_sequence D:/perl/site/lib/Bio/Perl.pm:510
STACK: C:\DOCUME~1\yangmeng\LOCALS~1\Temp\dir13D.tmp\Untitled.pl:6
-----------------------------------------------------------

I don't know the reason of the problem.I have installed the addition perl modules such as bioperl-db,bioperl-network,bioperlgui and almost all "BioPerl Dependencies modules".My network is also OK. It's an annoying promleb to me.
I have consulted many experts but didn't got a reply. Could you vacuate in your mass business to give me a help?

Thank you!

Best regards!

YangMeng  




________________________________________________________________
Sent via the WebMail system at genomics.org.cn


 
                   


From cjfields at uiuc.edu  Fri Sep  7 10:09:18 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 7 Sep 2007 09:09:18 -0500
Subject: [Bioperl-l] a question
In-Reply-To: <200709071557.AA78971054@genomics.org.cn>
References: <200709071557.AA78971054@genomics.org.cn>
Message-ID: <7F176E39-18A6-4BF9-9247-863D6F3C167D@uiuc.edu>


On Sep 7, 2007, at 2:57 AM, ???????????????? wrote:

> I am a student from China.During my learing the bioperl,I encounter  
> a problem as follows:
>
> I run the program,
>
> use Bio::Perl;
> $seq_object = get_sequence('swissprot',"ROA1_HUMAN");
> write_sequence(">roa1.fasta",'fasta',$seq_object);
>
> But It returns lots of mistake informatiom,

First, always preface problems of this sort with the version of  
BioPerl you are using (there are quite a few versions still being used).

> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: WebDBSeqI Request Error:
> 501 Protocol scheme '' is not supported
> Content-Type: text/plain
> Client-Date: Fri, 07 Sep 2007 07:26:06 GMT
> Client-Warning: Internal response
> 501 Protocol scheme '' is not supported
> STACK: Error::throw
> STACK: Bio::Root::Root::throw D:/perl/site/lib/Bio/Root/Root.pm:359
> STACK: Bio::DB::WebDBSeqI::_request D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm:685
> STACK: Bio::DB::WebDBSeqI::get_seq_stream D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm:4
> 91
> STACK: Bio::DB::WebDBSeqI::get_Stream_by_id D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm
> :275
> STACK: Bio::DB::WebDBSeqI::get_Seq_by_id D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm:14
> 5
> STACK: Bio::Perl::get_sequence D:/perl/site/lib/Bio/Perl.pm:510
> STACK: C:\DOCUME~1\yangmeng\LOCALS~1\Temp\dir13D.tmp\Untitled.pl:6
> -----------------------------------------------------------

This works for me using bioperl from CVS.  There were a few remote  
DbFetch server changes if I recall correctly, so updating from CVS  
may be your best option.

> I don't know the reason of the problem.I have installed the  
> addition perl modules such as bioperl-db,bioperl-network,bioperlgui  
> and almost all "BioPerl Dependencies modules".My network is also  
> OK. It's an annoying promleb to me.
> I have consulted many experts but didn't got a reply. Could you  
> vacuate in your mass business to give me a help?
>
> Thank you!
>
> Best regards!
>
> YangMeng

I think my 'vacuating' is a private matter, let alone doing so in my  
mass business...

http://www.thefreedictionary.com/Vacuate

;>

chris


From cjfields at uiuc.edu  Mon Sep 10 18:04:14 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 10 Sep 2007 17:04:14 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
Message-ID: <3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>

On Sep 7, 2007, at 4:20 AM, Albert Vilella wrote:

>>> He'd need to map his exon boundaries from whatever format he has
>>> into a
>>> GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to
>>> munch on.
>>
>> I use segmented SeqFeatures in my example.  The HOWTO also uses a
>> variation ('graded_segments'):
>>
>> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
>>
>> The subseqfeatures are colored by score.  Feasibly one could hack
>> this so that the exons/introns have a different 'score', thus
>> displaying different colors.
>
>
> The exon boundary could be a vertical line or a triangular tick or
> something. I don't know if there is a consensus on this kind of  
> cartoons.
> Does anybody know how exon boundaries are displayed in different
> browsers/apps?

Don't know.  BTW, apparently there is something being cooked up as an  
alignment browser (among other things) for GBrowse:

https://www.nescent.org/wg_phyloinformatics/ 
PhyloSoC:Phylogenetic_and_Haplotype_Displays_for_GBrowse

Acc. to Lincoln (from his last GBrowse post) there will be a testable  
version within a few weeks or so.  You could always ask more  
questions about it on the GBrowse list.

chris


From lstein at cshl.edu  Mon Sep 10 18:09:41 2007
From: lstein at cshl.edu (Lincoln Stein)
Date: Mon, 10 Sep 2007 18:09:41 -0400
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
Message-ID: <6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>

You can view a simple multiple alignment now. Go to www.wormbase.org, turn
on some of the EST tracks and then zoom down to base pair level.

In bio::graphics, use the "segments" glyph and turn on the -draw_target
option. The features must have DNA attached to them.

What's coming soon is support for MAF format, which provides genome-level
alignments.

Lincoln

On 9/10/07, Chris Fields <cjfields at uiuc.edu> wrote:
>
> On Sep 7, 2007, at 4:20 AM, Albert Vilella wrote:
>
> >>> He'd need to map his exon boundaries from whatever format he has
> >>> into a
> >>> GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to
> >>> munch on.
> >>
> >> I use segmented SeqFeatures in my example.  The HOWTO also uses a
> >> variation ('graded_segments'):
> >>
> >> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
> >>
> >> The subseqfeatures are colored by score.  Feasibly one could hack
> >> this so that the exons/introns have a different 'score', thus
> >> displaying different colors.
> >
> >
> > The exon boundary could be a vertical line or a triangular tick or
> > something. I don't know if there is a consensus on this kind of
> > cartoons.
> > Does anybody know how exon boundaries are displayed in different
> > browsers/apps?
>
> Don't know.  BTW, apparently there is something being cooked up as an
> alignment browser (among other things) for GBrowse:
>
> https://www.nescent.org/wg_phyloinformatics/
> PhyloSoC:Phylogenetic_and_Haplotype_Displays_for_GBrowse
>
> Acc. to Lincoln (from his last GBrowse post) there will be a testable
> version within a few weeks or so.  You could always ask more
> questions about it on the GBrowse list.
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
(516) 367-8380 (voice)
(516) 367-8389 (fax)
FOR URGENT MESSAGES & SCHEDULING,
PLEASE CONTACT MY ASSISTANT,
SANDRA MICHELSEN, AT michelse at cshl.edu


From cjfields at uiuc.edu  Mon Sep 10 23:00:29 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 10 Sep 2007 22:00:29 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
	<6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
Message-ID: <885E5E3B-E2F7-4279-8EE3-FC21AF535D7E@uiuc.edu>

Doesn't that work only for SeqFeature::SimilarityPair and HSP-like  
(paired) alignments, or am I mistaken?

chris

On Sep 10, 2007, at 5:09 PM, Lincoln Stein wrote:

> You can view a simple multiple alignment now. Go to  
> www.wormbase.org, turn
> on some of the EST tracks and then zoom down to base pair level.
>
> In bio::graphics, use the "segments" glyph and turn on the - 
> draw_target
> option. The features must have DNA attached to them.
>
> What's coming soon is support for MAF format, which provides genome- 
> level
> alignments.
>
> Lincoln




From christoph.theunert at web.de  Tue Sep 11 06:37:49 2007
From: christoph.theunert at web.de (Christoph Theunert)
Date: Tue, 11 Sep 2007 03:37:49 -0700 (PDT)
Subject: [Bioperl-l] release of own projects
Message-ID: <12611951.post@talk.nabble.com>


Hi, I am a bioinformatics student from germany and I need your help 

Working with perl and bioperl is pretty new to me - 
currently I am working on a Bioperl project, and I don't know how to release
my project when i am finished with it.

I want to pack my modules so that other users can download it and install it
on their machines.

Do I use the command h2xs as to create cpan modules ( makefiles ...) or what
is the best way to solve my 
problem ?

thanks for help 

Christoph
-- 
View this message in context: http://www.nabble.com/release-of-own-projects-tf4421681.html#a12611951
Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.



From spiros at lokku.com  Tue Sep 11 06:57:14 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 11 Sep 2007 11:57:14 +0100
Subject: [Bioperl-l] release of own projects
In-Reply-To: <12611951.post@talk.nabble.com>
References: <12611951.post@talk.nabble.com>
Message-ID: <bba689ec0709110357o2fb66071w611a8598bef8134e@mail.gmail.com>

Hey,

Yes, IMHO the best way would be to create CPANesque modules that
people are able to download and install. The installation is pretty
straightforward, covers prerequisites  and more advanced features if
needed and as an approach it is widely supported. Also, it gives you
the ability to create and integrate tests seamlessly :)

Check out these URL's on how to do it:

http://search.cpan.org/~nwclark/perl-5.8.8/pod/perlnewmod.pod
http://www.perlmonks.org/?node_id=158999
http://www.perlmonks.org/?node_id=431702

Btw, more friendly and automated tools exist besides h2xs. Be sure to
have a look at:

http://search.cpan.org/perldoc?ExtUtils::ModuleMaker
http://search.cpan.org/perldoc?Module::Starter

Hope this helps,
Spiros

ps. i suggest since its your research work you are going to be handing
out to read a bit on the various software licenses which exist and
which you prefer to license your code under.


On 9/11/07, Christoph Theunert <christoph.theunert at web.de> wrote:
>
> Hi, I am a bioinformatics student from germany and I need your help
>
> Working with perl and bioperl is pretty new to me -
> currently I am working on a Bioperl project, and I don't know how to release
> my project when i am finished with it.
>
> I want to pack my modules so that other users can download it and install it
> on their machines.
>
> Do I use the command h2xs as to create cpan modules ( makefiles ...) or what
> is the best way to solve my
> problem ?
>
> thanks for help
>
> Christoph
> --
> View this message in context: http://www.nabble.com/release-of-own-projects-tf4421681.html#a12611951
> Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From bix at sendu.me.uk  Tue Sep 11 07:12:41 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 11 Sep 2007 12:12:41 +0100
Subject: [Bioperl-l] release of own projects
In-Reply-To: <12611951.post@talk.nabble.com>
References: <12611951.post@talk.nabble.com>
Message-ID: <46E67829.8060303@sendu.me.uk>

Christoph Theunert wrote:
> Hi, I am a bioinformatics student from germany and I need your help 
> 
> Working with perl and bioperl is pretty new to me - 
> currently I am working on a Bioperl project, and I don't know how to release
> my project when i am finished with it.
> 
> I want to pack my modules so that other users can download it and install it
> on their machines.
> 
> Do I use the command h2xs as to create cpan modules ( makefiles ...) or what
> is the best way to solve my 
> problem ?

You can do it however you like. You can just stick the modules in a 
folder, .tar.gz it and offer that to people. You can use h2xs to 
automate certain things. You can use Module::Build.

To make your work available via cpan, see
http://www.cpan.org/modules/04pause.html

If your modules are of general bioinformatic utility you might even 
consider making them a part of bioperl itself.


From jay at jays.net  Tue Sep 11 17:15:17 2007
From: jay at jays.net (Jay Hannah)
Date: Tue, 11 Sep 2007 16:15:17 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
 with exon boundaries
In-Reply-To: <6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>	
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>	
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>	
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>	
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>	
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
	<6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
Message-ID: <46E70565.5040503@jays.net>

Lincoln Stein wrote:
> You can view a simple multiple alignment now. Go to www.wormbase.org 
> <http://www.wormbase.org>, turn on some of the EST tracks and then 
> zoom down to base pair level.
>
> In bio::graphics, use the "segments" glyph and turn on the 
> -draw_target option. The features must have DNA attached to them.

Wow.  *http://tinyurl.com/yuz8bq*   I hadn't seen that done before.

> What's coming soon is support for MAF format, which provides 
> genome-level alignments.

I'm looking forward to trying to wrap my head around that.  :)

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah



From cjfields at uiuc.edu  Tue Sep 11 18:40:55 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 11 Sep 2007 17:40:55 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <46E70565.5040503@jays.net>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>	
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>	
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>	
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>	
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>	
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
	<6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
	<46E70565.5040503@jays.net>
Message-ID: <BC255B1A-EBB6-401B-BCDF-357A653A5972@uiuc.edu>


On Sep 11, 2007, at 4:15 PM, Jay Hannah wrote:

> Lincoln Stein wrote:
>> You can view a simple multiple alignment now. Go to www.wormbase.org
>> <http://www.wormbase.org>, turn on some of the EST tracks and then
>> zoom down to base pair level.
>>
>> In bio::graphics, use the "segments" glyph and turn on the
>> -draw_target option. The features must have DNA attached to them.
>
> Wow.  *http://tinyurl.com/yuz8bq*   I hadn't seen that done before.

There is a section detailing how this is done in the GBrowse tutorial  
(though it uses older GFF):

http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
Browser/docs/tutorial/tutorial.html

>> What's coming soon is support for MAF format, which provides
>> genome-level alignments.
>
> I'm looking forward to trying to wrap my head around that.  :)
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

It's easily parsible, which is nice!

chris


From stephan.roessner at gsf.de  Wed Sep 12 04:44:10 2007
From: stephan.roessner at gsf.de (Stephan Roessner)
Date: Wed, 12 Sep 2007 10:44:10 +0200
Subject: [Bioperl-l] bug in Bio::SearchIO?
Message-ID: <200709121044.11741.stephan.roessner@gsf.de>

Hi,

I am parsing a BlastN output with Bio::SearchIO and getting an error for some 
of the hits when retrieving the start and/or the end position with 
$hit->end('sbjct') , $hit->start('sbjct'). I want to filter for hits which 
are are of equal length (~ > 0.9) to the query sequences. 

SearchIO is retrieving the right results, but throws an exemption, in this 
case: MSG:Undefined sub-sequence (1633,760). Valid range = 693 - 760 .....

It seems to me valid range is parsed incorrectly, isn't it? Is this a bug?

Does anybody have a similar problem?

see code, error, and blastn output below.

thanks,
Stephan


Stephan Roessner
MIPS/IBI Inst. for Bioinformatics
GSF Research Center for Environment and Health
Ingolst?dter Landstr. 1
85764 Neuherberg; Germany
phone: +49 (0)89 3187 3583
fax: ? ? ? +49 (0)89 3187 3585
email: stephan.roessner at gsf.de


Here is the piece of code I am using:

my $blast_report = new Bio::SearchIO ('-format'=>'blast',
                                         '-file' => $source);
  	
while( my $result=$blast_report->next_result) {
		while( my $hit= $result->next_hit()) {
			print "Name: ".$hit->name."\n";
			print "S: ".$hit->start('sbjct')."\n";
			print "E: ".$hit->end('sbjct')."\n";
			print "L: ".$hit->length()."\n";
		}
 	}


Here's the message: 

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Undefined sub-sequence (1633,760). Valid range = 693 - 760
STACK: Error::throw
STACK: 
Bio::Root::Root::throw /usr/lib/perl5/vendor_perl/5.8.8/Bio/Root/Root.pm:359
STACK: 
Bio::Search::HSP::HSPI::matches /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/HSP/HSPI.pm:691
STACK: 
Bio::Search::SearchUtils::_adjust_contigs /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/SearchUtils.pm:489
STACK: 
Bio::Search::SearchUtils::tile_hsps /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/SearchUtils.pm:206
STACK: 
Bio::Search::Hit::GenericHit::start /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/Hit/GenericHit.pm:935
STACK: 
main::parse /home/users/roessner/workspace/GeneSimilarity/similarity_analysis.pl:82
STACK: /home/users/roessner/workspace/GeneSimilarity/similarity_analysis.pl:51
-----------------------------------------------------------

S: 635
E: 790
L: 2052

This is the BLASTN output I am parsing::

>LOC_Os11g37470.1 chr11_pseudomolecule_TIGR r_jap version0
            21623485-21621434 BestGuessTranscript
          Length = 2052

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 106/124 (85%), Gaps = 1/124 (0%)
 Strand = Plus / Plus

                                                                        
Query: 3191 tattaagcataattaatgtatcattagcacatgtagg-ttactgtagcatttaaggctaa 3249
            |||||||| |||||||| | ||||| ||||||||||| |||||||| || ||| ||||||
Sbjct: 635  tattaagcctaattaatctgtcattggcacatgtagggttactgtaacacttatggctaa 694

                                                                        
Query: 3250 tcatagagtaactagacttaaaagactcgtctcgcgattttcaaccaaactgtgtaatta 3309
            |||| || ||| |||||| |||||| || ||||||||||||||  ||||| ||| |||||
Sbjct: 695  tcatggactaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaatta 754

                
Query: 3310 gttt 3313
            ||||
Sbjct: 755  gttt 758



 Score = 48.1 bits (24), Expect = 0.002
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                        
Query: 2253 aaaaactaattacacaatttacctgtacatcgcgagatgaatcttttaagtttagttact 2312
            ||||||||||| |||  ||| | || | ||||||||||||||||||| ||| || ||| |
Sbjct: 760  aaaaactaattgcacggtttgcatgaaaatcgcgagatgaatcttttgagtctatttagt 701

                    
Query: 2313 ccatgatt 2320
            ||||||||
Sbjct: 700  ccatgatt 693



 Score = 44.1 bits (22), Expect = 0.038
 Identities = 76/94 (80%)
 Strand = Plus / Minus

                                                                        
Query: 1539 atgcatgtagtattaaatatagacgaaaataaaaactaattgcacagtttggtcgaaatt 1598
            ||||||| || |||||||||| |  |||  ||||||||||||||| |||||   |||| |
Sbjct: 790  atgcatggagcattaaatataaataaaatgaaaaactaattgcacggtttgcatgaaaat 731

                                              
Query: 1599 gtcgagacgaattttttgagtctagttaggccat 1632
              ||||| |||| ||||||||||| |||| ||||
Sbjct: 730  cgcgagatgaatcttttgagtctatttagtccat 697



 Score = 44.1 bits (22), Expect = 0.038
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 2026 actaactagaattaaaagattcgtctcgtcatttacagacaaactgtgtaattagttttt 2085
            ||||| |||| | ||||||||| |||||  |||| ||  ||||| ||| |||||||||||
Sbjct: 701  actaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaattagttttt 760

                                          
Query: 2086 gttttcgtctatatttaatgcttcatgcat 2115
              |||  | ||||||||||||| |||||||
Sbjct: 761  cattttatttatatttaatgctccatgcat 790







From cjfields at uiuc.edu  Wed Sep 12 10:57:22 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 12 Sep 2007 09:57:22 -0500
Subject: [Bioperl-l] bug in Bio::SearchIO?
In-Reply-To: <200709121044.11741.stephan.roessner@gsf.de>
References: <200709121044.11741.stephan.roessner@gsf.de>
Message-ID: <74CE1BB2-FCEB-43C3-B783-09706C7F55D8@uiuc.edu>

Try updating to bioperl from CVS.  I believe this issue was fixed but  
I don't believe it made the 1.5.2 release.

chris

On Sep 12, 2007, at 3:44 AM, Stephan Roessner wrote:

> Hi,
>
> I am parsing a BlastN output with Bio::SearchIO and getting an  
> error for some
> of the hits when retrieving the start and/or the end position with
> $hit->end('sbjct') , $hit->start('sbjct'). I want to filter for  
> hits which
> are are of equal length (~ > 0.9) to the query sequences.
>
> SearchIO is retrieving the right results, but throws an exemption,  
> in this
> case: MSG:Undefined sub-sequence (1633,760). Valid range = 693 -  
> 760 .....
>
> It seems to me valid range is parsed incorrectly, isn't it? Is this  
> a bug?
>
> Does anybody have a similar problem?
>
> see code, error, and blastn output below.
>
> thanks,
> Stephan
>
>
> Stephan Roessner
> MIPS/IBI Inst. for Bioinformatics
> GSF Research Center for Environment and Health
> Ingolst?dter Landstr. 1
> 85764 Neuherberg; Germany
> phone: +49 (0)89 3187 3583
> fax:       +49 (0)89 3187 3585
> email: stephan.roessner at gsf.de
>
>
> Here is the piece of code I am using:
>
> my $blast_report = new Bio::SearchIO ('-format'=>'blast',
>                                          '-file' => $source);
>   	
> while( my $result=$blast_report->next_result) {
> 		while( my $hit= $result->next_hit()) {
> 			print "Name: ".$hit->name."\n";
> 			print "S: ".$hit->start('sbjct')."\n";
> 			print "E: ".$hit->end('sbjct')."\n";
> 			print "L: ".$hit->length()."\n";
> 		}
>  	}
>
>
> Here's the message:
>
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: Undefined sub-sequence (1633,760). Valid range = 693 - 760
> STACK: Error::throw
> STACK:
> Bio::Root::Root::throw /usr/lib/perl5/vendor_perl/5.8.8/Bio/Root/ 
> Root.pm:359
> STACK:
> Bio::Search::HSP::HSPI::matches /usr/lib/perl5/vendor_perl/5.8.8/ 
> Bio/Search/HSP/HSPI.pm:691
> STACK:
> Bio::Search::SearchUtils::_adjust_contigs /usr/lib/perl5/ 
> vendor_perl/5.8.8/Bio/Search/SearchUtils.pm:489
> STACK:
> Bio::Search::SearchUtils::tile_hsps /usr/lib/perl5/vendor_perl/ 
> 5.8.8/Bio/Search/SearchUtils.pm:206
> STACK:
> Bio::Search::Hit::GenericHit::start /usr/lib/perl5/vendor_perl/ 
> 5.8.8/Bio/Search/Hit/GenericHit.pm:935
> STACK:
> main::parse /home/users/roessner/workspace/GeneSimilarity/ 
> similarity_analysis.pl:82
> STACK: /home/users/roessner/workspace/GeneSimilarity/ 
> similarity_analysis.pl:51
> -----------------------------------------------------------
>
> S: 635
> E: 790
> L: 2052
>
> This is the BLASTN output I am parsing::
>
>> LOC_Os11g37470.1 chr11_pseudomolecule_TIGR r_jap version0
>             21623485-21621434 BestGuessTranscript
>           Length = 2052
>
>  Score = 95.6 bits (48), Expect = 1e-17
>  Identities = 106/124 (85%), Gaps = 1/124 (0%)
>  Strand = Plus / Plus
>
>
> Query: 3191 tattaagcataattaatgtatcattagcacatgtagg- 
> ttactgtagcatttaaggctaa 3249
>             |||||||| |||||||| | ||||| ||||||||||| |||||||| || |||  
> ||||||
> Sbjct: 635   
> tattaagcctaattaatctgtcattggcacatgtagggttactgtaacacttatggctaa 694
>
>
> Query: 3250  
> tcatagagtaactagacttaaaagactcgtctcgcgattttcaaccaaactgtgtaatta 3309
>             |||| || ||| |||||| |||||| || ||||||||||||||  ||||| |||  
> |||||
> Sbjct: 695   
> tcatggactaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaatta 754
>
>
> Query: 3310 gttt 3313
>             ||||
> Sbjct: 755  gttt 758
>
>
>
>  Score = 48.1 bits (24), Expect = 0.002
>  Identities = 57/68 (83%)
>  Strand = Plus / Minus
>
>
> Query: 2253  
> aaaaactaattacacaatttacctgtacatcgcgagatgaatcttttaagtttagttact 2312
>             ||||||||||| |||  ||| | || | ||||||||||||||||||| ||| ||  
> ||| |
> Sbjct: 760   
> aaaaactaattgcacggtttgcatgaaaatcgcgagatgaatcttttgagtctatttagt 701
>
>
> Query: 2313 ccatgatt 2320
>             ||||||||
> Sbjct: 700  ccatgatt 693
>
>
>
>  Score = 44.1 bits (22), Expect = 0.038
>  Identities = 76/94 (80%)
>  Strand = Plus / Minus
>
>
> Query: 1539  
> atgcatgtagtattaaatatagacgaaaataaaaactaattgcacagtttggtcgaaatt 1598
>             ||||||| || |||||||||| |  |||  ||||||||||||||| |||||    
> |||| |
> Sbjct: 790   
> atgcatggagcattaaatataaataaaatgaaaaactaattgcacggtttgcatgaaaat 731
>
>
> Query: 1599 gtcgagacgaattttttgagtctagttaggccat 1632
>               ||||| |||| ||||||||||| |||| ||||
> Sbjct: 730  cgcgagatgaatcttttgagtctatttagtccat 697
>
>
>
>  Score = 44.1 bits (22), Expect = 0.038
>  Identities = 73/90 (81%)
>  Strand = Plus / Plus
>
>
> Query: 2026  
> actaactagaattaaaagattcgtctcgtcatttacagacaaactgtgtaattagttttt 2085
>             ||||| |||| | ||||||||| |||||  |||| ||  ||||| |||  
> |||||||||||
> Sbjct: 701   
> actaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaattagttttt 760
>
>
> Query: 2086 gttttcgtctatatttaatgcttcatgcat 2115
>               |||  | ||||||||||||| |||||||
> Sbjct: 761  cattttatttatatttaatgctccatgcat 790
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign






From n.haigh at sheffield.ac.uk  Wed Sep 12 12:34:26 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Wed, 12 Sep 2007 17:34:26 +0100
Subject: [Bioperl-l] Bio::Graphics transparent background
Message-ID: <46E81512.3090503@sheffield.ac.uk>

Is it possible to set the bg colour of glyphs and the panel background
to be transparent? If so, which output formats support transparency?

Cheers
Nath




From Kevin.M.Brown at asu.edu  Wed Sep 12 14:15:10 2007
From: Kevin.M.Brown at asu.edu (Kevin Brown)
Date: Wed, 12 Sep 2007 11:15:10 -0700
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <46E81512.3090503@sheffield.ac.uk>
References: <46E81512.3090503@sheffield.ac.uk>
Message-ID: <1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>

> Is it possible to set the bg colour of glyphs and the panel 
> background to be transparent? If so, which output formats 
> support transparency?

Not sure if you can, but SVG, PNG, Gif all support a transparent
background.



From bioperl-list at superfrink.net  Thu Sep 13 01:15:39 2007
From: bioperl-list at superfrink.net (bioperl-list at superfrink.net)
Date: Wed, 12 Sep 2007 23:15:39 -0600 (MDT)
Subject: [Bioperl-l]  Bio::Graphics transparent background
Message-ID: <Pine.LNX.4.64.0709122245450.8424@gurchecyrohssnyb.arg>

> Is it possible to set the bg colour of glyphs and the panel background
> to be transparent? If so, which output formats support transparency?

I had a look at the code and I don't believe it is possible.

You could produce a PNG file and knowing the red/green/blue values of the 
background colour run the following script to make an image with the bg 
colour transparent.

For example:
    ./make-transparent.pl 252 253 252 2004-11-22.png

will produce:  2004-11-22.png.new.png
with the RGB colour of (252, 253, 252) replaced with transparency.

Regards,
Chad


#!/usr/bin/perl -w
#
# file: make-transparent.pl
# purpose: make a single colour in a PNG file transparent
# author: chad c d clark
# $Id$

use strict;
use GD;

# -- subroutines -------------------------------------------------------
sub usage_message();


# -- main() ------------------------------------------------------------

if(scalar @ARGV < 4) {
     print usage_message();
     exit 1;
}

# get the colour and make sure it is valid
my @RGB = splice @ARGV, 0, 3;
for my $i (@RGB) {

     if ( ($i !~ /^[\d]+$/) or (255 < $i) ) {
 	print "Invalid colour '$i'.\n";
         print usage_message();
         exit 1;
     }
}
print "RGB: (@RGB)\n";

# process each file
FILE: while (my $filename = shift @ARGV) {

     # read the file
     my $image = GD::Image->new($filename);
     unless(defined $image) {
 	warn "Unable to read image from file.  Skipping '$filename'.\n";
 	next FILE;
     }

     # find the colour index
     my $index = $image->colorExact(@RGB);
     if(-1 == $index) {
 	warn "Colour not found in file.  Skipping '$filename'.\n";
 	next FILE;
     }

     # make the colour index transparent
     if(-1 == $image->transparent($index)) {
 	warn "Unable to make colour transparent.  Skipping '$filename'.\n";
 	next FILE;
     }

     # write the updated image file
     my $new_filename = $filename . ".new.png";
     # my $new_filename = $filename;  # use to over-write existing file
     open FH, ">" . $new_filename or die "can't open $new_filename";
     print FH $image->png;
     close FH;

     print "Found file '$filename'.\tCreated '$new_filename'.\n";
}

exit 0;


# -- subroutines -------------------------------------------------------

sub usage_message() {

return qq/
   Usage: $0 RED GREEN BLUE FILELIST

   Where:
       RED       - red   value in decimal (0 to 255)
       GREEN     - green value in decimal (0 to 255)
       BLUE      - blue  value in decimal (0 to 255)
       FILELIST  - list of files to convert

   Examples:
       $0 255 255 255 2004-11-22.png
       $0 252 253 252 2004-11-22.png second.png
       $0 1   1   200 2004-11-22.png second.png third.png

   Description:
   For each file "foo.png" a new file "foo.png.new.png" will be created (and
   over-written if it existed).  The new file will be the same as the original
   but the colour specified by the RED, GREEN, and BLUE value will be removed
   and replaced by transparent pixels.

/;
}


From n.haigh at sheffield.ac.uk  Thu Sep 13 06:07:46 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Thu, 13 Sep 2007 11:07:46 +0100
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
References: <46E81512.3090503@sheffield.ac.uk>
	<1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
Message-ID: <46E90BF2.5010607@sheffield.ac.uk>

Kevin Brown wrote:
>> Is it possible to set the bg colour of glyphs and the panel 
>> background to be transparent? If so, which output formats 
>> support transparency?
>>     
>
> Not sure if you can, but SVG, PNG, Gif all support a transparent
> background.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>   

Looking at the GD module documentation:
http://search.cpan.org/~lds/GD-2.30/GD.pm

It appears that you can set a colour as being transparent - so I think
it should be possible to get Bio::Graphics to do this = may require some
code to be written. Any one got ideas?

Cheers,
Nath


From n.haigh at sheffield.ac.uk  Thu Sep 13 07:59:20 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Thu, 13 Sep 2007 12:59:20 +0100
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <46E90BF2.5010607@sheffield.ac.uk>
References: <46E81512.3090503@sheffield.ac.uk>	<1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
	<46E90BF2.5010607@sheffield.ac.uk>
Message-ID: <46E92618.7050208@sheffield.ac.uk>

Nathan Haigh wrote:
> Kevin Brown wrote:
>   
>>> Is it possible to set the bg colour of glyphs and the panel 
>>> background to be transparent? If so, which output formats 
>>> support transparency?
>>>     
>>>       
>> Not sure if you can, but SVG, PNG, Gif all support a transparent
>> background.
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>   
>>     
>
> Looking at the GD module documentation:
> http://search.cpan.org/~lds/GD-2.30/GD.pm
>
> It appears that you can set a colour as being transparent - so I think
> it should be possible to get Bio::Graphics to do this = may require some
> code to be written. Any one got ideas?
>
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>   

I took a look and made a simple change to Bio::Graphics::Panel

Please see the following bug for a patch and explanation:
http://bugzilla.open-bio.org/show_bug.cgi?id=2365

I'd appreciate any comments, especially regarding the method name! If
there aren't any complaints I'll commit it later today.

Nath


From n.haigh at sheffield.ac.uk  Thu Sep 13 08:26:57 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Thu, 13 Sep 2007 13:26:57 +0100
Subject: [Bioperl-l] Bio::Graphics Resolution
Message-ID: <46E92C91.5020307@sheffield.ac.uk>

I want to be able to print my Bio::Graphics image on a poster with good
resolution. What can I do to ensure I don't get blocky graphics/text.

Altering the width/height of the panel simple increases the size of the
canvas on which to draw the image, but the text appears the same size
and thus relatively smaller to the rest of the image. So I don't think
this would work for printing on a poster.

Cheers,
Nath


From cjfields at uiuc.edu  Thu Sep 13 08:46:02 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 13 Sep 2007 07:46:02 -0500
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <69321A85-8715-43C0-BCB0-CEE8F42D7235@uiuc.edu>

Print to SVG instead of PNG (should be resolution-independent); I use  
Illustrator to fine-tune it but there are several other programs  
which can do the same.  You'll need to install GD::SVG for it to work.

The alignment example I posted previously about (http:// 
www.bioperl.org/wiki/HOWTO_Discussion:Graphics) shows essentially  
what you need to do:

my $panel = Bio::Graphics::Panel->new(
     -image_class => 'SVG',
     # and whatever else
);

# later...

print $panel->svg;

chris

On Sep 13, 2007, at 7:26 AM, Nathan Haigh wrote:

> I want to be able to print my Bio::Graphics image on a poster with  
> good
> resolution. What can I do to ensure I don't get blocky graphics/text.
>
> Altering the width/height of the panel simple increases the size of  
> the
> canvas on which to draw the image, but the text appears the same size
> and thus relatively smaller to the rest of the image. So I don't think
> this would work for printing on a poster.
>
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From jonathancrabtree at gmail.com  Thu Sep 13 09:09:56 2007
From: jonathancrabtree at gmail.com (Jonathan Crabtree)
Date: Thu, 13 Sep 2007 09:09:56 -0400
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <46E92618.7050208@sheffield.ac.uk>
References: <46E81512.3090503@sheffield.ac.uk>
	<1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
	<46E90BF2.5010607@sheffield.ac.uk> <46E92618.7050208@sheffield.ac.uk>
Message-ID: <8e5b8bf80709130609x4be19cf6y60f2440a1ac5d332@mail.gmail.com>

Hi Nathan-

One problem with your proposed solution is that it won't necessarily work
when GD::SVG is being used instead of GD (i.e., via the image_class method
of Bio::Graphics::Panel).  SVG doesn't handle transparency in the same way
as GD.  At least when you're compositing multiple SVG images/documents,
transparency is the default; if you superimpose one SVG image on another (
e.g., by merging the two into a single SVG document) then the bottom image
will be visible through any area of the top image that has not been drawn
on.  When I'm working in SVG with Bio::Graphics I get a "transparent"
background by simply not setting the bgcolor; this ensures that
Bio::Graphics::Panel will refrain from drawing a filled background rectangle
underneath the drawing area.  What I don't know is how to ensure that the
background is transparent when you're working with the various methods of
embedding SVG in web pages ( i.e., transparent with respect to whatever is
_underneath_ the SVG-rendered content); this is probably a slightly
different issue that's more a question of what the browser/plugin supports.

I'm not sure what to suggest as an alternative, but at the very least this
probably warrants a YMMV comment in the documentation for the new method, or
perhaps it could even throw a runtime error if called when the $gd object is
of type GD::SVG.  A final option would be to say that this (setting a
transparent background) is something that should get handled outside of
Bio::Graphics::Panel; I don't think there's any technical reason why the
calling code couldn't be responsible for this.  I don't think we can modify
your new method to unset the bgcolor when working with GD::SVG, because that
might affect the image in other ways.  I do it in my code but I'm not sure
it's 100% safe, since I think GD::SVG might actually _use_ the bgcolor in
some situations (e.g., drawing dashed lines) and I haven't checked the code
thoroughly to make sure that there are no unintended consequences.

Jonathan

p.s. I see that Chris has beaten me to the punch in mentioning SVG as a fix
to your blocky font problems.  All the more reason to think about how this
feature will work in that context!


On 9/13/07, Nathan Haigh <n.haigh at sheffield.ac.uk > wrote:
>
> Nathan Haigh wrote:
> > Kevin Brown wrote:
> >
> >>> Is it possible to set the bg colour of glyphs and the panel
> >>> background to be transparent? If so, which output formats
> >>> support transparency?
> >>>
> >>>
> >> Not sure if you can, but SVG, PNG, Gif all support a transparent
> >> background.
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>
> >>
> >
> > Looking at the GD module documentation:
> > http://search.cpan.org/~lds/GD-2.30/GD.pm
> <http://search.cpan.org/%7Elds/GD-2.30/GD.pm>
> >
> > It appears that you can set a colour as being transparent - so I think
> > it should be possible to get Bio::Graphics to do this = may require some
> > code to be written. Any one got ideas?
> >
> > Cheers,
> > Nath
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
>
> I took a look and made a simple change to Bio::Graphics::Panel
>
> Please see the following bug for a patch and explanation:
> http://bugzilla.open-bio.org/show_bug.cgi?id=2365
>
> I'd appreciate any comments, especially regarding the method name! If
> there aren't any complaints I'll commit it later today.
>
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From bix at sendu.me.uk  Thu Sep 13 09:03:46 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 13 Sep 2007 14:03:46 +0100
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <46E93532.6030505@sendu.me.uk>

Nathan Haigh wrote:
> I want to be able to print my Bio::Graphics image on a poster with good
> resolution. What can I do to ensure I don't get blocky graphics/text.

Output in SVG, which is a vector format == no blockiness.


From jonathancrabtree at gmail.com  Thu Sep 13 09:20:43 2007
From: jonathancrabtree at gmail.com (Jonathan Crabtree)
Date: Thu, 13 Sep 2007 09:20:43 -0400
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <8e5b8bf80709130620r4a24fe8fi5171539f50735bf3@mail.gmail.com>

Nathan-

As Chris said, you'll want to use GD::SVG instead of GD.  However, you're
still going to have the issue that you raised that the fonts will be
proportionally small with respect to your figure (particularly if you're
printing a large region at poster size.)  From what I remember GD only gives
you a few font sizes to choose from, so even at the largest size you may
still have problems.  I've worked around this in the past by using scripts
to post-process the resulting SVG.  I do a global search and replace to
increase the font sizes (and, in many cases, to adjust the y-offset of the
text accordingly.)  You may also need to tweak the amount of vertical
whitespace in the image (e.g., between adjacent rows of features) to give
yourself space to increase the font size.  The same caveat applies to the
horizontal dimension, since with a larger font you may have collisions
between labels (assuming that the features in your figure are labeled.)  To
fix this you need to trick Bio::Graphics into thinking the feature labels
are longer than they actually are.  I forget whether I did this by padding
the labels with extra whitespace or actually modifying the code that
computes the feature bounding boxes, but something along those lines should
work.  Essentially you have to trick Bio::Graphics into leaving extra
whitespace so that everything looks OK when you bump up the font sizes.
Unfortunately I don't have a generic script that does this; after generating
a couple of posters this way I switched to direct SVG generation to avoid
the constraints imposed by going through GD.

Jonathan


On 9/13/07, Nathan Haigh <n.haigh at sheffield.ac.uk> wrote:
>
> I want to be able to print my Bio::Graphics image on a poster with good
> resolution. What can I do to ensure I don't get blocky graphics/text.
>
> Altering the width/height of the panel simple increases the size of the
> canvas on which to draw the image, but the text appears the same size
> and thus relatively smaller to the rest of the image. So I don't think
> this would work for printing on a poster.
>
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From arareko at campus.iztacala.unam.mx  Thu Sep 13 10:59:31 2007
From: arareko at campus.iztacala.unam.mx (Mauricio Herrera Cuadra)
Date: Thu, 13 Sep 2007 09:59:31 -0500
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <46E95053.8090300@campus.iztacala.unam.mx>

Try saving the output of your Bio::Graphics image as SVG (with the 
desired proportions between text & graphics), then, at the moment of 
printing, set the desired output size (from the SVG file) and everything 
should be scaled accordingly. That can probably work.

Cheers,
Mauricio.

Nathan Haigh wrote:
> I want to be able to print my Bio::Graphics image on a poster with good
> resolution. What can I do to ensure I don't get blocky graphics/text.
> 
> Altering the width/height of the panel simple increases the size of the
> canvas on which to draw the image, but the text appears the same size
> and thus relatively smaller to the rest of the image. So I don't think
> this would work for printing on a poster.
> 
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 

-- 
MAURICIO HERRERA CUADRA
arareko at campus.iztacala.unam.mx
Laboratorio de Gen?tica
Unidad de Morfofisiolog?a y Funci?n
Facultad de Estudios Superiores Iztacala, UNAM



From jay at jays.net  Fri Sep 14 10:27:38 2007
From: jay at jays.net (Jay Hannah)
Date: Fri, 14 Sep 2007 09:27:38 -0500
Subject: [Bioperl-l] [patch] getGenBank.pl
Message-ID: <1088BA7F-009A-482E-B15E-80D4D59218BE@jays.net>

http://cvs.bioperl.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/ 
examples/db/getGenBank.pl

Using this:
my $seqio = $gb->get_Stream_by_batch([ qw( 124430577 )]);

Throws this warning:
$ ./fetch.pl > 124430577.gbk
get_Stream_by_batch() is deprecated; use get_Stream_by_id() instead
STACK Bio::DB::NCBIHelper::__ANON__ /usr/lib/perl5/Bio/DB/ 
NCBIHelper.pm:261
STACK toplevel ./fetch.pl:17


Can someone with commit access please change getGenBank.pl?

24,25c24,25
< # if you want to get a bunch of sequences use the batch method
< my $seqio = $gb->get_Stream_by_batch([ qw(J00522 AF303112 2981014)]);
---
 > # feel free to pull multiple sequences
 > my $seqio = $gb->get_Stream_by_id([ qw(J00522 AF303112 2981014)]);


The tweaked version works fine for me and the warning goes away.

Thanks,

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah




From cjfields at uiuc.edu  Fri Sep 14 12:36:56 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 14 Sep 2007 11:36:56 -0500
Subject: [Bioperl-l] [patch] getGenBank.pl
In-Reply-To: <1088BA7F-009A-482E-B15E-80D4D59218BE@jays.net>
References: <1088BA7F-009A-482E-B15E-80D4D59218BE@jays.net>
Message-ID: <5255407E-F19E-45B6-9F66-3DC1AB25C0AC@uiuc.edu>

Done.  Thanks for the heads up!

chris

On Sep 14, 2007, at 9:27 AM, Jay Hannah wrote:

> http://cvs.bioperl.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/
> examples/db/getGenBank.pl
>
> Using this:
> my $seqio = $gb->get_Stream_by_batch([ qw( 124430577 )]);
>
> Throws this warning:
> $ ./fetch.pl > 124430577.gbk
> get_Stream_by_batch() is deprecated; use get_Stream_by_id() instead
> STACK Bio::DB::NCBIHelper::__ANON__ /usr/lib/perl5/Bio/DB/
> NCBIHelper.pm:261
> STACK toplevel ./fetch.pl:17
>
>
> Can someone with commit access please change getGenBank.pl?
>
> 24,25c24,25
> < # if you want to get a bunch of sequences use the batch method
> < my $seqio = $gb->get_Stream_by_batch([ qw(J00522 AF303112  
> 2981014)]);
> ---
>> # feel free to pull multiple sequences
>> my $seqio = $gb->get_Stream_by_id([ qw(J00522 AF303112 2981014)]);
>
>
> The tweaked version works fine for me and the warning goes away.
>
> Thanks,
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From MEC at stowers-institute.org  Mon Sep 17 16:15:39 2007
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Mon, 17 Sep 2007 15:15:39 -0500
Subject: [Bioperl-l] Bioperl -- why so old? ... or ...
	Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
Message-ID: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>

Sometime ago, in the ensembl-dev mailing list, mdr wrote:

> > I'm always running into bugs in bioperl that have been fixed in more
recent
> > versions than the version 1-2-3 that the installation document
specifies.  
> > 
> > Just wondering, are there plans to try to move to 1-5 any time soon,
or is that
> > not possible for some reason?  Or, by any chance, is Ensembl
actually compatible
> > with 1-5 and it's just a documentation issue?
> 
> "Ewan Birney" replied
> Ensembl doesn't make heavy use of Bioperl anymore - most of the
critical things
> we re-wrote, mainly due to speed/memory issues. I think the short
answer is that
> it _probably_ works with 1.5, but we don't have a strong desire to
move up
> as certainly there are no problems with the 1.2.3 release we are
using.

FWIW, I have just discovered that the round of bioperl changes in
service of http://www.bioperl.org/wiki/Feature_Annotation_rollback
introduce (additional?) incompatibilities between current bioperl and
the Ensembl Core API.  The changes bring me to obtain and use Bioperl
version 1.2.3 for use in conjunction with Ensemble API application (as
is recommended by Ensembl).

Until now, the ways I have used the Ensembl API appear not to have
been effected by changes in Bioperl; I have successfully used it
in conjunction with the bioperl's leading edge.  Of course there may be
other incompatibilities that I have just not noticed yet.

Evidence of the new incompatibility is present in this back trace,
which bridges between code in current bioperl-live and current
ensembl/modules/Bio:

-------------------- EXCEPTION --------------------
MSG: Operator overloading of AnnotationI is deprecated
STACK Bio::Annotation::DBLink::__ANON__
/home/mec/cvs/bioperl-live/Bio/Annotation/DBLink.pm:59
STACK Bio::EnsEMBL::DBSQL::DBEntryAdaptor::_fetch_by_object_type
/home/mec/cvs/foo/ensembl/modules/Bio/EnsEMBL/DBSQL/DBEntryAdaptor.pm:77
8


Obtaining version 1.2.3 fixes the issue for me.  

This is just a warning to others....

Your milage may vary....

--

Malcolm Cook
Stowers Institute for Medical Research - Kansas City, Missouri
 



From cjfields at uiuc.edu  Mon Sep 17 17:52:55 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 17 Sep 2007 16:52:55 -0500
Subject: [Bioperl-l] Bioperl -- why so old? ... or ...
	Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
In-Reply-To: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>
References: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>
Message-ID: <1CAA1977-45AE-4A8F-815C-4C726DB0E6E4@uiuc.edu>

Malcolm,

I have removed the Bio::Annotation overloading exceptions from  
bioperl-live; they're just more trouble than they're worth right  
now.  Could you try it out and see if that suffices, and drop us a  
note if it doesn't or if you run into other odd issues?  I'll be busy  
until the end of the month but I'll do the best I can to help out.

The rollbacks were fairly simple and essentially reversed, corrected,  
or simplified many changes made prior to the 1.5 release (most of  
which were undocumented and not completely implemented).  They pass  
all current tests and should make BioPerl classes (particularly  
Annotations and SeqFeatures) behave more like 1.4.  Beyond the now- 
removed exceptions it should be fine unless it is in an area of  
already-known incompatibility between BioPerl and Ensembl, some of  
which you've already outlined.

chris

On Sep 17, 2007, at 3:15 PM, Cook, Malcolm wrote:

> ...
> FWIW, I have just discovered that the round of bioperl changes in
> service of http://www.bioperl.org/wiki/Feature_Annotation_rollback
> introduce (additional?) incompatibilities between current bioperl and
> the Ensembl Core API.  The changes bring me to obtain and use Bioperl
> version 1.2.3 for use in conjunction with Ensemble API application (as
> is recommended by Ensembl).
>
> Until now, the ways I have used the Ensembl API appear not to have
> been effected by changes in Bioperl; I have successfully used it
> in conjunction with the bioperl's leading edge.  Of course there  
> may be
> other incompatibilities that I have just not noticed yet.
>
> Evidence of the new incompatibility is present in this back trace,
> which bridges between code in current bioperl-live and current
> ensembl/modules/Bio:
>
> -------------------- EXCEPTION --------------------
> MSG: Operator overloading of AnnotationI is deprecated
> STACK Bio::Annotation::DBLink::__ANON__
> /home/mec/cvs/bioperl-live/Bio/Annotation/DBLink.pm:59
> STACK Bio::EnsEMBL::DBSQL::DBEntryAdaptor::_fetch_by_object_type
> /home/mec/cvs/foo/ensembl/modules/Bio/EnsEMBL/DBSQL/ 
> DBEntryAdaptor.pm:77
> 8
>
>
> Obtaining version 1.2.3 fixes the issue for me.
>
> This is just a warning to others....
>
> Your milage may vary....
>
> --
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri




From MEC at stowers-institute.org  Mon Sep 17 18:14:41 2007
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Mon, 17 Sep 2007 17:14:41 -0500
Subject: [Bioperl-l] Bioperl -- why so old? ... or ...
	Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
In-Reply-To: <1CAA1977-45AE-4A8F-815C-4C726DB0E6E4@uiuc.edu>
References: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>
	<1CAA1977-45AE-4A8F-815C-4C726DB0E6E4@uiuc.edu>
Message-ID: <CED81D34E37D5043A1211565277A51E509514EB3@exchkc02.stowers-institute.org>

Chris,

Removing those exceptions makes my application work with current
bioperl-live again.  Hooray!  Thanks.

But!  I have been warned!

Regards,

Malcolm Cook
Stowers Institute for Medical Research - Kansas City, Missouri
  

> -----Original Message-----
> From: Chris Fields [mailto:cjfields at uiuc.edu] 
> Sent: Monday, September 17, 2007 4:53 PM
> To: Cook, Malcolm
> Cc: bioperl list; ensembl-dev at ebi.ac.uk
> Subject: Re: [Bioperl-l] Bioperl -- why so old? ... or ... 
> Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
> 
> Malcolm,
> 
> I have removed the Bio::Annotation overloading exceptions 
> from bioperl-live; they're just more trouble than they're 
> worth right now.  Could you try it out and see if that 
> suffices, and drop us a note if it doesn't or if you run into 
> other odd issues?  I'll be busy until the end of the month 
> but I'll do the best I can to help out.
> 
> The rollbacks were fairly simple and essentially reversed, 
> corrected, or simplified many changes made prior to the 1.5 
> release (most of which were undocumented and not completely 
> implemented).  They pass all current tests and should make 
> BioPerl classes (particularly Annotations and SeqFeatures) 
> behave more like 1.4.  Beyond the now- removed exceptions it 
> should be fine unless it is in an area of already-known 
> incompatibility between BioPerl and Ensembl, some of which 
> you've already outlined.
> 
> chris
> 
> On Sep 17, 2007, at 3:15 PM, Cook, Malcolm wrote:
> 
> > ...
> > FWIW, I have just discovered that the round of bioperl changes in 
> > service of http://www.bioperl.org/wiki/Feature_Annotation_rollback
> > introduce (additional?) incompatibilities between current 
> bioperl and 
> > the Ensembl Core API.  The changes bring me to obtain and 
> use Bioperl 
> > version 1.2.3 for use in conjunction with Ensemble API 
> application (as 
> > is recommended by Ensembl).
> >
> > Until now, the ways I have used the Ensembl API appear not to have 
> > been effected by changes in Bioperl; I have successfully used it in 
> > conjunction with the bioperl's leading edge.  Of course 
> there may be 
> > other incompatibilities that I have just not noticed yet.
> >
> > Evidence of the new incompatibility is present in this back trace, 
> > which bridges between code in current bioperl-live and current
> > ensembl/modules/Bio:
> >
> > -------------------- EXCEPTION --------------------
> > MSG: Operator overloading of AnnotationI is deprecated STACK 
> > Bio::Annotation::DBLink::__ANON__
> > /home/mec/cvs/bioperl-live/Bio/Annotation/DBLink.pm:59
> > STACK Bio::EnsEMBL::DBSQL::DBEntryAdaptor::_fetch_by_object_type
> > /home/mec/cvs/foo/ensembl/modules/Bio/EnsEMBL/DBSQL/
> > DBEntryAdaptor.pm:77
> > 8
> >
> >
> > Obtaining version 1.2.3 fixes the issue for me.
> >
> > This is just a warning to others....
> >
> > Your milage may vary....
> >
> > --
> >
> > Malcolm Cook
> > Stowers Institute for Medical Research - Kansas City, Missouri
> 
> 
> 



From neetisomaiya at gmail.com  Tue Sep 18 06:30:34 2007
From: neetisomaiya at gmail.com (neeti somaiya)
Date: Tue, 18 Sep 2007 16:00:34 +0530
Subject: [Bioperl-l] A perl regex query
Message-ID: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>

Hi,

This isnt really a bioperl query.
But does anyone know how I can substitute all special characters (+ some
other things) in a string with nothing in perl?
I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.

-- 
-Neeti
Even my blood says, B positive


From spiros at lokku.com  Tue Sep 18 06:57:18 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 18 Sep 2007 11:57:18 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
Message-ID: <bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>

Heya, seperate the items you want to remove by a pipe and add the g
regex flag. For example:

spiros$ echo Cyclic-2,3-bisphospho-D-glycerate | perl -ne ' $_ =~
s at -D-|Cyclic\-@@g ; print $_ ;'
2,3-bisphosphoglycerate

IMHO this is ugly. Best to make an array of all the elements you want
to remove and then iterate through the array, calling the regex each
time with a different element. This way it will be much more easy to
read, debug and maintain.

For example

my $ra_bad_terms = [  '-D-', 'Cyclic-' ] ;

foreach (@$ra_bad_terms) {
   $string =~ s@$_@@g ;
}

etc.

Dont forget escaping and \Q \E if needed.

Spiros



On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
> Hi,
>
> This isnt really a bioperl query.
> But does anyone know how I can substitute all special characters (+ some
> other things) in a string with nothing in perl?
> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
>
> --
> -Neeti
> Even my blood says, B positive
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From n.haigh at sheffield.ac.uk  Tue Sep 18 07:44:14 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Tue, 18 Sep 2007 12:44:14 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
Message-ID: <46EFBA0E.4030104@sheffield.ac.uk>

An even better way is to use the array as Spiros suggested, but you
should then be able to use that in the regex like this:

my @ra_bad_terms = (  '-D-', 'Cyclic-' );
$string =~ s/@ra_bad_terms//g;

Again you might need escaping with \Q and \E - can't remember off hand.

You might also want to look here:
http://www.perl.com/pub/a/2002/06/04/apo5.html?page=15

Cheers
Nath



Spiros Denaxas wrote:
> Heya, seperate the items you want to remove by a pipe and add the g
> regex flag. For example:
>
> spiros$ echo Cyclic-2,3-bisphospho-D-glycerate | perl -ne ' $_ =~
> s at -D-|Cyclic\-@@g ; print $_ ;'
> 2,3-bisphosphoglycerate
>
> IMHO this is ugly. Best to make an array of all the elements you want
> to remove and then iterate through the array, calling the regex each
> time with a different element. This way it will be much more easy to
> read, debug and maintain.
>
> For example
>
> my $ra_bad_terms = [  '-D-', 'Cyclic-' ] ;
>
> foreach (@$ra_bad_terms) {
>    $string =~ s@$_@@g ;
> }
>
> etc.
>
> Dont forget escaping and \Q \E if needed.
>
> Spiros
>
>
>
> On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
>   
>> Hi,
>>
>> This isnt really a bioperl query.
>> But does anyone know how I can substitute all special characters (+ some
>> other things) in a string with nothing in perl?
>> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
>> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
>>
>> --
>> -Neeti
>> Even my blood says, B positive
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>     
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>   



From neetisomaiya at gmail.com  Tue Sep 18 08:13:42 2007
From: neetisomaiya at gmail.com (neeti somaiya)
Date: Tue, 18 Sep 2007 17:43:42 +0530
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFBE8A.6080402@cam.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
Message-ID: <764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>

Thanks.
It might work, but not always, because the string could be somthing like
Cyclic-2,3-Bisphospho-D-Glycerate.
Here I will first convert the full thing to a lower case and would then try
to get what I want.

Nothing seems to work, when I try to substitute -D- with nothing, "D" and
"-" when occuring separately also get substituted with nothing.

On 9/18/07, Roy Chaudhuri <rrc22 at cam.ac.uk> wrote:
>
> > This isnt really a bioperl query.
> > But does anyone know how I can substitute all special characters (+ some
> > other things) in a string with nothing in perl?
> > I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I
> want
> > ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
> >
>
> A more general approach that might work is to keep lower case words (I
> don't know if that will be true for all your cases):
>
> $_='Cyclic-2,3-bisphospho-D-glycerate';
> print join '', /\b[a-z]+\b/g;
>
> Roy.
> --
> Dr. Roy Chaudhuri
> Department of Veterinary Medicine
> University of Cambridge, U.K.
>



-- 
-Neeti
Even my blood says, B positive


From ak at ebi.ac.uk  Tue Sep 18 08:20:32 2007
From: ak at ebi.ac.uk (Andreas Kahari)
Date: Tue, 18 Sep 2007 13:20:32 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
Message-ID: <20070918122032.GV14066@ebi.ac.uk>

On Tue, Sep 18, 2007 at 04:00:34PM +0530, neeti somaiya wrote:
> Hi,
> 
> This isnt really a bioperl query.
> But does anyone know how I can substitute all special characters (+ some
> other things) in a string with nothing in perl?
> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.

This is in additions to the suggestions you've already had.

If you always want to concatenate the 3rd and 5th part of the string, as
delimited by dashes, then you could do this:

  my $string = 'Cyclic-2,3-bisphospho-D-glycerate';
  my $newstring = join( '', ( split( /-/, $string ) )[ 2, 4 ] );


Cheers,
Andreas

-- 
Andreas K?h?ri :: Ensembl Software Developer
European Bioinformatics Institute (EMBL-EBI)
--------------------------------------------


From spiros at lokku.com  Tue Sep 18 08:23:49 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 18 Sep 2007 13:23:49 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
Message-ID: <bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>

Its not impossibe, you just have to use \b to denote the word boundaries :)

echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'

this-is-a_teststring-D

It only gets rid of -D- , all other occurrences of D and - remain intact.

Spiros


On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
> Thanks.
> It might work, but not always, because the string could be somthing like
> Cyclic-2,3-Bisphospho-D-Glycerate.
> Here I will first convert the full thing to a lower case and would then try
> to get what I want.
>
> Nothing seems to work, when I try to substitute -D- with nothing, "D" and
> "-" when occuring separately also get substituted with nothing.
>
> On 9/18/07, Roy Chaudhuri <rrc22 at cam.ac.uk> wrote:
> >
> > > This isnt really a bioperl query.
> > > But does anyone know how I can substitute all special characters (+ some
> > > other things) in a string with nothing in perl?
> > > I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I
> > want
> > > ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
> > >
> >
> > A more general approach that might work is to keep lower case words (I
> > don't know if that will be true for all your cases):
> >
> > $_='Cyclic-2,3-bisphospho-D-glycerate';
> > print join '', /\b[a-z]+\b/g;
> >
> > Roy.
> > --
> > Dr. Roy Chaudhuri
> > Department of Veterinary Medicine
> > University of Cambridge, U.K.
> >
>
>
>
> --
> -Neeti
> Even my blood says, B positive
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From rrc22 at cam.ac.uk  Tue Sep 18 08:03:22 2007
From: rrc22 at cam.ac.uk (Roy Chaudhuri)
Date: Tue, 18 Sep 2007 13:03:22 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
Message-ID: <46EFBE8A.6080402@cam.ac.uk>

> This isnt really a bioperl query.
> But does anyone know how I can substitute all special characters (+ some
> other things) in a string with nothing in perl?
> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
> 

A more general approach that might work is to keep lower case words (I 
don't know if that will be true for all your cases):

$_='Cyclic-2,3-bisphospho-D-glycerate';
print join '', /\b[a-z]+\b/g;

Roy.
--
Dr. Roy Chaudhuri
Department of Veterinary Medicine
University of Cambridge, U.K.


From neetisomaiya at gmail.com  Tue Sep 18 08:47:18 2007
From: neetisomaiya at gmail.com (neeti somaiya)
Date: Tue, 18 Sep 2007 18:17:18 +0530
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
Message-ID: <764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>

My actual problem is a bit more complicated.
It is not just one string, nut lakhs of them, they are actually names of
chemical compounds.

THe problem is there are 2 different data sources, I need to match the
compond names between them, but the problem is though the compound may be
the same in the two, they use different naming formats for them.

eg 1 : Glucose
DB1 : D-glucose
DB2 : alpha-D-Glucose

eg2 : 2,3-bisphosphoglycerate
DB1 : Cyclic-2,3-bisphospho-D-Glycerate
DB2 : 2,3 bisphoshpglycerate

And there are some simple examples, there are even more complicated ones,
with many digits, alhas, betas, hyphens, S, R, cis, trans etc etc.

I just want to see if the basic compond is the same, i.e. the first one will
be glucose and second one will be 2,3-biphosphoglycerate (can't take just
bisphosphoglycerate because 1,3-bisphosphoglycerate would mean something
else).

Anyone has any suggestions how to tackle this?

Thanks.

On 9/18/07, Spiros Denaxas <spiros at lokku.com> wrote:
>
> Its not impossibe, you just have to use \b to denote the word boundaries
> :)
>
> echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'
>
> this-is-a_teststring-D
>
> It only gets rid of -D- , all other occurrences of D and - remain intact.
>
> Spiros
>
>
> On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
> > Thanks.
> > It might work, but not always, because the string could be somthing like
> > Cyclic-2,3-Bisphospho-D-Glycerate.
> > Here I will first convert the full thing to a lower case and would then
> try
> > to get what I want.
> >
> > Nothing seems to work, when I try to substitute -D- with nothing, "D"
> and
> > "-" when occuring separately also get substituted with nothing.
> >
> > On 9/18/07, Roy Chaudhuri <rrc22 at cam.ac.uk> wrote:
> > >
> > > > This isnt really a bioperl query.
> > > > But does anyone know how I can substitute all special characters (+
> some
> > > > other things) in a string with nothing in perl?
> > > > I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and
> I
> > > want
> > > > ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3-
> etc.
> > > >
> > >
> > > A more general approach that might work is to keep lower case words (I
> > > don't know if that will be true for all your cases):
> > >
> > > $_='Cyclic-2,3-bisphospho-D-glycerate';
> > > print join '', /\b[a-z]+\b/g;
> > >
> > > Roy.
> > > --
> > > Dr. Roy Chaudhuri
> > > Department of Veterinary Medicine
> > > University of Cambridge, U.K.
> > >
> >
> >
> >
> > --
> > -Neeti
> > Even my blood says, B positive
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
>



-- 
-Neeti
Even my blood says, B positive


From spiros at lokku.com  Tue Sep 18 08:56:44 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 18 Sep 2007 13:56:44 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFCA4E.5090605@sendu.me.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<46EFCA4E.5090605@sendu.me.uk>
Message-ID: <bba689ec0709180556q5f23e8a7ub50302891e0c3849@mail.gmail.com>

On 9/18/07, Sendu Bala <bix at sendu.me.uk> wrote:
> Spiros Denaxas wrote:
> > Its not impossibe, you just have to use \b to denote the word boundaries :)
> >
> > echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'
> >
> > this-is-a_teststring-D
> >
> > It only gets rid of -D- , all other occurrences of D and - remain intact.
>
> I'm confused. The simpler:
>
> echo 'this-is-a_test-D-string-D' | perl -ne ' s/-D-//g ; print ;'
>
> gives the same answer. You'd have to something very strange for a regex
> on -D- to match D or - alone.
>

Its the same thing. He was just mixing up character classes in the regex.

Spiros


From bix at sendu.me.uk  Tue Sep 18 08:53:34 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 18 Sep 2007 13:53:34 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<46EFBE8A.6080402@cam.ac.uk>	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
Message-ID: <46EFCA4E.5090605@sendu.me.uk>

Spiros Denaxas wrote:
> Its not impossibe, you just have to use \b to denote the word boundaries :)
> 
> echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'
> 
> this-is-a_teststring-D
> 
> It only gets rid of -D- , all other occurrences of D and - remain intact.

I'm confused. The simpler:

echo 'this-is-a_test-D-string-D' | perl -ne ' s/-D-//g ; print ;'

gives the same answer. You'd have to something very strange for a regex 
on -D- to match D or - alone.


From rrc22 at cam.ac.uk  Tue Sep 18 09:26:47 2007
From: rrc22 at cam.ac.uk (Roy Chaudhuri)
Date: Tue, 18 Sep 2007 14:26:47 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	
	<46EFBE8A.6080402@cam.ac.uk>	
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>	
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
Message-ID: <46EFD217.1030103@cam.ac.uk>

> My actual problem is a bit more complicated.
> It is not just one string, nut lakhs of them, they are actually names of 
> chemical compounds.
> 
> THe problem is there are 2 different data sources, I need to match the 
> compond names between them, but the problem is though the compound may 
> be the same in the two, they use different naming formats for them.

Unless you can define in simple and precise terms exactly which parts of 
the string you need then there is no way that you will be able to code a 
solution in Perl.

Maybe you could look for a database that contains the synonyms for each 
molecule? A quick Google finds ChEBI (http://www.ebi.ac.uk/chebi), which 
is available to download as flat files.

Roy.
--
Dr. Roy Chaudhuri
Department of Veterinary Medicine
University of Cambridge, U.K.


From js5 at sanger.ac.uk  Tue Sep 18 08:58:36 2007
From: js5 at sanger.ac.uk (James Smith)
Date: Tue, 18 Sep 2007 13:58:36 +0100 (BST)
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <20070918122032.GV14066@ebi.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<20070918122032.GV14066@ebi.ac.uk>
Message-ID: <Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>


Neeti,

This isn't really a bioperl query - but I will try and explain a simple
solution...

warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );

sub simplify {
   local $_ = "-$_[0]-";
         ## Quick hack add -'s at start and end! as always match "-string-"
   s/-(
     Cyclic | # The prefix "cyclic"
     \d+    | # a single number between two "-"s
     \d+,\d+| # number,number between two "-"s
     \w       # a single letter between two "-"s
   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
         ## 0-width +ve lookahead assertion - so can match
         ## multiple consecutive -x- constructions in same regexp!
   s/-//g;
         ## remove remaining "-"s from string...
}

Not sure what other test strings you may want - but most should be able to
fit in the () brackets in the first regexp of simplify

James

On Tue, 18 Sep 2007, Andreas Kahari wrote:

> On Tue, Sep 18, 2007 at 04:00:34PM +0530, neeti somaiya wrote:
>> Hi,
>>
>> This isnt really a bioperl query.
>> But does anyone know how I can substitute all special characters (+ some
>> other things) in a string with nothing in perl?
>> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
>> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
>
> This is in additions to the suggestions you've already had.
>
> If you always want to concatenate the 3rd and 5th part of the string, as
> delimited by dashes, then you could do this:
>
>  my $string = 'Cyclic-2,3-bisphospho-D-glycerate';
>  my $newstring = join( '', ( split( /-/, $string ) )[ 2, 4 ] );
>
>
> Cheers,
> Andreas
>
> -- 
> Andreas K?h?ri :: Ensembl Software Developer
> European Bioinformatics Institute (EMBL-EBI)
> --------------------------------------------
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 


From stefan.kirov at bms.com  Tue Sep 18 09:05:16 2007
From: stefan.kirov at bms.com (Stefan Kirov)
Date: Tue, 18 Sep 2007 09:05:16 -0400
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
Message-ID: <46EFCD0C.3010306@bms.com>

neeti somaiya wrote:
> My actual problem is a bit more complicated.
> It is not just one string, nut lakhs of them, they are actually names of
> chemical compounds.
>
> THe problem is there are 2 different data sources, I need to match the
> compond names between them, but the problem is though the compound may be
> the same in the two, they use different naming formats for them.
>
> eg 1 : Glucose
> DB1 : D-glucose
> DB2 : alpha-D-Glucose
>
> eg2 : 2,3-bisphosphoglycerate
> DB1 : Cyclic-2,3-bisphospho-D-Glycerate
> DB2 : 2,3 bisphoshpglycerate
>   
It seems to me you are trying to match 2 collections of chemical
compounds. If you need to do this reliably you need to use canonical
smiles (perhaps there are other solutions but I am not aware of them).
There are many resources for that, including open-source:
http://openbabel.sourceforge.net/wiki/Main_Page
It is not really bioperl's cup of tea, this is much more a
chemi-informatics problem. I am not sure if there is a need for bioperl
to be extended this way- any thoughts on that?
Hope this helps, regards
Stefan
> And there are some simple examples, there are even more complicated ones,
> with many digits, alhas, betas, hyphens, S, R, cis, trans etc etc.
>
> I just want to see if the basic compond is the same, i.e. the first one will
> be glucose and second one will be 2,3-biphosphoglycerate (can't take just
> bisphosphoglycerate because 1,3-bisphosphoglycerate would mean something
> else).
>
> Anyone has any suggestions how to tackle this?
>
> Thanks.
>
> On 9/18/07, Spiros Denaxas <spiros at lokku.com> wrote:
>   
>> Its not impossibe, you just have to use \b to denote the word boundaries
>> :)
>>
>> echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'
>>
>> this-is-a_teststring-D
>>
>> It only gets rid of -D- , all other occurrences of D and - remain intact.
>>
>> Spiros
>>
>>
>> On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
>>     
>>> Thanks.
>>> It might work, but not always, because the string could be somthing like
>>> Cyclic-2,3-Bisphospho-D-Glycerate.
>>> Here I will first convert the full thing to a lower case and would then
>>>       
>> try
>>     
>>> to get what I want.
>>>
>>> Nothing seems to work, when I try to substitute -D- with nothing, "D"
>>>       
>> and
>>     
>>> "-" when occuring separately also get substituted with nothing.
>>>
>>> On 9/18/07, Roy Chaudhuri <rrc22 at cam.ac.uk> wrote:
>>>       
>>>>> This isnt really a bioperl query.
>>>>> But does anyone know how I can substitute all special characters (+
>>>>>           
>> some
>>     
>>>>> other things) in a string with nothing in perl?
>>>>> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and
>>>>>           
>> I
>>     
>>>> want
>>>>         
>>>>> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3-
>>>>>           
>> etc.
>>     
>>>> A more general approach that might work is to keep lower case words (I
>>>> don't know if that will be true for all your cases):
>>>>
>>>> $_='Cyclic-2,3-bisphospho-D-glycerate';
>>>> print join '', /\b[a-z]+\b/g;
>>>>
>>>> Roy.
>>>> --
>>>> Dr. Roy Chaudhuri
>>>> Department of Veterinary Medicine
>>>> University of Cambridge, U.K.
>>>>
>>>>         
>>>
>>> --
>>> -Neeti
>>> Even my blood says, B positive
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>       
>
>
>
>   



From stephane.teletchea at jouy.inra.fr  Tue Sep 18 09:48:05 2007
From: stephane.teletchea at jouy.inra.fr (=?ISO-8859-1?Q?St=E9phane_T=E9letch=E9a?=)
Date: Tue, 18 Sep 2007 15:48:05 +0200
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<46EFBE8A.6080402@cam.ac.uk>	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
Message-ID: <46EFD715.4060308@jouy.inra.fr>

neeti somaiya a ?crit :
> My actual problem is a bit more complicated.
> It is not just one string, nut lakhs of them, they are actually names of
> chemical compounds.
> 
> THe problem is there are 2 different data sources, I need to match the
> compond names between them, but the problem is though the compound may be
> the same in the two, they use different naming formats for them.
> 
> eg 1 : Glucose
> DB1 : D-glucose
> DB2 : alpha-D-Glucose
> 
> eg2 : 2,3-bisphosphoglycerate
> DB1 : Cyclic-2,3-bisphospho-D-Glycerate
> DB2 : 2,3 bisphoshpglycerate
> 
> And there are some simple examples, there are even more complicated ones,
> with many digits, alhas, betas, hyphens, S, R, cis, trans etc etc.
> 
> I just want to see if the basic compond is the same, i.e. the first one will
> be glucose and second one will be 2,3-biphosphoglycerate (can't take just
> bisphosphoglycerate because 1,3-bisphosphoglycerate would mean something
> else).
> 
> Anyone has any suggestions how to tackle this?
> 

I would use a two step approach :
1 - filter the entries, use a convention, for instance translata all '+' 
into their 'plus' literal equivalent, change spaces by '_', change all 
'-' for '_' also, etc
2 - try matching the result, if the match does not work, try to match 
some characters (for instance, try to remove all non alphabetical 
characters and see if the resulting produces a match).

That's theory, now, you have some time for errors and trials, but i 
think there is not essay, one shot solution, neither a bioperl facility 
for handling (bio)chemical compounds.

Cheers,
St?phane

-- 
St?phane T?letch?a, PhD.                  http://www.steletch.org
Unit? Math?matique Informatique et G?nome http://migale.jouy.inra.fr/mig
INRA, Domaine de Vilvert                  T?l : (33) 134 652 891
78352 Jouy-en-Josas cedex, France         Fax : (33) 134 652 901


From puetz at mpipsykl.mpg.de  Tue Sep 18 10:12:47 2007
From: puetz at mpipsykl.mpg.de (Benno Puetz)
Date: Tue, 18 Sep 2007 16:12:47 +0200
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<20070918122032.GV14066@ebi.ac.uk>
	<Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
Message-ID: <46EFDCDF.6030309@mpipsykl.mpg.de>

James Smith wrote:
>
> Neeti,
>
> This isn't really a bioperl query - but I will try and explain a simple
> solution...
>
> warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );
>
> sub simplify {
>   local $_ = "-$_[0]-";
>         ## Quick hack add -'s at start and end! as always match 
> "-string-"
>   s/-(
>     Cyclic | # The prefix "cyclic"
>     \d+    | # a single number between two "-"s
>     \d+,\d+| # number,number between two "-"s
>     \w       # a single letter between two "-"s
>   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
>         ## 0-width +ve lookahead assertion - so can match
>         ## multiple consecutive -x- constructions in same regexp!
>   s/-//g;
>         ## remove remaining "-"s from string...
> }
>
> Not sure what other test strings you may want - but most should be 
> able to
> fit in the () brackets in the first regexp of simplify
>
> James
Along the same line

# some test for most of the removals below
my $string = "Alpha-Cyclic-2,3-bi-sphos-1,2,5-pho-D-beta-glycerate";
my @ra_bad_terms = (  '-?(D|R|S)-',
                      '-?([aA]lpha|[bB]eta|[gG]amma)-',
                      '-?([cC]is|[tT]rans)-',
                      '-?[cC]yclic-',
                    # '-?\d+(,\d+)+-',   # uncomment to remove numbers, too
                      '(?<!\d)-' );          # '-' following number
print "$string\n";
foreach ( @ra_bad_terms ){

  eval { $string =~ s/$_//g; };
  print "$_:$string\n";   # for feedback only
}
#$string =~ s/<@ra_bad_terms>//g;

print lc($string),"\n";


-- 
Benno P?tz
Statistische Genetik
Max-Planck-Institut f. Psychiatrie            Tel.: +49-89-30622-222
Kraepelinstr. 10                              Fax : +49-89-30622-601
80804 M?nchen, Germany



From spiros at lokku.com  Tue Sep 18 10:41:20 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 18 Sep 2007 15:41:20 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFDCDF.6030309@mpipsykl.mpg.de>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<20070918122032.GV14066@ebi.ac.uk>
	<Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
	<46EFDCDF.6030309@mpipsykl.mpg.de>
Message-ID: <bba689ec0709180741s13b358e3l1b326a47700259a6@mail.gmail.com>

On 9/18/07, Benno Puetz <puetz at mpipsykl.mpg.de> wrote:
> James Smith wrote:
> >
> > Neeti,
> >
> > This isn't really a bioperl query - but I will try and explain a simple
> > solution...
> >
> > warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );
> >
> > sub simplify {
> >   local $_ = "-$_[0]-";
> >         ## Quick hack add -'s at start and end! as always match
> > "-string-"
> >   s/-(
> >     Cyclic | # The prefix "cyclic"
> >     \d+    | # a single number between two "-"s
> >     \d+,\d+| # number,number between two "-"s
> >     \w       # a single letter between two "-"s
> >   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
> >         ## 0-width +ve lookahead assertion - so can match
> >         ## multiple consecutive -x- constructions in same regexp!
> >   s/-//g;
> >         ## remove remaining "-"s from string...
> > }
> >
> > Not sure what other test strings you may want - but most should be
> > able to
> > fit in the () brackets in the first regexp of simplify
> >
> > James
> Along the same line
>
> # some test for most of the removals below
> my $string = "Alpha-Cyclic-2,3-bi-sphos-1,2,5-pho-D-beta-glycerate";
> my @ra_bad_terms = (  '-?(D|R|S)-',
>                       '-?([aA]lpha|[bB]eta|[gG]amma)-',
>                       '-?([cC]is|[tT]rans)-',
>                       '-?[cC]yclic-',
>                     # '-?\d+(,\d+)+-',   # uncomment to remove numbers, too
>                       '(?<!\d)-' );          # '-' following number
> print "$string\n";
> foreach ( @ra_bad_terms ){
>
>   eval { $string =~ s/$_//g; };
>   print "$_:$string\n";   # for feedback only
> }
> #$string =~ s/<@ra_bad_terms>//g;
>
> print lc($string),"\n";
>
>
> --
> Benno P?tz

My humble opinion would be to avoid using regular expressions to do
your task and try and locate a more valid and centralized information
repository to use, be it a database of synonyms or some other indexing
code. This will add the required domain knowledge in your solution.
Using regular expressions will almost certainly lead to problems and
bugs which will be very hard to resolve.
Should you decide to go forward and treat everything simply as strings
and compare them, I feel this is more of an NLP problem.

Spiros



From cjfields at uiuc.edu  Tue Sep 18 11:24:52 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 10:24:52 -0500
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFD217.1030103@cam.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	
	<46EFBE8A.6080402@cam.ac.uk>	
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>	
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
	<46EFD217.1030103@cam.ac.uk>
Message-ID: <155C67C0-1F81-4A1C-AD68-A21B4E6918C9@uiuc.edu>


On Sep 18, 2007, at 8:26 AM, Roy Chaudhuri wrote:

>> My actual problem is a bit more complicated.
>> It is not just one string, nut lakhs of them, they are actually  
>> names of
>> chemical compounds.
>>
>> THe problem is there are 2 different data sources, I need to match  
>> the
>> compond names between them, but the problem is though the compound  
>> may
>> be the same in the two, they use different naming formats for them.
>
> Unless you can define in simple and precise terms exactly which  
> parts of
> the string you need then there is no way that you will be able to  
> code a
> solution in Perl.
>
> Maybe you could look for a database that contains the synonyms for  
> each
> molecule? A quick Google finds ChEBI (http://www.ebi.ac.uk/chebi),  
> which
> is available to download as flat files.
>
> Roy.
> --
> Dr. Roy Chaudhuri
> Department of Veterinary Medicine
> University of Cambridge, U.K.

D'oh!  Roy beat me to it; that's what I was going to suggest.  I  
agree; don't trust simple word munging to always get you the correct  
answer in this case, it's just too complicated to try and catch every  
case.

ChEBI is a good choice; Stefan's suggestion of OpenBabel is also a  
good one.  I would also try not to reinvent the wheel; there may be  
some modules available via CPAN which do what you need, such as these:

http://search.cpan.org/search?query=chem&mode=module

or this:

http://search.cpan.org/~ghutchis/Chemistry-OpenBabel-1.2.0/

chris


From shameer at ncbs.res.in  Tue Sep 18 10:57:55 2007
From: shameer at ncbs.res.in (Shameer Khadar)
Date: Tue, 18 Sep 2007 20:27:55 +0530 (IST)
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFDCDF.6030309@mpipsykl.mpg.de>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<20070918122032.GV14066@ebi.ac.uk>
	<Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
	<46EFDCDF.6030309@mpipsykl.mpg.de>
Message-ID: <53713.192.168.1.1.1190127475.squirrel@mail.ncbs.res.in>

I used this module for my simple chemoinformatics tasks,

http://www.perlmol.org/ - PerlMol - Perl Modules for Molecular Chemistry
Please explore, you may find something useful.

-- 



> James Smith wrote:
>>
>> Neeti,
>>
>> This isn't really a bioperl query - but I will try and explain a simple
>> solution...
>>
>> warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );
>>
>> sub simplify {
>>   local $_ = "-$_[0]-";
>>         ## Quick hack add -'s at start and end! as always match
>> "-string-"
>>   s/-(
>>     Cyclic | # The prefix "cyclic"
>>     \d+    | # a single number between two "-"s
>>     \d+,\d+| # number,number between two "-"s
>>     \w       # a single letter between two "-"s
>>   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
>>         ## 0-width +ve lookahead assertion - so can match
>>         ## multiple consecutive -x- constructions in same regexp!
>>   s/-//g;
>>         ## remove remaining "-"s from string...
>> }
>>
>> Not sure what other test strings you may want - but most should be
>> able to
>> fit in the () brackets in the first regexp of simplify
>>
>> James
> Along the same line
>
> # some test for most of the removals below
> my $string = "Alpha-Cyclic-2,3-bi-sphos-1,2,5-pho-D-beta-glycerate";
> my @ra_bad_terms = (  '-?(D|R|S)-',
>                       '-?([aA]lpha|[bB]eta|[gG]amma)-',
>                       '-?([cC]is|[tT]rans)-',
>                       '-?[cC]yclic-',
>                     # '-?\d+(,\d+)+-',   # uncomment to remove numbers,
> too
>                       '(?<!\d)-' );          # '-' following number
> print "$string\n";
> foreach ( @ra_bad_terms ){
>
>   eval { $string =~ s/$_//g; };
>   print "$_:$string\n";   # for feedback only
> }
> #$string =~ s/<@ra_bad_terms>//g;
>
> print lc($string),"\n";
>
>
> --
> Benno P?tz
> Statistische Genetik
> Max-Planck-Institut f. Psychiatrie            Tel.: +49-89-30622-222
> Kraepelinstr. 10                              Fax : +49-89-30622-601
> 80804 M?nchen, Germany
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


-- 
Shameer Khadar
Prof. R. Sowdhamini's Lab (# 25) The Computational Biology Group
National Centre for Biological Sciences (TIFR)
GKVK Campus, Bellary Road, Bangalore - 65, Karnataka - India
T - 91-080-23666001 EXT - 6251
W - http://www.ncbs.res.in



From js5 at sanger.ac.uk  Tue Sep 18 11:37:57 2007
From: js5 at sanger.ac.uk (James Smith)
Date: Tue, 18 Sep 2007 16:37:57 +0100 (BST)
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <bba689ec0709180741s13b358e3l1b326a47700259a6@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<20070918122032.GV14066@ebi.ac.uk>
	<Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
	<46EFDCDF.6030309@mpipsykl.mpg.de>
	<bba689ec0709180741s13b358e3l1b326a47700259a6@mail.gmail.com>
Message-ID: <Pine.LNX.4.64.0709181632450.28437@cbi4a.internal.sanger.ac.uk>



On Tue, 18 Sep 2007, Spiros Denaxas wrote:

> On 9/18/07, Benno Puetz <puetz at mpipsykl.mpg.de> wrote:
> James Smith wrote:
> >
> > Neeti,
> >
> > This isn't really a bioperl query - but I will try and explain a simple
> > solution...
> >
> > warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );
> >
> > sub simplify {
> >   local $_ = "-$_[0]-";
> >         ## Quick hack add -'s at start and end! as always match
> > "-string-"
> >   s/-(
> >     Cyclic | # The prefix "cyclic"
> >     \d+    | # a single number between two "-"s
> >     \d+,\d+| # number,number between two "-"s
> >     \w       # a single letter between two "-"s
> >   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
> >         ## 0-width +ve lookahead assertion - so can match
> >         ## multiple consecutive -x- constructions in same regexp!
> >   s/-//g;
> >         ## remove remaining "-"s from string...
> > }
> >
> > Not sure what other test strings you may want - but most should be
> > able to
> > fit in the () brackets in the first regexp of simplify
> >
> > James
> Along the same line
>

But the point is you don't need to loop over things....


Updated regexp...


sub simplify {
   local $_ = "-$_[0]-";             # Add '-' at start and end!
   s{-(
     [cC]yclic                     | # The prefix "cyclic"
     [aA]lpha | [bB]eta | [gG]amma | # Alpha/beta/gamma
     [tT]rans | [cC]is             | # Trans/cis
     [DRS]                         | # Single letter "D","R" or "S"
#    \d+(,\d+)*                   | # list of 1 or more "," separated nos
   )(?=-)}{}xg;                      # No. list currently commented out!
   s/-//g;                           # remove all "-"
   s/([^\d,])([\d,])/\1-\2/g;        # re-introduce "-" between number/
   s/([\d,])([^\d,])/\1-\2/g;        #  comma and letters
   s/--/-/g;                         # remove duplicate "-" signs..
   return $_;
}




-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 


From cjfields at uiuc.edu  Tue Sep 18 11:38:04 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 10:38:04 -0500
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFCD0C.3010306@bms.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
	<46EFCD0C.3010306@bms.com>
Message-ID: <68EC5D58-9D84-4692-BD99-F53FC75FD0E7@uiuc.edu>


On Sep 18, 2007, at 8:05 AM, Stefan Kirov wrote:

> neeti somaiya wrote:
>> ...
> It seems to me you are trying to match 2 collections of chemical
> compounds. If you need to do this reliably you need to use canonical
> smiles (perhaps there are other solutions but I am not aware of them).
> There are many resources for that, including open-source:
> http://openbabel.sourceforge.net/wiki/Main_Page
> It is not really bioperl's cup of tea, this is much more a
> chemi-informatics problem. I am not sure if there is a need for  
> bioperl
> to be extended this way- any thoughts on that?
> Hope this helps, regards
> Stefan

I would vote nyet myself unless I was convinced that this would be  
beneficial to bioperl core.  Right now I'm not yet there, primarily b/ 
c of the already available OpenBabel (with available CPAN interface)  
and other resources, not to mention there are too many areas in  
bioperl which need more focus (tests, documentation, etc).

However, if we do want to incorporate chemi-informatics at some point  
it could be something which is not integrated into the core  
architecture and can be installed separately (like network, ext, db,  
etc).

chris


From bioperl-list at superfrink.net  Tue Sep 18 12:16:48 2007
From: bioperl-list at superfrink.net (bioperl-list at superfrink.net)
Date: Tue, 18 Sep 2007 10:16:48 -0600 (MDT)
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFBA0E.4030104@sheffield.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
	<46EFBA0E.4030104@sheffield.ac.uk>
Message-ID: <Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>

On Tue, 18 Sep 2007, Nathan Haigh wrote:

> An even better way is to use the array as Spiros suggested, but you
> should then be able to use that in the regex like this:
>
> my @ra_bad_terms = (  '-D-', 'Cyclic-' );
> $string =~ s/@ra_bad_terms//g;

I didn't know one could do that.  I couldn't get it to work so I asked 
around.  In case anyone else read it and thought about using that code it 
might only work in Perl 6.

Regards,
Chad


From bix at sendu.me.uk  Tue Sep 18 13:21:06 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 18 Sep 2007 18:21:06 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>
	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
Message-ID: <46F00902.9070401@sendu.me.uk>

bioperl-list at superfrink.net wrote:
> On Tue, 18 Sep 2007, Nathan Haigh wrote:
> 
>> An even better way is to use the array as Spiros suggested, but you
>> should then be able to use that in the regex like this:
>>
>> my @ra_bad_terms = (  '-D-', 'Cyclic-' );
>> $string =~ s/@ra_bad_terms//g;
> 
> I didn't know one could do that.  I couldn't get it to work so I asked 
> around.  In case anyone else read it and thought about using that code it 
> might only work in Perl 6.

I assumed it was a typo. You can get it to work by adding

$" = '|';

before the regex;


From cjfields at uiuc.edu  Tue Sep 18 13:52:00 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 12:52:00 -0500
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
	<46EFBA0E.4030104@sheffield.ac.uk>
	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
Message-ID: <F7ADCFDC-D065-4401-AF1F-F53D6958CF37@uiuc.edu>


On Sep 18, 2007, at 11:16 AM, bioperl-list at superfrink.net wrote:

> On Tue, 18 Sep 2007, Nathan Haigh wrote:
>
>> An even better way is to use the array as Spiros suggested, but you
>> should then be able to use that in the regex like this:
>>
>> my @ra_bad_terms = (  '-D-', 'Cyclic-' );
>> $string =~ s/@ra_bad_terms//g;
>
> I didn't know one could do that.  I couldn't get it to work so I asked
> around.  In case anyone else read it and thought about using that  
> code it
> might only work in Perl 6.
>
> Regards,
> Chad

I think the problem is what s/@terms//g means.  To most it means  
group substitutions, which you can get by using s/(?:a|b|c|d)//g; to  
others it means stepwise 's/$old//g for $old (@terms)'.

To go from an array of terms to an optimized group regex, use  
Regexp::List (CPAN to the rescue!):

http://search.cpan.org/~dankogai/Regexp-Optimizer-0.15/lib/Regexp/ 
List.pm

chris


From cjfields at uiuc.edu  Tue Sep 18 14:23:37 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 13:23:37 -0500
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46F00902.9070401@sendu.me.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>
	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
	<46F00902.9070401@sendu.me.uk>
Message-ID: <5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>


On Sep 18, 2007, at 12:21 PM, Sendu Bala wrote:

> bioperl-list at superfrink.net wrote:
>> On Tue, 18 Sep 2007, Nathan Haigh wrote:
>>
>>> An even better way is to use the array as Spiros suggested, but you
>>> should then be able to use that in the regex like this:
>>>
>>> my @ra_bad_terms = (  '-D-', 'Cyclic-' );
>>> $string =~ s/@ra_bad_terms//g;
>>
>> I didn't know one could do that.  I couldn't get it to work so I  
>> asked
>> around.  In case anyone else read it and thought about using that  
>> code it
>> might only work in Perl 6.
>
> I assumed it was a typo. You can get it to work by adding
>
> $" = '|';
>
> before the regex;

Ah, didn't know that one.  Nice, though shouldn't it be localized?

The (supposed) advantage of Regexp::List is the regex is optimized  
for speed; I haven't tried it out myself, so YMMV.

chris


From stefan.kirov at bms.com  Tue Sep 18 14:54:49 2007
From: stefan.kirov at bms.com (Stefan Kirov)
Date: Tue, 18 Sep 2007 14:54:49 -0400
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <155C67C0-1F81-4A1C-AD68-A21B4E6918C9@uiuc.edu>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
	<46EFD217.1030103@cam.ac.uk>
	<155C67C0-1F81-4A1C-AD68-A21B4E6918C9@uiuc.edu>
Message-ID: <46F01EF9.80003@bms.com>

Actually, smiles can be tricky too- you can easily generate
non-canonical keys, where InChi is unique (as I understand it at least).
It is promoted by IUAPC:
http://www.iupac.org/inchi/
and can be generated by OpenBabel.
My take is that if you need to map between small molecules InChi might
be the best way..
Stefan

Chris Fields wrote:
> On Sep 18, 2007, at 8:26 AM, Roy Chaudhuri wrote:
>
>   
>>> My actual problem is a bit more complicated.
>>> It is not just one string, nut lakhs of them, they are actually  
>>> names of
>>> chemical compounds.
>>>
>>> THe problem is there are 2 different data sources, I need to match  
>>> the
>>> compond names between them, but the problem is though the compound  
>>> may
>>> be the same in the two, they use different naming formats for them.
>>>       
>> Unless you can define in simple and precise terms exactly which  
>> parts of
>> the string you need then there is no way that you will be able to  
>> code a
>> solution in Perl.
>>
>> Maybe you could look for a database that contains the synonyms for  
>> each
>> molecule? A quick Google finds ChEBI (http://www.ebi.ac.uk/chebi),  
>> which
>> is available to download as flat files.
>>
>> Roy.
>> --
>> Dr. Roy Chaudhuri
>> Department of Veterinary Medicine
>> University of Cambridge, U.K.
>>     
>
> D'oh!  Roy beat me to it; that's what I was going to suggest.  I  
> agree; don't trust simple word munging to always get you the correct  
> answer in this case, it's just too complicated to try and catch every  
> case.
>
> ChEBI is a good choice; Stefan's suggestion of OpenBabel is also a  
> good one.  I would also try not to reinvent the wheel; there may be  
> some modules available via CPAN which do what you need, such as these:
>
> http://search.cpan.org/search?query=chem&mode=module
>
> or this:
>
> http://search.cpan.org/~ghutchis/Chemistry-OpenBabel-1.2.0/
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>   



From jason at bioperl.org  Tue Sep 18 20:04:05 2007
From: jason at bioperl.org (Jason Stajich)
Date: Tue, 18 Sep 2007 17:04:05 -0700
Subject: [Bioperl-l] bioperl + GFF3 audit
Message-ID: <C7895984-E679-4079-A584-9EB013F22EB5@bioperl.org>

Something to throw out there for discussion with GFF3 gurus.  Maybe  
we can have a little STATE-OF-GFF3 and compliance at the GMOD  
workshop after Genome Informatics in Nov?

I propose after we get the next stable release out we consider doing  
a systematic code audit to insure that we can really generate proper  
GFF3 compliant data from all of our parsers.  This would include both  
good ID/Parent as well as .  I'd be happy to also think about making  
sure we can generate proper GTF/GFF2.5 - whether this means we have a  
translator that works on these objects or we have to code this into  
the parser software that creating the sequence features, not sure.   
The whole Bio::Tools mishmash is a little unsettling when trying to  
generate standardized output.  I'm not really clear if Bio::FeatureIO  
actually tries to do this properly, but 'gene_id'/'transcript_id' for  
GTF and ID/Parent 3-level Features for gene->transcript->exon/CDS  
doesn't really come out properly and I end up writing workarounds on  
the downstream data.

One aspect that is biting is the flat versus multi-level features  
(genes -> transcripts -> exons) and how we handle them.  I think this  
ought to get fleshed out better so we can really support .  A lot of  
the Bio::Tools parsers are generally pretty laissez fair here about  
things and we have a variety of non-standard and non-compliant aspects.

For example, I am playing with tRNA parsing and I assume that proper  
GFF3 here is three levels of :
gene -> tRNA -> exon
with those being the primary_tag names that correspond to the  
Sequence Ontology.

I have modified the code locally to report generic features but which  
have sub-features that must be extracted.  In addition the ID/Parent  
fields are explicitly filled in and I wonder if we want to do a  
better job insuring these are meaningfully entered?

So if there are interested people out there we can try and hammer out  
a todo list on the wiki and see if we're generating proper GFF3 in  
the first place and trying to make sure all the features that get fed  
out to Bio::FeatureIO or Bio::Tools::GFF can get properly transformed  
into GFF3 and GTF output.

Comments/Volunteers?

-jason

--
Jason Stajich
jason at bioperl.org



From cjfields at uiuc.edu  Tue Sep 18 23:37:30 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 22:37:30 -0500
Subject: [Bioperl-l] bioperl + GFF3 audit
In-Reply-To: <C7895984-E679-4079-A584-9EB013F22EB5@bioperl.org>
References: <C7895984-E679-4079-A584-9EB013F22EB5@bioperl.org>
Message-ID: <D6630AE3-B968-462C-9CED-D09C90BE786B@uiuc.edu>

On Sep 18, 2007, at 7:04 PM, Jason Stajich wrote:

> Something to throw out there for discussion with GFF3 gurus.  Maybe
> we can have a little STATE-OF-GFF3 and compliance at the GMOD
> workshop after Genome Informatics in Nov?
>
> I propose after we get the next stable release out we consider doing
> a systematic code audit to insure that we can really generate proper
> GFF3 compliant data from all of our parsers.  This would include both
> good ID/Parent as well as .  I'd be happy to also think about making
> sure we can generate proper GTF/GFF2.5 - whether this means we have a
> translator that works on these objects or we have to code this into
> the parser software that creating the sequence features, not sure.
> The whole Bio::Tools mishmash is a little unsettling when trying to
> generate standardized output.  I'm not really clear if Bio::FeatureIO
> actually tries to do this properly, but 'gene_id'/'transcript_id' for
> GTF and ID/Parent 3-level Features for gene->transcript->exon/CDS
> doesn't really come out properly and I end up writing workarounds on
> the downstream data.

This suggests we should try to get a stable out fairly quickly and  
work on the next dev straight away.  I'm okay with that, though it  
would be nice to finish up a few loose ends first, the svn move  
foremost.

The Feature/Annotation stuff has been pretty much rolled back so  
maybe a stable release can be done fairly quickly.  My main concern  
was that any rollback would break FeatureIO or SF::Annotated, but so  
far FeatureIO and SF::Annotated both pass tests.  However, I think  
both also need better documentation and possibly more/better test  
coverage.

> One aspect that is biting is the flat versus multi-level features
> (genes -> transcripts -> exons) and how we handle them.  I think this
> ought to get fleshed out better so we can really support .  A lot of
> the Bio::Tools parsers are generally pretty laissez fair here about
> things and we have a variety of non-standard and non-compliant  
> aspects.

Agreed.

> For example, I am playing with tRNA parsing and I assume that proper
> GFF3 here is three levels of :
> gene -> tRNA -> exon
> with those being the primary_tag names that correspond to the
> Sequence Ontology.
>
> I have modified the code locally to report generic features but which
> have sub-features that must be extracted.  In addition the ID/Parent
> fields are explicitly filled in and I wonder if we want to do a
> better job insuring these are meaningfully entered?

Would a factory approach work here?  For instance, have a Factory  
which generates the SeqFeature type you want on the fly if passed  
appropriate parameters and location, say flattened vs unflattened,  
strictly typed vs lightweight, etc.  For that matter, maybe we could  
reimplement FTHelper in SeqIO to do the same...

> So if there are interested people out there we can try and hammer out
> a todo list on the wiki and see if we're generating proper GFF3 in
> the first place and trying to make sure all the features that get fed
> out to Bio::FeatureIO or Bio::Tools::GFF can get properly transformed
> into GFF3 and GTF output.
>
> Comments/Volunteers?
>
> -jason
>
> --
> Jason Stajich
> jason at bioperl.org

I'll be busy 'til mid-Oct but I'll chip in.  I'll keep tabs on the wiki.

chris


From harryzs1981 at yahoo.com.cn  Fri Sep 21 10:40:55 2007
From: harryzs1981 at yahoo.com.cn (sheng zhao)
Date: Fri, 21 Sep 2007 22:40:55 +0800 (CST)
Subject: [Bioperl-l] Help for extracting CDS sequences from FASTA form
Message-ID: <815154.22486.qm@web15901.mail.cnb.yahoo.com>

              Dear all:      
I have got a set of DAN sequences in FASTA form as following: 
   
  >gnl|UG|Bt#S37443275 Bos taurus cathelicidin 4, mRNA (cDNA clone MGC:157131 IMAGE:8442308), complete cds /cds=p(18,452) /gb=BC133480 /gi=126717494 /ug=Bt.3 /len=572
  TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................................
  >gnl|UG|Bt#S11932596 B.taurus mRNA for interleukin-5 /cds=p(1,405) /gb=Z67872 /gi=1113120 /ug=Bt.5 /len=405
  TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC...................................
  >gnl|UG|Bt#S29311270 Hw_Loin_11_0520_C11 Bos taurus CF-24-HW loin cDNA library Bos taurus cDNA, mRNA sequence /gb=DV796078 /gi=82648993 /ug=Bt.10 /len=1332
  AACCGGGAGCACGCCGTGTACCCGCCAGTGGGGCTTCTGAGGACATGGGGGCCACCGTCA...................................
   
  I would like to know how to extract CDS sequences from them? Or a Perl program?
   
  Thank you for your reply and help.
   
  Sincerely yours,
  Best wishes,
  Harry 




       
---------------------------------
 @yahoo.cn ??????????????????????????


From bix at sendu.me.uk  Fri Sep 21 11:28:30 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 21 Sep 2007 16:28:30 +0100
Subject: [Bioperl-l] Help for extracting CDS sequences from FASTA form
In-Reply-To: <815154.22486.qm@web15901.mail.cnb.yahoo.com>
References: <815154.22486.qm@web15901.mail.cnb.yahoo.com>
Message-ID: <46F3E31E.2010606@sendu.me.uk>

sheng zhao wrote:
> >gnl|UG|Bt#S37443275 [snip] /gb=BC133480 /gi=126717494 /ug=Bt.3 /len=572
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGC
[snip]
> I would like to know how to extract CDS sequences from them? Or a Perl program?

Where did you get the fasta sequences from? It would be easiest to go to 
the source that originally generated them and get it to give you the CDS 
coordinates as well.

Failing that you can get them from the NCBI database using the gb or gi ids.

Someone else will be along to give you the Bioperl code to do that, I'm 
sure :)


From harryzs1981 at yahoo.com.cn  Fri Sep 21 12:30:45 2007
From: harryzs1981 at yahoo.com.cn (sheng zhao)
Date: Sat, 22 Sep 2007 00:30:45 +0800 (CST)
Subject: [Bioperl-l]  Help for extracting CDS sequences from FASTA form
Message-ID: <352861.19969.qm@web15909.mail.cnb.yahoo.com>

Dear sir:
   
  Thank you for your relp.
   
  I got these sequences from NCBI(ftp.ncbi.nlm.nih.gov/repository/UniGene/Bos_taurus/Bt.seq.uniq.gz).
   
  Would you mind to tell me how to get gb or gi ids from this form?
  Thank you again.
   
  Best wishes.
  Harry
  


Sendu Bala <bix at sendu.me.uk> ??????
    sheng zhao wrote:
> >gnl|UG|Bt#S37443275 [snip] /gb=BC133480 /gi=126717494 /ug=Bt.3 /len=572
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGC
[snip]
> I would like to know how to extract CDS sequences from them? Or a Perl program?

Where did you get the fasta sequences from? It would be easiest to go to 
the source that originally generated them and get it to give you the CDS 
coordinates as well.

Failing that you can get them from the NCBI database using the gb or gi ids.

Someone else will be along to give you the Bioperl code to do that, I'm 
sure :)
   


       
---------------------------------
???????????????????? 


From harryzs1981 at yahoo.com.cn  Fri Sep 21 12:32:21 2007
From: harryzs1981 at yahoo.com.cn (sheng zhao)
Date: Sat, 22 Sep 2007 00:32:21 +0800 (CST)
Subject: [Bioperl-l]
 =?gb2312?q?=BB=D8=B8=B4=A3=BA=20Re:=20=20Help=20for=20extracti?=
 =?gb2312?q?ng=20CDS=20sequences=20from=20FASTA=20form?=
In-Reply-To: <C319614A.FB06%bosborne11@verizon.net>
Message-ID: <548016.71302.qm@web15914.mail.cnb.yahoo.com>

Dear Brian O.:
   
   Thank you for your reple.
  I just want to get CDS sequences (DNA sequence) from them according to the CDS information in the title for each sequence. 
   
  For example, for the first sequence, the information is "complete cds /cds=p(18,452)" .

  Thank you again!
   
  Best wishes!
  Harry



Brian Osborne <bosborne11 at verizon.net> ??????
  Harry,

Do you mean find an ORF starting at the first initiation codon and translate
that? Or some other approach?

Take a look at the translate() method:

http://www.bioperl.org/wiki/Bptutorial.pl#Translating


Brian O.


On 9/21/07 10:40 AM, "sheng zhao" wrote:

> Dear all:
> I have got a set of DAN sequences in FASTA form as following:
> 
>> gnl|UG|Bt#S37443275 Bos taurus cathelicidin 4, mRNA (cDNA clone MGC:157131
>> IMAGE:8442308), complete cds /cds=p(18,452) /gb=BC133480 /gi=126717494
>> /ug=Bt.3 /len=572
> 
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................
> ................
>> gnl|UG|Bt#S11932596 B.taurus mRNA for interleukin-5 /cds=p(1,405) /gb=Z67872
>> /gi=1113120 /ug=Bt.5 /len=405
> 
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................
> .................
>> gnl|UG|Bt#S29311270 Hw_Loin_11_0520_C11 Bos taurus CF-24-HW loin cDNA library
>> Bos taurus cDNA, mRNA sequence /gb=DV796078 /gi=82648993 /ug=Bt.10 /len=1332
> 
> AACCGGGAGCACGCCGTGTACCCGCCAGTGGGGCTTCTGAGGACATGGGGGCCACCGTCA..................
> .................
> 
> I would like to know how to extract CDS sequences from them? Or a Perl
> program?
> 
> Thank you for your reply and help.
> 
> Sincerely yours,
> Best wishes,
> Harry 
> 
> 
> 
> 
> 
> ---------------------------------
> @yahoo.cn ??????????????????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




       
---------------------------------
???????????????????? 


From bosborne11 at verizon.net  Fri Sep 21 11:53:46 2007
From: bosborne11 at verizon.net (Brian Osborne)
Date: Fri, 21 Sep 2007 11:53:46 -0400
Subject: [Bioperl-l] Help for extracting CDS sequences from FASTA form
In-Reply-To: <815154.22486.qm@web15901.mail.cnb.yahoo.com>
Message-ID: <C319614A.FB06%bosborne11@verizon.net>

Harry,

Do you mean find an ORF starting at the first initiation codon and translate
that? Or some other approach?

Take a look at the translate() method:

http://www.bioperl.org/wiki/Bptutorial.pl#Translating


Brian O.


On 9/21/07 10:40 AM, "sheng zhao" <harryzs1981 at yahoo.com.cn> wrote:

>               Dear all:
> I have got a set of DAN sequences in FASTA form as following:
>    
>> gnl|UG|Bt#S37443275 Bos taurus cathelicidin 4, mRNA (cDNA clone MGC:157131
>> IMAGE:8442308), complete cds /cds=p(18,452) /gb=BC133480 /gi=126717494
>> /ug=Bt.3 /len=572
>   
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................
> ................
>> gnl|UG|Bt#S11932596 B.taurus mRNA for interleukin-5 /cds=p(1,405) /gb=Z67872
>> /gi=1113120 /ug=Bt.5 /len=405
>   
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................
> .................
>> gnl|UG|Bt#S29311270 Hw_Loin_11_0520_C11 Bos taurus CF-24-HW loin cDNA library
>> Bos taurus cDNA, mRNA sequence /gb=DV796078 /gi=82648993 /ug=Bt.10 /len=1332
>   
> AACCGGGAGCACGCCGTGTACCCGCCAGTGGGGCTTCTGAGGACATGGGGGCCACCGTCA..................
> .................
>    
>   I would like to know how to extract CDS sequences from them? Or a Perl
> program?
>    
>   Thank you for your reply and help.
>    
>   Sincerely yours,
>   Best wishes,
>   Harry 
> 
> 
> 
> 
>        
> ---------------------------------
>  @yahoo.cn ??????????????????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l





From florent.angly at gmail.com  Sat Sep 22 01:02:28 2007
From: florent.angly at gmail.com (Florent Angly)
Date: Fri, 21 Sep 2007 22:02:28 -0700
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
Message-ID: <46F4A1E4.7020002@gmail.com>

Hi,
I need to quantify how good some overlaps in contigs are. I have 
extracted the alignment of the overlapping region and only need to score 
it. I noticed the Bio::Tools::dpAlign has a scoring function.
Is it the right tool for the right tool? Is there anything else?
Thank you,
Florent


From florent.angly at gmail.com  Sat Sep 22 21:41:40 2007
From: florent.angly at gmail.com (Florent Angly)
Date: Sat, 22 Sep 2007 18:41:40 -0700
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <46F4A1E4.7020002@gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com>
Message-ID: <46F5C454.3050005@gmail.com>

Eventually, I gave Bio::Tools::dpAlign a try. I had no luck running it 
when installing its dependency, bioperl-ext v1.4 or v1.5.1. However all 
the tests passed when installing the CVS version.
So finally, here I am trying to score my alignments. For alignments of 2 
small sequences, it works, but as soon as the sequences get bigger than 
a few dozen nucleotides, it crashes:
Segmentation fault (core dumped)

I did not find any help in the documentation...

Can I fix this? Is this a bug?

Thanks for your help,

Florent

Florent Angly wrote:
> Hi,
> I need to quantify how good some overlaps in contigs are. I have 
> extracted the alignment of the overlapping region and only need to 
> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
> Is it the right tool for the right tool? Is there anything else?
> Thank you,
> Florent
>



From bioperl-list at superfrink.net  Sun Sep 23 12:21:44 2007
From: bioperl-list at superfrink.net (Chad Clark)
Date: Sun, 23 Sep 2007 10:21:44 -0600 (MDT)
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <46F5C454.3050005@gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
	<46EFBA0E.4030104@sheffield.ac.uk>
	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
Message-ID: <Pine.LNX.4.64.0709231013340.21280@gurchecyrohssnyb.arg>

On Sat, 22 Sep 2007, Florent Angly wrote:

> So finally, here I am trying to score my alignments. For alignments of 2
> small sequences, it works, but as soon as the sequences get bigger than
> a few dozen nucleotides, it crashes:
> Segmentation fault (core dumped)

In my experience if a program runs on small sets of data and segfaults on 
larger sets it is likely running out of stack space.  You can try changing 
the allowed stack size with "ulimit" before running your program and see 
if it works with more data.

   [chad at water ~]$ ulimit -a | grep -i stack
   stack size              (kbytes, -s) 10240
   [chad at water ~]$ ulimit -s 40960
   [chad at water ~]$ ulimit -a | grep -i stack
   stack size              (kbytes, -s) 40960

I don't know the code / algorithm in question but it might require 
significantly more stack space as the data set grows in size so this 
change might not help enough.

Good luck,
Chad


From bix at sendu.me.uk  Mon Sep 24 05:35:39 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Mon, 24 Sep 2007 10:35:39 +0100
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
Message-ID: <46F784EB.9050507@sendu.me.uk>

Hi,

I'm finding that when writing GFF files the version header line gets 
printed out twice. This is because:

sub _initialize {
   # [snip]

   if ($arg{-file} =~ /^>.*/ ) {
     $self->_print("##gff-version " . $self->version() . "\n");
   }
   else {
     my $directive;
     while(($directive = $self->_readline()) && ( $directive =~ /^##/ || 
$directive =~ /^>/)){
       $self->_handle_directive($directive);
     }
     $self->_pushback($directive);
   }

   if ($arg{-file} =~ /^>.*/ ) {
     $self->_print("##gff-version " . $self->version() . "\n");
   }

   # [snip]
}

Does it make sense for if ($arg{-file} =~ /^>.*/ ) to appear twice like 
that? If not, which one should be removed? The independent one, or the 
if/else one?


Cheers,
Sendu.


From awitney at sgul.ac.uk  Mon Sep 24 08:40:07 2007
From: awitney at sgul.ac.uk (Adam Witney)
Date: Mon, 24 Sep 2007 13:40:07 +0100
Subject: [Bioperl-l] Minor docs discrepancy?
In-Reply-To: <E8CEAD6A-9F6B-43B8-94A3-95A1C96E872D@duke.edu>
Message-ID: <C31D6EB7.1A1BD%awitney@sgul.ac.uk>


Hi,

I was just going through the BlastHSP.pm POD and lines 23-24 say

"For Bio::SearchIO BLAST parsing usage examples, see the
"examples/search-blast" directory of the Bioperl distribution."

However in the distribution (1.4 and 1.5.2_102) it looks to be
"examples/searchio"

Is this in need of updating, or am I looking in the wrong place?

Thanks

Adam




From cjfields at uiuc.edu  Mon Sep 24 09:09:46 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 08:09:46 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <46F784EB.9050507@sendu.me.uk>
References: <46F784EB.9050507@sendu.me.uk>
Message-ID: <7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>

It looks like the first is a cut-and-paste revision of the second, so  
I would say the second independent if block is redundant.

Should we be printing output in _initialize()?  I would think any  
output would be handled in a write_* method of some sort and not in a  
common method used for initializing both input and output stream  
data.  What happens here if you use '-fh' and want output redirected  
to STDOUT?

chris

On Sep 24, 2007, at 4:35 AM, Sendu Bala wrote:

> Hi,
>
> I'm finding that when writing GFF files the version header line gets
> printed out twice. This is because:
>
> sub _initialize {
>    # [snip]
>
>    if ($arg{-file} =~ /^>.*/ ) {
>      $self->_print("##gff-version " . $self->version() . "\n");
>    }
>    else {
>      my $directive;
>      while(($directive = $self->_readline()) && ( $directive =~ / 
> ^##/ ||
> $directive =~ /^>/)){
>        $self->_handle_directive($directive);
>      }
>      $self->_pushback($directive);
>    }
>
>    if ($arg{-file} =~ /^>.*/ ) {
>      $self->_print("##gff-version " . $self->version() . "\n");
>    }
>
>    # [snip]
> }
>
> Does it make sense for if ($arg{-file} =~ /^>.*/ ) to appear twice  
> like
> that? If not, which one should be removed? The independent one, or the
> if/else one?
>
>
> Cheers,
> Sendu.



From cjfields at uiuc.edu  Mon Sep 24 09:13:53 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 08:13:53 -0500
Subject: [Bioperl-l] Minor docs discrepancy?
In-Reply-To: <C31D6EB7.1A1BD%awitney@sgul.ac.uk>
References: <C31D6EB7.1A1BD%awitney@sgul.ac.uk>
Message-ID: <B692F0F5-7CA3-4D32-B588-78087B25D193@uiuc.edu>

I have updated that in CVS.  Thanks for pointing that out!

chris

On Sep 24, 2007, at 7:40 AM, Adam Witney wrote:

>
> Hi,
>
> I was just going through the BlastHSP.pm POD and lines 23-24 say
>
> "For Bio::SearchIO BLAST parsing usage examples, see the
> "examples/search-blast" directory of the Bioperl distribution."
>
> However in the distribution (1.4 and 1.5.2_102) it looks to be
> "examples/searchio"
>
> Is this in need of updating, or am I looking in the wrong place?
>
> Thanks
>
> Adam


From bix at sendu.me.uk  Mon Sep 24 09:20:33 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Mon, 24 Sep 2007 14:20:33 +0100
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
Message-ID: <46F7B9A1.9080206@sendu.me.uk>

Chris Fields wrote:
> It looks like the first is a cut-and-paste revision of the second, so I 
> would say the second independent if block is redundant.

I agree. I'll make that change.


> Should we be printing output in _initialize()?  I would think any output 
> would be handled in a write_* method of some sort and not in a common 
> method used for initializing both input and output stream data.  What 
> happens here if you use '-fh' and want output redirected to STDOUT?

I think the problem is that the method is write_feature(), which can be 
called many times for a single output file, but the version should only 
be printed once at the very start of the file.

I suppose it just needs better capturing of when we're intending to 
write... Hmmm... didn't I fix a method related to that?...

Yes, yes I did:
Bio::Root::IO->mode
;)

Any objections to me replacing the if clause with one using that method?


From cjfields at uiuc.edu  Mon Sep 24 09:35:22 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 08:35:22 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <46F7B9A1.9080206@sendu.me.uk>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
Message-ID: <EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>


On Sep 24, 2007, at 8:20 AM, Sendu Bala wrote:

> Chris Fields wrote:
>> It looks like the first is a cut-and-paste revision of the second,  
>> so I would say the second independent if block is redundant.
>
> I agree. I'll make that change.
>
>
>> Should we be printing output in _initialize()?  I would think any  
>> output would be handled in a write_* method of some sort and not  
>> in a common method used for initializing both input and output  
>> stream data.  What happens here if you use '-fh' and want output  
>> redirected to STDOUT?
>
> I think the problem is that the method is write_feature(), which  
> can be called many times for a single output file, but the version  
> should only be printed once at the very start of the file.
>
> I suppose it just needs better capturing of when we're intending to  
> write... Hmmm... didn't I fix a method related to that?...
>
> Yes, yes I did:
> Bio::Root::IO->mode
> ;)
>
> Any objections to me replacing the if clause with one using that  
> method?

I think that'll work fine.  The other option would be call a  
print_gff_header() function within write_feature() with the intent to  
print the header only once, using a flag or similar:

if (!$self->header_printed) {
     $self->print_gff_header;
     $self->header_printed(1);
}

chris


From hlapp at gmx.net  Mon Sep 24 13:41:34 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Mon, 24 Sep 2007 13:41:34 -0400
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
Message-ID: <234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>

I'd lean toward this or a similar approach too. Writing stuff out in  
the constructor doesn't feel like the best design.

	-hilmar

On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:

>
> On Sep 24, 2007, at 8:20 AM, Sendu Bala wrote:
>
>> Chris Fields wrote:
>>> It looks like the first is a cut-and-paste revision of the second,
>>> so I would say the second independent if block is redundant.
>>
>> I agree. I'll make that change.
>>
>>
>>> Should we be printing output in _initialize()?  I would think any
>>> output would be handled in a write_* method of some sort and not
>>> in a common method used for initializing both input and output
>>> stream data.  What happens here if you use '-fh' and want output
>>> redirected to STDOUT?
>>
>> I think the problem is that the method is write_feature(), which
>> can be called many times for a single output file, but the version
>> should only be printed once at the very start of the file.
>>
>> I suppose it just needs better capturing of when we're intending to
>> write... Hmmm... didn't I fix a method related to that?...
>>
>> Yes, yes I did:
>> Bio::Root::IO->mode
>> ;)
>>
>> Any objections to me replacing the if clause with one using that
>> method?
>
> I think that'll work fine.  The other option would be call a
> print_gff_header() function within write_feature() with the intent to
> print the header only once, using a flag or similar:
>
> if (!$self->header_printed) {
>      $self->print_gff_header;
>      $self->header_printed(1);
> }
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From cjfields at uiuc.edu  Mon Sep 24 14:11:47 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 13:11:47 -0500
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <46F5C454.3050005@gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
Message-ID: <9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>

As Chad mentioned it could be a stack issue, but it might be worth  
filing a bug on.  I will note that bioperl-ext has seen very little  
use in the last few years, so don't expect it to be fixed unless you  
can contact the ext module author.

chris

On Sep 22, 2007, at 8:41 PM, Florent Angly wrote:

> Eventually, I gave Bio::Tools::dpAlign a try. I had no luck running it
> when installing its dependency, bioperl-ext v1.4 or v1.5.1. However  
> all
> the tests passed when installing the CVS version.
> So finally, here I am trying to score my alignments. For alignments  
> of 2
> small sequences, it works, but as soon as the sequences get bigger  
> than
> a few dozen nucleotides, it crashes:
> Segmentation fault (core dumped)
>
> I did not find any help in the documentation...
>
> Can I fix this? Is this a bug?
>
> Thanks for your help,
>
> Florent
>
> Florent Angly wrote:
>> Hi,
>> I need to quantify how good some overlaps in contigs are. I have
>> extracted the alignment of the overlapping region and only need to
>> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
>> Is it the right tool for the right tool? Is there anything else?
>> Thank you,
>> Florent
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From florent.angly at gmail.com  Mon Sep 24 15:07:35 2007
From: florent.angly at gmail.com (Florent Angly)
Date: Mon, 24 Sep 2007 12:07:35 -0700
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
	<9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>
Message-ID: <46F80AF7.4090109@gmail.com>

I see... Thanks for the replies Chad and Chris. Then I have two more 
questions!
1/ Do you know how to get a core dump that could help debug my 
segmentation fault? I have produced dumps of binary C programs before 
with gdb. I have used the Perl debugger for Perl scripts. But how to 
deal with C functions called by Perl?
2/ Is there an easier method to calculate an alignment score in BioPerl 
than using Bio::Tools::dpAlign? I didn't seem to locate something else, 
but who knows...
I have workarounds for quantifying the quality of the overlap, so 
calculating a score is not critical for me (though I believe this would 
be the most accurate/adapted method).
Florent

Chris Fields wrote:
> As Chad mentioned it could be a stack issue, but it might be worth 
> filing a bug on.  I will note that bioperl-ext has seen very little 
> use in the last few years, so don't expect it to be fixed unless you 
> can contact the ext module author.
>
> chris
>
> On Sep 22, 2007, at 8:41 PM, Florent Angly wrote:
>
>> Eventually, I gave Bio::Tools::dpAlign a try. I had no luck running it
>> when installing its dependency, bioperl-ext v1.4 or v1.5.1. However all
>> the tests passed when installing the CVS version.
>> So finally, here I am trying to score my alignments. For alignments of 2
>> small sequences, it works, but as soon as the sequences get bigger than
>> a few dozen nucleotides, it crashes:
>> Segmentation fault (core dumped)
>>
>> I did not find any help in the documentation...
>>
>> Can I fix this? Is this a bug?
>>
>> Thanks for your help,
>>
>> Florent
>>
>> Florent Angly wrote:
>>> Hi,
>>> I need to quantify how good some overlaps in contigs are. I have
>>> extracted the alignment of the overlapping region and only need to
>>> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
>>> Is it the right tool for the right tool? Is there anything else?
>>> Thank you,
>>> Florent
>>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
>



From cjfields at uiuc.edu  Mon Sep 24 15:26:46 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 14:26:46 -0500
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <46F80AF7.4090109@gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
	<9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>
	<46F80AF7.4090109@gmail.com>
Message-ID: <0C6508FB-4765-4E4E-AFD1-6E5BFE8F9368@uiuc.edu>

I suppose if you can find a way to export the contig data into a  
Bio::SimpleAlign you look at the methods in  
Bio::Align::DNAStatistics.  SimpleAlign also has some builtin methods  
like average_percentage_identity, percentage_identity, etc, which may  
be worth a look.

chris

On Sep 24, 2007, at 2:07 PM, Florent Angly wrote:

> I see... Thanks for the replies Chad and Chris. Then I have two more
> questions!
> 1/ Do you know how to get a core dump that could help debug my
> segmentation fault? I have produced dumps of binary C programs before
> with gdb. I have used the Perl debugger for Perl scripts. But how to
> deal with C functions called by Perl?
> 2/ Is there an easier method to calculate an alignment score in  
> BioPerl
> than using Bio::Tools::dpAlign? I didn't seem to locate something  
> else,
> but who knows...
> I have workarounds for quantifying the quality of the overlap, so
> calculating a score is not critical for me (though I believe this  
> would
> be the most accurate/adapted method).
> Florent
>
> Chris Fields wrote:
>> As Chad mentioned it could be a stack issue, but it might be worth
>> filing a bug on.  I will note that bioperl-ext has seen very little
>> use in the last few years, so don't expect it to be fixed unless you
>> can contact the ext module author.
>>
>> chris
>>
>> On Sep 22, 2007, at 8:41 PM, Florent Angly wrote:
>>
>>> Eventually, I gave Bio::Tools::dpAlign a try. I had no luck  
>>> running it
>>> when installing its dependency, bioperl-ext v1.4 or v1.5.1.  
>>> However all
>>> the tests passed when installing the CVS version.
>>> So finally, here I am trying to score my alignments. For  
>>> alignments of 2
>>> small sequences, it works, but as soon as the sequences get  
>>> bigger than
>>> a few dozen nucleotides, it crashes:
>>> Segmentation fault (core dumped)
>>>
>>> I did not find any help in the documentation...
>>>
>>> Can I fix this? Is this a bug?
>>>
>>> Thanks for your help,
>>>
>>> Florent
>>>
>>> Florent Angly wrote:
>>>> Hi,
>>>> I need to quantify how good some overlaps in contigs are. I have
>>>> extracted the alignment of the overlapping region and only need to
>>>> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
>>>> Is it the right tool for the right tool? Is there anything else?
>>>> Thank you,
>>>> Florent
>>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From florent.angly at gmail.com  Mon Sep 24 15:46:36 2007
From: florent.angly at gmail.com (Florent Angly)
Date: Mon, 24 Sep 2007 12:46:36 -0700
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <0C6508FB-4765-4E4E-AFD1-6E5BFE8F9368@uiuc.edu>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
	<9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>
	<46F80AF7.4090109@gmail.com>
	<0C6508FB-4765-4E4E-AFD1-6E5BFE8F9368@uiuc.edu>
Message-ID: <46F8141C.8010507@gmail.com>

Yes, right! That's the methods I use as my workarounds. =)
Thanks for suggesting.
Florent

Chris Fields wrote:
> I suppose if you can find a way to export the contig data into a 
> Bio::SimpleAlign you look at the methods in 
> Bio::Align::DNAStatistics.  SimpleAlign also has some builtin methods 
> like average_percentage_identity, percentage_identity, etc, which may 
> be worth a look.
>
> chris
>
> On Sep 24, 2007, at 2:07 PM, Florent Angly wrote:
>
>> I see... Thanks for the replies Chad and Chris. Then I have two more
>> questions!
>> 1/ Do you know how to get a core dump that could help debug my
>> segmentation fault? I have produced dumps of binary C programs before
>> with gdb. I have used the Perl debugger for Perl scripts. But how to
>> deal with C functions called by Perl?
>> 2/ Is there an easier method to calculate an alignment score in BioPerl
>> than using Bio::Tools::dpAlign? I didn't seem to locate something else,
>> but who knows...
>> I have workarounds for quantifying the quality of the overlap, so
>> calculating a score is not critical for me (though I believe this would
>> be the most accurate/adapted method).
>> Florent
>>
>> Chris Fields wrote:
>>> As Chad mentioned it could be a stack issue, but it might be worth
>>> filing a bug on.  I will note that bioperl-ext has seen very little
>>> use in the last few years, so don't expect it to be fixed unless you
>>> can contact the ext module author.
>>>
>>> chris
>>>
>>> On Sep 22, 2007, at 8:41 PM, Florent Angly wrote:
>>>
>>>> Eventually, I gave Bio::Tools::dpAlign a try. I had no luck running it
>>>> when installing its dependency, bioperl-ext v1.4 or v1.5.1. However 
>>>> all
>>>> the tests passed when installing the CVS version.
>>>> So finally, here I am trying to score my alignments. For alignments 
>>>> of 2
>>>> small sequences, it works, but as soon as the sequences get bigger 
>>>> than
>>>> a few dozen nucleotides, it crashes:
>>>> Segmentation fault (core dumped)
>>>>
>>>> I did not find any help in the documentation...
>>>>
>>>> Can I fix this? Is this a bug?
>>>>
>>>> Thanks for your help,
>>>>
>>>> Florent
>>>>
>>>> Florent Angly wrote:
>>>>> Hi,
>>>>> I need to quantify how good some overlaps in contigs are. I have
>>>>> extracted the alignment of the overlapping region and only need to
>>>>> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
>>>>> Is it the right tool for the right tool? Is there anything else?
>>>>> Thank you,
>>>>> Florent
>>>>>
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>> Christopher Fields
>>> Postdoctoral Researcher
>>> Lab of Dr. Robert Switzer
>>> Dept of Biochemistry
>>> University of Illinois Urbana-Champaign
>>>
>>>
>>>
>>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
>



From bix at sendu.me.uk  Tue Sep 25 06:00:20 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 25 Sep 2007 11:00:20 +0100
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
Message-ID: <46F8DC34.6020908@sendu.me.uk>

Hilmar Lapp wrote:
> On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:
>> I think that'll work fine.  The other option would be call a
>> print_gff_header() function within write_feature() with the intent to
>> print the header only once, using a flag or similar:
>>
>> if (!$self->header_printed) {
>>      $self->print_gff_header;
>>      $self->header_printed(1);
>> }
 >
> I'd lean toward this or a similar approach too. Writing stuff out in the 
> constructor doesn't feel like the best design.

I'd argue that the alternative is just inefficient with no compensating 
benefit. You have something that must only be done once, and a method 
(_initialize) that is only called once. The constructor is used to set 
up the file, getting it into a state ready to add features. This 
involves opening it for writing with the correct filename and setting 
the desired GFF version. Why wouldn't it also output what ever else was 
necessary it initialize the file?

Also, what do we expect should happen when we use Bioperl to create a 
GFF file and don't write any features to it? Should it be an empty file, 
or should it contain whatever GFF information the user had managed to 
supply (the version)?


From cjfields at uiuc.edu  Tue Sep 25 10:14:04 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 25 Sep 2007 09:14:04 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <46F8DC34.6020908@sendu.me.uk>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
Message-ID: <22FB7AE5-2E1C-450C-A48C-6014CC5EB786@uiuc.edu>


On Sep 25, 2007, at 5:00 AM, Sendu Bala wrote:

> Hilmar Lapp wrote:
>> On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:
>>> I think that'll work fine.  The other option would be call a
>>> print_gff_header() function within write_feature() with the  
>>> intent to
>>> print the header only once, using a flag or similar:
>>>
>>> if (!$self->header_printed) {
>>>      $self->print_gff_header;
>>>      $self->header_printed(1);
>>> }
>>
>> I'd lean toward this or a similar approach too. Writing stuff out  
>> in the
>> constructor doesn't feel like the best design.
>
> I'd argue that the alternative is just inefficient with no  
> compensating
> benefit. You have something that must only be done once, and a method
> (_initialize) that is only called once. The constructor is used to set
> up the file, getting it into a state ready to add features. This
> involves opening it for writing with the correct filename and setting
> the desired GFF version. Why wouldn't it also output what ever else  
> was
> necessary it initialize the file?

It's great to have someone picking this up, so anything that works is  
fine by me, to tell the truth.  I'll state my piece, though, and  
stand out of the way.

In my opinion there are a couple of compensating benefits.  One is  
long-term maintenance, primarily being all calls to generate output  
are contained within the write_features method and are thus easier to  
find and more maintainable.  The logic goes, if there were a bug I  
would expect to find output in a write_* method or a method called  
from within write_* method, not in the constructor or something  
called from the constructor, like _initialize().  I've always been  
told the constructor in any OO language is typically limited to  
setting state data and behavior, not generating new data (i.e.  
generating output).

Related to that, the other benefit is expected behavior when calling  
a method.  I don't know of cases in other IO classes in Bioperl which  
generate output when a new() instance is created; output is expected  
specifically when calling a particular write_* method.  Therefore I  
wouldn't expect any output be generated until write_feature() were  
called (or calling similarly named methods where output would be  
expected, like a print_* method).

Saying all that, I'm probably not the best one to bang the 'best  
practices' drum right now as I haven't had time to finish up several  
modules I've been working on!  Speaking of (going back to work...)

> Also, what do we expect should happen when we use Bioperl to create a
> GFF file and don't write any features to it? Should it be an empty  
> file,
> or should it contain whatever GFF information the user had managed to
> supply (the version)?

As mentioned above, I would expect no output generated at all unless  
explicitly calling write_features(), just like any of the other IOs;  
the header info would be generated then.  BioPerl has traditionally  
been for whatever works though, which is fine by me.

chris


From forrest_zhang at 163.com  Thu Sep 27 03:41:44 2007
From: forrest_zhang at 163.com (Forrest)
Date: Thu, 27 Sep 2007 15:41:44 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
Message-ID: <000501c800d9$dc9c8e90$95d5abb0$@com>

Hi, all
    I install the biosql, and bioperl-db. I want to import swissport data.
But the programe show some error as below:
============================================================================
===============================================
>perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
-namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
Loading /home/forrest/uniprot/uniprot_sprot.dat ...
Could not store Q6DAH5:
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: The supplied lineage does not start near 'Erwinia carotovora subsp.
atroseptica' (I was supplied 'Erwinia carotovora subsp. | Pectobacterium |
Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
Proteobacteria | Bacteria')
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
STACK: Bio::Species::classification
/usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:552
STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:1305
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:973
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:852
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:182
STACK: Bio::DB::Persistent::PersistentObject::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:244
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:169
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:251
STACK: Bio::DB::Persistent::PersistentObject::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:271
STACK: load_seqdatabase.pl:620
-----------------------------------------------------------

 at load_seqdatabase.pl line 633
============================================================================
===============================================

How can I solve it, please help me, Thank you.

Thanks
Forrest zhang





From bix at sendu.me.uk  Thu Sep 27 04:38:00 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 27 Sep 2007 09:38:00 +0100
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000501c800d9$dc9c8e90$95d5abb0$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
Message-ID: <46FB6BE8.9050203@sendu.me.uk>

Forrest wrote:
> Hi, all
>     I install the biosql, and bioperl-db. I want to import swissport data.
> But the programe show some error as below:
> ============================================================================
> ===============================================
>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
> Could not store Q6DAH5:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: The supplied lineage does not start near 'Erwinia carotovora subsp.
> atroseptica' (I was supplied 'Erwinia carotovora subsp. | Pectobacterium |
> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
> Proteobacteria | Bacteria')

From:
OS   Erwinia carotovora subsp. atroseptica (Pectobacterium atrosepticum).
OC   Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales;
OC   Enterobacteriaceae; Pectobacterium.

I'm guessing some oddity in the Swissprot parser where in one place it 
truncates the OS to the first '.', and in another it doesn't?

Can someone confirm this with CVS versions of bioperl-live and -db in 
case Chris already fixed it in recent parser changes?


From cjfields at uiuc.edu  Thu Sep 27 08:47:00 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 07:47:00 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <46FB6BE8.9050203@sendu.me.uk>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<46FB6BE8.9050203@sendu.me.uk>
Message-ID: <AB3D3A39-0B66-4C22-9EE1-98429A958598@uiuc.edu>


On Sep 27, 2007, at 3:38 AM, Sendu Bala wrote:

> Forrest wrote:
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import  
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora  
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |  
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>
> From:
> OS   Erwinia carotovora subsp. atroseptica (Pectobacterium  
> atrosepticum).
> OC   Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales;
> OC   Enterobacteriaceae; Pectobacterium.
>
> I'm guessing some oddity in the Swissprot parser where in one place it
> truncates the OS to the first '.', and in another it doesn't?
>
> Can someone confirm this with CVS versions of bioperl-live and -db in
> case Chris already fixed it in recent parser changes?

It looks suspiciously like he isn't using bioperl-live code (I  
changed the exception to a warning a while back, and I think the '.'  
truncation was fixed).  This is still an outstanding issue with  
bioperl-db which hasn't been fully fixed yet, though; we may have to  
move the priority up on this one.

chris


From bix at sendu.me.uk  Thu Sep 27 09:47:06 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 27 Sep 2007 14:47:06 +0100
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
Message-ID: <46FBB45A.10505@sendu.me.uk>

I want to create a Bio::SeqFeature::Annotated object where the 'type' is 
'conserved_region'.

I got the idea that 'conserved_region' might be ok from here:
http://song.sourceforge.net/SOterm_tables.html#SO:0000330

However, this doesn't work since:

------------- EXCEPTION -------------
MSG: couldn't find a SOFA term matching type 'conserved_region'.
STACK Bio::SeqFeature::Annotated::type 
/data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/Annotated.pm:371
[snip]


I'm guessing Bio::Ontology::OntologyStore is getting its allowed SOFA 
terms from:
http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition


I don't know much about this area. Can someone offer a little guidance 
as to what the significance of these two different files is, why they 
don't contain the same terms, and why I can't use 'conserved_region'?

What's the closest alternative term?


From cain.cshl at gmail.com  Thu Sep 27 10:20:50 2007
From: cain.cshl at gmail.com (Scott Cain)
Date: Thu, 27 Sep 2007 10:20:50 -0400
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
In-Reply-To: <46FBB45A.10505@sendu.me.uk>
References: <46FBB45A.10505@sendu.me.uk>
Message-ID: <1190902850.12078.26.camel@localhost.localdomain>

Hi Sendu,

I believe that BSFA uses SOFA but the growing consensus is that SOFA
should be pitched and all of SO should be used where SOFA was being
used.  I also suspect that BioPerl is using a very old version of SOFA,
since at the time BSFA was written, BioPerl couldn't parse OBO files
(can it now?), so it was using the very old file format (whose name I
can't even remember now) and that file hasn't been updated in a long
time (which is why it isn't finding conserved_region).

If BioPerl can parse OBO files, we should switch BSFA to validate
against 

http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo

Scott


On Thu, 2007-09-27 at 14:47 +0100, Sendu Bala wrote:
> I want to create a Bio::SeqFeature::Annotated object where the 'type' is 
> 'conserved_region'.
> 
> I got the idea that 'conserved_region' might be ok from here:
> http://song.sourceforge.net/SOterm_tables.html#SO:0000330
> 
> However, this doesn't work since:
> 
> ------------- EXCEPTION -------------
> MSG: couldn't find a SOFA term matching type 'conserved_region'.
> STACK Bio::SeqFeature::Annotated::type 
> /data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/Annotated.pm:371
> [snip]
> 
> 
> I'm guessing Bio::Ontology::OntologyStore is getting its allowed SOFA 
> terms from:
> http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition
> 
> 
> I don't know much about this area. Can someone offer a little guidance 
> as to what the significance of these two different files is, why they 
> don't contain the same terms, and why I can't use 'conserved_region'?
> 
> What's the closest alternative term?
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain at cshl.edu
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory



From cjfields at uiuc.edu  Thu Sep 27 11:25:13 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 10:25:13 -0500
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
In-Reply-To: <1190902850.12078.26.camel@localhost.localdomain>
References: <46FBB45A.10505@sendu.me.uk>
	<1190902850.12078.26.camel@localhost.localdomain>
Message-ID: <29DFE331-33F5-47ED-9A6D-AF488E5F0689@uiuc.edu>


On Sep 27, 2007, at 9:20 AM, Scott Cain wrote:

> Hi Sendu,
>
> I believe that BSFA uses SOFA but the growing consensus is that SOFA
> should be pitched and all of SO should be used where SOFA was being
> used.  I also suspect that BioPerl is using a very old version of  
> SOFA,
> since at the time BSFA was written, BioPerl couldn't parse OBO files
> (can it now?), so it was using the very old file format (whose name I
> can't even remember now) and that file hasn't been updated in a long
> time (which is why it isn't finding conserved_region).
>
> If BioPerl can parse OBO files, we should switch BSFA to validate
> against
>
> http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo
>
> Scott

I agree, this would definitely be for the best.  BioPerl can parse  
obo; not sure how often it's used or what the tests are like, but  
switching to SO should give it a good workout and might wring out any  
issues.

chris

> On Thu, 2007-09-27 at 14:47 +0100, Sendu Bala wrote:
>> I want to create a Bio::SeqFeature::Annotated object where the  
>> 'type' is
>> 'conserved_region'.
>>
>> I got the idea that 'conserved_region' might be ok from here:
>> http://song.sourceforge.net/SOterm_tables.html#SO:0000330
>>
>> However, this doesn't work since:
>>
>> ------------- EXCEPTION -------------
>> MSG: couldn't find a SOFA term matching type 'conserved_region'.
>> STACK Bio::SeqFeature::Annotated::type
>> /data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/ 
>> Annotated.pm:371
>> [snip]
>>
>>
>> I'm guessing Bio::Ontology::OntologyStore is getting its allowed SOFA
>> terms from:
>> http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition
>>
>>
>> I don't know much about this area. Can someone offer a little  
>> guidance
>> as to what the significance of these two different files is, why they
>> don't contain the same terms, and why I can't use 'conserved_region'?
>>
>> What's the closest alternative term?
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> -- 
> ---------------------------------------------------------------------- 
> --
> Scott Cain, Ph. D.                                          
> cain at cshl.edu
> GMOD Coordinator (http://www.gmod.org/)                      
> 216-392-3087
> Cold Spring Harbor Laboratory
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Research Associate
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From cain.cshl at gmail.com  Thu Sep 27 11:34:57 2007
From: cain.cshl at gmail.com (Scott Cain)
Date: Thu, 27 Sep 2007 11:34:57 -0400
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
In-Reply-To: <29DFE331-33F5-47ED-9A6D-AF488E5F0689@uiuc.edu>
References: <46FBB45A.10505@sendu.me.uk>
	<1190902850.12078.26.camel@localhost.localdomain>
	<29DFE331-33F5-47ED-9A6D-AF488E5F0689@uiuc.edu>
Message-ID: <1190907297.12078.32.camel@localhost.localdomain>

OK--while I would normal volunteer to do this, I don't think I am going
to have time until after the Genome Informatics and GMOD meetings in
November :-/  If it is still not done then, somebody poke me and remind
me that I said that.

Scott


On Thu, 2007-09-27 at 10:25 -0500, Chris Fields wrote:
> On Sep 27, 2007, at 9:20 AM, Scott Cain wrote:
> 
> > Hi Sendu,
> >
> > I believe that BSFA uses SOFA but the growing consensus is that SOFA
> > should be pitched and all of SO should be used where SOFA was being
> > used.  I also suspect that BioPerl is using a very old version of  
> > SOFA,
> > since at the time BSFA was written, BioPerl couldn't parse OBO files
> > (can it now?), so it was using the very old file format (whose name I
> > can't even remember now) and that file hasn't been updated in a long
> > time (which is why it isn't finding conserved_region).
> >
> > If BioPerl can parse OBO files, we should switch BSFA to validate
> > against
> >
> > http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo
> >
> > Scott
> 
> I agree, this would definitely be for the best.  BioPerl can parse  
> obo; not sure how often it's used or what the tests are like, but  
> switching to SO should give it a good workout and might wring out any  
> issues.
> 
> chris
> 
> > On Thu, 2007-09-27 at 14:47 +0100, Sendu Bala wrote:
> >> I want to create a Bio::SeqFeature::Annotated object where the  
> >> 'type' is
> >> 'conserved_region'.
> >>
> >> I got the idea that 'conserved_region' might be ok from here:
> >> http://song.sourceforge.net/SOterm_tables.html#SO:0000330
> >>
> >> However, this doesn't work since:
> >>
> >> ------------- EXCEPTION -------------
> >> MSG: couldn't find a SOFA term matching type 'conserved_region'.
> >> STACK Bio::SeqFeature::Annotated::type
> >> /data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/ 
> >> Annotated.pm:371
> >> [snip]
> >>
> >>
> >> I'm guessing Bio::Ontology::OntologyStore is getting its allowed SOFA
> >> terms from:
> >> http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition
> >>
> >>
> >> I don't know much about this area. Can someone offer a little  
> >> guidance
> >> as to what the significance of these two different files is, why they
> >> don't contain the same terms, and why I can't use 'conserved_region'?
> >>
> >> What's the closest alternative term?
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > -- 
> > ---------------------------------------------------------------------- 
> > --
> > Scott Cain, Ph. D.                                          
> > cain at cshl.edu
> > GMOD Coordinator (http://www.gmod.org/)                      
> > 216-392-3087
> > Cold Spring Harbor Laboratory
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> Christopher Fields
> Research Associate
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
> 
> 
> 
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   cain.cshl at gmail.com
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory




From cjfields at uiuc.edu  Thu Sep 27 11:43:06 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 10:43:06 -0500
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
In-Reply-To: <1190907297.12078.32.camel@localhost.localdomain>
References: <46FBB45A.10505@sendu.me.uk>
	<1190902850.12078.26.camel@localhost.localdomain>
	<29DFE331-33F5-47ED-9A6D-AF488E5F0689@uiuc.edu>
	<1190907297.12078.32.camel@localhost.localdomain>
Message-ID: <FE3DC3B9-E202-4C92-9618-90D0BF4E3B52@uiuc.edu>

Actually, I just added 'Sequence Ontology OBO' to  
Bio::Ontology::DocumentRegistry and switched BSFA over to use that in  
bioperl-live.  So far it still passes tests checking SO using obo.   
Sendu, does that work or crash-and-burn?

chris

On Sep 27, 2007, at 10:34 AM, Scott Cain wrote:

> OK--while I would normal volunteer to do this, I don't think I am  
> going
> to have time until after the Genome Informatics and GMOD meetings in
> November :-/  If it is still not done then, somebody poke me and  
> remind
> me that I said that.
>
> Scott
>
>
> On Thu, 2007-09-27 at 10:25 -0500, Chris Fields wrote:
>> On Sep 27, 2007, at 9:20 AM, Scott Cain wrote:
>>
>>> Hi Sendu,
>>>
>>> I believe that BSFA uses SOFA but the growing consensus is that SOFA
>>> should be pitched and all of SO should be used where SOFA was being
>>> used.  I also suspect that BioPerl is using a very old version of
>>> SOFA,
>>> since at the time BSFA was written, BioPerl couldn't parse OBO files
>>> (can it now?), so it was using the very old file format (whose  
>>> name I
>>> can't even remember now) and that file hasn't been updated in a long
>>> time (which is why it isn't finding conserved_region).
>>>
>>> If BioPerl can parse OBO files, we should switch BSFA to validate
>>> against
>>>
>>> http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo
>>>
>>> Scott
>>
>> I agree, this would definitely be for the best.  BioPerl can parse
>> obo; not sure how often it's used or what the tests are like, but
>> switching to SO should give it a good workout and might wring out any
>> issues.
>>
>> chris
>>
>>> On Thu, 2007-09-27 at 14:47 +0100, Sendu Bala wrote:
>>>> I want to create a Bio::SeqFeature::Annotated object where the
>>>> 'type' is
>>>> 'conserved_region'.
>>>>
>>>> I got the idea that 'conserved_region' might be ok from here:
>>>> http://song.sourceforge.net/SOterm_tables.html#SO:0000330
>>>>
>>>> However, this doesn't work since:
>>>>
>>>> ------------- EXCEPTION -------------
>>>> MSG: couldn't find a SOFA term matching type 'conserved_region'.
>>>> STACK Bio::SeqFeature::Annotated::type
>>>> /data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/
>>>> Annotated.pm:371
>>>> [snip]
>>>>
>>>>
>>>> I'm guessing Bio::Ontology::OntologyStore is getting its allowed  
>>>> SOFA
>>>> terms from:
>>>> http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition
>>>>
>>>>
>>>> I don't know much about this area. Can someone offer a little
>>>> guidance
>>>> as to what the significance of these two different files is, why  
>>>> they
>>>> don't contain the same terms, and why I can't use  
>>>> 'conserved_region'?
>>>>
>>>> What's the closest alternative term?
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>> -- 
>>> -------------------------------------------------------------------- 
>>> --
>>> --
>>> Scott Cain, Ph. D.
>>> cain at cshl.edu
>>> GMOD Coordinator (http://www.gmod.org/)
>>> 216-392-3087
>>> Cold Spring Harbor Laboratory
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Research Associate
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
> -- 
> ---------------------------------------------------------------------- 
> --
> Scott Cain, Ph. D.                                    
> cain.cshl at gmail.com
> GMOD Coordinator (http://www.gmod.org/)                      
> 216-392-3087
> Cold Spring Harbor Laboratory
>
>

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From hlapp at gmx.net  Thu Sep 27 18:17:16 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu, 27 Sep 2007 18:17:16 -0400
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000501c800d9$dc9c8e90$95d5abb0$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
Message-ID: <2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>

Forrest,

have you preloaded the NCBI taxonomy as suggested in the BioSQL  
installation guidelines? SwissProt format has NCBI taxon IDs, and the  
code will try to use it to look up species and their lineage, rather  
than inserting the lineage from whatever BioPerl parses out of the  
sequence record.

	-hilmar

On Sep 27, 2007, at 3:41 AM, Forrest wrote:

> Hi, all
>     I install the biosql, and bioperl-db. I want to import  
> swissport data.
> But the programe show some error as below:
> ====================================================================== 
> ======
> ===============================================
>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
> Could not store Q6DAH5:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: The supplied lineage does not start near 'Erwinia carotovora  
> subsp.
> atroseptica' (I was supplied 'Erwinia carotovora subsp. |  
> Pectobacterium |
> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
> Proteobacteria | Bacteria')
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
> STACK: Bio::Species::classification
> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:552
> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:1305
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:973
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:852
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:182
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: load_seqdatabase.pl:620
> -----------------------------------------------------------
>
>  at load_seqdatabase.pl line 633
> ====================================================================== 
> ======
> ===============================================
>
> How can I solve it, please help me, Thank you.
>
> Thanks
> Forrest zhang
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From wcnelson at usc.edu  Thu Sep 27 15:20:47 2007
From: wcnelson at usc.edu (William C. Nelson)
Date: Thu, 27 Sep 2007 15:20:47 -0400
Subject: [Bioperl-l] cpan install
Message-ID: <46FC028F.3050000@usc.edu>

Hello,

I tried to install v1.5.2 using cpan.

My urllist looks like:

cpan[2]> o conf urllist
    urllist
        0 [ftp://cpan.cs.utah.edu/pub/CPAN/]
        1 [ftp://cpan.mirrors.tds.net/pub/CPAN]
        2 [ftp://ftp.open-bio.org/pub/bioperl/DIST/]
Type 'o conf' to view all configuration items


And when I look for bioperl, I see:

cpan[1]> d /bioperl/
CPAN: Storable loaded ok (v2.16)
Going to read /root/.cpan/Metadata
  Database was generated on Thu, 27 Sep 2007 18:36:44 GMT
Distribution    BIRNEY/bioperl-1.2.1.tar.gz
Distribution    BIRNEY/bioperl-1.2.2.tar.gz
Distribution    BIRNEY/bioperl-1.2.3.tar.gz
Distribution    BIRNEY/bioperl-1.2.tar.gz
Distribution    BIRNEY/bioperl-1.4.tar.gz
Distribution    BIRNEY/bioperl-db-0.1.tar.gz
Distribution    BIRNEY/bioperl-ext-1.4.tar.gz
Distribution    BIRNEY/bioperl-gui-0.7.tar.gz
Distribution    BIRNEY/bioperl-run-1.2.2.tar.gz
Distribution    BIRNEY/bioperl-run-1.4.tar.gz
Distribution    BOZO/Fry-Lib-BioPerl-0.15.tar.gz
Distribution    CRAFFI/Bundle-BioPerl-2.1.8.tar.gz
12 items found


No v 1.5.2.  This may be because it can't see the distribution at 
ftp://ftp.open-bio.org/pub/bioperl/DIST/. When I try to reload the 
index, I get messages saying cpan can't find the files 
ftp://ftp.open-bio.org/pub/bioperl/DIST/authors/01mailrc.txt.gz or 
ftp://ftp.open-bio.org/pub/bioperl/DIST/modules/02packages.details.txt.gz 
or ftp://ftp.open-bio.org/pub/bioperl/DIST/modules/03modlist.data.gz.

Am I doing something wrong?
Does the FTP site need to be updated?

Thanks,
Bill

-- 
-----------------------------------------------------
William C. Nelson, PhD
Research Asst Professor
Wrigely Institute for Environmental Studies
University of Southern California LAS/MEB
310-510-4097
wcnelson at usc.edu



From wgallin at ualberta.ca  Thu Sep 27 22:51:12 2007
From: wgallin at ualberta.ca (Warren Gallin)
Date: Thu, 27 Sep 2007 20:51:12 -0600
Subject: [Bioperl-l] A couple Eutilities questions
Message-ID: <98B80D80-AF6F-424B-81B7-5B0CFD8D6CB2@ualberta.ca>

I've just started using Bio::DB::Eutilities and I have encountered  
two things that seem like problems.

I am using the latest (retrieved Wednesday September 26, 2007) CVS  
version, running in an Apple Xserver.

Problem 1:  When I execute the following code:


#Create new EUTILS object for retrieving sets of entries, given an  
array of accession numbers
	my $gpeptfactory = Bio::DB::EUtilities -> new(	-eutil => 'efetch',
													-db => 'protein',
													-rettype =>'genbank',
													-id => \@pro_acc) ;
	my $file = 'temp_hold.gb';
	
	$gpeptfactory -> get_Response(-file => $file);
	
	my $retr_seq = Bio::SeqIO->new(	-file => $file,
                             		-format => 'genbank');


I get the following warning, consistently:

Use of uninitialized value in concatenation (.) or string at /Library/ 
Perl/5.8.1/Bio/DB/GenericWebAgent.pm line 92.


Also, about half the time I get a crash with the following error  
message:


------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Response Error
Bad Gateway
STACK: Error::throw
STACK: Bio::Root::Root::throw /Library/Perl/5.8.1/Bio/Root/Root.pm:357
STACK: Bio::DB::GenericWebAgent::get_Response /Library/Perl/5.8.1/Bio/ 
DB/GenericWebAgent.pm:184
STACK: gb_update_v4.pl:118
-----------------------------------------------------------



The other half of the time the script runs fine through to the end.   
I have no idea whether the crash is related to the warning or not.  I  
looked at the line where the warning is generated, and it appears to  
be the "new" method for the GenericWebAgent.pm  .  I can't see how  
the call to Eutilities is can be passing an undefined value through  
to this method.


Problem #2:

When the code runs, I retrieve an incorrect record.  I am retrieving  
using accessions, and accession I51532 retrieves two records.  One is  
the record I am after, an ion channel protein, the other comes from a  
patent application; the problem is that, although the accession  
number for the unwanted record is AAB76204, the LOCUS entry in the  
record is I51532.

So, is it possible that the efetch function is collecting on the  
basis of LOCUS, not ACCESSION?  I realize that the two are almost  
always the same, but not apparently in this case.

Any advice and/or explanation is appreciated.

Warren Gallin


From forrest_zhang at 163.com  Thu Sep 27 22:50:53 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 10:50:53 +0800
Subject: [Bioperl-l] cpan install
In-Reply-To: <46FC028F.3050000@usc.edu>
References: <46FC028F.3050000@usc.edu>
Message-ID: <000001c8017a$6384bae0$2a8e30a0$@com>

Try 
cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz

other question you should browse
http://www.bioperl.org/wiki/Installing_Bioperl_for_Unix

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of William C. Nelson
Sent: Friday, September 28, 2007 3:21 AM
To: bioperl-l at bioperl.org
Subject: [Bioperl-l] cpan install

Hello,

I tried to install v1.5.2 using cpan.

My urllist looks like:

cpan[2]> o conf urllist
    urllist
        0 [ftp://cpan.cs.utah.edu/pub/CPAN/]
        1 [ftp://cpan.mirrors.tds.net/pub/CPAN]
        2 [ftp://ftp.open-bio.org/pub/bioperl/DIST/]
Type 'o conf' to view all configuration items


And when I look for bioperl, I see:

cpan[1]> d /bioperl/
CPAN: Storable loaded ok (v2.16)
Going to read /root/.cpan/Metadata
  Database was generated on Thu, 27 Sep 2007 18:36:44 GMT
Distribution    BIRNEY/bioperl-1.2.1.tar.gz
Distribution    BIRNEY/bioperl-1.2.2.tar.gz
Distribution    BIRNEY/bioperl-1.2.3.tar.gz
Distribution    BIRNEY/bioperl-1.2.tar.gz
Distribution    BIRNEY/bioperl-1.4.tar.gz
Distribution    BIRNEY/bioperl-db-0.1.tar.gz
Distribution    BIRNEY/bioperl-ext-1.4.tar.gz
Distribution    BIRNEY/bioperl-gui-0.7.tar.gz
Distribution    BIRNEY/bioperl-run-1.2.2.tar.gz
Distribution    BIRNEY/bioperl-run-1.4.tar.gz
Distribution    BOZO/Fry-Lib-BioPerl-0.15.tar.gz
Distribution    CRAFFI/Bundle-BioPerl-2.1.8.tar.gz
12 items found


No v 1.5.2.  This may be because it can't see the distribution at 
ftp://ftp.open-bio.org/pub/bioperl/DIST/. When I try to reload the 
index, I get messages saying cpan can't find the files 
ftp://ftp.open-bio.org/pub/bioperl/DIST/authors/01mailrc.txt.gz or 
ftp://ftp.open-bio.org/pub/bioperl/DIST/modules/02packages.details.txt.gz 
or ftp://ftp.open-bio.org/pub/bioperl/DIST/modules/03modlist.data.gz.

Am I doing something wrong?
Does the FTP site need to be updated?

Thanks,
Bill

-- 
-----------------------------------------------------
William C. Nelson, PhD
Research Asst Professor
Wrigely Institute for Environmental Studies
University of Southern California LAS/MEB
310-510-4097
wcnelson at usc.edu

_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





From forrest_zhang at 163.com  Thu Sep 27 23:15:03 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 11:15:03 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
Message-ID: <000101c8017d$c4643360$4d2c9a20$@com>

Hilmar,
	I have already pre-loaded the NCBI taxonomy using
load_ncbi_taxonomy.pl yet. The error message show:

--------------------- WARNING ---------------------
MSG: The supplied lineage does not start near 'Phaseolus aureus' (I was
supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I | rosids
| core eudicotyledons | eudicotyledons | Magnoliophyta | Euphyllophyta |
Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
---------------------------------------------------
Could not store Q40784: 
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: create: object (Bio::Species) failed to insert or to be found by unique
key
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:206
STACK: Bio::DB::Persistent::PersistentObject::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:244
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:169
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:251
STACK: Bio::DB::Persistent::PersistentObject::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:271
STACK: /usr/bin/bp_load_seqdatabase.pl:633
-----------------------------------------------------------
Sigh~~~~~~

Forrest Zhang


-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
Sent: Friday, September 28, 2007 6:17 AM
To: Forrest
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

Forrest,

have you preloaded the NCBI taxonomy as suggested in the BioSQL  
installation guidelines? SwissProt format has NCBI taxon IDs, and the  
code will try to use it to look up species and their lineage, rather  
than inserting the lineage from whatever BioPerl parses out of the  
sequence record.

	-hilmar

On Sep 27, 2007, at 3:41 AM, Forrest wrote:

> Hi, all
>     I install the biosql, and bioperl-db. I want to import  
> swissport data.
> But the programe show some error as below:
> ====================================================================== 
> ======
> ===============================================
>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
> Could not store Q6DAH5:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: The supplied lineage does not start near 'Erwinia carotovora  
> subsp.
> atroseptica' (I was supplied 'Erwinia carotovora subsp. |  
> Pectobacterium |
> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
> Proteobacteria | Bacteria')
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
> STACK: Bio::Species::classification
> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:552
> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:1305
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:973
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:852
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:182
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: load_seqdatabase.pl:620
> -----------------------------------------------------------
>
>  at load_seqdatabase.pl line 633
> ====================================================================== 
> ======
> ===============================================
>
> How can I solve it, please help me, Thank you.
>
> Thanks
> Forrest zhang
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================





_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





From forrest_zhang at 163.com  Thu Sep 27 23:33:21 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 11:33:21 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000101c8017d$c4643360$4d2c9a20$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
Message-ID: <000201c80180$54762650$fd6272f0$@com>

I reinstall the bioperl-db, I found some error.

t/01dbadaptor.....ok

t/02species.......FAILED tests 66-95

        Failed 30/65 tests, 53.85% okay
t/03simpleseq.....ok

t/04swiss.........ok

t/05seqfeature....ok

t/06comment.......ok

t/07dblink........ok

t/08genbank.......ok

t/09fuzzy2........ok

t/10ensembl.......ok

t/11locuslink.....ok

t/12ontology......ok

t/13remove........ok

t/14query.........ok

t/15cluster.......ok 9/160

--------------------- WARNING ---------------------
MSG: failed to store one or more child objects for an instance of class
Bio::Cluster::UniGene (PK=320)
---------------------------------------------------
t/15cluster.......ok

t/16obda..........ok

Failed Test   Stat Wstat Total Fail  List of Failed
----------------------------------------------------------------------------
---
t/02species.t               65   30  66-95
Failed 1/16 test scripts. -30/1423 subtests failed.
Files=16, Tests=1423, 35 wallclock secs (16.67 cusr +  0.63 csys = 17.30
CPU)
Failed 1/16 test programs. -30/1423 subtests failed.
make: *** [test] Error 255

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Forrest Zhang
Sent: Friday, September 28, 2007 11:15 AM
To: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

Hilmar,
	I have already pre-loaded the NCBI taxonomy using
load_ncbi_taxonomy.pl yet. The error message show:

--------------------- WARNING ---------------------
MSG: The supplied lineage does not start near 'Phaseolus aureus' (I was
supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I | rosids
| core eudicotyledons | eudicotyledons | Magnoliophyta | Euphyllophyta |
Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
---------------------------------------------------
Could not store Q40784: 
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: create: object (Bio::Species) failed to insert or to be found by unique
key
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:206
STACK: Bio::DB::Persistent::PersistentObject::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:244
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:169
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:251
STACK: Bio::DB::Persistent::PersistentObject::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:271
STACK: /usr/bin/bp_load_seqdatabase.pl:633
-----------------------------------------------------------
Sigh~~~~~~

Forrest Zhang


-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
Sent: Friday, September 28, 2007 6:17 AM
To: Forrest
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

Forrest,

have you preloaded the NCBI taxonomy as suggested in the BioSQL  
installation guidelines? SwissProt format has NCBI taxon IDs, and the  
code will try to use it to look up species and their lineage, rather  
than inserting the lineage from whatever BioPerl parses out of the  
sequence record.

	-hilmar

On Sep 27, 2007, at 3:41 AM, Forrest wrote:

> Hi, all
>     I install the biosql, and bioperl-db. I want to import  
> swissport data.
> But the programe show some error as below:
> ====================================================================== 
> ======
> ===============================================
>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
> Could not store Q6DAH5:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: The supplied lineage does not start near 'Erwinia carotovora  
> subsp.
> atroseptica' (I was supplied 'Erwinia carotovora subsp. |  
> Pectobacterium |
> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
> Proteobacteria | Bacteria')
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
> STACK: Bio::Species::classification
> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:552
> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:1305
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:973
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:852
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:182
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: load_seqdatabase.pl:620
> -----------------------------------------------------------
>
>  at load_seqdatabase.pl line 633
> ====================================================================== 
> ======
> ===============================================
>
> How can I solve it, please help me, Thank you.
>
> Thanks
> Forrest zhang
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================





_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l



_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





From cjfields at uiuc.edu  Fri Sep 28 00:58:27 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 23:58:27 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000201c80180$54762650$fd6272f0$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
	<000201c80180$54762650$fd6272f0$@com>
Message-ID: <9535284F-2DC5-4361-81A2-0B739A7E89E4@uiuc.edu>

Bio::Species will have problems if you test on a database with  
taxonomy loaded (it's mentioned in the install docs I think).

The UniGene warning has always popped up and isn't anything to worry  
about.

chris

On Sep 27, 2007, at 10:33 PM, Forrest Zhang wrote:

> I reinstall the bioperl-db, I found some error.
>
> t/01dbadaptor.....ok
>
> t/02species.......FAILED tests 66-95
>
>         Failed 30/65 tests, 53.85% okay
> t/03simpleseq.....ok
>
> t/04swiss.........ok
>
> t/05seqfeature....ok
>
> t/06comment.......ok
>
> t/07dblink........ok
>
> t/08genbank.......ok
>
> t/09fuzzy2........ok
>
> t/10ensembl.......ok
>
> t/11locuslink.....ok
>
> t/12ontology......ok
>
> t/13remove........ok
>
> t/14query.........ok
>
> t/15cluster.......ok 9/160
>
> --------------------- WARNING ---------------------
> MSG: failed to store one or more child objects for an instance of  
> class
> Bio::Cluster::UniGene (PK=320)
> ---------------------------------------------------
> t/15cluster.......ok
>
> t/16obda..........ok
>
> Failed Test   Stat Wstat Total Fail  List of Failed
> ---------------------------------------------------------------------- 
> ------
> ---
> t/02species.t               65   30  66-95
> Failed 1/16 test scripts. -30/1423 subtests failed.
> Files=16, Tests=1423, 35 wallclock secs (16.67 cusr +  0.63 csys =  
> 17.30
> CPU)
> Failed 1/16 test programs. -30/1423 subtests failed.
> make: *** [test] Error 255
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Forrest  
> Zhang
> Sent: Friday, September 28, 2007 11:15 AM
> To: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From cjfields at uiuc.edu  Fri Sep 28 00:57:55 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 23:57:55 -0500
Subject: [Bioperl-l] A couple Eutilities questions
In-Reply-To: <98B80D80-AF6F-424B-81B7-5B0CFD8D6CB2@ualberta.ca>
References: <98B80D80-AF6F-424B-81B7-5B0CFD8D6CB2@ualberta.ca>
Message-ID: <A8E3D712-1159-43F7-91A6-16BA6103AB7B@uiuc.edu>


On Sep 27, 2007, at 9:51 PM, Warren Gallin wrote:

> I've just started using Bio::DB::Eutilities and I have encountered
> two things that seem like problems.
>
> I am using the latest (retrieved Wednesday September 26, 2007) CVS
> version, running in an Apple Xserver.
>
> Problem 1:  When I execute the following code:
>
>
> #Create new EUTILS object for retrieving sets of entries, given an
> array of accession numbers
> 	my $gpeptfactory = Bio::DB::EUtilities -> new(	-eutil => 'efetch',
> 													-db => 'protein',
> 													-rettype =>'genbank',
> 													-id => \@pro_acc) ;
> 	my $file = 'temp_hold.gb';
> 	
> 	$gpeptfactory -> get_Response(-file => $file);
> 	
> 	my $retr_seq = Bio::SeqIO->new(	-file => $file,
>                              		-format => 'genbank');
>
>
> I get the following warning, consistently:
>
> Use of uninitialized value in concatenation (.) or string at /Library/
> Perl/5.8.1/Bio/DB/GenericWebAgent.pm line 92.

The above works for me w/o problems.  The error itself doesn't make  
much sense; the line is:

     $self->ua(LWP::UserAgent->new(env_proxy => 1,
             agent => ref($self).':'.$self->VERSION));

so either $self isn't a ref (which it appears to be) or there is no  
version (which is odd but may be a perl bug).  What happens if you  
hard-code the version number to something simple?

Also, I noticed you're using perl 5.8.1; which version of Mac OS X  
are you using?  I remember something was off about that perl version  
but I can't remember what it was...

> Also, about half the time I get a crash with the following error
> message:
>
>
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: Response Error
> Bad Gateway
> STACK: Error::throw
> STACK: Bio::Root::Root::throw /Library/Perl/5.8.1/Bio/Root/Root.pm:357
> STACK: Bio::DB::GenericWebAgent::get_Response /Library/Perl/5.8.1/Bio/
> DB/GenericWebAgent.pm:184
> STACK: gb_update_v4.pl:118
> -----------------------------------------------------------

I have seen it sometimes pop up when the NCBI server is under heavy  
server load.  It may also be related to your local ISP or setup; see  
here:

http://www.checkupdown.com/status/E502.html

Supposedly this may pop up with mod_perl but I haven't seen/heard  
anything myself related to this.

> The other half of the time the script runs fine through to the end.
> I have no idea whether the crash is related to the warning or not.  I
> looked at the line where the warning is generated, and it appears to
> be the "new" method for the GenericWebAgent.pm  .  I can't see how
> the call to Eutilities is can be passing an undefined value through
> to this method.

EUtilities is-a GenericWebAgent; the new() constructors are chained  
using SUPER::new().  Also, you can call VERSION from any variable so  
it could be a problem there if VERSION is undef, though again I can't  
think why this would fail.  Regardless, the 'Use of undefined'  
warning is not a fatal error.

> Problem #2:
>
> When the code runs, I retrieve an incorrect record.  I am retrieving
> using accessions, and accession I51532 retrieves two records.  One is
> the record I am after, an ion channel protein, the other comes from a
> patent application; the problem is that, although the accession
> number for the unwanted record is AAB76204, the LOCUS entry in the
> record is I51532.
>
> So, is it possible that the efetch function is collecting on the
> basis of LOCUS, not ACCESSION?  I realize that the two are almost
> always the same, but not apparently in this case.
>
> Any advice and/or explanation is appreciated.
>
> Warren Gallin

The only means NCBI guarantees to retrieve a unique record every time  
is by using the primary ID, which for sequence records is the GI.   
The accession works most of the time, and efetch accepts accs in the  
place of GI (it's the only eutil that does).  However, every once in  
a while you get stung and retrieve multiple seqs.

BTW, I entered your sequence into Entrez and it popped up as  
discontinued (which could be part of the problem); the current acc is  
Q91781.

chris


From cjfields at uiuc.edu  Fri Sep 28 01:00:18 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 00:00:18 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000101c8017d$c4643360$4d2c9a20$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
Message-ID: <8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>

If this is occurring using bioperl from CVS then I'll try taking a  
look at it.

chris

On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:

> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From forrest_zhang at 163.com  Fri Sep 28 01:34:21 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 13:34:21 +0800
Subject: [Bioperl-l] FW:  load_seqdatabase.pl error
Message-ID: <000101c80191$3b300e70$b1902b50$@com>

Oh, my God!  I am tring reinstall bioperl-live using CVS, so many error
shown below.

biocc bioperl-live # perl Build.PL 
Checking whether your kit is complete...
Looks good

Checking prerequisites...
Looks good

Checking features:
  BioDBGFF.................enabled
  BioDBSeqFeature_mysql....enabled
  Network..................enabled
  BioDBSeqFeature_BDB......enabled

Install [a]ll Bioperl scripts, [n]one, or choose groups [i]nteractively? [a]

  - will install all scripts

Do you want to run the BioDBGFF live database tests? y/n [n] y
Which database should I use for testing the mysql driver? [test] 
On which host is database 'test' running (hostname, ip address or host:port)
[localhost] 
User name for connecting to database 'test'? [undef] root
Password for connecting to database 'test'? [undef] 
  - will run the BioDBGFF tests with database driver 'mysql' and these
settings:
    Database test
    Host     localhost
    DSN      dbi:mysql:database=test
    User     root
    Password undef

Do you want to run tests that require connection to servers across the
internet
(likely to cause some failures)? y/n [n] y
  - will run internet-requiring tests
Deleting Build
Removed previous script 'Build'

Creating new 'Build' script for 'bioperl' version '1.0050021'
biocc bioperl-live # ./Build test
Copying Bio/Align/Utilities.pm -> blib/lib/Bio/Align/Utilities.pm
Copying Bio/Search/HSP/ModelHSP.pm -> blib/lib/Bio/Search/HSP/ModelHSP.pm
Copying Bio/Ontology/DocumentRegistry.pm ->
blib/lib/Bio/Ontology/DocumentRegistry.pm
Copying Bio/SeqFeature/Annotated.pm -> blib/lib/Bio/SeqFeature/Annotated.pm
Copying Bio/SimpleAlign.pm -> blib/lib/Bio/SimpleAlign.pm
Copying Bio/AlignIO/stockholm.pm -> blib/lib/Bio/AlignIO/stockholm.pm
Copying scripts/utilities/bp_sreformat.PLS -> blib/script/bp_sreformat.PLS
Deleting blib/script/bp_sreformat.PLS.bak
blib/script/bp_sreformat.PLS -> blib/script/bp_sreformat.pl
Copying scripts/graphics/contig_draw.PLS -> blib/script/contig_draw.PLS
Deleting blib/script/contig_draw.PLS.bak
blib/script/contig_draw.PLS -> blib/script/bp_contig_draw.pl
Copying scripts/Bio-DB-GFF/meta_gff.PLS -> blib/script/meta_gff.PLS
Deleting blib/script/meta_gff.PLS.bak
blib/script/meta_gff.PLS -> blib/script/bp_meta_gff.pl
Copying scripts/tree/tree2pag.PLS -> blib/script/tree2pag.PLS
Deleting blib/script/tree2pag.PLS.bak
blib/script/tree2pag.PLS -> blib/script/bp_tree2pag.pl
Copying scripts/Bio-SeqFeature-Store/bp_seqfeature_gff3.PLS ->
blib/script/bp_seqfeature_gff3.PLS
blib/script/bp_seqfeature_gff3.PLS -> blib/script/bp_seqfeature_gff3.pl
Copying scripts/popgen/heterogeneity_test.PLS ->
blib/script/heterogeneity_test.PLS
Deleting blib/script/heterogeneity_test.PLS.bak
blib/script/heterogeneity_test.PLS -> blib/script/bp_heterogeneity_test.pl
Copying scripts/DB/flanks.PLS -> blib/script/flanks.PLS
Deleting blib/script/flanks.PLS.bak
blib/script/flanks.PLS -> blib/script/bp_flanks.pl
Copying scripts/graphics/feature_draw.PLS -> blib/script/feature_draw.PLS
Deleting blib/script/feature_draw.PLS.bak
blib/script/feature_draw.PLS -> blib/script/bp_feature_draw.pl
Copying scripts/DB/biogetseq.PLS -> blib/script/biogetseq.PLS
Deleting blib/script/biogetseq.PLS.bak
blib/script/biogetseq.PLS -> blib/script/bp_biogetseq.pl
Copying scripts/Bio-SeqFeature-Store/bp_seqfeature_load.PLS ->
blib/script/bp_seqfeature_load.PLS
Deleting blib/script/bp_seqfeature_load.PLS.bak
blib/script/bp_seqfeature_load.PLS -> blib/script/bp_seqfeature_load.pl
Copying scripts/searchio/fastam9_to_table.PLS ->
blib/script/fastam9_to_table.PLS
Deleting blib/script/fastam9_to_table.PLS.bak
blib/script/fastam9_to_table.PLS -> blib/script/bp_fastam9_to_table.pl
Copying scripts/utilities/seq_length.PLS -> blib/script/seq_length.PLS
Deleting blib/script/seq_length.PLS.bak
blib/script/seq_length.PLS -> blib/script/bp_seq_length.pl
Copying scripts/Bio-DB-GFF/genbank2gff.PLS -> blib/script/genbank2gff.PLS
Deleting blib/script/genbank2gff.PLS.bak
blib/script/genbank2gff.PLS -> blib/script/bp_genbank2gff.pl
Copying scripts/taxa/taxid4species.PLS -> blib/script/taxid4species.PLS
Deleting blib/script/taxid4species.PLS.bak
blib/script/taxid4species.PLS -> blib/script/bp_taxid4species.pl
Copying scripts/biographics/bp_glyphs1-demo.PLS ->
blib/script/bp_glyphs1-demo.PLS
Deleting blib/script/bp_glyphs1-demo.PLS.bak
blib/script/bp_glyphs1-demo.PLS -> blib/script/bp_glyphs1-demo.pl
Copying scripts/tree/blast2tree.PLS -> blib/script/blast2tree.PLS
Deleting blib/script/blast2tree.PLS.bak
blib/script/blast2tree.PLS -> blib/script/bp_blast2tree.pl
Copying scripts/graphics/frend.PLS -> blib/script/frend.PLS
Deleting blib/script/frend.PLS.bak
blib/script/frend.PLS -> blib/script/bp_frend.pl
Copying scripts/taxa/query_entrez_taxa.PLS ->
blib/script/query_entrez_taxa.PLS
Deleting blib/script/query_entrez_taxa.PLS.bak
blib/script/query_entrez_taxa.PLS -> blib/script/bp_query_entrez_taxa.pl
Copying scripts/biographics/bp_glyphs2-demo.PLS ->
blib/script/bp_glyphs2-demo.PLS
Deleting blib/script/bp_glyphs2-demo.PLS.bak
blib/script/bp_glyphs2-demo.PLS -> blib/script/bp_glyphs2-demo.pl
Copying scripts/taxa/taxonomy2tree.PLS -> blib/script/taxonomy2tree.PLS
Deleting blib/script/taxonomy2tree.PLS.bak
blib/script/taxonomy2tree.PLS -> blib/script/bp_taxonomy2tree.pl
Copying scripts/utilities/search2alnblocks.PLS ->
blib/script/search2alnblocks.PLS
Deleting blib/script/search2alnblocks.PLS.bak
blib/script/search2alnblocks.PLS -> blib/script/bp_search2alnblocks.pl
Copying scripts/utilities/mask_by_search.PLS ->
blib/script/mask_by_search.PLS
Deleting blib/script/mask_by_search.PLS.bak
blib/script/mask_by_search.PLS -> blib/script/bp_mask_by_search.pl
Copying scripts/seqstats/gccalc.PLS -> blib/script/gccalc.PLS
Deleting blib/script/gccalc.PLS.bak
blib/script/gccalc.PLS -> blib/script/bp_gccalc.pl
Copying scripts/popgen/composite_LD.PLS -> blib/script/composite_LD.PLS
Deleting blib/script/composite_LD.PLS.bak
blib/script/composite_LD.PLS -> blib/script/bp_composite_LD.pl
Copying scripts/seqstats/aacomp.PLS -> blib/script/aacomp.PLS
Deleting blib/script/aacomp.PLS.bak
blib/script/aacomp.PLS -> blib/script/bp_aacomp.pl
Copying scripts/Bio-DB-GFF/process_wormbase.PLS ->
blib/script/process_wormbase.PLS
Deleting blib/script/process_wormbase.PLS.bak
blib/script/process_wormbase.PLS -> blib/script/bp_process_wormbase.pl
Copying scripts/taxa/local_taxonomydb_query.PLS ->
blib/script/local_taxonomydb_query.PLS
Deleting blib/script/local_taxonomydb_query.PLS.bak
blib/script/local_taxonomydb_query.PLS ->
blib/script/bp_local_taxonomydb_query.pl
Copying scripts/biblio/biblio.PLS -> blib/script/biblio.PLS
Deleting blib/script/biblio.PLS.bak
blib/script/biblio.PLS -> blib/script/bp_biblio.pl
Copying scripts/biographics/bp_embl2picture.PLS ->
blib/script/bp_embl2picture.PLS
Deleting blib/script/bp_embl2picture.PLS.bak
blib/script/bp_embl2picture.PLS -> blib/script/bp_embl2picture.pl
Copying scripts/Bio-DB-GFF/genbank2gff3.PLS -> blib/script/genbank2gff3.PLS
Deleting blib/script/genbank2gff3.PLS.bak
blib/script/genbank2gff3.PLS -> blib/script/bp_genbank2gff3.pl
Copying scripts/utilities/search2BSML.PLS -> blib/script/search2BSML.PLS
Deleting blib/script/search2BSML.PLS.bak
blib/script/search2BSML.PLS -> blib/script/bp_search2BSML.pl
Copying scripts/seq/seqconvert.PLS -> blib/script/seqconvert.PLS
Deleting blib/script/seqconvert.PLS.bak
blib/script/seqconvert.PLS -> blib/script/bp_seqconvert.pl
Copying scripts/searchio/parse_hmmsearch.PLS ->
blib/script/parse_hmmsearch.PLS
Deleting blib/script/parse_hmmsearch.PLS.bak
blib/script/parse_hmmsearch.PLS -> blib/script/bp_parse_hmmsearch.pl
Copying scripts/index/bp_seqret.PLS -> blib/script/bp_seqret.PLS
Deleting blib/script/bp_seqret.PLS.bak
blib/script/bp_seqret.PLS -> blib/script/bp_seqret.pl
Copying scripts/searchio/filter_search.PLS -> blib/script/filter_search.PLS
Deleting blib/script/filter_search.PLS.bak
blib/script/filter_search.PLS -> blib/script/bp_filter_search.pl
Copying scripts/tree/nexus2nh.PLS -> blib/script/nexus2nh.PLS
Deleting blib/script/nexus2nh.PLS.bak
blib/script/nexus2nh.PLS -> blib/script/bp_nexus2nh.pl
Copying scripts/Bio-DB-GFF/generate_histogram.PLS ->
blib/script/generate_histogram.PLS
Deleting blib/script/generate_histogram.PLS.bak
blib/script/generate_histogram.PLS -> blib/script/bp_generate_histogram.pl
Copying scripts/seq/split_seq.PLS -> blib/script/split_seq.PLS
Deleting blib/script/split_seq.PLS.bak
blib/script/split_seq.PLS -> blib/script/bp_split_seq.pl
Copying scripts/Bio-DB-GFF/load_gff.PLS -> blib/script/load_gff.PLS
Deleting blib/script/load_gff.PLS.bak
blib/script/load_gff.PLS -> blib/script/bp_load_gff.pl
Copying scripts/index/bp_fetch.PLS -> blib/script/bp_fetch.PLS
Deleting blib/script/bp_fetch.PLS.bak
blib/script/bp_fetch.PLS -> blib/script/bp_fetch.pl
Copying scripts/utilities/mutate.PLS -> blib/script/mutate.PLS
Deleting blib/script/mutate.PLS.bak
blib/script/mutate.PLS -> blib/script/bp_mutate.pl
Copying scripts/Bio-DB-GFF/process_sgd.PLS -> blib/script/process_sgd.PLS
Deleting blib/script/process_sgd.PLS.bak
blib/script/process_sgd.PLS -> blib/script/bp_process_sgd.pl
Copying scripts/index/bp_index.PLS -> blib/script/bp_index.PLS
Deleting blib/script/bp_index.PLS.bak
blib/script/bp_index.PLS -> blib/script/bp_index.pl
Copying scripts/utilities/dbsplit.PLS -> blib/script/dbsplit.PLS
Deleting blib/script/dbsplit.PLS.bak
blib/script/dbsplit.PLS -> blib/script/bp_dbsplit.pl
Copying scripts/seqstats/oligo_count.PLS -> blib/script/oligo_count.PLS
Deleting blib/script/oligo_count.PLS.bak
blib/script/oligo_count.PLS -> blib/script/bp_oligo_count.pl
Copying scripts/searchio/hmmer_to_table.PLS ->
blib/script/hmmer_to_table.PLS
Deleting blib/script/hmmer_to_table.PLS.bak
blib/script/hmmer_to_table.PLS -> blib/script/bp_hmmer_to_table.pl
Copying scripts/Bio-DB-GFF/process_gadfly.PLS ->
blib/script/process_gadfly.PLS
Deleting blib/script/process_gadfly.PLS.bak
blib/script/process_gadfly.PLS -> blib/script/bp_process_gadfly.pl
Copying scripts/DB/biofetch_genbank_proxy.PLS ->
blib/script/biofetch_genbank_proxy.PLS
Deleting blib/script/biofetch_genbank_proxy.PLS.bak
blib/script/biofetch_genbank_proxy.PLS ->
blib/script/bp_biofetch_genbank_proxy.pl
Copying scripts/seq/extract_feature_seq.PLS ->
blib/script/extract_feature_seq.PLS
Deleting blib/script/extract_feature_seq.PLS.bak
blib/script/extract_feature_seq.PLS -> blib/script/bp_extract_feature_seq.pl
Copying scripts/Bio-DB-GFF/bulk_load_gff.PLS ->
blib/script/bulk_load_gff.PLS
Deleting blib/script/bulk_load_gff.PLS.bak
blib/script/bulk_load_gff.PLS -> blib/script/bp_bulk_load_gff.pl
Copying scripts/utilities/search2gff.PLS -> blib/script/search2gff.PLS
Deleting blib/script/search2gff.PLS.bak
blib/script/search2gff.PLS -> blib/script/bp_search2gff.pl
Copying scripts/seq/make_mrna_protein.PLS ->
blib/script/make_mrna_protein.PLS
Deleting blib/script/make_mrna_protein.PLS.bak
blib/script/make_mrna_protein.PLS -> blib/script/bp_make_mrna_protein.pl
Copying scripts/seq/unflatten_seq.PLS -> blib/script/unflatten_seq.PLS
Deleting blib/script/unflatten_seq.PLS.bak
blib/script/unflatten_seq.PLS -> blib/script/bp_unflatten_seq.pl
Copying scripts/utilities/search2tribe.PLS -> blib/script/search2tribe.PLS
Deleting blib/script/search2tribe.PLS.bak
blib/script/search2tribe.PLS -> blib/script/bp_search2tribe.pl
Copying scripts/DB/bioflat_index.PLS -> blib/script/bioflat_index.PLS
Deleting blib/script/bioflat_index.PLS.bak
blib/script/bioflat_index.PLS -> blib/script/bp_bioflat_index.pl
Copying scripts/utilities/pairwise_kaks.PLS -> blib/script/pairwise_kaks.PLS
Deleting blib/script/pairwise_kaks.PLS.bak
blib/script/pairwise_kaks.PLS -> blib/script/bp_pairwise_kaks.pl
Copying scripts/Bio-DB-GFF/fast_load_gff.PLS ->
blib/script/fast_load_gff.PLS
Deleting blib/script/fast_load_gff.PLS.bak
blib/script/fast_load_gff.PLS -> blib/script/bp_fast_load_gff.pl
Copying scripts/seqstats/chaos_plot.PLS -> blib/script/chaos_plot.PLS
Deleting blib/script/chaos_plot.PLS.bak
blib/script/chaos_plot.PLS -> blib/script/bp_chaos_plot.pl
Copying scripts/utilities/bp_mrtrans.PLS -> blib/script/bp_mrtrans.PLS
Deleting blib/script/bp_mrtrans.PLS.bak
blib/script/bp_mrtrans.PLS -> blib/script/bp_mrtrans.pl
Copying scripts/utilities/bp_nrdb.PLS -> blib/script/bp_nrdb.PLS
Deleting blib/script/bp_nrdb.PLS.bak
blib/script/bp_nrdb.PLS -> blib/script/bp_nrdb.pl
Copying scripts/taxa/classify_hits_kingdom.PLS ->
blib/script/classify_hits_kingdom.PLS
Deleting blib/script/classify_hits_kingdom.PLS.bak
blib/script/classify_hits_kingdom.PLS ->
blib/script/bp_classify_hits_kingdom.pl
Copying scripts/utilities/remote_blast.PLS -> blib/script/remote_blast.PLS
Deleting blib/script/remote_blast.PLS.bak
blib/script/remote_blast.PLS -> blib/script/bp_remote_blast.pl
Copying scripts/searchio/search2table.PLS -> blib/script/search2table.PLS
Deleting blib/script/search2table.PLS.bak
blib/script/search2table.PLS -> blib/script/bp_search2table.pl
Copying scripts/seq/translate_seq.PLS -> blib/script/translate_seq.PLS
Deleting blib/script/translate_seq.PLS.bak
blib/script/translate_seq.PLS -> blib/script/bp_translate_seq.pl
Copying scripts/graphics/search_overview.PLS ->
blib/script/search_overview.PLS
Deleting blib/script/search_overview.PLS.bak
blib/script/search_overview.PLS -> blib/script/bp_search_overview.pl
t/AAChange...................ok

t/AAReverseMutate............ok

t/AlignIO....................ok

t/AlignStats.................ok

t/AlignUtil..................ok

t/Allele.....................ok

t/Alphabet...................ok

t/Annotation.................ok 1/112

#   Failed (TODO) test 'The object isa Bio::Annotation::Comment'
#   at t/Annotation.t line 214.
#     The object isn't a 'Bio::Annotation::Comment' it's a
'Bio::Annotation::OntologyTerm'
t/Annotation.................ok

        1/112 unexpectedly succeeded
TODO PASSED test 96

t/AnnotationAdaptor..........ok

t/Assembly...................ok 1/35

#   Failed (TODO) test 'get_nof_singlets'
#   at t/Assembly.t line 44.
#          got: '0'
#     expected: '1'

#   Failed (TODO) test 'get_seq_ids'
#   at t/Assembly.t line 48.
#          got: '0'
#     expected: '2'

#   Failed (TODO) test at t/Assembly.t line 53.
#     '0'
#         ne
#     '0'

#   Failed test at t/Assembly.t line 145.
#          got: '_main_contig_feature:106'
#     expected: '_aligned_coord:sdsu|SDSU_RFPERU_006_E04.x01.phd.1'
t/Assembly...................NOK 31/35# Looks like you failed 1 test of 35.

t/Assembly...................dubious

        Test returned status 1 (wstat 256, 0x100)
DIED. FAILED test 31
        Failed 1/35 tests, 97.14% okay
t/Biblio.....................ok

t/BiblioReferences...........ok

t/Biblio_biofetch............ok

t/Biblio_eutils..............ok

t/BioDBGFF...................ok

        3/277 skipped: various reasons
t/BioDBSeqFeature............ok

t/BioDBSeqFeature_BDB........ok

t/BioDBSeqFeature_mysql......ok

t/BioFetch_DB................ok

t/BioGraphics................ok

t/BlastIndex.................ok

t/Chain......................ok

t/ClusterIO..................ok

t/Coalescent.................ok

t/CodonTable.................ok

t/Compatible.................ok

t/CoordinateGraph............ok

t/CoordinateMapper...........ok

t/Correlate..................ok

t/CytoMap....................ok

t/DB.........................ok 104/116Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 491.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 565.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 565.
t/DB.........................ok 107/116Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 565.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 565.
t/DB.........................ok

t/DBCUTG.....................ok

t/DBFasta....................ok

t/DNAMutation................ok

t/Domcut.....................ok

t/ECnumber...................ok

t/ELM........................ok

t/EMBL_DB....................ok

t/EMBOSS_Tools...............ok

t/ESEfinder..................ok

t/EUtilities.................skipped
        all skipped: Must set BIOPERLDEBUG=1 for network tests
t/EncodedSeq.................ok

t/Exception..................ok

t/Exonerate..................ok

        4/45 skipped: various reasons
t/FeatureIO..................ok

t/FootPrinter................ok

t/GDB........................ok

t/GFF........................ok

t/GOR4.......................ok

t/GOterm.....................ok

t/GbrowseGFF.................ok

t/Gel........................ok

t/GeneCoordinateMapper.......ok

t/Geneid.....................ok

t/Genewise...................ok 1/53

#   Failed (TODO) test at t/Genewise.t line 79.
#          got: 'Scaffold_2042.1'
#     expected: 'SINFRUP00000067802'

#   Failed (TODO) test at t/Genewise.t line 80.
#          got: 'SINFRUP00000067802'
#     expected: 'Scaffold_2042.1'
t/Genewise...................NOK 37/53

#   Failed test at t/Genewise.t line 82.
#          got: ''
#     expected: '2054.68'
t/Genewise...................NOK 41/53

#   Failed test at t/Genewise.t line 88.
#          got: ''
#     expected: '2054.68'
t/Genewise...................NOK 45/53

#   Failed test at t/Genewise.t line 93.
#          got: ''
#     expected: '2054.68'
# Looks like you failed 3 tests of 53.
t/Genewise...................dubious

        Test returned status 3 (wstat 768, 0x300)
DIED. FAILED tests 37, 41, 45
        Failed 3/53 tests, 94.34% okay
t/Genomewise.................ok

t/Genpred....................ok 1/157Argument "<1" isn't numeric in numeric
gt (>) at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/Tools/Glimmer.pm line
519, <GEN11> line 2.
t/Genpred....................ok

t/GraphAdaptor...............ok

t/GuessSeqFormat.............ok

t/HNN........................ok

t/Handler....................ok 288/545

#   Failed (TODO) test at t/Handler.t line 696.
t/Handler....................ok

t/HtSNP......................ok

t/IUPAC......................ok

t/Index......................ok

t/InstanceSite...............ok

t/InterProParser.............ok

t/LargeLocatableSeq..........ok

t/LinkageMap.................ok

t/LiveSeq....................ok

t/LocatableSeq...............ok

t/Location...................ok

t/LocationFactory............ok

t/LocusLink..................ok

t/MK.........................ok

        4/46 skipped: various reasons
t/Map........................ok

t/MapIO......................ok

t/Matrix.....................ok

t/MeSH.......................ok

t/Measure....................ok

t/MetaSeq....................ok

t/MicrosatelliteMarker.......ok

t/MiniMIMentry...............ok

t/MitoProt...................ok

t/Molphy.....................ok

t/MultiFile..................ok

t/Mutation...................ok

t/Mutator....................ok

t/NetPhos....................ok

t/Node.......................ok

t/OMIMentry..................ok

t/OMIMentryAllelicVariant....ok

t/OMIMparser.................ok

t/OddCodes...................ok

t/Ontology...................ok

t/OntologyEngine.............ok

t/OntologyStore..............ok

t/PAML.......................ok

t/Perl.......................ok

t/Phenotype..................ok

t/PhylipDist.................ok

t/PhysicalMap................ok

t/Pictogram..................ok

t/PodSyntax..................skipped
        all skipped: Test::Pod 1.00 required for testing POD
t/PopGen.....................ok 1/99

#   Failed (TODO) test at t/PopGen.t line 242.
t/PopGen.....................ok

        2/99 unexpectedly succeeded
TODO PASSED tests 97-98

t/PopGenSims.................ok

t/PrimarySeq.................ok

t/Primer.....................ok

t/Promoterwise...............ok

t/ProtDist...................ok

t/ProtMatrix.................ok

t/ProtPsm....................ok

        10/14 skipped: various reasons
t/Pseudowise.................ok

t/QRNA.......................ok

t/RNAChange..................ok

t/RNA_SearchIO...............ok 2/496

#   Failed (TODO) test 'HSP meta'
#   at t/RNA_SearchIO.t line 798.
#     undef
#         ne
#     undef

#   Failed (TODO) test at t/RNA_SearchIO.t line 800.
#     undef
#         ne
#     undef

#   Failed (TODO) test at t/RNA_SearchIO.t line 802.
#     undef
#         ne
#     undef

#   Failed (TODO) test 'HSP meta'
#   at t/RNA_SearchIO.t line 848.
#     undef
#         ne
#     undef

#   Failed (TODO) test at t/RNA_SearchIO.t line 850.
#     undef
#         ne
#     undef

#   Failed (TODO) test at t/RNA_SearchIO.t line 852.
#     undef
#         ne
#     undef
t/RNA_SearchIO...............ok

t/RandDistFunctions..........ok

t/RandomTreeFactory..........ok

t/Range......................ok

t/RangeI.....................ok

t/RefSeq.....................ok

t/Registry...................ok 1/14

--------------------- WARNING ---------------------
MSG: Couldn't call new_from_registry() on [Bio::DB::Flat]

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: you must specify an indexing scheme
STACK: Error::throw
STACK: Bio::Root::Root::throw
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/Root/Root.pm:357
STACK: Bio::DB::Flat::new
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/DB/Flat.pm:160
STACK: Bio::DB::Flat::new_from_registry
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/DB/Flat.pm:252
STACK: Bio::DB::Registry::_load_registry
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/DB/Registry.pm:164
STACK: Bio::DB::Registry::new
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/DB/Registry.pm:95
STACK: t/Registry.t:51
-----------------------------------------------------------

---------------------------------------------------
t/Registry...................ok

        6/14 skipped: various reasons
t/Relationship...............ok

t/RelationshipType...........ok

t/RemoteBlast................ok

t/RepeatMasker...............ok

t/RestrictionAnalysis........ok

t/RestrictionIO..............ok 1/15

#   Failed (TODO) test at t/RestrictionIO.t line 31.
t/RestrictionIO..............ok

t/Root-Utilities.............ok 1/50

--------------------- WARNING ---------------------
MSG: Not owner of file t/data/test.txt. Compressing to temp file
/tmp/MBKEv1uzJB.tmp.bioperl.gz.
---------------------------------------------------
t/Root-Utilities.............ok

t/RootI......................ok

t/RootIO.....................ok

t/RootStorable...............ok

t/SNP........................ok

t/Scansite...................ok

        5/14 skipped: various reasons
t/SearchDist.................skipped
        all skipped: The optional module Bio::Ext::Align (or dependencies
thereof) was not installed
t/SearchIO...................ok 529/1449

#   Failed (TODO) test at t/SearchIO.t line 989.
#     '0.852'
#         >
#     '0.9'

#   Failed (TODO) test at t/SearchIO.t line 990.
#     '1.599'
#         <=
#     '1'
t/SearchIO...................ok

t/Seg........................ok

t/Seq........................ok

t/SeqAnalysisParser..........ok

t/SeqBuilder.................ok

t/SeqDiff....................ok

t/SeqEvolution...............ok

t/SeqFeatAnnotated...........ok

t/SeqFeatCollection..........ok

t/SeqFeature.................ok

t/SeqHound_DB................ok

t/SeqIO......................ok

t/SeqPattern.................ok

t/SeqStats...................ok

t/SeqUtils...................ok

t/SeqVersion.................ok

t/SeqWords...................ok

t/SequenceFamily.............ok

t/Sigcleave..................ok

t/Signalp....................ok

t/Signalp2...................ok

t/Sim4.......................ok

t/SimilarityPair.............ok

t/SimpleAlign................ok

t/SiteMatrix.................ok

t/Sopma......................ok

t/Species....................ok

t/Spidey.....................ok

t/StandAloneBlast............ok

        11/45 skipped: various reasons
t/StructIO...................ok

t/Structure..................ok

t/Symbol.....................ok

t/TagHaplotype...............ok

t/TandemRepeatsFinder........ok

t/TaxonTree..................skipped
        all skipped: All tests are being skipped, probably because the
module(s) being tested here are now deprecated
t/Taxonomy...................ok

t/Tempfile...................ok

t/Term.......................ok

t/Tmhmm......................ok

t/Tools......................ok

t/Tree.......................ok

t/TreeBuild..................ok

t/TreeIO.....................ok

t/UCSCParsers................ok

t/Unflattener................ok

t/Unflattener2...............ok

t/UniGene....................ok

t/Variation_IO...............ok

t/WABA.......................ok

t/WrapperBase................ok

t/abi........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
t/ace........................ok

t/alignUtilities.............ok

t/asciitree..................ok

t/blast_pull.................ok 1/287

#   Failed (TODO) test at t/blast_pull.t line 258.
#          got: '0.946'
#     expected: '0.943'
t/blast_pull.................ok

t/bsml_sax...................ok

t/chaosxml...................ok

t/cigarstring................ok

t/consed.....................ok

t/ctf........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
t/dblink.....................ok

t/ePCR.......................ok

t/embl.......................ok

t/entrezgene.................ok 542/1422Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/SeqIO/entrezgene.pm line
491.
t/entrezgene.................ok 966/1422Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/SeqIO/entrezgene.pm line
491.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/SeqIO/entrezgene.pm line
491.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/SeqIO/entrezgene.pm line
491.
t/entrezgene.................ok

t/est2genome.................ok

t/exp........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
t/fasta......................ok

t/flat.......................ok

t/game.......................ok

t/gcg........................ok

t/genbank....................ok

t/hmmer......................ok

t/hmmer_pull.................ok

t/interpro...................ok

t/kegg.......................ok

t/largefasta.................ok

t/largepseq..................ok

t/lasergene..................ok

t/lucy.......................ok

t/masta......................ok

t/metafasta..................ok

t/multiple_fasta.............ok

t/obo_parser.................ok

t/pICalculator...............ok

t/phd........................ok

t/pir........................ok

t/pln........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
t/primaryqual................ok

t/primedseq..................ok

t/primer3....................ok

t/protgraph..................ok 1/70

#   Failed (TODO) test at t/protgraph.t line 55.

#   Failed (TODO) test at t/protgraph.t line 56.
#          got: '13'
#     expected: '14'
t/protgraph..................ok 49/70

#   Failed (TODO) test at t/protgraph.t line 248.
#          got: 'Helicobacter pylori'
#     expected: 'Helicobacter pylori 26695'
t/protgraph..................ok

t/psm........................ok

t/qual.......................ok

t/raw........................ok

t/rnamotif...................ok

t/scf........................ok

t/seq_quality................ok

t/seqfeaturePrimer...........ok

t/seqread_fail...............ok

t/sequencetrace..............ok

t/seqwithquality.............ok

t/simpleGOparser.............ok

t/singlet....................ok

t/sirna......................ok

t/splicedseq.................ok

t/swiss......................ok 1/239

#   Failed (TODO) test at t/swiss.t line 47.
t/swiss......................ok

t/tRNAscanSE.................ok

t/tab........................ok

t/table......................ok

t/targetp....................ok

t/tigrxml....................ok

t/tinyseq....................ok

t/trim.......................ok

t/ztr........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
Failed Test  Stat Wstat Total Fail  List of Failed
----------------------------------------------------------------------------
---
t/Assembly.t    1   256    35    1  31
t/Genewise.t    3   768    53    3  37 41 45
 (3 subtests UNEXPECTEDLY SUCCEEDED), 9 tests and 43 subtests skipped.
Failed 2/248 test scripts. 4/15415 subtests failed.
Files=248, Tests=15415, 973 wallclock secs (123.75 cusr +  8.58 csys =
132.33 CPU)
Failed 2/248 test programs. 4/15415 subtests failed.



-----Original Message-----
From: Chris Fields [mailto:cjfields at uiuc.edu] 
Sent: Friday, September 28, 2007 1:00 PM
To: Forrest Zhang
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

If this is occurring using bioperl from CVS then I'll try taking a  
look at it.

chris

On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:

> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign








From bix at sendu.me.uk  Fri Sep 28 02:46:48 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 28 Sep 2007 07:46:48 +0100
Subject: [Bioperl-l] FW:  load_seqdatabase.pl error
In-Reply-To: <000101c80191$3b300e70$b1902b50$@com>
References: <000101c80191$3b300e70$b1902b50$@com>
Message-ID: <46FCA358.9070202@sendu.me.uk>

Forrest Zhang wrote:
> Oh, my God!  I am tring reinstall bioperl-live using CVS, so many error
> shown below.
[snip]
> t/Assembly.t    1   256    35    1  31
> t/Genewise.t    3   768    53    3  37 41 45

You failed 4 tests, and this is CVS. Don't worry about the failures if 
they're in tests of modules you're not using. Do you use the Assembly or 
Genewise modules?


From bix at sendu.me.uk  Fri Sep 28 02:40:04 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 28 Sep 2007 07:40:04 +0100
Subject: [Bioperl-l] cpan install
In-Reply-To: <000001c8017a$6384bae0$2a8e30a0$@com>
References: <46FC028F.3050000@usc.edu> <000001c8017a$6384bae0$2a8e30a0$@com>
Message-ID: <46FCA1C4.7030101@sendu.me.uk>

Forrest Zhang wrote:
> Try 
> cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
> 
> other question you should browse
> http://www.bioperl.org/wiki/Installing_Bioperl_for_Unix

Yes, the explanation for 1.5.2 not showing up in d /bioperl/ being 'only 
stable versions appear in that list'.


From forrest_zhang at 163.com  Fri Sep 28 07:26:56 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 19:26:56 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
Message-ID: <000301c801c2$7deb6080$79c22180$@com>

Yes, it is happened using CVS.

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Chris Fields
Sent: Friday, September 28, 2007 1:00 PM
To: Forrest Zhang
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

If this is occurring using bioperl from CVS then I'll try taking a  
look at it.

chris

On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:

> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign



_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





From forrest_zhang at 163.com  Fri Sep 28 07:28:41 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 19:28:41 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
Message-ID: <000401c801c2$ba0bae30$2e230a90$@com>

Message using CVS.

biocc bioperl-db # ./Build test
Copying scripts/biosql/terms/importrelation.pl ->
blib/script/importrelation.pl
blib/script/importrelation.pl -> blib/script/bp_importrelation.pl
Copying scripts/biosql/merge-unique-ann.pl ->
blib/script/merge-unique-ann.pl
blib/script/merge-unique-ann.pl -> blib/script/bp_merge-unique-ann.pl
Copying scripts/biosql/update-on-new-date.pl ->
blib/script/update-on-new-date.pl
blib/script/update-on-new-date.pl -> blib/script/bp_update-on-new-date.pl
Copying scripts/biosql/terms/add-term-annot.pl ->
blib/script/add-term-annot.pl
Deleting blib/script/add-term-annot.pl.bak
blib/script/add-term-annot.pl -> blib/script/bp_add-term-annot.pl
Copying scripts/corba/caching_corba_server.pl ->
blib/script/caching_corba_server.pl
Deleting blib/script/caching_corba_server.pl.bak
blib/script/caching_corba_server.pl ->
blib/script/bp_caching_corba_server.pl
Copying scripts/biosql/load_ontology.pl -> blib/script/load_ontology.pl
Deleting blib/script/load_ontology.pl.bak
blib/script/load_ontology.pl -> blib/script/bp_load_ontology.pl
Copying scripts/biosql/load_seqdatabase.pl ->
blib/script/load_seqdatabase.pl
Deleting blib/script/load_seqdatabase.pl.bak
blib/script/load_seqdatabase.pl -> blib/script/bp_load_seqdatabase.pl
Copying scripts/biosql/terms/interpro2go.pl -> blib/script/interpro2go.pl
blib/script/interpro2go.pl -> blib/script/bp_interpro2go.pl
Copying scripts/biosql/clean_ontology.pl -> blib/script/clean_ontology.pl
blib/script/clean_ontology.pl -> blib/script/bp_clean_ontology.pl
Copying scripts/corba/test_bioenv.pl -> blib/script/test_bioenv.pl
Deleting blib/script/test_bioenv.pl.bak
blib/script/test_bioenv.pl -> blib/script/bp_test_bioenv.pl
Copying scripts/biosql/update-on-new-version.pl ->
blib/script/update-on-new-version.pl
blib/script/update-on-new-version.pl ->
blib/script/bp_update-on-new-version.pl
Copying scripts/biosql/bioentry2flat.pl -> blib/script/bioentry2flat.pl
Deleting blib/script/bioentry2flat.pl.bak
blib/script/bioentry2flat.pl -> blib/script/bp_bioentry2flat.pl
Copying scripts/corba/bioenv_server.pl -> blib/script/bioenv_server.pl
Deleting blib/script/bioenv_server.pl.bak
blib/script/bioenv_server.pl -> blib/script/bp_bioenv_server.pl
Copying scripts/biosql/load_interpro.pl -> blib/script/load_interpro.pl
blib/script/load_interpro.pl -> blib/script/bp_load_interpro.pl
Copying scripts/biosql/cgi-bin/getentry.pl -> blib/script/getentry.pl
Deleting blib/script/getentry.pl.bak
blib/script/getentry.pl -> blib/script/bp_getentry.pl
Copying scripts/biosql/del-assocs-sql.pl -> blib/script/del-assocs-sql.pl
blib/script/del-assocs-sql.pl -> blib/script/bp_del-assocs-sql.pl
Copying scripts/biosql/freshen-annot.pl -> blib/script/freshen-annot.pl
blib/script/freshen-annot.pl -> blib/script/bp_freshen-annot.pl
t/01dbadaptor.....ok

t/02species.......FAILED tests 66-95

        Failed 30/65 tests, 53.85% okay
t/03simpleseq.....ok

t/04swiss.........ok

t/05seqfeature....ok

t/06comment.......ok

t/07dblink........ok

t/08genbank.......ok

t/09fuzzy2........ok

t/10ensembl.......ok

t/11locuslink.....ok

t/12ontology......ok

t/13remove........ok

t/14query.........ok

t/15cluster.......ok 9/160

--------------------- WARNING ---------------------
MSG: failed to store one or more child objects for an instance of class
Bio::Cluster::UniGene (PK=366)
---------------------------------------------------
t/15cluster.......ok

t/16obda..........ok

Failed Test   Stat Wstat Total Fail  List of Failed
----------------------------------------------------------------------------
---
t/02species.t               65   30  66-95
Failed 1/16 test scripts. -30/1423 subtests failed.
Files=16, Tests=1423, 36 wallclock secs (16.64 cusr +  0.65 csys = 17.29
CPU)
Failed 1/16 test programs. -30/1423 subtests failed.

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Chris Fields
Sent: Friday, September 28, 2007 1:00 PM
To: Forrest Zhang
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

If this is occurring using bioperl from CVS then I'll try taking a  
look at it.

chris

On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:

> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign



_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





From hlapp at gmx.net  Fri Sep 28 11:36:39 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 28 Sep 2007 11:36:39 -0400
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <46F8DC34.6020908@sendu.me.uk>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
Message-ID: <8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>

You do have a point here. From a design perspective, it feels odd if  
instantiating an object can fail with an I/O exception. But in  
reality that's how it's done all the time, from Bio::SeqIO to  
java.io.*, if I'm not mistaken. I also agree that asking a  
conditional that we know will be false every time except once  
violates the sense of elegance.

So upon second consideration, I think I agree with you. And a GFF3  
file with zero features in it should still be a valid GFF3 file,  
i.e., have the mandatory headers.

Does that make sense?

	-hilmar

On Sep 25, 2007, at 6:00 AM, Sendu Bala wrote:

> Hilmar Lapp wrote:
>> On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:
>>> I think that'll work fine.  The other option would be call a
>>> print_gff_header() function within write_feature() with the  
>>> intent to
>>> print the header only once, using a flag or similar:
>>>
>>> if (!$self->header_printed) {
>>>      $self->print_gff_header;
>>>      $self->header_printed(1);
>>> }
> >
>> I'd lean toward this or a similar approach too. Writing stuff out  
>> in the constructor doesn't feel like the best design.
>
> I'd argue that the alternative is just inefficient with no  
> compensating benefit. You have something that must only be done  
> once, and a method (_initialize) that is only called once. The  
> constructor is used to set up the file, getting it into a state  
> ready to add features. This involves opening it for writing with  
> the correct filename and setting the desired GFF version. Why  
> wouldn't it also output what ever else was necessary it initialize  
> the file?
>
> Also, what do we expect should happen when we use Bioperl to create  
> a GFF file and don't write any features to it? Should it be an  
> empty file, or should it contain whatever GFF information the user  
> had managed to supply (the version)?

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From hlapp at gmx.net  Fri Sep 28 11:53:33 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 28 Sep 2007 11:53:33 -0400
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
Message-ID: <9917490A-B7AF-4AE6-9C78-AD516700155B@gmx.net>

Chris let me know if you get stumped. I'm surprised that the special  
ranks ('eurosids I' etc) show up in the lineage (has NCBI started to  
assign ranks to them? I thought I filter them out. Needs to be looked  
into too.), but at any rate I don't understand why they aren't being  
accepted.

Also, maybe we need a more verbose output here - Forrest, can you run  
this with adding a --printerror argument. (I'm embarrassed to find  
that this doesn't seem to be documented. Sigh.)

	-hilmar

On Sep 28, 2007, at 1:00 AM, Chris Fields wrote:

> If this is occurring using bioperl from CVS then I'll try taking a
> look at it.
>
> chris
>
> On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:
>
>> Hilmar,
>> 	I have already pre-loaded the NCBI taxonomy using
>> load_ncbi_taxonomy.pl yet. The error message show:
>>
>> --------------------- WARNING ---------------------
>> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I
>> was
>> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I
>> | rosids
>> | core eudicotyledons | eudicotyledons | Magnoliophyta |
>> Euphyllophyta |
>> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
>> ---------------------------------------------------
>> Could not store Q40784:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: create: object (Bio::Species) failed to insert or to be found
>> by unique
>> key
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:206
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: /usr/bin/bp_load_seqdatabase.pl:633
>> -----------------------------------------------------------
>> Sigh~~~~~~
>>
>> Forrest Zhang
>>
>>
>> -----Original Message-----
>> From: bioperl-l-bounces at lists.open-bio.org
>> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar  
>> Lapp
>> Sent: Friday, September 28, 2007 6:17 AM
>> To: Forrest
>> Cc: bioperl-l at bioperl.org
>> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>>
>> Forrest,
>>
>> have you preloaded the NCBI taxonomy as suggested in the BioSQL
>> installation guidelines? SwissProt format has NCBI taxon IDs, and the
>> code will try to use it to look up species and their lineage, rather
>> than inserting the lineage from whatever BioPerl parses out of the
>> sequence record.
>>
>> 	-hilmar
>>
>> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>>
>>> Hi, all
>>>     I install the biosql, and bioperl-db. I want to import
>>> swissport data.
>>> But the programe show some error as below:
>>> ==================================================================== 
>>> =
>>> =
>>> ======
>>> ===============================================
>>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver  
>>>> mysql
>>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>>> Could not store Q6DAH5:
>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>>> subsp.
>>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>>> Pectobacterium |
>>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>>> Proteobacteria | Bacteria')
>>> STACK: Error::throw
>>> STACK: Bio::Root::Root::throw
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>>> STACK: Bio::Species::classification
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:552
>>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:1305
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:973
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:852
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:182
>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:244
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:169
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:251
>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:271
>>> STACK: load_seqdatabase.pl:620
>>> -----------------------------------------------------------
>>>
>>>  at load_seqdatabase.pl line 633
>>> ==================================================================== 
>>> =
>>> =
>>> ======
>>> ===============================================
>>>
>>> How can I solve it, please help me, Thank you.
>>>
>>> Thanks
>>> Forrest zhang
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> -- 
>> ===========================================================
>> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
>> ===========================================================
>>
>>
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From cjfields at uiuc.edu  Fri Sep 28 12:04:08 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 11:04:08 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
Message-ID: <5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>

On Sep 28, 2007, at 10:36 AM, Hilmar Lapp wrote:

> You do have a point here. From a design perspective, it feels odd  
> if instantiating an object can fail with an I/O exception. But in  
> reality that's how it's done all the time, from Bio::SeqIO to  
> java.io.*, if I'm not mistaken. I also agree that asking a  
> conditional that we know will be false every time except once  
> violates the sense of elegance.

I agree with the lack of elegance from a design perspective on both  
counts, but when have we ever been worried about that? ;>

In general I don't think SeqIO classes generates actual output (like  
the GFF header information) in the constructor, they just initialize  
IO and other state data.  It makes sense to fail in this case if an  
error pops up.  Regardless, one could argue ad infinitum that either  
proposed fix has its benefits/deficiencies, however both will work,  
so I'm happy with either.

chris

> So upon second consideration, I think I agree with you. And a GFF3  
> file with zero features in it should still be a valid GFF3 file,  
> i.e., have the mandatory headers.
>
> Does that make sense?
>
> 	-hilmar
>
> On Sep 25, 2007, at 6:00 AM, Sendu Bala wrote:
>
>> Hilmar Lapp wrote:
>>> On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:
>>>> I think that'll work fine.  The other option would be call a
>>>> print_gff_header() function within write_feature() with the  
>>>> intent to
>>>> print the header only once, using a flag or similar:
>>>>
>>>> if (!$self->header_printed) {
>>>>      $self->print_gff_header;
>>>>      $self->header_printed(1);
>>>> }
>> >
>>> I'd lean toward this or a similar approach too. Writing stuff out  
>>> in the constructor doesn't feel like the best design.
>>
>> I'd argue that the alternative is just inefficient with no  
>> compensating benefit. You have something that must only be done  
>> once, and a method (_initialize) that is only called once. The  
>> constructor is used to set up the file, getting it into a state  
>> ready to add features. This involves opening it for writing with  
>> the correct filename and setting the desired GFF version. Why  
>> wouldn't it also output what ever else was necessary it initialize  
>> the file?
>>
>> Also, what do we expect should happen when we use Bioperl to  
>> create a GFF file and don't write any features to it? Should it be  
>> an empty file, or should it contain whatever GFF information the  
>> user had managed to supply (the version)?
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From cjfields at uiuc.edu  Fri Sep 28 12:10:59 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 11:10:59 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <9917490A-B7AF-4AE6-9C78-AD516700155B@gmx.net>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
	<9917490A-B7AF-4AE6-9C78-AD516700155B@gmx.net>
Message-ID: <EECC931E-C7B5-485E-B059-4A7A9A7C092E@uiuc.edu>

I'm actually getting some odd recursion issues again; not sure what's  
causing it, but a reinstall of both bioperl and bioperl-db fixed it  
last time.  It may be related to the rollback, just not sure yet.

I'll try tracking it down if it persists (bad pun).

t/04swiss....ok 3/52
--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------
t/04swiss....ok
All tests successful.
Files=1, Tests=52,  2 wallclock secs ( 1.33 cusr +  0.18 csys =  1.51  
CPU)

The specific error under verbose running is:

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:680
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:677
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:691
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:677
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:691
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:677
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:677
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:658
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store /Users/cjfields/ 
src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:252
STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
PrimarySeqAdaptor.pm:229
STACK Bio::DB::BioSQL::SeqAdaptor::store_children /Users/cjfields/src/ 
core/bioperl-db/blib/lib/Bio/DB/BioSQL/SeqAdaptor.pm:217
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create /Users/cjfields/ 
src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:213
STACK Bio::DB::Persistent::PersistentObject::create /Users/cjfields/ 
src/core/bioperl-db/blib/lib/Bio/DB/Persistent/PersistentObject.pm:244
STACK toplevel t/04swiss.t:37
---------------------------------------------------


chris

On Sep 28, 2007, at 10:53 AM, Hilmar Lapp wrote:

> Chris let me know if you get stumped. I'm surprised that the special
> ranks ('eurosids I' etc) show up in the lineage (has NCBI started to
> assign ranks to them? I thought I filter them out. Needs to be looked
> into too.), but at any rate I don't understand why they aren't being
> accepted.
>
> Also, maybe we need a more verbose output here - Forrest, can you run
> this with adding a --printerror argument. (I'm embarrassed to find
> that this doesn't seem to be documented. Sigh.)
>
> 	-hilmar
>
> On Sep 28, 2007, at 1:00 AM, Chris Fields wrote:
>
>> If this is occurring using bioperl from CVS then I'll try taking a
>> look at it.
>>
>> chris
>>
>> On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:
>>
>>> Hilmar,
>>> 	I have already pre-loaded the NCBI taxonomy using
>>> load_ncbi_taxonomy.pl yet. The error message show:
>>>
>>> --------------------- WARNING ---------------------
>>> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I
>>> was
>>> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I
>>> | rosids
>>> | core eudicotyledons | eudicotyledons | Magnoliophyta |
>>> Euphyllophyta |
>>> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
>>> ---------------------------------------------------
>>> Could not store Q40784:
>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>> MSG: create: object (Bio::Species) failed to insert or to be found
>>> by unique
>>> key
>>> STACK: Error::throw
>>> STACK: Bio::Root::Root::throw
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:206
>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:244
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:169
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:251
>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:271
>>> STACK: /usr/bin/bp_load_seqdatabase.pl:633
>>> -----------------------------------------------------------
>>> Sigh~~~~~~
>>>
>>> Forrest Zhang
>>>
>>>
>>> -----Original Message-----
>>> From: bioperl-l-bounces at lists.open-bio.org
>>> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar
>>> Lapp
>>> Sent: Friday, September 28, 2007 6:17 AM
>>> To: Forrest
>>> Cc: bioperl-l at bioperl.org
>>> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>>>
>>> Forrest,
>>>
>>> have you preloaded the NCBI taxonomy as suggested in the BioSQL
>>> installation guidelines? SwissProt format has NCBI taxon IDs, and  
>>> the
>>> code will try to use it to look up species and their lineage, rather
>>> than inserting the lineage from whatever BioPerl parses out of the
>>> sequence record.
>>>
>>> 	-hilmar
>>>
>>> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>>>
>>>> Hi, all
>>>>     I install the biosql, and bioperl-db. I want to import
>>>> swissport data.
>>>> But the programe show some error as below:
>>>> =================================================================== 
>>>> =
>>>> =
>>>> =
>>>> ======
>>>> ===============================================
>>>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver
>>>>> mysql
>>>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>>>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>>>> Could not store Q6DAH5:
>>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>>>> subsp.
>>>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>>>> Pectobacterium |
>>>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>>>> Proteobacteria | Bacteria')
>>>> STACK: Error::throw
>>>> STACK: Bio::Root::Root::throw
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>>>> STACK: Bio::Species::classification
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>>>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:552
>>>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:1305
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:973
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:852
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:182
>>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:244
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:169
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:251
>>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:271
>>>> STACK: load_seqdatabase.pl:620
>>>> -----------------------------------------------------------
>>>>
>>>>  at load_seqdatabase.pl line 633
>>>> =================================================================== 
>>>> =
>>>> =
>>>> =
>>>> ======
>>>> ===============================================
>>>>
>>>> How can I solve it, please help me, Thank you.
>>>>
>>>> Thanks
>>>> Forrest zhang
>>>>
>>>>
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>> -- 
>>> ===========================================================
>>> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
>>> ===========================================================
>>>
>>>
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From hlapp at gmx.net  Fri Sep 28 17:09:28 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 28 Sep 2007 17:09:28 -0400
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
Message-ID: <41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>


On Sep 28, 2007, at 12:04 PM, Chris Fields wrote:

> In general I don't think SeqIO classes generates actual output  
> (like the GFF header information) in the constructor

There's probably two reasons they don't (if really all of them  
don't): i) unless you explicitly test (how?) whether the file has  
been opened for writing, you actually don't know in the SeqIO  
constructor whether someone's going to write to the file or read from  
it. ii) off hand, I don't know of a sequence file format that would  
require a particular header being written just once.

Though thinking about this, I start asking myself whether i) wouldn't  
also apply to FeatureIO (are we not reading gff too in this class?),  
and I'm wondering that there must  be a header (or at least an  
enclosing tag) for SeqIO XML formats - so how is that dealt with there?

	-hilmar
-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From cjfields at uiuc.edu  Fri Sep 28 17:34:13 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 16:34:13 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
Message-ID: <530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>


On Sep 28, 2007, at 4:09 PM, Hilmar Lapp wrote:

>
> On Sep 28, 2007, at 12:04 PM, Chris Fields wrote:
>
>> In general I don't think SeqIO classes generates actual output
>> (like the GFF header information) in the constructor
>
> There's probably two reasons they don't (if really all of them
> don't): i) unless you explicitly test (how?) whether the file has
> been opened for writing, you actually don't know in the SeqIO
> constructor whether someone's going to write to the file or read from
> it. ii) off hand, I don't know of a sequence file format that would
> require a particular header being written just once.
>
> Though thinking about this, I start asking myself whether i) wouldn't
> also apply to FeatureIO (are we not reading gff too in this class?),
> and I'm wondering that there must  be a header (or at least an
> enclosing tag) for SeqIO XML formats - so how is that dealt with  
> there?
>
> 	-hilmar

Re: (i) and FeatureIO: I believe most FeatureIO classes read/write to/ 
from specific feature files (bed, gff, ptt, interpro, etc), which is  
one reason I thought everything I(nput) should go into next_feature 
(), everything O(utput) into write_feature().  The section writing  
the gff header info in _initialize() checks the file specifically for  
'>' prior to output; I think Sendu planned on changing that to use  
mode() instead.

Re: (ii): I'm not sure, actually; I wouldn't be surprised if XML  
output hasn't been tested very well.

If I could go to the Nov. GMOD meeting to help hammer out some of the  
GFF3/FeatureIO/SF::Annotated stuff I would, but I would be traveling  
on my own dime.  Maybe I'll see what I can come up with and stay at  
the no-tell motel...

chris


From cjfields at uiuc.edu  Fri Sep 28 18:03:06 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 17:03:06 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <EECC931E-C7B5-485E-B059-4A7A9A7C092E@uiuc.edu>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
	<9917490A-B7AF-4AE6-9C78-AD516700155B@gmx.net>
	<EECC931E-C7B5-485E-B059-4A7A9A7C092E@uiuc.edu>
Message-ID: <FD7C7306-92E1-49D9-93E4-EDFBF09E1A1A@uiuc.edu>

Okay, fixed the recursion (extra copy of a BasePersistentAdaptor  
module I was working which tripped it, so nothing in CVS).

Forrest, I get all tests passing.  I used a database without taxonomy  
loaded with bioperl-db and bioperl from cvs and it worked w/o  
problems.  I'll try working with your sequence when I have time this  
weekend.

chris

On Sep 28, 2007, at 11:10 AM, Chris Fields wrote:

> I'm actually getting some odd recursion issues again; not sure what's
> causing it, but a reinstall of both bioperl and bioperl-db fixed it
> last time.  It may be related to the rollback, just not sure yet.
>
> I'll try tracking it down if it persists (bad pun).
>
> t/04swiss....ok 3/52
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
> t/04swiss....ok
> All tests successful.
> Files=1, Tests=52,  2 wallclock secs ( 1.33 cusr +  0.18 csys =  1.51
> CPU)
>
> The specific error under verbose running is:
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:680
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:677
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:691
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:677
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:691
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:677
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:677
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:658
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store /Users/cjfields/
> src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:252
> STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> PrimarySeqAdaptor.pm:229
> STACK Bio::DB::BioSQL::SeqAdaptor::store_children /Users/cjfields/src/
> core/bioperl-db/blib/lib/Bio/DB/BioSQL/SeqAdaptor.pm:217
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create /Users/cjfields/
> src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:213
> STACK Bio::DB::Persistent::PersistentObject::create /Users/cjfields/
> src/core/bioperl-db/blib/lib/Bio/DB/Persistent/PersistentObject.pm:244
> STACK toplevel t/04swiss.t:37
> ---------------------------------------------------
>
>
> chris
>
> On Sep 28, 2007, at 10:53 AM, Hilmar Lapp wrote:
>
>> Chris let me know if you get stumped. I'm surprised that the special
>> ranks ('eurosids I' etc) show up in the lineage (has NCBI started to
>> assign ranks to them? I thought I filter them out. Needs to be looked
>> into too.), but at any rate I don't understand why they aren't being
>> accepted.
>>
>> Also, maybe we need a more verbose output here - Forrest, can you run
>> this with adding a --printerror argument. (I'm embarrassed to find
>> that this doesn't seem to be documented. Sigh.)
>>
>> 	-hilmar
>>
>> On Sep 28, 2007, at 1:00 AM, Chris Fields wrote:
>>
>>> If this is occurring using bioperl from CVS then I'll try taking a
>>> look at it.
>>>
>>> chris
>>>
>>> On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:
>>>
>>>> Hilmar,
>>>> 	I have already pre-loaded the NCBI taxonomy using
>>>> load_ncbi_taxonomy.pl yet. The error message show:
>>>>
>>>> --------------------- WARNING ---------------------
>>>> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I
>>>> was
>>>> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I
>>>> | rosids
>>>> | core eudicotyledons | eudicotyledons | Magnoliophyta |
>>>> Euphyllophyta |
>>>> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
>>>> ---------------------------------------------------
>>>> Could not store Q40784:
>>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>>> MSG: create: object (Bio::Species) failed to insert or to be found
>>>> by unique
>>>> key
>>>> STACK: Error::throw
>>>> STACK: Bio::Root::Root::throw
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:206
>>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:244
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:169
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:251
>>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:271
>>>> STACK: /usr/bin/bp_load_seqdatabase.pl:633
>>>> -----------------------------------------------------------
>>>> Sigh~~~~~~
>>>>
>>>> Forrest Zhang
>>>>
>>>>
>>>> -----Original Message-----
>>>> From: bioperl-l-bounces at lists.open-bio.org
>>>> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar
>>>> Lapp
>>>> Sent: Friday, September 28, 2007 6:17 AM
>>>> To: Forrest
>>>> Cc: bioperl-l at bioperl.org
>>>> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>>>>
>>>> Forrest,
>>>>
>>>> have you preloaded the NCBI taxonomy as suggested in the BioSQL
>>>> installation guidelines? SwissProt format has NCBI taxon IDs, and
>>>> the
>>>> code will try to use it to look up species and their lineage,  
>>>> rather
>>>> than inserting the lineage from whatever BioPerl parses out of the
>>>> sequence record.
>>>>
>>>> 	-hilmar
>>>>
>>>> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>>>>
>>>>> Hi, all
>>>>>     I install the biosql, and bioperl-db. I want to import
>>>>> swissport data.
>>>>> But the programe show some error as below:
>>>>> ================================================================== 
>>>>> =
>>>>> =
>>>>> =
>>>>> =
>>>>> ======
>>>>> ===============================================
>>>>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver
>>>>>> mysql
>>>>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>>>>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>>>>> Could not store Q6DAH5:
>>>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>>>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>>>>> subsp.
>>>>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>>>>> Pectobacterium |
>>>>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>>>>> Proteobacteria | Bacteria')
>>>>> STACK: Error::throw
>>>>> STACK: Bio::Root::Root::throw
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>>>>> STACK: Bio::Species::classification
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>>>>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>>> PersistentObject.pm:552
>>>>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:1305
>>>>> STACK:  
>>>>> Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:973
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:852
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:182
>>>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>>> PersistentObject.pm:244
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:169
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:251
>>>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>>> PersistentObject.pm:271
>>>>> STACK: load_seqdatabase.pl:620
>>>>> -----------------------------------------------------------
>>>>>
>>>>>  at load_seqdatabase.pl line 633
>>>>> ================================================================== 
>>>>> =
>>>>> =
>>>>> =
>>>>> =
>>>>> ======
>>>>> ===============================================
>>>>>
>>>>> How can I solve it, please help me, Thank you.
>>>>>
>>>>> Thanks
>>>>> Forrest zhang
>>>>>
>>>>>
>>>>>
>>>>> _______________________________________________
>>>>> Bioperl-l mailing list
>>>>> Bioperl-l at lists.open-bio.org
>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>> -- 
>>>> ===========================================================
>>>> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
>>>> ===========================================================
>>>>
>>>>
>>>>
>>>>
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>>
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>> Christopher Fields
>>> Postdoctoral Researcher
>>> Lab of Dr. Robert Switzer
>>> Dept of Biochemistry
>>> University of Illinois Urbana-Champaign
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> -- 
>> ===========================================================
>> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
>> ===========================================================
>>
>>
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From hlapp at gmx.net  Fri Sep 28 18:20:37 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 28 Sep 2007 18:20:37 -0400
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
	<530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
Message-ID: <5FC8F92C-42DD-4DAF-8008-0F8C545065B5@gmx.net>


On Sep 28, 2007, at 5:34 PM, Chris Fields wrote:

> The section writing the gff header info in _initialize() checks the  
> file specifically for '>' prior to output; I think Sendu planned on  
> changing that to use mode() instead.

What if we pass in a file handle?

	-hilmar
-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From cjfields at uiuc.edu  Fri Sep 28 19:04:21 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 18:04:21 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <5FC8F92C-42DD-4DAF-8008-0F8C545065B5@gmx.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
	<530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
	<5FC8F92C-42DD-4DAF-8008-0F8C545065B5@gmx.net>
Message-ID: <E351BFD9-57C8-4A62-986F-F5E674B28FC5@uiuc.edu>


On Sep 28, 2007, at 5:20 PM, Hilmar Lapp wrote:

>
> On Sep 28, 2007, at 5:34 PM, Chris Fields wrote:
>
>> The section writing the gff header info in _initialize() checks the
>> file specifically for '>' prior to output; I think Sendu planned on
>> changing that to use mode() instead.
>
> What if we pass in a file handle?
>
> 	-hilmar

The old way def. wouldn't work with filehandles.  Not sure if  
checking Root::IO::mode() would work as expected in this case, but  
it's certainly worth a try.

chris


From jay at jays.net  Fri Sep 28 18:50:29 2007
From: jay at jays.net (Jay Hannah)
Date: Fri, 28 Sep 2007 17:50:29 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
	<530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
Message-ID: <FAFE7FDD-5191-4500-894E-05A11E71D410@jays.net>

On Sep 28, 2007, at 4:34 PM, Chris Fields wrote:
> On Sep 28, 2007, at 4:09 PM, Hilmar Lapp wrote:
>> and I'm wondering that there must  be a header (or at least an
>> enclosing tag) for SeqIO XML formats - so how is that dealt with
>> there?
>
> Re: (ii): I'm not sure, actually; I wouldn't be surprised if XML
> output hasn't been tested very well.

For good or ill I stole what I found in other Bio/SeqIO/* classes  
when I started writing my Bio::SeqIO::solrxml. It is not ready, but  
you can poke it with a stick here if you like:

http://vc.jays.net/viewvc.cgi/SolrGene/solrxml.pm? 
revision=26&root=CLAB&view=markup

In _initialize() it sends XML header goo into $self->_print(), and it  
uses DESTROY to drop an XML closure tag into $self->_print().

Constructing it

$out_solr  = Bio::SeqIO->new(-file => ">seq.solr.xml",
                              -format => 'solrxml');

without writing any sequences to it created a seq.solr.xml file with  
the XML header and footer and nothing in the middle.

If this is not The Right Way I'm happy to change it to do whatever.  :)

> If I could go to the Nov. GMOD meeting to help hammer out some of the
> GFF3/FeatureIO/SF::Annotated stuff I would, but I would be traveling
> on my own dime.  Maybe I'll see what I can come up with and stay at
> the no-tell motel...

I've decided to spend many of my own dimes and make the trek. I hope  
to meet many BioPerl'ers. I'll buy you dinner if you show up.  :)

Take care,

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah





From cjfields at uiuc.edu  Sat Sep 29 14:28:16 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sat, 29 Sep 2007 13:28:16 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <FAFE7FDD-5191-4500-894E-05A11E71D410@jays.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
	<530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
	<FAFE7FDD-5191-4500-894E-05A11E71D410@jays.net>
Message-ID: <E6C9C3D8-9E3F-4740-B590-6F4E5A152C5E@uiuc.edu>


On Sep 28, 2007, at 5:50 PM, Jay Hannah wrote:

> On Sep 28, 2007, at 4:34 PM, Chris Fields wrote:
>> On Sep 28, 2007, at 4:09 PM, Hilmar Lapp wrote:
>>> and I'm wondering that there must  be a header (or at least an
>>> enclosing tag) for SeqIO XML formats - so how is that dealt with
>>> there?
>>
>> Re: (ii): I'm not sure, actually; I wouldn't be surprised if XML
>> output hasn't been tested very well.
>
> For good or ill I stole what I found in other Bio/SeqIO/* classes
> when I started writing my Bio::SeqIO::solrxml. It is not ready, but
> you can poke it with a stick here if you like:
>
> http://vc.jays.net/viewvc.cgi/SolrGene/solrxml.pm?
> revision=26&root=CLAB&view=markup
>
> In _initialize() it sends XML header goo into $self->_print(), and it
> uses DESTROY to drop an XML closure tag into $self->_print().
>
> Constructing it
>
> $out_solr  = Bio::SeqIO->new(-file => ">seq.solr.xml",
>                               -format => 'solrxml');
>
> without writing any sequences to it created a seq.solr.xml file with
> the XML header and footer and nothing in the middle.
>
> If this is not The Right Way I'm happy to change it to do  
> whatever.  :)

If you do it this way you should probably run a check on the mode()  
the object state is in ('r'=read, 'w'=write, '?'=unknown), and only  
_print() on write mode.  Might also be a good idea to implement a  
next_seq with an exception ('Module is write only').

>> If I could go to the Nov. GMOD meeting to help hammer out some of the
>> GFF3/FeatureIO/SF::Annotated stuff I would, but I would be traveling
>> on my own dime.  Maybe I'll see what I can come up with and stay at
>> the no-tell motel...
>
> I've decided to spend many of my own dimes and make the trek. I hope
> to meet many BioPerl'ers. I'll buy you dinner if you show up.  :)
>
> Take care,
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

I may see what I can scrape up myself but it doesn't look good (lab's  
closing down soon, so money's pretty tight).  If I knew about the  
meeting a while in advance I would probably have made it.  Oh well!

chris



From cjfields at uiuc.edu  Sun Sep 30 16:39:23 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 30 Sep 2007 15:39:23 -0500
Subject: [Bioperl-l] DB::SeqFeature::Store error
Message-ID: <A56E6D20-EF3E-4B5D-B3F2-9F2B7D0178EF@uiuc.edu>

I'm getting the following error on my local MySQL (v 5.0.41) with  
bp_seqfeature_load:

-------------------- EXCEPTION --------------------
MSG: The used table type doesn't support FULLTEXT indexes
STACK Bio::DB::SeqFeature::Store::DBI::mysql::_init_database /Library/ 
Perl/5.8.6/Bio/DB/SeqFeature/Store/DBI/mysql.pm:414
STACK Bio::DB::SeqFeature::Store::init_database /Library/Perl/5.8.6/ 
Bio/DB/SeqFeature/Store.pm:382
STACK Bio::DB::SeqFeature::Store::DBI::mysql::init /Library/Perl/ 
5.8.6/Bio/DB/SeqFeature/Store/DBI/mysql.pm:218
STACK Bio::DB::SeqFeature::Store::new /Library/Perl/5.8.6/Bio/DB/ 
SeqFeature/Store.pm:345
STACK toplevel /usr/local/bin/bp_seqfeature_load.pl:57
-------------------------------------------

The default setting for storage is InnoDB; switching to MyISAM fixes  
the issue.  Should we specify TYPE = MyISAM with the various CREATE  
TABLE queries in Bio::DB::SeqFeature::Store::DBI::mysql to be on the  
safe side?

chris


From alan at tll.org.sg  Sun Sep 30 21:53:07 2007
From: alan at tll.org.sg (alan)
Date: Mon, 1 Oct 2007 09:53:07 +0800
Subject: [Bioperl-l] exonerate
References: <034FB11C-B4E9-4E4E-B213-D4AC6A397B1B@tll.org.sg>
Message-ID: <29C4D729-6715-4C19-9872-3B1AF90EAFA3@tll.org.sg>

Hi,


>> I am calling exonerate.pm within my script while attempting to  
>> align cDNA  to multiple genomic fragments. After processing about  
>> 120+ genomic fragments my code crashes with the following error:
>>
>> ** ERROR **: Could not open [/tmp/tlInatbOED] : Too many open files
>> aborting...
>> MSG: Exonerate call (/usr/local/bin/exonerate   /tmp/8X9jQuHUGF / 
>> tmp/tlInatbOED  > /tmp/EolF5qCNLZ/cIf0HfIRf5) crashed: 34304
>> STACK Bio::Tools::Run::Alignment::Exonerate::_run /nfs1/alan/ 
>> cvs_src/bioperl-run/Bio/Tools/Run/Alignment/Exonerate.pm:214
>> STACK Bio::Tools::Run::Alignment::Exonerate::run /nfs1/alan/ 
>> cvs_src/bioperl-run/Bio/Tools/Run/Alignment/Exonerate.pm:174
>>
>> The code in Exonerate.pm closes the tmpfile at the end of the  
>> routine yet I get the error message about "too many open files".
>> Any suggestions on how I should be closing these files?
>>
>>
>> Extract from my code that runs exonerate is listed below.
>>
>> foreach my $f(@files) {
>>   next unless (-f  "$dir/$f");
>>   my $q_in = Bio::SeqIO->new(-file=>$query, -format=>"Fasta");
>>   my $query_obj = $q_in->next_seq();
>>   my $target_in = Bio::SeqIO->new(-file=>"$dir/$f", - 
>> format=>"Fasta");
>>   my $target_obj = $target_in->next_seq();
>>   my $run = Bio::Tools::Run::Alignment::Exonerate->new();
>>   my $exonerate_io = $run->run($query_obj, $target_obj);
>>
>>   [code for parsing the data.......]
>>
>>   $exonerate_io->close; #tried this line out of desperation but it  
>> did not help :-)
>> }
>>
>> thanks
>> alan
>>
>>
>>
>> Alan Christoffels
>> Computational Biology Group
>> Temasek LifeSciences Laboratory
>> 1 Research Link
>> National University of Singapore
>> Singapore
>> 117604
>> Tel: +65 68744945
>> Fax: +65 68727007
>> Lab webpage: http://www.tll.org.sg/alan.asp
>>
>>
>



From ewijaya at gmail.com  Sun Sep 30 10:10:25 2007
From: ewijaya at gmail.com (Edward Wijaya)
Date: Sun, 30 Sep 2007 22:10:25 +0800
Subject: [Bioperl-l] Bio::Graphics - Howto draw graded segments overlap with
	line track
Message-ID: <3521d3670709300710l4a41c47es1c72cc5a450a3736@mail.gmail.com>

Hi,

I want to draw a binding sites hits on sequence of various length.
What I have now is a graded segments only. Is there a way to draw
segments overlapping with the line ? (see attached figure).

--
Edward
-------------- next part --------------
A non-text attachment was scrubbed...
Name: hits.PNG
Type: image/png
Size: 15613 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20070930/2402791e/attachment-0003.png>

From cjfields at uiuc.edu  Sun Sep  2 23:54:54 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 2 Sep 2007 18:54:54 -0500
Subject: [Bioperl-l] (no subject)
Message-ID: <CA6A55BB-BB63-4FCE-A0AA-FBB2392C778F@uiuc.edu>

Posted this to biosql-l already but felt it needed posting here as  
well.  Sorry if you get this twice.

I noticed some critical recursion issues with bioperl-db when working  
in Bio::Ontology changes.  This was using bioperl-live (post-feature/ 
annotation fixes).  Bug report is here:

http://bugzilla.open-bio.org/show_bug.cgi?id=2355

It seems to be Bio:Taxon related; this is from 03swiss.t:

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:681
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:692
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
...
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:587
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:253
STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
PrimarySeqAdaptor.pm:229
STACK Bio::DB::BioSQL::SeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
SeqAdaptor.pm:217
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:214
STACK Bio::DB::Persistent::PersistentObject::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/Persistent/ 
PersistentObject.pm:244
STACK toplevel t/04swiss.t:36
---------------------------------------------------

Also, seeing this with 13remove.t and 15.cluster.t, both of which  
appear to infinitely recurse:

Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 587, <GEN0> line 1.
Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 630, <GEN0> line 1.


chris



From cjfields at uiuc.edu  Sun Sep  2 23:57:59 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 2 Sep 2007 18:57:59 -0500
Subject: [Bioperl-l] recursion issues with bioperl-db
Message-ID: <2E14450C-C135-42DD-A9DE-EB47EB80E6AC@uiuc.edu>

Apologies if you get this more than once; the first post appeared to  
get sent w/o a proper subject line.  Posted this to biosql-l already  
but felt it needed posting here as well.

I noticed some critical recursion issues with bioperl-db when working  
in Bio::Ontology changes.  This was using bioperl-live (post-feature/ 
annotation fixes).  Bug report is here:

http://bugzilla.open-bio.org/show_bug.cgi?id=2355

It seems to be Bio:Taxon related; this is from 03swiss.t:

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:681
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:692
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:630
...
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:587
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:253
STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
PrimarySeqAdaptor.pm:229
STACK Bio::DB::BioSQL::SeqAdaptor::store_children
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
SeqAdaptor.pm:217
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:214
STACK Bio::DB::Persistent::PersistentObject::create
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/Persistent/ 
PersistentObject.pm:244
STACK toplevel t/04swiss.t:36
---------------------------------------------------

Also, seeing this with 13remove.t and 15.cluster.t, both of which  
appear to infinitely recurse:

Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 587, <GEN0> line 1.
Deep recursion on subroutine
"Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child" at
/Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm
line 630, <GEN0> line 1.


chris



From cjfields at uiuc.edu  Mon Sep  3 01:40:48 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 2 Sep 2007 20:40:48 -0500
Subject: [Bioperl-l] recursion issues with bioperl-db
In-Reply-To: <2E14450C-C135-42DD-A9DE-EB47EB80E6AC@uiuc.edu>
References: <2E14450C-C135-42DD-A9DE-EB47EB80E6AC@uiuc.edu>
Message-ID: <25CFD36D-D921-4F5F-BADF-D858A2FE76D4@uiuc.edu>

Okay, we can the previous posts!  Odd, but I started from scratch and  
can't reproduce the issue; there may have been some cross-talk with  
different bioperl installations on my laptop.  Anyway, everything  
passes now w/o recursion so I'll mark the bug as invalid.

chris

On Sep 2, 2007, at 6:57 PM, Chris Fields wrote:

> Apologies if you get this more than once; the first post appeared to
> get sent w/o a proper subject line.  Posted this to biosql-l already
> but felt it needed posting here as well.
>
> I noticed some critical recursion issues with bioperl-db when working
> in Bio::Ontology changes.  This was using bioperl-live (post-feature/
> annotation fixes).  Bug report is here:
>
> http://bugzilla.open-bio.org/show_bug.cgi?id=2355
>
> It seems to be Bio:Taxon related; this is from 03swiss.t:
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:681
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:630
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:692
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:630
> ...
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:587
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:253
> STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> PrimarySeqAdaptor.pm:229
> STACK Bio::DB::BioSQL::SeqAdaptor::store_children
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> SeqAdaptor.pm:217
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:214
> STACK Bio::DB::Persistent::PersistentObject::create
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/Persistent/
> PersistentObject.pm:244
> STACK toplevel t/04swiss.t:36
> ---------------------------------------------------
>
> Also, seeing this with 13remove.t and 15.cluster.t, both of which
> appear to infinitely recurse:
>
> Deep recursion on subroutine
> "Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent" at
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm
> line 587, <GEN0> line 1.
> Deep recursion on subroutine
> "Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child" at
> /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm
> line 630, <GEN0> line 1.
>
>
> chris
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From bernd.web at gmail.com  Mon Sep  3 12:43:26 2007
From: bernd.web at gmail.com (Bernd Web)
Date: Mon, 3 Sep 2007 14:43:26 +0200
Subject: [Bioperl-l] Fh::flush warning
Message-ID: <716af09c0709030543w79f83368gf0ac74d220a96f8c@mail.gmail.com>

Hi,

Sometimes with Bio::SimpleAlign/AlignIO, I get the following warning:
(in cleanup) Undefined subroutine Fh::flush, at
/lib/perl/Bio/Root/IO.pm line 541.

This occurs in a rather large script and have not been able to isolate
a small example where I also get this warning. Does someone know more
about this warning and why it is thrown?

Regards,
Bernd


From cjfields at uiuc.edu  Mon Sep  3 14:41:49 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 3 Sep 2007 09:41:49 -0500
Subject: [Bioperl-l] Fh::flush warning
In-Reply-To: <716af09c0709030543w79f83368gf0ac74d220a96f8c@mail.gmail.com>
References: <716af09c0709030543w79f83368gf0ac74d220a96f8c@mail.gmail.com>
Message-ID: <98A9D081-2570-4D4E-A8F8-D03282D41E0C@uiuc.edu>

Could you give a bit more info (bioperl version, OS, etc)?

I'm guessing a recent version as the error coincides with a call to  
flush() in Root::IO (which is probably called indirectly via DESTROY)  
and that you're probably using a tied filehandle somewhere for  
output, e.g. Bio::AlignIO::newFh() or Bio::AlignIO::fh(), so knowing  
the input/output formats could help.

chris

On Sep 3, 2007, at 7:43 AM, Bernd Web wrote:

> Hi,
>
> Sometimes with Bio::SimpleAlign/AlignIO, I get the following warning:
> (in cleanup) Undefined subroutine Fh::flush, at
> /lib/perl/Bio/Root/IO.pm line 541.
>
> This occurs in a rather large script and have not been able to isolate
> a small example where I also get this warning. Does someone know more
> about this warning and why it is thrown?
>
> Regards,
> Bernd
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From xianranli78 at yahoo.com.cn  Tue Sep  4 02:11:09 2007
From: xianranli78 at yahoo.com.cn (xianran li)
Date: Tue, 4 Sep 2007 10:11:09 +0800 (CST)
Subject: [Bioperl-l] question about Bio::DB::GFF
Message-ID: <361239.6752.qm@web15309.mail.cnb.yahoo.com>

 
  Hi,
   
  I tried to load the  gff3 file with load_gff.pl and extrac some information with Bio::DB::GFF. Althougth this code work properly under windows xp, the $seg got nothing when i run it under Linux. 
   
  Here is my code and the gff3 file,
  ####################################################################
   
    #!/usr/local/bin/perl -w
   
  use strict;
use Bio::SeqIO;
use Bio::DB::GFF; 
   
  my $in_gff = Bio::DB::GFF->new( -adaptor    => 'dbi::mysqlopt',
                                -dsn        => 'dbi:mysql:test',
                                -aggregator => ['coding'],
                                -user       => "lixr",
                                -pass       => "123456"
                                );                           
my $seg = $in_gff->segment'BGIOSIBCE000001.1');
print $seg->abs_start."\n"; 


  ##################################################################
  ##gff-version 3 
##sequence-region       Chr01   1       43037
Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1
Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
Chr01 bgf CDS 19344 20165 . + 0 Parent=BGIOSIBCE000001.1
Chr01 bgf mRNA 30220 36442 . + . ID=BGIOSIBCE000002.1
Chr01 bgf CDS 30220 30387 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 31128 31226 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 32228 32331 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 33907 34715 . + 1 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 34799 34921 . + 2 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 35003 35091 . + 2 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 35179 35379 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf CDS 35981 36442 . + 0 Parent=BGIOSIBCE000002.1
Chr01 bgf mRNA 38143 39015 . - . ID=BGIOSIBCE000003.1
Chr01 bgf CDS 38143 38541 . - 0 Parent=BGIOSIBCE000003.1
Chr01 bgf CDS 38649 38813 . - 0 Parent=BGIOSIBCE000003.1
Chr01 bgf CDS 38917 39015 . - 0 Parent=BGIOSIBCE000003.1
Chr01 bgf mRNA 39545 42080 . + . ID=BGIOSIBCE000004.1
Chr01 bgf CDS 39545 40584 . + 0 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 40677 41042 . + 1 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 41130 41208 . + 1 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 41740 41920 . + 0 Parent=BGIOSIBCE000004.1
Chr01 bgf CDS 42037 42080 . + 2 Parent=BGIOSIBCE000004.1
  #################################################################
   
   
  I would appreaciate if any one can give me some clues/link to accomplish this. 
   
  thanks in advance ,

  Xianran Li

       
---------------------------------
?????????????????????? 


From cjfields at uiuc.edu  Tue Sep  4 04:04:29 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 3 Sep 2007 23:04:29 -0500
Subject: [Bioperl-l] question about Bio::DB::GFF
In-Reply-To: <361239.6752.qm@web15309.mail.cnb.yahoo.com>
References: <361239.6752.qm@web15309.mail.cnb.yahoo.com>
Message-ID: <37BE6493-B49B-47DF-8047-37D616B669A8@uiuc.edu>

Not sure if the gff3 you show was modified for demonstration here but  
it should always be tab-delimited.  Also, I have had problems myself  
when using files with Windows/Mac Classic line endings on UNIX'y  
systems (Excel and a few other Mac OS X programs insist on adding \r  
instead of \n, which plays havoc with parsers sometimes even with  
readline fixes).

chris

On Sep 3, 2007, at 9:11 PM, xianran li wrote:

>
>   Hi,
>
>   I tried to load the  gff3 file with load_gff.pl and extrac some  
> information with Bio::DB::GFF. Althougth this code work properly  
> under windows xp, the $seg got nothing when i run it under Linux.
>
>   Here is my code and the gff3 file,
>   ####################################################################
>
>     #!/usr/local/bin/perl -w
>
>   use strict;
> use Bio::SeqIO;
> use Bio::DB::GFF;
>
>   my $in_gff = Bio::DB::GFF->new( -adaptor    => 'dbi::mysqlopt',
>                                 -dsn        => 'dbi:mysql:test',
>                                 -aggregator => ['coding'],
>                                 -user       => "lixr",
>                                 -pass       => "123456"
>                                 );
> my $seg = $in_gff->segment'BGIOSIBCE000001.1');
> print $seg->abs_start."\n";
>
>
>   ##################################################################
>   ##gff-version 3
> ##sequence-region       Chr01   1       43037
> Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1
> Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf CDS 19344 20165 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf mRNA 30220 36442 . + . ID=BGIOSIBCE000002.1
> Chr01 bgf CDS 30220 30387 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 31128 31226 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 32228 32331 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 33907 34715 . + 1 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 34799 34921 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35003 35091 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35179 35379 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35981 36442 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf mRNA 38143 39015 . - . ID=BGIOSIBCE000003.1
> Chr01 bgf CDS 38143 38541 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38649 38813 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38917 39015 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf mRNA 39545 42080 . + . ID=BGIOSIBCE000004.1
> Chr01 bgf CDS 39545 40584 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 40677 41042 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41130 41208 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41740 41920 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 42037 42080 . + 2 Parent=BGIOSIBCE000004.1
>   #################################################################
>
>
>   I would appreaciate if any one can give me some clues/link to  
> accomplish this.
>
>   thanks in advance ,
>
>   Xianran Li
>
>
> ---------------------------------
> ??????????????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign






From xianranli78 at yahoo.com.cn  Tue Sep  4 04:58:48 2007
From: xianranli78 at yahoo.com.cn (xianran li)
Date: Tue, 4 Sep 2007 12:58:48 +0800 (CST)
Subject: [Bioperl-l]
 =?gb2312?q?=BB=D8=B8=B4=A3=BA=20Re:=20=20question=20about=20Bi?=
 =?gb2312?q?o::DB::GFF?=
In-Reply-To: <37BE6493-B49B-47DF-8047-37D616B669A8@uiuc.edu>
Message-ID: <866169.66154.qm@web15309.mail.cnb.yahoo.com>

Hi, everybody,
   
  It looks like for the different perl version(5.8.8 of  windows and 5.8.5 for linux). And I fixed this problem by adding ";Name=XXXX" after each line with "mRNA"
  ##############################################################################
  Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1;Name=BGIOSIBCE000001.1
Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
    ##############################################################################

  This time my code works properly.
   
  Xianran

Chris Fields <cjfields at uiuc.edu> ???
  Not sure if the gff3 you show was modified for demonstration here but 
it should always be tab-delimited. Also, I have had problems myself 
when using files with Windows/Mac Classic line endings on UNIX'y 
systems (Excel and a few other Mac OS X programs insist on adding \r 
instead of \n, which plays havoc with parsers sometimes even with 
readline fixes).

chris

On Sep 3, 2007, at 9:11 PM, xianran li wrote:

>
> Hi,
>
> I tried to load the gff3 file with load_gff.pl and extrac some 
> information with Bio::DB::GFF. Althougth this code work properly 
> under windows xp, the $seg got nothing when i run it under Linux.
>
> Here is my code and the gff3 file,
> ####################################################################
>
> #!/usr/local/bin/perl -w
>
> use strict;
> use Bio::SeqIO;
> use Bio::DB::GFF;
>
> my $in_gff = Bio::DB::GFF->new( -adaptor => 'dbi::mysqlopt',
> -dsn => 'dbi:mysql:test',
> -aggregator => ['coding'],
> -user => "lixr",
> -pass => "123456"
> );
> my $seg = $in_gff->segment'BGIOSIBCE000001.1');
> print $seg->abs_start."\n";
>
>
> ##################################################################
> ##gff-version 3
> ##sequence-region Chr01 1 43037
> Chr01 bgf mRNA 18113 20165 . + . ID=BGIOSIBCE000001.1
> Chr01 bgf CDS 18113 19150 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf CDS 19344 20165 . + 0 Parent=BGIOSIBCE000001.1
> Chr01 bgf mRNA 30220 36442 . + . ID=BGIOSIBCE000002.1
> Chr01 bgf CDS 30220 30387 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 31128 31226 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 32228 32331 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 33907 34715 . + 1 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 34799 34921 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35003 35091 . + 2 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35179 35379 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf CDS 35981 36442 . + 0 Parent=BGIOSIBCE000002.1
> Chr01 bgf mRNA 38143 39015 . - . ID=BGIOSIBCE000003.1
> Chr01 bgf CDS 38143 38541 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38649 38813 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf CDS 38917 39015 . - 0 Parent=BGIOSIBCE000003.1
> Chr01 bgf mRNA 39545 42080 . + . ID=BGIOSIBCE000004.1
> Chr01 bgf CDS 39545 40584 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 40677 41042 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41130 41208 . + 1 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 41740 41920 . + 0 Parent=BGIOSIBCE000004.1
> Chr01 bgf CDS 42037 42080 . + 2 Parent=BGIOSIBCE000004.1
> #################################################################
>
>
> I would appreaciate if any one can give me some clues/link to 
> accomplish this.
>
> thanks in advance ,
>
> Xianran Li
>
>
> ---------------------------------
> ??????????????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





       
---------------------------------
 ????????????????


From jay at jays.net  Tue Sep  4 14:31:36 2007
From: jay at jays.net (Jay Hannah)
Date: Tue, 4 Sep 2007 09:31:36 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
Message-ID: <96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>

On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> Probably a bit of a long shot but does anyone have code for
> displaying protein or CDS multiple sequence alignments with the exon
> boundaries of each gene in the alignment?
>
> Something in the bioperl world without funky external dependencies.  
> I think
> it would be an awesome addition to the howtos.
>
> Currently, the Bio::Graphics howto has cdna to genome mapping  
> scripts or
> blast output scripts, but
> I couldn't find code for dealing with multiple sequence alignments.

I'm currently under the (potentially uninformed) impression that  
Bio::Graphics and related tools only work with a single  coordinate  
system. I've never seen a multiple sequence alignment example.

(
   I Google'd for "gbrowse alignment" and hit this:
   http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi

   Click the second Example link and you'll see exons mapped out.

   But zooming all the way in with all the tracks turned on it looks  
like the AZM tracks are just the coding regions. I don't see any  
multiple sequence alignment...
)

I doubt that helped.  :)

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah




From cjfields at uiuc.edu  Tue Sep  4 15:28:01 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 4 Sep 2007 10:28:01 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
Message-ID: <59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>


On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:

> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>> Probably a bit of a long shot but does anyone have code for
>> displaying protein or CDS multiple sequence alignments with the exon
>> boundaries of each gene in the alignment?
>>
>> Something in the bioperl world without funky external dependencies.
>> I think
>> it would be an awesome addition to the howtos.
>>
>> Currently, the Bio::Graphics howto has cdna to genome mapping
>> scripts or
>> blast output scripts, but
>> I couldn't find code for dealing with multiple sequence alignments.
>
> I'm currently under the (potentially uninformed) impression that
> Bio::Graphics and related tools only work with a single  coordinate
> system. I've never seen a multiple sequence alignment example.
>
> (
>    I Google'd for "gbrowse alignment" and hit this:
>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>
>    Click the second Example link and you'll see exons mapped out.
>
>    But zooming all the way in with all the tracks turned on it looks
> like the AZM tracks are just the coding regions. I don't see any
> multiple sequence alignment...
> )
>
> I doubt that helped.  :)
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:

http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
Browser/docs/tutorial/tutorial.html

chris



From avilella at gmail.com  Wed Sep  5 09:42:37 2007
From: avilella at gmail.com (Albert Vilella)
Date: Wed, 5 Sep 2007 11:42:37 +0200
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
Message-ID: <358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>

A couple of examples:

http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041

treefam has exon boundary and PFAM domain mappings

http://www.ensembl.org/Homo_sapiens/genetreeview?gene=ENSG00000139618

here the tree is shown as well, but the idea would be to plot the alignment

So it's more "show me the multiple CDS/protein alignment" rather than "show
my aligned CDS/proteins wrt my reference genome"

I think it would be quite neat to have this as a bioperl howto,

Comments?

    Albert.

On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>
>
> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>
> > On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> >> Probably a bit of a long shot but does anyone have code for
> >> displaying protein or CDS multiple sequence alignments with the exon
> >> boundaries of each gene in the alignment?
> >>
> >> Something in the bioperl world without funky external dependencies.
> >> I think
> >> it would be an awesome addition to the howtos.
> >>
> >> Currently, the Bio::Graphics howto has cdna to genome mapping
> >> scripts or
> >> blast output scripts, but
> >> I couldn't find code for dealing with multiple sequence alignments.
> >
> > I'm currently under the (potentially uninformed) impression that
> > Bio::Graphics and related tools only work with a single  coordinate
> > system. I've never seen a multiple sequence alignment example.
> >
> > (
> >    I Google'd for "gbrowse alignment" and hit this:
> >    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
> >
> >    Click the second Example link and you'll see exons mapped out.
> >
> >    But zooming all the way in with all the tracks turned on it looks
> > like the AZM tracks are just the coding regions. I don't see any
> > multiple sequence alignment...
> > )
> >
> > I doubt that helped.  :)
> >
> > Jay Hannah
> > http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>
> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>
> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
> Browser/docs/tutorial/tutorial.html
>
> chris
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From alexl at users.sourceforge.net  Wed Sep  5 10:08:14 2007
From: alexl at users.sourceforge.net (Alex Lancaster)
Date: Wed, 05 Sep 2007 03:08:14 -0700
Subject: [Bioperl-l] Clarifying license of bioperl
In-Reply-To: <8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net> (Hilmar Lapp's
	message of "Sat\, 18 Aug 2007 12\:13\:28 -0400")
References: <cg3ayi39sn.fsf@allele2.localdomain>
	<nrsl6i1ub4.fsf@allele2.localdomain>
	<1A4207F8295607498283FE9E93B775B40390172E@EX02.asurite.ad.asu.edu>
	<n9ir7e18y2.fsf@allele2.localdomain>
	<3515AB25-9919-407B-93E9-352BC426AFA1@uiuc.edu>
	<8td4xlyt4h.fsf@allele2.localdomain>
	<8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net>
Message-ID: <s73axt5ss1.fsf@allele2.localdomain>

>>>>> "HL" == Hilmar Lapp  writes:

HL> On Aug 18, 2007, at 7:33 AM, Alex Lancaster wrote:

> I imagine the intent of the bioperl
>> contributors is that it should be under the same terms as Perl,
>> whatever that happens to be (which just happens to be GPL or
>> Artistic, which is fine).

HL> I fully agree.

>> A clarification to that effect would be useful.

HL> Agreed, too. Would you mind changing that language on the wiki,
HL> since you seem to have a fairly good grasp on the issue?

OK, I've updated the wiki in two places:

http://www.bioperl.org/wiki/Licensing_BioPerl

http://www.bioperl.org/wiki/FAQ#What_are_the_license_terms_for_BioPerl.3F

It would also be nice if the LICENSE and Build.PL files in CVS (so it
finds its way into the next release) were also updated to reflect the
dual-licensed status, currently they only mention the Artistic
license:

http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/LICENSE?rev=HEAD&content-type=text/vnd.viewcvs-markup

http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/Build.PL?rev=HEAD&content-type=text/vnd.viewcvs-markup

For Build.PL this is easy:

(e.g., license             => 'artistic', should be 
       license             => 'GPL or Artistic',)

Possible solutions for the LICENSE file include:

1) The GPL could be added to LICENSE file at the end (with a note at
   the top to indicate that GPL is also included);

2) LICENSE could be moved to LICENSE.Artistic and another file
   "LICENSE.GPL" added with the GPL (version 2+) conditions, and the
   contents of LICENSE would include a note about each license.

I don't have access to the bioperl CVS repository, so I can't make the
changes myself).  This would also apply to the Build.PL (and LICENSE
files if they are present) in bioperl-run and other modules.

Thanks,
Alex


From cjfields at uiuc.edu  Wed Sep  5 12:25:21 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 07:25:21 -0500
Subject: [Bioperl-l] Clarifying license of bioperl
In-Reply-To: <s73axt5ss1.fsf@allele2.localdomain>
References: <cg3ayi39sn.fsf@allele2.localdomain>
	<nrsl6i1ub4.fsf@allele2.localdomain>
	<1A4207F8295607498283FE9E93B775B40390172E@EX02.asurite.ad.asu.edu>
	<n9ir7e18y2.fsf@allele2.localdomain>
	<3515AB25-9919-407B-93E9-352BC426AFA1@uiuc.edu>
	<8td4xlyt4h.fsf@allele2.localdomain>
	<8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net>
	<s73axt5ss1.fsf@allele2.localdomain>
Message-ID: <EE93F2F5-A76B-40C6-8A95-3E1DDD3D8562@uiuc.edu>


On Sep 5, 2007, at 5:08 AM, Alex Lancaster wrote:
...
>
> OK, I've updated the wiki in two places:
>
> http://www.bioperl.org/wiki/Licensing_BioPerl
>
> http://www.bioperl.org/wiki/ 
> FAQ#What_are_the_license_terms_for_BioPerl.3F
>
> It would also be nice if the LICENSE and Build.PL files in CVS (so it
> finds its way into the next release) were also updated to reflect the
> dual-licensed status, currently they only mention the Artistic
> license:
>
> http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/LICENSE? 
> rev=HEAD&content-type=text/vnd.viewcvs-markup
>
> http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-live/Build.PL? 
> rev=HEAD&content-type=text/vnd.viewcvs-markup
>
> For Build.PL this is easy:
>
> (e.g., license             => 'artistic', should be
>        license             => 'GPL or Artistic',)
>
> Possible solutions for the LICENSE file include:
>
> 1) The GPL could be added to LICENSE file at the end (with a note at
>    the top to indicate that GPL is also included);
>
> 2) LICENSE could be moved to LICENSE.Artistic and another file
>    "LICENSE.GPL" added with the GPL (version 2+) conditions, and the
>    contents of LICENSE would include a note about each license.
>
> I don't have access to the bioperl CVS repository, so I can't make the
> changes myself).  This would also apply to the Build.PL (and LICENSE
> files if they are present) in bioperl-run and other modules.
>
> Thanks,
> Alex

Looks like Sendu has done that.  There have been recent troubling  
developments re: Artistic License:

http://use.perl.org/article.pl?sid=07/08/26/1541205&from=rss

but the case hasn't been conclusively decided yet.

chris


From bix at sendu.me.uk  Wed Sep  5 12:18:35 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Wed, 05 Sep 2007 13:18:35 +0100
Subject: [Bioperl-l] Clarifying license of bioperl
In-Reply-To: <s73axt5ss1.fsf@allele2.localdomain>
References: <cg3ayi39sn.fsf@allele2.localdomain>	<nrsl6i1ub4.fsf@allele2.localdomain>	<1A4207F8295607498283FE9E93B775B40390172E@EX02.asurite.ad.asu.edu>	<n9ir7e18y2.fsf@allele2.localdomain>	<3515AB25-9919-407B-93E9-352BC426AFA1@uiuc.edu>	<8td4xlyt4h.fsf@allele2.localdomain>	<8D3FBCDF-47E7-4A6E-8001-C034CA27BF3F@gmx.net>
	<s73axt5ss1.fsf@allele2.localdomain>
Message-ID: <46DE9E9B.80107@sendu.me.uk>

Alex Lancaster wrote:
>>>>>> "HL" == Hilmar Lapp  writes:
> 
> HL> On Aug 18, 2007, at 7:33 AM, Alex Lancaster wrote:
> 
>>> I imagine the intent of the bioperl
>>> contributors is that it should be under the same terms as Perl,
>>> whatever that happens to be (which just happens to be GPL or
>>> Artistic, which is fine).
> 
> HL> I fully agree.
> 
>>> A clarification to that effect would be useful.
> 
> HL> Agreed, too. Would you mind changing that language on the wiki,
> HL> since you seem to have a fairly good grasp on the issue?
> 
> OK, I've updated the wiki in two places:
> 
> http://www.bioperl.org/wiki/Licensing_BioPerl
> 
> http://www.bioperl.org/wiki/FAQ#What_are_the_license_terms_for_BioPerl.3F

Thank you very much for that Alex.


> It would also be nice if the LICENSE and Build.PL files in CVS (so it
> finds its way into the next release) were also updated to reflect the
> dual-licensed status, currently they only mention the Artistic
> license:
[snip]
> For Build.PL this is easy:
> 
> (e.g., license             => 'artistic', should be 
>        license             => 'GPL or Artistic',)

As per the 'license' section of 
http://search.cpan.org/~kwilliams/Module-Build-0.2808/lib/Module/Build/API.pod, 
I've changed it to 'perl', which means Artistic or GPL.


> Possible solutions for the LICENSE file include:
> 
> 1) The GPL could be added to LICENSE file at the end (with a note at
>    the top to indicate that GPL is also included);

I took this approach, using your language for the explanation at the 
top, and including GPL 3.0 at the bottom.


I've made these changes for core (live), run, db and network.

Thanks again for your help and advice.


From cjfields at uiuc.edu  Wed Sep  5 12:53:25 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 07:53:25 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
Message-ID: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>

You mean something like this?

http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics

chris

On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:

> A couple of examples:
>
> http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
>
> treefam has exon boundary and PFAM domain mappings
>
> http://www.ensembl.org/Homo_sapiens/genetreeview?gene=ENSG00000139618
>
> here the tree is shown as well, but the idea would be to plot the  
> alignment
>
> So it's more "show me the multiple CDS/protein alignment" rather  
> than "show
> my aligned CDS/proteins wrt my reference genome"
>
> I think it would be quite neat to have this as a bioperl howto,
>
> Comments?
>
>     Albert.
>
> On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>
>>
>> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>>
>>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>>>> Probably a bit of a long shot but does anyone have code for
>>>> displaying protein or CDS multiple sequence alignments with the  
>>>> exon
>>>> boundaries of each gene in the alignment?
>>>>
>>>> Something in the bioperl world without funky external dependencies.
>>>> I think
>>>> it would be an awesome addition to the howtos.
>>>>
>>>> Currently, the Bio::Graphics howto has cdna to genome mapping
>>>> scripts or
>>>> blast output scripts, but
>>>> I couldn't find code for dealing with multiple sequence alignments.
>>>
>>> I'm currently under the (potentially uninformed) impression that
>>> Bio::Graphics and related tools only work with a single  coordinate
>>> system. I've never seen a multiple sequence alignment example.
>>>
>>> (
>>>    I Google'd for "gbrowse alignment" and hit this:
>>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>>>
>>>    Click the second Example link and you'll see exons mapped out.
>>>
>>>    But zooming all the way in with all the tracks turned on it looks
>>> like the AZM tracks are just the coding regions. I don't see any
>>> multiple sequence alignment...
>>> )
>>>
>>> I doubt that helped.  :)
>>>
>>> Jay Hannah
>>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>>
>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>>
>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
>> Browser/docs/tutorial/tutorial.html
>>
>> chris
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From avilella at gmail.com  Wed Sep  5 13:31:24 2007
From: avilella at gmail.com (Albert Vilella)
Date: Wed, 5 Sep 2007 15:31:24 +0200
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
Message-ID: <358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>

Awesome!!

Thanks Chris!

On 9/5/07, Chris Fields <cjfields at uiuc.edu> wrote:
>
> You mean something like this?
>
> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>
> chris
>
> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>
> > A couple of examples:
> >
> > http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
> >
> > treefam has exon boundary and PFAM domain mappings
> >
> > http://www.ensembl.org/Homo_sapiens/genetreeview?gene=ENSG00000139618
> >
> > here the tree is shown as well, but the idea would be to plot the
> > alignment
> >
> > So it's more "show me the multiple CDS/protein alignment" rather
> > than "show
> > my aligned CDS/proteins wrt my reference genome"
> >
> > I think it would be quite neat to have this as a bioperl howto,
> >
> > Comments?
> >
> >     Albert.
> >
> > On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
> >>
> >>
> >> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
> >>
> >>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> >>>> Probably a bit of a long shot but does anyone have code for
> >>>> displaying protein or CDS multiple sequence alignments with the
> >>>> exon
> >>>> boundaries of each gene in the alignment?
> >>>>
> >>>> Something in the bioperl world without funky external dependencies.
> >>>> I think
> >>>> it would be an awesome addition to the howtos.
> >>>>
> >>>> Currently, the Bio::Graphics howto has cdna to genome mapping
> >>>> scripts or
> >>>> blast output scripts, but
> >>>> I couldn't find code for dealing with multiple sequence alignments.
> >>>
> >>> I'm currently under the (potentially uninformed) impression that
> >>> Bio::Graphics and related tools only work with a single  coordinate
> >>> system. I've never seen a multiple sequence alignment example.
> >>>
> >>> (
> >>>    I Google'd for "gbrowse alignment" and hit this:
> >>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
> >>>
> >>>    Click the second Example link and you'll see exons mapped out.
> >>>
> >>>    But zooming all the way in with all the tracks turned on it looks
> >>> like the AZM tracks are just the coding regions. I don't see any
> >>> multiple sequence alignment...
> >>> )
> >>>
> >>> I doubt that helped.  :)
> >>>
> >>> Jay Hannah
> >>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
> >>
> >> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
> >>
> >> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
> >> Browser/docs/tutorial/tutorial.html
> >>
> >> chris
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
>


From cjfields at uiuc.edu  Wed Sep  5 14:17:51 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 09:17:51 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
Message-ID: <31E25B64-2043-4460-ADC8-9684D01C2468@uiuc.edu>

It would be nice to place the labels to the left of the segments.  I  
believe there is a way to do this, but can't remember; if I can find  
it I'll revise the script.

chris

On Sep 5, 2007, at 8:31 AM, Albert Vilella wrote:

> Awesome!!
>
> Thanks Chris!
>
> On 9/5/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>
>> You mean something like this?
>>
>> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>>
>> chris
>>
>> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>>
>>> A couple of examples:
>>>
>>> http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
>>>
>>> treefam has exon boundary and PFAM domain mappings
>>>
>>> http://www.ensembl.org/Homo_sapiens/genetreeview? 
>>> gene=ENSG00000139618
>>>
>>> here the tree is shown as well, but the idea would be to plot the
>>> alignment
>>>
>>> So it's more "show me the multiple CDS/protein alignment" rather
>>> than "show
>>> my aligned CDS/proteins wrt my reference genome"
>>>
>>> I think it would be quite neat to have this as a bioperl howto,
>>>
>>> Comments?
>>>
>>>     Albert.
>>>
>>> On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>>>
>>>>
>>>> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>>>>
>>>>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>>>>>> Probably a bit of a long shot but does anyone have code for
>>>>>> displaying protein or CDS multiple sequence alignments with the
>>>>>> exon
>>>>>> boundaries of each gene in the alignment?
>>>>>>
>>>>>> Something in the bioperl world without funky external  
>>>>>> dependencies.
>>>>>> I think
>>>>>> it would be an awesome addition to the howtos.
>>>>>>
>>>>>> Currently, the Bio::Graphics howto has cdna to genome mapping
>>>>>> scripts or
>>>>>> blast output scripts, but
>>>>>> I couldn't find code for dealing with multiple sequence  
>>>>>> alignments.
>>>>>
>>>>> I'm currently under the (potentially uninformed) impression that
>>>>> Bio::Graphics and related tools only work with a single   
>>>>> coordinate
>>>>> system. I've never seen a multiple sequence alignment example.
>>>>>
>>>>> (
>>>>>    I Google'd for "gbrowse alignment" and hit this:
>>>>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>>>>>
>>>>>    Click the second Example link and you'll see exons mapped out.
>>>>>
>>>>>    But zooming all the way in with all the tracks turned on it  
>>>>> looks
>>>>> like the AZM tracks are just the coding regions. I don't see any
>>>>> multiple sequence alignment...
>>>>> )
>>>>>
>>>>> I doubt that helped.  :)
>>>>>
>>>>> Jay Hannah
>>>>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>>>>
>>>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>>>>
>>>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
>>>> Browser/docs/tutorial/tutorial.html
>>>>
>>>> chris
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From n.haigh at sheffield.ac.uk  Wed Sep  5 14:22:44 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Wed, 05 Sep 2007 15:22:44 +0100
Subject: [Bioperl-l] Bio::Graphics support for floating point positions
In-Reply-To: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
Message-ID: <46DEBBB4.1030200@sheffield.ac.uk>

Chris Fields wrote:
> You mean something like this?
>
> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>
> chris
>
> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>
>   

Nice!

On a similar (well, related to Bio::Graphics) topic, I've written a
script that uses markers that have been mapped from a model organism to
linkage groups in related species in order to estimate the location of
"unknown" markers in those linkage groups.

I'm using the Bio::Map::* modules for much of this work and then I use
Bio::Graphics to display the linkage groups of the non-model organism
with the putative position of the "unknown" markers. However, I've had
to do a bit of fudging to get Bio::Graphics to draw this data. The
problems I encountered are described below. I also have an open bug:
http://bugzilla.open-bio.org/show_bug.cgi?id=2343

1) Linkage maps are measured in cM - which can and are likely to be
non-integer values. Bio::Graphics needs integer values, so I simply
scaled all my cM measurements prior to drawing by *1000. However, the
ruler now doesn't represent the "true scale" - can this be adjusted?

2) Some markers map to 0cM. However, Bio::Graphics requires positions
>0. To get round this I simply incremented these positions by 1
(post-scaling), so they display almost in the correct place.

Is it possible/likely/wise to support positions starting at zero and
float positions? Would such support simply be to internalise what I have
already done outside Bio::Graphics into the Bio::Graphics modules and
have it display the correctly scaled ruler?

Thoughts comments welcome.

Cheers,
Nath


From cjfields at uiuc.edu  Wed Sep  5 14:52:00 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 09:52:00 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<358f4d650709050631t136901e6v6280a44089999bde@mail.gmail.com>
Message-ID: <A8815527-2027-4F9D-BC47-C16E351067AA@uiuc.edu>

Updated the page on the web site with the new script.

Figured it out; if you pass the parameter -label_position 'left' it  
will display the label to the left.  However it displays them right  
next to the segment (ala GBrowse).  I added a hack to  
Bio::Graphics::Glyph::generic in CVS which allows 'alignment_left' as  
an option, displaying it aligned to the far left of the panel; there  
is probably a way to use a callback here as well.

chris

On Sep 5, 2007, at 8:31 AM, Albert Vilella wrote:

> Awesome!!
>
> Thanks Chris!
>
> On 9/5/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>
>> You mean something like this?
>>
>> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>>
>> chris
>>
>> On Sep 5, 2007, at 4:42 AM, Albert Vilella wrote:
>>
>>> A couple of examples:
>>>
>>> http://www.treefam.org/cgi-bin/alnview.pl?ac=TF105041
>>>
>>> treefam has exon boundary and PFAM domain mappings
>>>
>>> http://www.ensembl.org/Homo_sapiens/genetreeview? 
>>> gene=ENSG00000139618
>>>
>>> here the tree is shown as well, but the idea would be to plot the
>>> alignment
>>>
>>> So it's more "show me the multiple CDS/protein alignment" rather
>>> than "show
>>> my aligned CDS/proteins wrt my reference genome"
>>>
>>> I think it would be quite neat to have this as a bioperl howto,
>>>
>>> Comments?
>>>
>>>     Albert.
>>>
>>> On 9/4/07, Chris Fields <cjfields at uiuc.edu> wrote:
>>>>
>>>>
>>>> On Sep 4, 2007, at 9:31 AM, Jay Hannah wrote:
>>>>
>>>>> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>>>>>> Probably a bit of a long shot but does anyone have code for
>>>>>> displaying protein or CDS multiple sequence alignments with the
>>>>>> exon
>>>>>> boundaries of each gene in the alignment?
>>>>>>
>>>>>> Something in the bioperl world without funky external  
>>>>>> dependencies.
>>>>>> I think
>>>>>> it would be an awesome addition to the howtos.
>>>>>>
>>>>>> Currently, the Bio::Graphics howto has cdna to genome mapping
>>>>>> scripts or
>>>>>> blast output scripts, but
>>>>>> I couldn't find code for dealing with multiple sequence  
>>>>>> alignments.
>>>>>
>>>>> I'm currently under the (potentially uninformed) impression that
>>>>> Bio::Graphics and related tools only work with a single   
>>>>> coordinate
>>>>> system. I've never seen a multiple sequence alignment example.
>>>>>
>>>>> (
>>>>>    I Google'd for "gbrowse alignment" and hit this:
>>>>>    http://maizeapache.danforthcenter.org/cgi-bin/gbrowse.cgi
>>>>>
>>>>>    Click the second Example link and you'll see exons mapped out.
>>>>>
>>>>>    But zooming all the way in with all the tracks turned on it  
>>>>> looks
>>>>> like the AZM tracks are just the coding regions. I don't see any
>>>>> multiple sequence alignment...
>>>>> )
>>>>>
>>>>> I doubt that helped.  :)
>>>>>
>>>>> Jay Hannah
>>>>> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>>>>
>>>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>>>>
>>>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-
>>>> Browser/docs/tutorial/tutorial.html
>>>>
>>>> chris
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From cjfields at uiuc.edu  Wed Sep  5 16:47:46 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Sep 2007 11:47:46 -0500
Subject: [Bioperl-l] Bio::Graphics support for floating point positions
In-Reply-To: <46DEBBB4.1030200@sheffield.ac.uk>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<46DEBBB4.1030200@sheffield.ac.uk>
Message-ID: <C445D375-6B45-476F-B0A9-2B28851EE970@uiuc.edu>

On Sep 5, 2007, at 9:22 AM, Nathan Haigh wrote:

> ...
> On a similar (well, related to Bio::Graphics) topic, I've written a
> script that uses markers that have been mapped from a model  
> organism to
> linkage groups in related species in order to estimate the location of
> "unknown" markers in those linkage groups.
>
> I'm using the Bio::Map::* modules for much of this work and then I use
> Bio::Graphics to display the linkage groups of the non-model organism
> with the putative position of the "unknown" markers. However, I've had
> to do a bit of fudging to get Bio::Graphics to draw this data. The
> problems I encountered are described below. I also have an open bug:
> http://bugzilla.open-bio.org/show_bug.cgi?id=2343
>
> 1) Linkage maps are measured in cM - which can and are likely to be
> non-integer values. Bio::Graphics needs integer values, so I simply
> scaled all my cM measurements prior to drawing by *1000. However, the
> ruler now doesn't represent the "true scale" - can this be adjusted?
>
> 2) Some markers map to 0cM. However, Bio::Graphics requires positions
>> 0. To get round this I simply incremented these positions by 1
> (post-scaling), so they display almost in the correct place.
>
> Is it possible/likely/wise to support positions starting at zero and
> float positions? Would such support simply be to internalise what I  
> have
> already done outside Bio::Graphics into the Bio::Graphics modules and
> have it display the correctly scaled ruler?
>
> Thoughts comments welcome.
>
> Cheers,
> Nath

There is this section in the GBrowse configure doc, which to me  
suggests there is a way to do what you want in Bioperl; you may have  
to delve into the Bio::Graphics or GBrowse code to work it out,  
though.  I think the GBrowse mail list archives also have more on this.

chris

.....

F. DISPLAYING GENETIC AND RH MAPS

GBrowse can be tweaked to make it more suitable for displaying genetic
and radiation hybrid maps.

The main issue is that the Bio::DB::GFF database expects coordinates
to be positive integers, not fractions, but genetic and RH maps use
floating point numbers.  Working around this is a bit of an ugly hack.
Before loading your data you must multiply all your coordinates by a
constant power of 10 in order to convert them into integers.  For
example, if a genetic map uses Morgan units ranging from 0 to 1.80,
you would multiple by 100 to create a map in ranging from 0 to 180.

Create a GFF file containing the markers in modified coordinates and
load it as usual.  Now you must tell GBrowse to reverse these changes.
Enter the following options into the [GENERAL] section of the
configuration file:

  units = M
  unit_divider = 100

These two options tell GBrowse to use "M" (Morgan) units, and to
divide all coordinates by 100.  GBrowse will automatically display the
scale using the most appropriate units, so the displayed map will
typically be drawn using cM units.



From bernd.web at gmail.com  Wed Sep  5 17:44:26 2007
From: bernd.web at gmail.com (Bernd Web)
Date: Wed, 5 Sep 2007 19:44:26 +0200
Subject: [Bioperl-l] SearchIO ResultWriter
Message-ID: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>

Hi,

For SearchIO there are ResultWriters to write text, html and BSML
(BSMLResultWriter). However, is there also a BLAST xml writer, which
writes the original blast xml files. This may have come up before. If
there is not, is there interest in having this?


Regards,
Bernd


From sac at bioperl.org  Wed Sep  5 20:37:37 2007
From: sac at bioperl.org (Steve Chervitz)
Date: Wed, 5 Sep 2007 13:37:37 -0700
Subject: [Bioperl-l] SearchIO ResultWriter
In-Reply-To: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>
References: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>
Message-ID: <8f200b4c0709051337u532804d6r27712b05faaeea7d@mail.gmail.com>

Looks like there is no such functionality in the current repository. If you
have implemented such a beast and are willing to contribute it, go for it
(or coordinate with a developer if you lack CVS write access).

Steve

On 9/5/07, Bernd Web <bernd.web at gmail.com> wrote:
>
> Hi,
>
> For SearchIO there are ResultWriters to write text, html and BSML
> (BSMLResultWriter). However, is there also a BLAST xml writer, which
> writes the original blast xml files. This may have come up before. If
> there is not, is there interest in having this?
>
>
> Regards,
> Bernd
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From n.haigh at sheffield.ac.uk  Wed Sep  5 21:18:17 2007
From: n.haigh at sheffield.ac.uk (Nathan S. Haigh)
Date: Wed, 05 Sep 2007 22:18:17 +0100
Subject: [Bioperl-l] Bio::Graphics support for floating point positions
In-Reply-To: <C445D375-6B45-476F-B0A9-2B28851EE970@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<46DEBBB4.1030200@sheffield.ac.uk>
	<C445D375-6B45-476F-B0A9-2B28851EE970@uiuc.edu>
Message-ID: <46DF1D19.9010707@sheffield.ac.uk>

Chris Fields wrote:
> On Sep 5, 2007, at 9:22 AM, Nathan Haigh wrote:
>
>> ...
>> On a similar (well, related to Bio::Graphics) topic, I've written a
>> script that uses markers that have been mapped from a model organism to
>> linkage groups in related species in order to estimate the location of
>> "unknown" markers in those linkage groups.
>>
>> I'm using the Bio::Map::* modules for much of this work and then I use
>> Bio::Graphics to display the linkage groups of the non-model organism
>> with the putative position of the "unknown" markers. However, I've had
>> to do a bit of fudging to get Bio::Graphics to draw this data. The
>> problems I encountered are described below. I also have an open bug:
>> http://bugzilla.open-bio.org/show_bug.cgi?id=2343
>>
>> 1) Linkage maps are measured in cM - which can and are likely to be
>> non-integer values. Bio::Graphics needs integer values, so I simply
>> scaled all my cM measurements prior to drawing by *1000. However, the
>> ruler now doesn't represent the "true scale" - can this be adjusted?
>>
>> 2) Some markers map to 0cM. However, Bio::Graphics requires positions
>>> 0. To get round this I simply incremented these positions by 1
>> (post-scaling), so they display almost in the correct place.
>>
>> Is it possible/likely/wise to support positions starting at zero and
>> float positions? Would such support simply be to internalise what I have
>> already done outside Bio::Graphics into the Bio::Graphics modules and
>> have it display the correctly scaled ruler?
>>
>> Thoughts comments welcome.
>>
>> Cheers,
>> Nath
>
> There is this section in the GBrowse configure doc, which to me
> suggests there is a way to do what you want in Bioperl; you may have
> to delve into the Bio::Graphics or GBrowse code to work it out,
> though.  I think the GBrowse mail list archives also have more on this.
>
> chris
>
> .....
>
> F. DISPLAYING GENETIC AND RH MAPS
>
> GBrowse can be tweaked to make it more suitable for displaying genetic
> and radiation hybrid maps.
>
> The main issue is that the Bio::DB::GFF database expects coordinates
> to be positive integers, not fractions, but genetic and RH maps use
> floating point numbers.  Working around this is a bit of an ugly hack.
> Before loading your data you must multiply all your coordinates by a
> constant power of 10 in order to convert them into integers.  For
> example, if a genetic map uses Morgan units ranging from 0 to 1.80,
> you would multiple by 100 to create a map in ranging from 0 to 180.
>
> Create a GFF file containing the markers in modified coordinates and
> load it as usual.  Now you must tell GBrowse to reverse these changes.
> Enter the following options into the [GENERAL] section of the
> configuration file:
>
>  units = M
>  unit_divider = 100
>
> These two options tell GBrowse to use "M" (Morgan) units, and to
> divide all coordinates by 100.  GBrowse will automatically display the
> scale using the most appropriate units, so the displayed map will
> typically be drawn using cM units.
>


Thanks for for the pointer Chris!

>From what you've said, it appears they might have done a similar hack to
me - which is always nice to know! It seems then to me, that it may be
worth making the Bio::Graphic::* modules slightly more generic and
applicable for these situations. It's late, so does anyone have
suggestions before I start digging through Bio::Graphic::* modules in
the morning? Maybe you guys across the water have something to say by
the time I wake up in the morning!?

Thanks
Nath


From jason at bioperl.org  Wed Sep  5 21:33:44 2007
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 5 Sep 2007 14:33:44 -0700
Subject: [Bioperl-l] SearchIO ResultWriter
In-Reply-To: <8f200b4c0709051337u532804d6r27712b05faaeea7d@mail.gmail.com>
References: <716af09c0709051044t1cb9e857uc4b91ad64c9ef22a@mail.gmail.com>
	<8f200b4c0709051337u532804d6r27712b05faaeea7d@mail.gmail.com>
Message-ID: <AE9E4472-3424-49F6-AA93-6F05F14446AA@bioperl.org>

I think most ppl aren't that enamored with the NCBI XML Blast format  
but I guess it is standard if the NCBI puts it out...
It should be a pretty easy writer to make at any rate just follow  
along with what was done for BSMLWriter.

-jason
On Sep 5, 2007, at 1:37 PM, Steve Chervitz wrote:

> Looks like there is no such functionality in the current  
> repository. If you
> have implemented such a beast and are willing to contribute it, go  
> for it
> (or coordinate with a developer if you lack CVS write access).
>
> Steve
>
> On 9/5/07, Bernd Web <bernd.web at gmail.com> wrote:
>>
>> Hi,
>>
>> For SearchIO there are ResultWriters to write text, html and BSML
>> (BSMLResultWriter). However, is there also a BLAST xml writer, which
>> writes the original blast xml files. This may have come up before. If
>> there is not, is there interest in having this?
>>
>>
>> Regards,
>> Bernd
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
jason at bioperl.org



From jay at jays.net  Thu Sep  6 19:50:53 2007
From: jay at jays.net (Jay Hannah)
Date: Thu, 6 Sep 2007 15:50:53 -0400 (EDT)
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
 with exon boundaries
In-Reply-To: <08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
Message-ID: <Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>


On Wed, 5 Sep 2007, Chris Fields wrote:
> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics

Wow. That's slick.  :)   Is it possible to zoom in far enough to see the 
individual bases and gaps??

On Tue, 4 Sep 2007, Chris Fields wrote:
> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-Browser/docs/tutorial/tutorial.html

Yes, indeed. GBrowse graphs all sorts of amazing things. Specifically, 
this image might be what Albert is looking for:

http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome-Browser/docs/tutorial/figures/segmented_features2.gif

He'd need to map his exon boundaries from whatever format he has into a 
GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to munch on.

On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> "Something in the bioperl world without funky external dependencies"

There are still things the long arm of BioPerl justice hasn't reached?   :)

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah



From cjfields at uiuc.edu  Thu Sep  6 23:39:07 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 6 Sep 2007 18:39:07 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
Message-ID: <9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>


On Sep 6, 2007, at 2:50 PM, Jay Hannah wrote:

>
> On Wed, 5 Sep 2007, Chris Fields wrote:
>> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
>
> Wow. That's slick.  :)   Is it possible to zoom in far enough to  
> see the
> individual bases and gaps??

I'm not sure; you can do something like that with GBrowse with some  
features so there is probably a way to put something together which  
could do that.

> On Tue, 4 Sep 2007, Chris Fields wrote:
>> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
>> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
>> Browser/docs/tutorial/tutorial.html
>
> Yes, indeed. GBrowse graphs all sorts of amazing things. Specifically,
> this image might be what Albert is looking for:
>
> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
> Browser/docs/tutorial/figures/segmented_features2.gif
>
> He'd need to map his exon boundaries from whatever format he has  
> into a
> GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to  
> munch on.

I use segmented SeqFeatures in my example.  The HOWTO also uses a  
variation ('graded_segments'):

http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output

The subseqfeatures are colored by score.  Feasibly one could hack  
this so that the exons/introns have a different 'score', thus  
displaying different colors.

> On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
>> "Something in the bioperl world without funky external dependencies"
>
> There are still things the long arm of BioPerl justice hasn't  
> reached?   :)
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

chris


From cain.cshl at gmail.com  Fri Sep  7 03:20:04 2007
From: cain.cshl at gmail.com (Scott Cain)
Date: Thu, 06 Sep 2007 23:20:04 -0400
Subject: [Bioperl-l] display protein/CDS multiple sequence
	alignments	with exon boundaries
In-Reply-To: <9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
Message-ID: <1189135204.2560.52.camel@localhost.localdomain>

On Thu, 2007-09-06 at 18:39 -0500, Chris Fields wrote:
> On Sep 6, 2007, at 2:50 PM, Jay Hannah wrote:
> 
> >
> > On Wed, 5 Sep 2007, Chris Fields wrote:
> >> http://www.bioperl.org/wiki/HOWTO_Discussion:Graphics
> >
> > Wow. That's slick.  :)   Is it possible to zoom in far enough to  
> > see the
> > individual bases and gaps??
> 
> I'm not sure; you can do something like that with GBrowse with some  
> features so there is probably a way to put something together which  
> could do that.

Yeah, if it were me, I would install GBrowse, hack my data into GFF and
use gbrowse_img to generate pictures.  It would probably be easier than
starting from scratch.


> 
> > On Tue, 4 Sep 2007, Chris Fields wrote:
> >> Acc. to the Gbrowse tutorial GBrowse can deal with alignment data:
> >> http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
> >> Browser/docs/tutorial/tutorial.html
> >
> > Yes, indeed. GBrowse graphs all sorts of amazing things. Specifically,
> > this image might be what Albert is looking for:
> >
> > http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
> > Browser/docs/tutorial/figures/segmented_features2.gif
> >
> > He'd need to map his exon boundaries from whatever format he has  
> > into a
> > GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to  
> > munch on.
> 
> I use segmented SeqFeatures in my example.  The HOWTO also uses a  
> variation ('graded_segments'):
> 
> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
> 
> The subseqfeatures are colored by score.  Feasibly one could hack  
> this so that the exons/introns have a different 'score', thus  
> displaying different colors.
> 
> > On Aug 31, 2007, at 4:29 AM, Albert Vilella wrote:
> >> "Something in the bioperl world without funky external dependencies"
> >
> > There are still things the long arm of BioPerl justice hasn't  
> > reached?   :)
> >
> > Jay Hannah
> > http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
> 
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain at cshl.edu
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory
-------------- next part --------------
A non-text attachment was scrubbed...
Name: signature.asc
Type: application/pgp-signature
Size: 189 bytes
Desc: This is a digitally signed message part
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20070906/6b2b9ea2/attachment.sig>

From avilella at gmail.com  Fri Sep  7 09:20:01 2007
From: avilella at gmail.com (Albert Vilella)
Date: Fri, 7 Sep 2007 10:20:01 +0100
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
Message-ID: <358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>

>
> > He'd need to map his exon boundaries from whatever format he has
> > into a
> > GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to
> > munch on.
>
> I use segmented SeqFeatures in my example.  The HOWTO also uses a
> variation ('graded_segments'):
>
> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
>
> The subseqfeatures are colored by score.  Feasibly one could hack
> this so that the exons/introns have a different 'score', thus
> displaying different colors.


The exon boundary could be a vertical line or a triangular tick or
something. I don't know if there is a consensus on this kind of cartoons.
Does anybody know how exon boundaries are displayed in different
browsers/apps?


From yangmeng at genomics.org.cn  Fri Sep  7 07:57:14 2007
From: yangmeng at genomics.org.cn (=?ISO-8859-1?Q?=D1=EE=C3=CD=A3=A8=D6=D0=D0=C4=CA=B5=D1=E9=CA=D2?= )
Date: Fri,  7 Sep 2007 15:57:14 +0800
Subject: [Bioperl-l] a question
Message-ID: <200709071557.AA78971054@genomics.org.cn>

I am a student from China.During my learing the bioperl,I encounter a problem as follows:

I run the program,

use Bio::Perl;
$seq_object = get_sequence('swissprot',"ROA1_HUMAN");
write_sequence(">roa1.fasta",'fasta',$seq_object);

But It returns lots of mistake informatiom,

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: WebDBSeqI Request Error:
501 Protocol scheme '' is not supported
Content-Type: text/plain
Client-Date: Fri, 07 Sep 2007 07:26:06 GMT
Client-Warning: Internal response
501 Protocol scheme '' is not supported
STACK: Error::throw
STACK: Bio::Root::Root::throw D:/perl/site/lib/Bio/Root/Root.pm:359
STACK: Bio::DB::WebDBSeqI::_request D:/perl/site/lib/Bio/DB/WebDBSeqI.pm:685
STACK: Bio::DB::WebDBSeqI::get_seq_stream D:/perl/site/lib/Bio/DB/WebDBSeqI.pm:4
91
STACK: Bio::DB::WebDBSeqI::get_Stream_by_id D:/perl/site/lib/Bio/DB/WebDBSeqI.pm
:275
STACK: Bio::DB::WebDBSeqI::get_Seq_by_id D:/perl/site/lib/Bio/DB/WebDBSeqI.pm:14
5
STACK: Bio::Perl::get_sequence D:/perl/site/lib/Bio/Perl.pm:510
STACK: C:\DOCUME~1\yangmeng\LOCALS~1\Temp\dir13D.tmp\Untitled.pl:6
-----------------------------------------------------------

I don't know the reason of the problem.I have installed the addition perl modules such as bioperl-db,bioperl-network,bioperlgui and almost all "BioPerl Dependencies modules".My network is also OK. It's an annoying promleb to me.
I have consulted many experts but didn't got a reply. Could you vacuate in your mass business to give me a help?

Thank you!

Best regards!

YangMeng  




________________________________________________________________
Sent via the WebMail system at genomics.org.cn


 
                   


From cjfields at uiuc.edu  Fri Sep  7 14:09:18 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 7 Sep 2007 09:09:18 -0500
Subject: [Bioperl-l] a question
In-Reply-To: <200709071557.AA78971054@genomics.org.cn>
References: <200709071557.AA78971054@genomics.org.cn>
Message-ID: <7F176E39-18A6-4BF9-9247-863D6F3C167D@uiuc.edu>


On Sep 7, 2007, at 2:57 AM, ???????????????? wrote:

> I am a student from China.During my learing the bioperl,I encounter  
> a problem as follows:
>
> I run the program,
>
> use Bio::Perl;
> $seq_object = get_sequence('swissprot',"ROA1_HUMAN");
> write_sequence(">roa1.fasta",'fasta',$seq_object);
>
> But It returns lots of mistake informatiom,

First, always preface problems of this sort with the version of  
BioPerl you are using (there are quite a few versions still being used).

> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: WebDBSeqI Request Error:
> 501 Protocol scheme '' is not supported
> Content-Type: text/plain
> Client-Date: Fri, 07 Sep 2007 07:26:06 GMT
> Client-Warning: Internal response
> 501 Protocol scheme '' is not supported
> STACK: Error::throw
> STACK: Bio::Root::Root::throw D:/perl/site/lib/Bio/Root/Root.pm:359
> STACK: Bio::DB::WebDBSeqI::_request D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm:685
> STACK: Bio::DB::WebDBSeqI::get_seq_stream D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm:4
> 91
> STACK: Bio::DB::WebDBSeqI::get_Stream_by_id D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm
> :275
> STACK: Bio::DB::WebDBSeqI::get_Seq_by_id D:/perl/site/lib/Bio/DB/ 
> WebDBSeqI.pm:14
> 5
> STACK: Bio::Perl::get_sequence D:/perl/site/lib/Bio/Perl.pm:510
> STACK: C:\DOCUME~1\yangmeng\LOCALS~1\Temp\dir13D.tmp\Untitled.pl:6
> -----------------------------------------------------------

This works for me using bioperl from CVS.  There were a few remote  
DbFetch server changes if I recall correctly, so updating from CVS  
may be your best option.

> I don't know the reason of the problem.I have installed the  
> addition perl modules such as bioperl-db,bioperl-network,bioperlgui  
> and almost all "BioPerl Dependencies modules".My network is also  
> OK. It's an annoying promleb to me.
> I have consulted many experts but didn't got a reply. Could you  
> vacuate in your mass business to give me a help?
>
> Thank you!
>
> Best regards!
>
> YangMeng

I think my 'vacuating' is a private matter, let alone doing so in my  
mass business...

http://www.thefreedictionary.com/Vacuate

;>

chris


From cjfields at uiuc.edu  Mon Sep 10 22:04:14 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 10 Sep 2007 17:04:14 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
Message-ID: <3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>

On Sep 7, 2007, at 4:20 AM, Albert Vilella wrote:

>>> He'd need to map his exon boundaries from whatever format he has
>>> into a
>>> GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to
>>> munch on.
>>
>> I use segmented SeqFeatures in my example.  The HOWTO also uses a
>> variation ('graded_segments'):
>>
>> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
>>
>> The subseqfeatures are colored by score.  Feasibly one could hack
>> this so that the exons/introns have a different 'score', thus
>> displaying different colors.
>
>
> The exon boundary could be a vertical line or a triangular tick or
> something. I don't know if there is a consensus on this kind of  
> cartoons.
> Does anybody know how exon boundaries are displayed in different
> browsers/apps?

Don't know.  BTW, apparently there is something being cooked up as an  
alignment browser (among other things) for GBrowse:

https://www.nescent.org/wg_phyloinformatics/ 
PhyloSoC:Phylogenetic_and_Haplotype_Displays_for_GBrowse

Acc. to Lincoln (from his last GBrowse post) there will be a testable  
version within a few weeks or so.  You could always ask more  
questions about it on the GBrowse list.

chris


From lstein at cshl.edu  Mon Sep 10 22:09:41 2007
From: lstein at cshl.edu (Lincoln Stein)
Date: Mon, 10 Sep 2007 18:09:41 -0400
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
Message-ID: <6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>

You can view a simple multiple alignment now. Go to www.wormbase.org, turn
on some of the EST tracks and then zoom down to base pair level.

In bio::graphics, use the "segments" glyph and turn on the -draw_target
option. The features must have DNA attached to them.

What's coming soon is support for MAF format, which provides genome-level
alignments.

Lincoln

On 9/10/07, Chris Fields <cjfields at uiuc.edu> wrote:
>
> On Sep 7, 2007, at 4:20 AM, Albert Vilella wrote:
>
> >>> He'd need to map his exon boundaries from whatever format he has
> >>> into a
> >>> GFF file (or DAS/BioSQL/Chado/? server, or...?) for GBrowse to
> >>> munch on.
> >>
> >> I use segmented SeqFeatures in my example.  The HOWTO also uses a
> >> variation ('graded_segments'):
> >>
> >> http://www.bioperl.org/wiki/HOWTO:Graphics#Parsing_Real_BLAST_Output
> >>
> >> The subseqfeatures are colored by score.  Feasibly one could hack
> >> this so that the exons/introns have a different 'score', thus
> >> displaying different colors.
> >
> >
> > The exon boundary could be a vertical line or a triangular tick or
> > something. I don't know if there is a consensus on this kind of
> > cartoons.
> > Does anybody know how exon boundaries are displayed in different
> > browsers/apps?
>
> Don't know.  BTW, apparently there is something being cooked up as an
> alignment browser (among other things) for GBrowse:
>
> https://www.nescent.org/wg_phyloinformatics/
> PhyloSoC:Phylogenetic_and_Haplotype_Displays_for_GBrowse
>
> Acc. to Lincoln (from his last GBrowse post) there will be a testable
> version within a few weeks or so.  You could always ask more
> questions about it on the GBrowse list.
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
(516) 367-8380 (voice)
(516) 367-8389 (fax)
FOR URGENT MESSAGES & SCHEDULING,
PLEASE CONTACT MY ASSISTANT,
SANDRA MICHELSEN, AT michelse at cshl.edu


From cjfields at uiuc.edu  Tue Sep 11 03:00:29 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 10 Sep 2007 22:00:29 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
	<6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
Message-ID: <885E5E3B-E2F7-4279-8EE3-FC21AF535D7E@uiuc.edu>

Doesn't that work only for SeqFeature::SimilarityPair and HSP-like  
(paired) alignments, or am I mistaken?

chris

On Sep 10, 2007, at 5:09 PM, Lincoln Stein wrote:

> You can view a simple multiple alignment now. Go to  
> www.wormbase.org, turn
> on some of the EST tracks and then zoom down to base pair level.
>
> In bio::graphics, use the "segments" glyph and turn on the - 
> draw_target
> option. The features must have DNA attached to them.
>
> What's coming soon is support for MAF format, which provides genome- 
> level
> alignments.
>
> Lincoln




From christoph.theunert at web.de  Tue Sep 11 10:37:49 2007
From: christoph.theunert at web.de (Christoph Theunert)
Date: Tue, 11 Sep 2007 03:37:49 -0700 (PDT)
Subject: [Bioperl-l] release of own projects
Message-ID: <12611951.post@talk.nabble.com>


Hi, I am a bioinformatics student from germany and I need your help 

Working with perl and bioperl is pretty new to me - 
currently I am working on a Bioperl project, and I don't know how to release
my project when i am finished with it.

I want to pack my modules so that other users can download it and install it
on their machines.

Do I use the command h2xs as to create cpan modules ( makefiles ...) or what
is the best way to solve my 
problem ?

thanks for help 

Christoph
-- 
View this message in context: http://www.nabble.com/release-of-own-projects-tf4421681.html#a12611951
Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.



From spiros at lokku.com  Tue Sep 11 10:57:14 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 11 Sep 2007 11:57:14 +0100
Subject: [Bioperl-l] release of own projects
In-Reply-To: <12611951.post@talk.nabble.com>
References: <12611951.post@talk.nabble.com>
Message-ID: <bba689ec0709110357o2fb66071w611a8598bef8134e@mail.gmail.com>

Hey,

Yes, IMHO the best way would be to create CPANesque modules that
people are able to download and install. The installation is pretty
straightforward, covers prerequisites  and more advanced features if
needed and as an approach it is widely supported. Also, it gives you
the ability to create and integrate tests seamlessly :)

Check out these URL's on how to do it:

http://search.cpan.org/~nwclark/perl-5.8.8/pod/perlnewmod.pod
http://www.perlmonks.org/?node_id=158999
http://www.perlmonks.org/?node_id=431702

Btw, more friendly and automated tools exist besides h2xs. Be sure to
have a look at:

http://search.cpan.org/perldoc?ExtUtils::ModuleMaker
http://search.cpan.org/perldoc?Module::Starter

Hope this helps,
Spiros

ps. i suggest since its your research work you are going to be handing
out to read a bit on the various software licenses which exist and
which you prefer to license your code under.


On 9/11/07, Christoph Theunert <christoph.theunert at web.de> wrote:
>
> Hi, I am a bioinformatics student from germany and I need your help
>
> Working with perl and bioperl is pretty new to me -
> currently I am working on a Bioperl project, and I don't know how to release
> my project when i am finished with it.
>
> I want to pack my modules so that other users can download it and install it
> on their machines.
>
> Do I use the command h2xs as to create cpan modules ( makefiles ...) or what
> is the best way to solve my
> problem ?
>
> thanks for help
>
> Christoph
> --
> View this message in context: http://www.nabble.com/release-of-own-projects-tf4421681.html#a12611951
> Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From bix at sendu.me.uk  Tue Sep 11 11:12:41 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 11 Sep 2007 12:12:41 +0100
Subject: [Bioperl-l] release of own projects
In-Reply-To: <12611951.post@talk.nabble.com>
References: <12611951.post@talk.nabble.com>
Message-ID: <46E67829.8060303@sendu.me.uk>

Christoph Theunert wrote:
> Hi, I am a bioinformatics student from germany and I need your help 
> 
> Working with perl and bioperl is pretty new to me - 
> currently I am working on a Bioperl project, and I don't know how to release
> my project when i am finished with it.
> 
> I want to pack my modules so that other users can download it and install it
> on their machines.
> 
> Do I use the command h2xs as to create cpan modules ( makefiles ...) or what
> is the best way to solve my 
> problem ?

You can do it however you like. You can just stick the modules in a 
folder, .tar.gz it and offer that to people. You can use h2xs to 
automate certain things. You can use Module::Build.

To make your work available via cpan, see
http://www.cpan.org/modules/04pause.html

If your modules are of general bioinformatic utility you might even 
consider making them a part of bioperl itself.


From jay at jays.net  Tue Sep 11 21:15:17 2007
From: jay at jays.net (Jay Hannah)
Date: Tue, 11 Sep 2007 16:15:17 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
 with exon boundaries
In-Reply-To: <6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>	
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>	
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>	
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>	
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>	
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
	<6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
Message-ID: <46E70565.5040503@jays.net>

Lincoln Stein wrote:
> You can view a simple multiple alignment now. Go to www.wormbase.org 
> <http://www.wormbase.org>, turn on some of the EST tracks and then 
> zoom down to base pair level.
>
> In bio::graphics, use the "segments" glyph and turn on the 
> -draw_target option. The features must have DNA attached to them.

Wow.  *http://tinyurl.com/yuz8bq*   I hadn't seen that done before.

> What's coming soon is support for MAF format, which provides 
> genome-level alignments.

I'm looking forward to trying to wrap my head around that.  :)

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah



From cjfields at uiuc.edu  Tue Sep 11 22:40:55 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 11 Sep 2007 17:40:55 -0500
Subject: [Bioperl-l] display protein/CDS multiple sequence alignments
	with exon boundaries
In-Reply-To: <46E70565.5040503@jays.net>
References: <358f4d650708310229i421bb1d7w5f64e3ded5f92618@mail.gmail.com>	
	<96BB820A-9199-43FC-BA88-5F45F2D16D56@jays.net>	
	<59E877A9-B2A1-4E62-A291-FDE21CF586E6@uiuc.edu>	
	<358f4d650709050242u7743a532u3b460fcc55e1867e@mail.gmail.com>	
	<08E1C429-0686-49E2-825A-D98C709166F7@uiuc.edu>	
	<Pine.LNX.4.64.0709061549320.15293@ferret.jays.net>	
	<9AD575D1-A56C-415F-9C52-73105E846040@uiuc.edu>	
	<358f4d650709070220q3680c5a2kbd01adb6f2fca3dc@mail.gmail.com>	
	<3D1D9D7E-4162-4694-A3D6-23E926B07C0E@uiuc.edu>
	<6dce9a0b0709101509x5b1a18cfx7c567e40dffb4947@mail.gmail.com>
	<46E70565.5040503@jays.net>
Message-ID: <BC255B1A-EBB6-401B-BCDF-357A653A5972@uiuc.edu>


On Sep 11, 2007, at 4:15 PM, Jay Hannah wrote:

> Lincoln Stein wrote:
>> You can view a simple multiple alignment now. Go to www.wormbase.org
>> <http://www.wormbase.org>, turn on some of the EST tracks and then
>> zoom down to base pair level.
>>
>> In bio::graphics, use the "segments" glyph and turn on the
>> -draw_target option. The features must have DNA attached to them.
>
> Wow.  *http://tinyurl.com/yuz8bq*   I hadn't seen that done before.

There is a section detailing how this is done in the GBrowse tutorial  
(though it uses older GFF):

http://gmod.cvs.sourceforge.net/*checkout*/gmod/Generic-Genome- 
Browser/docs/tutorial/tutorial.html

>> What's coming soon is support for MAF format, which provides
>> genome-level alignments.
>
> I'm looking forward to trying to wrap my head around that.  :)
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

It's easily parsible, which is nice!

chris


From stephan.roessner at gsf.de  Wed Sep 12 08:44:10 2007
From: stephan.roessner at gsf.de (Stephan Roessner)
Date: Wed, 12 Sep 2007 10:44:10 +0200
Subject: [Bioperl-l] bug in Bio::SearchIO?
Message-ID: <200709121044.11741.stephan.roessner@gsf.de>

Hi,

I am parsing a BlastN output with Bio::SearchIO and getting an error for some 
of the hits when retrieving the start and/or the end position with 
$hit->end('sbjct') , $hit->start('sbjct'). I want to filter for hits which 
are are of equal length (~ > 0.9) to the query sequences. 

SearchIO is retrieving the right results, but throws an exemption, in this 
case: MSG:Undefined sub-sequence (1633,760). Valid range = 693 - 760 .....

It seems to me valid range is parsed incorrectly, isn't it? Is this a bug?

Does anybody have a similar problem?

see code, error, and blastn output below.

thanks,
Stephan


Stephan Roessner
MIPS/IBI Inst. for Bioinformatics
GSF Research Center for Environment and Health
Ingolst?dter Landstr. 1
85764 Neuherberg; Germany
phone: +49 (0)89 3187 3583
fax: ? ? ? +49 (0)89 3187 3585
email: stephan.roessner at gsf.de


Here is the piece of code I am using:

my $blast_report = new Bio::SearchIO ('-format'=>'blast',
                                         '-file' => $source);
  	
while( my $result=$blast_report->next_result) {
		while( my $hit= $result->next_hit()) {
			print "Name: ".$hit->name."\n";
			print "S: ".$hit->start('sbjct')."\n";
			print "E: ".$hit->end('sbjct')."\n";
			print "L: ".$hit->length()."\n";
		}
 	}


Here's the message: 

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Undefined sub-sequence (1633,760). Valid range = 693 - 760
STACK: Error::throw
STACK: 
Bio::Root::Root::throw /usr/lib/perl5/vendor_perl/5.8.8/Bio/Root/Root.pm:359
STACK: 
Bio::Search::HSP::HSPI::matches /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/HSP/HSPI.pm:691
STACK: 
Bio::Search::SearchUtils::_adjust_contigs /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/SearchUtils.pm:489
STACK: 
Bio::Search::SearchUtils::tile_hsps /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/SearchUtils.pm:206
STACK: 
Bio::Search::Hit::GenericHit::start /usr/lib/perl5/vendor_perl/5.8.8/Bio/Search/Hit/GenericHit.pm:935
STACK: 
main::parse /home/users/roessner/workspace/GeneSimilarity/similarity_analysis.pl:82
STACK: /home/users/roessner/workspace/GeneSimilarity/similarity_analysis.pl:51
-----------------------------------------------------------

S: 635
E: 790
L: 2052

This is the BLASTN output I am parsing::

>LOC_Os11g37470.1 chr11_pseudomolecule_TIGR r_jap version0
            21623485-21621434 BestGuessTranscript
          Length = 2052

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 106/124 (85%), Gaps = 1/124 (0%)
 Strand = Plus / Plus

                                                                        
Query: 3191 tattaagcataattaatgtatcattagcacatgtagg-ttactgtagcatttaaggctaa 3249
            |||||||| |||||||| | ||||| ||||||||||| |||||||| || ||| ||||||
Sbjct: 635  tattaagcctaattaatctgtcattggcacatgtagggttactgtaacacttatggctaa 694

                                                                        
Query: 3250 tcatagagtaactagacttaaaagactcgtctcgcgattttcaaccaaactgtgtaatta 3309
            |||| || ||| |||||| |||||| || ||||||||||||||  ||||| ||| |||||
Sbjct: 695  tcatggactaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaatta 754

                
Query: 3310 gttt 3313
            ||||
Sbjct: 755  gttt 758



 Score = 48.1 bits (24), Expect = 0.002
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                        
Query: 2253 aaaaactaattacacaatttacctgtacatcgcgagatgaatcttttaagtttagttact 2312
            ||||||||||| |||  ||| | || | ||||||||||||||||||| ||| || ||| |
Sbjct: 760  aaaaactaattgcacggtttgcatgaaaatcgcgagatgaatcttttgagtctatttagt 701

                    
Query: 2313 ccatgatt 2320
            ||||||||
Sbjct: 700  ccatgatt 693



 Score = 44.1 bits (22), Expect = 0.038
 Identities = 76/94 (80%)
 Strand = Plus / Minus

                                                                        
Query: 1539 atgcatgtagtattaaatatagacgaaaataaaaactaattgcacagtttggtcgaaatt 1598
            ||||||| || |||||||||| |  |||  ||||||||||||||| |||||   |||| |
Sbjct: 790  atgcatggagcattaaatataaataaaatgaaaaactaattgcacggtttgcatgaaaat 731

                                              
Query: 1599 gtcgagacgaattttttgagtctagttaggccat 1632
              ||||| |||| ||||||||||| |||| ||||
Sbjct: 730  cgcgagatgaatcttttgagtctatttagtccat 697



 Score = 44.1 bits (22), Expect = 0.038
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 2026 actaactagaattaaaagattcgtctcgtcatttacagacaaactgtgtaattagttttt 2085
            ||||| |||| | ||||||||| |||||  |||| ||  ||||| ||| |||||||||||
Sbjct: 701  actaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaattagttttt 760

                                          
Query: 2086 gttttcgtctatatttaatgcttcatgcat 2115
              |||  | ||||||||||||| |||||||
Sbjct: 761  cattttatttatatttaatgctccatgcat 790







From cjfields at uiuc.edu  Wed Sep 12 14:57:22 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 12 Sep 2007 09:57:22 -0500
Subject: [Bioperl-l] bug in Bio::SearchIO?
In-Reply-To: <200709121044.11741.stephan.roessner@gsf.de>
References: <200709121044.11741.stephan.roessner@gsf.de>
Message-ID: <74CE1BB2-FCEB-43C3-B783-09706C7F55D8@uiuc.edu>

Try updating to bioperl from CVS.  I believe this issue was fixed but  
I don't believe it made the 1.5.2 release.

chris

On Sep 12, 2007, at 3:44 AM, Stephan Roessner wrote:

> Hi,
>
> I am parsing a BlastN output with Bio::SearchIO and getting an  
> error for some
> of the hits when retrieving the start and/or the end position with
> $hit->end('sbjct') , $hit->start('sbjct'). I want to filter for  
> hits which
> are are of equal length (~ > 0.9) to the query sequences.
>
> SearchIO is retrieving the right results, but throws an exemption,  
> in this
> case: MSG:Undefined sub-sequence (1633,760). Valid range = 693 -  
> 760 .....
>
> It seems to me valid range is parsed incorrectly, isn't it? Is this  
> a bug?
>
> Does anybody have a similar problem?
>
> see code, error, and blastn output below.
>
> thanks,
> Stephan
>
>
> Stephan Roessner
> MIPS/IBI Inst. for Bioinformatics
> GSF Research Center for Environment and Health
> Ingolst?dter Landstr. 1
> 85764 Neuherberg; Germany
> phone: +49 (0)89 3187 3583
> fax:       +49 (0)89 3187 3585
> email: stephan.roessner at gsf.de
>
>
> Here is the piece of code I am using:
>
> my $blast_report = new Bio::SearchIO ('-format'=>'blast',
>                                          '-file' => $source);
>   	
> while( my $result=$blast_report->next_result) {
> 		while( my $hit= $result->next_hit()) {
> 			print "Name: ".$hit->name."\n";
> 			print "S: ".$hit->start('sbjct')."\n";
> 			print "E: ".$hit->end('sbjct')."\n";
> 			print "L: ".$hit->length()."\n";
> 		}
>  	}
>
>
> Here's the message:
>
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: Undefined sub-sequence (1633,760). Valid range = 693 - 760
> STACK: Error::throw
> STACK:
> Bio::Root::Root::throw /usr/lib/perl5/vendor_perl/5.8.8/Bio/Root/ 
> Root.pm:359
> STACK:
> Bio::Search::HSP::HSPI::matches /usr/lib/perl5/vendor_perl/5.8.8/ 
> Bio/Search/HSP/HSPI.pm:691
> STACK:
> Bio::Search::SearchUtils::_adjust_contigs /usr/lib/perl5/ 
> vendor_perl/5.8.8/Bio/Search/SearchUtils.pm:489
> STACK:
> Bio::Search::SearchUtils::tile_hsps /usr/lib/perl5/vendor_perl/ 
> 5.8.8/Bio/Search/SearchUtils.pm:206
> STACK:
> Bio::Search::Hit::GenericHit::start /usr/lib/perl5/vendor_perl/ 
> 5.8.8/Bio/Search/Hit/GenericHit.pm:935
> STACK:
> main::parse /home/users/roessner/workspace/GeneSimilarity/ 
> similarity_analysis.pl:82
> STACK: /home/users/roessner/workspace/GeneSimilarity/ 
> similarity_analysis.pl:51
> -----------------------------------------------------------
>
> S: 635
> E: 790
> L: 2052
>
> This is the BLASTN output I am parsing::
>
>> LOC_Os11g37470.1 chr11_pseudomolecule_TIGR r_jap version0
>             21623485-21621434 BestGuessTranscript
>           Length = 2052
>
>  Score = 95.6 bits (48), Expect = 1e-17
>  Identities = 106/124 (85%), Gaps = 1/124 (0%)
>  Strand = Plus / Plus
>
>
> Query: 3191 tattaagcataattaatgtatcattagcacatgtagg- 
> ttactgtagcatttaaggctaa 3249
>             |||||||| |||||||| | ||||| ||||||||||| |||||||| || |||  
> ||||||
> Sbjct: 635   
> tattaagcctaattaatctgtcattggcacatgtagggttactgtaacacttatggctaa 694
>
>
> Query: 3250  
> tcatagagtaactagacttaaaagactcgtctcgcgattttcaaccaaactgtgtaatta 3309
>             |||| || ||| |||||| |||||| || ||||||||||||||  ||||| |||  
> |||||
> Sbjct: 695   
> tcatggactaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaatta 754
>
>
> Query: 3310 gttt 3313
>             ||||
> Sbjct: 755  gttt 758
>
>
>
>  Score = 48.1 bits (24), Expect = 0.002
>  Identities = 57/68 (83%)
>  Strand = Plus / Minus
>
>
> Query: 2253  
> aaaaactaattacacaatttacctgtacatcgcgagatgaatcttttaagtttagttact 2312
>             ||||||||||| |||  ||| | || | ||||||||||||||||||| ||| ||  
> ||| |
> Sbjct: 760   
> aaaaactaattgcacggtttgcatgaaaatcgcgagatgaatcttttgagtctatttagt 701
>
>
> Query: 2313 ccatgatt 2320
>             ||||||||
> Sbjct: 700  ccatgatt 693
>
>
>
>  Score = 44.1 bits (22), Expect = 0.038
>  Identities = 76/94 (80%)
>  Strand = Plus / Minus
>
>
> Query: 1539  
> atgcatgtagtattaaatatagacgaaaataaaaactaattgcacagtttggtcgaaatt 1598
>             ||||||| || |||||||||| |  |||  ||||||||||||||| |||||    
> |||| |
> Sbjct: 790   
> atgcatggagcattaaatataaataaaatgaaaaactaattgcacggtttgcatgaaaat 731
>
>
> Query: 1599 gtcgagacgaattttttgagtctagttaggccat 1632
>               ||||| |||| ||||||||||| |||| ||||
> Sbjct: 730  cgcgagatgaatcttttgagtctatttagtccat 697
>
>
>
>  Score = 44.1 bits (22), Expect = 0.038
>  Identities = 73/90 (81%)
>  Strand = Plus / Plus
>
>
> Query: 2026  
> actaactagaattaaaagattcgtctcgtcatttacagacaaactgtgtaattagttttt 2085
>             ||||| |||| | ||||||||| |||||  |||| ||  ||||| |||  
> |||||||||||
> Sbjct: 701   
> actaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaattagttttt 760
>
>
> Query: 2086 gttttcgtctatatttaatgcttcatgcat 2115
>               |||  | ||||||||||||| |||||||
> Sbjct: 761  cattttatttatatttaatgctccatgcat 790
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign






From n.haigh at sheffield.ac.uk  Wed Sep 12 16:34:26 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Wed, 12 Sep 2007 17:34:26 +0100
Subject: [Bioperl-l] Bio::Graphics transparent background
Message-ID: <46E81512.3090503@sheffield.ac.uk>

Is it possible to set the bg colour of glyphs and the panel background
to be transparent? If so, which output formats support transparency?

Cheers
Nath




From Kevin.M.Brown at asu.edu  Wed Sep 12 18:15:10 2007
From: Kevin.M.Brown at asu.edu (Kevin Brown)
Date: Wed, 12 Sep 2007 11:15:10 -0700
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <46E81512.3090503@sheffield.ac.uk>
References: <46E81512.3090503@sheffield.ac.uk>
Message-ID: <1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>

> Is it possible to set the bg colour of glyphs and the panel 
> background to be transparent? If so, which output formats 
> support transparency?

Not sure if you can, but SVG, PNG, Gif all support a transparent
background.



From bioperl-list at superfrink.net  Thu Sep 13 05:15:39 2007
From: bioperl-list at superfrink.net (bioperl-list at superfrink.net)
Date: Wed, 12 Sep 2007 23:15:39 -0600 (MDT)
Subject: [Bioperl-l]  Bio::Graphics transparent background
Message-ID: <Pine.LNX.4.64.0709122245450.8424@gurchecyrohssnyb.arg>

> Is it possible to set the bg colour of glyphs and the panel background
> to be transparent? If so, which output formats support transparency?

I had a look at the code and I don't believe it is possible.

You could produce a PNG file and knowing the red/green/blue values of the 
background colour run the following script to make an image with the bg 
colour transparent.

For example:
    ./make-transparent.pl 252 253 252 2004-11-22.png

will produce:  2004-11-22.png.new.png
with the RGB colour of (252, 253, 252) replaced with transparency.

Regards,
Chad


#!/usr/bin/perl -w
#
# file: make-transparent.pl
# purpose: make a single colour in a PNG file transparent
# author: chad c d clark
# $Id$

use strict;
use GD;

# -- subroutines -------------------------------------------------------
sub usage_message();


# -- main() ------------------------------------------------------------

if(scalar @ARGV < 4) {
     print usage_message();
     exit 1;
}

# get the colour and make sure it is valid
my @RGB = splice @ARGV, 0, 3;
for my $i (@RGB) {

     if ( ($i !~ /^[\d]+$/) or (255 < $i) ) {
 	print "Invalid colour '$i'.\n";
         print usage_message();
         exit 1;
     }
}
print "RGB: (@RGB)\n";

# process each file
FILE: while (my $filename = shift @ARGV) {

     # read the file
     my $image = GD::Image->new($filename);
     unless(defined $image) {
 	warn "Unable to read image from file.  Skipping '$filename'.\n";
 	next FILE;
     }

     # find the colour index
     my $index = $image->colorExact(@RGB);
     if(-1 == $index) {
 	warn "Colour not found in file.  Skipping '$filename'.\n";
 	next FILE;
     }

     # make the colour index transparent
     if(-1 == $image->transparent($index)) {
 	warn "Unable to make colour transparent.  Skipping '$filename'.\n";
 	next FILE;
     }

     # write the updated image file
     my $new_filename = $filename . ".new.png";
     # my $new_filename = $filename;  # use to over-write existing file
     open FH, ">" . $new_filename or die "can't open $new_filename";
     print FH $image->png;
     close FH;

     print "Found file '$filename'.\tCreated '$new_filename'.\n";
}

exit 0;


# -- subroutines -------------------------------------------------------

sub usage_message() {

return qq/
   Usage: $0 RED GREEN BLUE FILELIST

   Where:
       RED       - red   value in decimal (0 to 255)
       GREEN     - green value in decimal (0 to 255)
       BLUE      - blue  value in decimal (0 to 255)
       FILELIST  - list of files to convert

   Examples:
       $0 255 255 255 2004-11-22.png
       $0 252 253 252 2004-11-22.png second.png
       $0 1   1   200 2004-11-22.png second.png third.png

   Description:
   For each file "foo.png" a new file "foo.png.new.png" will be created (and
   over-written if it existed).  The new file will be the same as the original
   but the colour specified by the RED, GREEN, and BLUE value will be removed
   and replaced by transparent pixels.

/;
}


From n.haigh at sheffield.ac.uk  Thu Sep 13 10:07:46 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Thu, 13 Sep 2007 11:07:46 +0100
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
References: <46E81512.3090503@sheffield.ac.uk>
	<1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
Message-ID: <46E90BF2.5010607@sheffield.ac.uk>

Kevin Brown wrote:
>> Is it possible to set the bg colour of glyphs and the panel 
>> background to be transparent? If so, which output formats 
>> support transparency?
>>     
>
> Not sure if you can, but SVG, PNG, Gif all support a transparent
> background.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>   

Looking at the GD module documentation:
http://search.cpan.org/~lds/GD-2.30/GD.pm

It appears that you can set a colour as being transparent - so I think
it should be possible to get Bio::Graphics to do this = may require some
code to be written. Any one got ideas?

Cheers,
Nath


From n.haigh at sheffield.ac.uk  Thu Sep 13 11:59:20 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Thu, 13 Sep 2007 12:59:20 +0100
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <46E90BF2.5010607@sheffield.ac.uk>
References: <46E81512.3090503@sheffield.ac.uk>	<1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
	<46E90BF2.5010607@sheffield.ac.uk>
Message-ID: <46E92618.7050208@sheffield.ac.uk>

Nathan Haigh wrote:
> Kevin Brown wrote:
>   
>>> Is it possible to set the bg colour of glyphs and the panel 
>>> background to be transparent? If so, which output formats 
>>> support transparency?
>>>     
>>>       
>> Not sure if you can, but SVG, PNG, Gif all support a transparent
>> background.
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>   
>>     
>
> Looking at the GD module documentation:
> http://search.cpan.org/~lds/GD-2.30/GD.pm
>
> It appears that you can set a colour as being transparent - so I think
> it should be possible to get Bio::Graphics to do this = may require some
> code to be written. Any one got ideas?
>
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>   

I took a look and made a simple change to Bio::Graphics::Panel

Please see the following bug for a patch and explanation:
http://bugzilla.open-bio.org/show_bug.cgi?id=2365

I'd appreciate any comments, especially regarding the method name! If
there aren't any complaints I'll commit it later today.

Nath


From n.haigh at sheffield.ac.uk  Thu Sep 13 12:26:57 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Thu, 13 Sep 2007 13:26:57 +0100
Subject: [Bioperl-l] Bio::Graphics Resolution
Message-ID: <46E92C91.5020307@sheffield.ac.uk>

I want to be able to print my Bio::Graphics image on a poster with good
resolution. What can I do to ensure I don't get blocky graphics/text.

Altering the width/height of the panel simple increases the size of the
canvas on which to draw the image, but the text appears the same size
and thus relatively smaller to the rest of the image. So I don't think
this would work for printing on a poster.

Cheers,
Nath


From cjfields at uiuc.edu  Thu Sep 13 12:46:02 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 13 Sep 2007 07:46:02 -0500
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <69321A85-8715-43C0-BCB0-CEE8F42D7235@uiuc.edu>

Print to SVG instead of PNG (should be resolution-independent); I use  
Illustrator to fine-tune it but there are several other programs  
which can do the same.  You'll need to install GD::SVG for it to work.

The alignment example I posted previously about (http:// 
www.bioperl.org/wiki/HOWTO_Discussion:Graphics) shows essentially  
what you need to do:

my $panel = Bio::Graphics::Panel->new(
     -image_class => 'SVG',
     # and whatever else
);

# later...

print $panel->svg;

chris

On Sep 13, 2007, at 7:26 AM, Nathan Haigh wrote:

> I want to be able to print my Bio::Graphics image on a poster with  
> good
> resolution. What can I do to ensure I don't get blocky graphics/text.
>
> Altering the width/height of the panel simple increases the size of  
> the
> canvas on which to draw the image, but the text appears the same size
> and thus relatively smaller to the rest of the image. So I don't think
> this would work for printing on a poster.
>
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From jonathancrabtree at gmail.com  Thu Sep 13 13:09:56 2007
From: jonathancrabtree at gmail.com (Jonathan Crabtree)
Date: Thu, 13 Sep 2007 09:09:56 -0400
Subject: [Bioperl-l] Bio::Graphics transparent background
In-Reply-To: <46E92618.7050208@sheffield.ac.uk>
References: <46E81512.3090503@sheffield.ac.uk>
	<1A4207F8295607498283FE9E93B775B403AEFF97@EX02.asurite.ad.asu.edu>
	<46E90BF2.5010607@sheffield.ac.uk> <46E92618.7050208@sheffield.ac.uk>
Message-ID: <8e5b8bf80709130609x4be19cf6y60f2440a1ac5d332@mail.gmail.com>

Hi Nathan-

One problem with your proposed solution is that it won't necessarily work
when GD::SVG is being used instead of GD (i.e., via the image_class method
of Bio::Graphics::Panel).  SVG doesn't handle transparency in the same way
as GD.  At least when you're compositing multiple SVG images/documents,
transparency is the default; if you superimpose one SVG image on another (
e.g., by merging the two into a single SVG document) then the bottom image
will be visible through any area of the top image that has not been drawn
on.  When I'm working in SVG with Bio::Graphics I get a "transparent"
background by simply not setting the bgcolor; this ensures that
Bio::Graphics::Panel will refrain from drawing a filled background rectangle
underneath the drawing area.  What I don't know is how to ensure that the
background is transparent when you're working with the various methods of
embedding SVG in web pages ( i.e., transparent with respect to whatever is
_underneath_ the SVG-rendered content); this is probably a slightly
different issue that's more a question of what the browser/plugin supports.

I'm not sure what to suggest as an alternative, but at the very least this
probably warrants a YMMV comment in the documentation for the new method, or
perhaps it could even throw a runtime error if called when the $gd object is
of type GD::SVG.  A final option would be to say that this (setting a
transparent background) is something that should get handled outside of
Bio::Graphics::Panel; I don't think there's any technical reason why the
calling code couldn't be responsible for this.  I don't think we can modify
your new method to unset the bgcolor when working with GD::SVG, because that
might affect the image in other ways.  I do it in my code but I'm not sure
it's 100% safe, since I think GD::SVG might actually _use_ the bgcolor in
some situations (e.g., drawing dashed lines) and I haven't checked the code
thoroughly to make sure that there are no unintended consequences.

Jonathan

p.s. I see that Chris has beaten me to the punch in mentioning SVG as a fix
to your blocky font problems.  All the more reason to think about how this
feature will work in that context!


On 9/13/07, Nathan Haigh <n.haigh at sheffield.ac.uk > wrote:
>
> Nathan Haigh wrote:
> > Kevin Brown wrote:
> >
> >>> Is it possible to set the bg colour of glyphs and the panel
> >>> background to be transparent? If so, which output formats
> >>> support transparency?
> >>>
> >>>
> >> Not sure if you can, but SVG, PNG, Gif all support a transparent
> >> background.
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>
> >>
> >
> > Looking at the GD module documentation:
> > http://search.cpan.org/~lds/GD-2.30/GD.pm
> <http://search.cpan.org/%7Elds/GD-2.30/GD.pm>
> >
> > It appears that you can set a colour as being transparent - so I think
> > it should be possible to get Bio::Graphics to do this = may require some
> > code to be written. Any one got ideas?
> >
> > Cheers,
> > Nath
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
>
> I took a look and made a simple change to Bio::Graphics::Panel
>
> Please see the following bug for a patch and explanation:
> http://bugzilla.open-bio.org/show_bug.cgi?id=2365
>
> I'd appreciate any comments, especially regarding the method name! If
> there aren't any complaints I'll commit it later today.
>
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From bix at sendu.me.uk  Thu Sep 13 13:03:46 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 13 Sep 2007 14:03:46 +0100
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <46E93532.6030505@sendu.me.uk>

Nathan Haigh wrote:
> I want to be able to print my Bio::Graphics image on a poster with good
> resolution. What can I do to ensure I don't get blocky graphics/text.

Output in SVG, which is a vector format == no blockiness.


From jonathancrabtree at gmail.com  Thu Sep 13 13:20:43 2007
From: jonathancrabtree at gmail.com (Jonathan Crabtree)
Date: Thu, 13 Sep 2007 09:20:43 -0400
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <8e5b8bf80709130620r4a24fe8fi5171539f50735bf3@mail.gmail.com>

Nathan-

As Chris said, you'll want to use GD::SVG instead of GD.  However, you're
still going to have the issue that you raised that the fonts will be
proportionally small with respect to your figure (particularly if you're
printing a large region at poster size.)  From what I remember GD only gives
you a few font sizes to choose from, so even at the largest size you may
still have problems.  I've worked around this in the past by using scripts
to post-process the resulting SVG.  I do a global search and replace to
increase the font sizes (and, in many cases, to adjust the y-offset of the
text accordingly.)  You may also need to tweak the amount of vertical
whitespace in the image (e.g., between adjacent rows of features) to give
yourself space to increase the font size.  The same caveat applies to the
horizontal dimension, since with a larger font you may have collisions
between labels (assuming that the features in your figure are labeled.)  To
fix this you need to trick Bio::Graphics into thinking the feature labels
are longer than they actually are.  I forget whether I did this by padding
the labels with extra whitespace or actually modifying the code that
computes the feature bounding boxes, but something along those lines should
work.  Essentially you have to trick Bio::Graphics into leaving extra
whitespace so that everything looks OK when you bump up the font sizes.
Unfortunately I don't have a generic script that does this; after generating
a couple of posters this way I switched to direct SVG generation to avoid
the constraints imposed by going through GD.

Jonathan


On 9/13/07, Nathan Haigh <n.haigh at sheffield.ac.uk> wrote:
>
> I want to be able to print my Bio::Graphics image on a poster with good
> resolution. What can I do to ensure I don't get blocky graphics/text.
>
> Altering the width/height of the panel simple increases the size of the
> canvas on which to draw the image, but the text appears the same size
> and thus relatively smaller to the rest of the image. So I don't think
> this would work for printing on a poster.
>
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From arareko at campus.iztacala.unam.mx  Thu Sep 13 14:59:31 2007
From: arareko at campus.iztacala.unam.mx (Mauricio Herrera Cuadra)
Date: Thu, 13 Sep 2007 09:59:31 -0500
Subject: [Bioperl-l] Bio::Graphics Resolution
In-Reply-To: <46E92C91.5020307@sheffield.ac.uk>
References: <46E92C91.5020307@sheffield.ac.uk>
Message-ID: <46E95053.8090300@campus.iztacala.unam.mx>

Try saving the output of your Bio::Graphics image as SVG (with the 
desired proportions between text & graphics), then, at the moment of 
printing, set the desired output size (from the SVG file) and everything 
should be scaled accordingly. That can probably work.

Cheers,
Mauricio.

Nathan Haigh wrote:
> I want to be able to print my Bio::Graphics image on a poster with good
> resolution. What can I do to ensure I don't get blocky graphics/text.
> 
> Altering the width/height of the panel simple increases the size of the
> canvas on which to draw the image, but the text appears the same size
> and thus relatively smaller to the rest of the image. So I don't think
> this would work for printing on a poster.
> 
> Cheers,
> Nath
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 

-- 
MAURICIO HERRERA CUADRA
arareko at campus.iztacala.unam.mx
Laboratorio de Gen?tica
Unidad de Morfofisiolog?a y Funci?n
Facultad de Estudios Superiores Iztacala, UNAM



From jay at jays.net  Fri Sep 14 14:27:38 2007
From: jay at jays.net (Jay Hannah)
Date: Fri, 14 Sep 2007 09:27:38 -0500
Subject: [Bioperl-l] [patch] getGenBank.pl
Message-ID: <1088BA7F-009A-482E-B15E-80D4D59218BE@jays.net>

http://cvs.bioperl.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/ 
examples/db/getGenBank.pl

Using this:
my $seqio = $gb->get_Stream_by_batch([ qw( 124430577 )]);

Throws this warning:
$ ./fetch.pl > 124430577.gbk
get_Stream_by_batch() is deprecated; use get_Stream_by_id() instead
STACK Bio::DB::NCBIHelper::__ANON__ /usr/lib/perl5/Bio/DB/ 
NCBIHelper.pm:261
STACK toplevel ./fetch.pl:17


Can someone with commit access please change getGenBank.pl?

24,25c24,25
< # if you want to get a bunch of sequences use the batch method
< my $seqio = $gb->get_Stream_by_batch([ qw(J00522 AF303112 2981014)]);
---
 > # feel free to pull multiple sequences
 > my $seqio = $gb->get_Stream_by_id([ qw(J00522 AF303112 2981014)]);


The tweaked version works fine for me and the warning goes away.

Thanks,

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah




From cjfields at uiuc.edu  Fri Sep 14 16:36:56 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 14 Sep 2007 11:36:56 -0500
Subject: [Bioperl-l] [patch] getGenBank.pl
In-Reply-To: <1088BA7F-009A-482E-B15E-80D4D59218BE@jays.net>
References: <1088BA7F-009A-482E-B15E-80D4D59218BE@jays.net>
Message-ID: <5255407E-F19E-45B6-9F66-3DC1AB25C0AC@uiuc.edu>

Done.  Thanks for the heads up!

chris

On Sep 14, 2007, at 9:27 AM, Jay Hannah wrote:

> http://cvs.bioperl.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/
> examples/db/getGenBank.pl
>
> Using this:
> my $seqio = $gb->get_Stream_by_batch([ qw( 124430577 )]);
>
> Throws this warning:
> $ ./fetch.pl > 124430577.gbk
> get_Stream_by_batch() is deprecated; use get_Stream_by_id() instead
> STACK Bio::DB::NCBIHelper::__ANON__ /usr/lib/perl5/Bio/DB/
> NCBIHelper.pm:261
> STACK toplevel ./fetch.pl:17
>
>
> Can someone with commit access please change getGenBank.pl?
>
> 24,25c24,25
> < # if you want to get a bunch of sequences use the batch method
> < my $seqio = $gb->get_Stream_by_batch([ qw(J00522 AF303112  
> 2981014)]);
> ---
>> # feel free to pull multiple sequences
>> my $seqio = $gb->get_Stream_by_id([ qw(J00522 AF303112 2981014)]);
>
>
> The tweaked version works fine for me and the warning goes away.
>
> Thanks,
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From MEC at stowers-institute.org  Mon Sep 17 20:15:39 2007
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Mon, 17 Sep 2007 15:15:39 -0500
Subject: [Bioperl-l] Bioperl -- why so old? ... or ...
	Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
Message-ID: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>

Sometime ago, in the ensembl-dev mailing list, mdr wrote:

> > I'm always running into bugs in bioperl that have been fixed in more
recent
> > versions than the version 1-2-3 that the installation document
specifies.  
> > 
> > Just wondering, are there plans to try to move to 1-5 any time soon,
or is that
> > not possible for some reason?  Or, by any chance, is Ensembl
actually compatible
> > with 1-5 and it's just a documentation issue?
> 
> "Ewan Birney" replied
> Ensembl doesn't make heavy use of Bioperl anymore - most of the
critical things
> we re-wrote, mainly due to speed/memory issues. I think the short
answer is that
> it _probably_ works with 1.5, but we don't have a strong desire to
move up
> as certainly there are no problems with the 1.2.3 release we are
using.

FWIW, I have just discovered that the round of bioperl changes in
service of http://www.bioperl.org/wiki/Feature_Annotation_rollback
introduce (additional?) incompatibilities between current bioperl and
the Ensembl Core API.  The changes bring me to obtain and use Bioperl
version 1.2.3 for use in conjunction with Ensemble API application (as
is recommended by Ensembl).

Until now, the ways I have used the Ensembl API appear not to have
been effected by changes in Bioperl; I have successfully used it
in conjunction with the bioperl's leading edge.  Of course there may be
other incompatibilities that I have just not noticed yet.

Evidence of the new incompatibility is present in this back trace,
which bridges between code in current bioperl-live and current
ensembl/modules/Bio:

-------------------- EXCEPTION --------------------
MSG: Operator overloading of AnnotationI is deprecated
STACK Bio::Annotation::DBLink::__ANON__
/home/mec/cvs/bioperl-live/Bio/Annotation/DBLink.pm:59
STACK Bio::EnsEMBL::DBSQL::DBEntryAdaptor::_fetch_by_object_type
/home/mec/cvs/foo/ensembl/modules/Bio/EnsEMBL/DBSQL/DBEntryAdaptor.pm:77
8


Obtaining version 1.2.3 fixes the issue for me.  

This is just a warning to others....

Your milage may vary....

--

Malcolm Cook
Stowers Institute for Medical Research - Kansas City, Missouri
 



From cjfields at uiuc.edu  Mon Sep 17 21:52:55 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 17 Sep 2007 16:52:55 -0500
Subject: [Bioperl-l] Bioperl -- why so old? ... or ...
	Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
In-Reply-To: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>
References: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>
Message-ID: <1CAA1977-45AE-4A8F-815C-4C726DB0E6E4@uiuc.edu>

Malcolm,

I have removed the Bio::Annotation overloading exceptions from  
bioperl-live; they're just more trouble than they're worth right  
now.  Could you try it out and see if that suffices, and drop us a  
note if it doesn't or if you run into other odd issues?  I'll be busy  
until the end of the month but I'll do the best I can to help out.

The rollbacks were fairly simple and essentially reversed, corrected,  
or simplified many changes made prior to the 1.5 release (most of  
which were undocumented and not completely implemented).  They pass  
all current tests and should make BioPerl classes (particularly  
Annotations and SeqFeatures) behave more like 1.4.  Beyond the now- 
removed exceptions it should be fine unless it is in an area of  
already-known incompatibility between BioPerl and Ensembl, some of  
which you've already outlined.

chris

On Sep 17, 2007, at 3:15 PM, Cook, Malcolm wrote:

> ...
> FWIW, I have just discovered that the round of bioperl changes in
> service of http://www.bioperl.org/wiki/Feature_Annotation_rollback
> introduce (additional?) incompatibilities between current bioperl and
> the Ensembl Core API.  The changes bring me to obtain and use Bioperl
> version 1.2.3 for use in conjunction with Ensemble API application (as
> is recommended by Ensembl).
>
> Until now, the ways I have used the Ensembl API appear not to have
> been effected by changes in Bioperl; I have successfully used it
> in conjunction with the bioperl's leading edge.  Of course there  
> may be
> other incompatibilities that I have just not noticed yet.
>
> Evidence of the new incompatibility is present in this back trace,
> which bridges between code in current bioperl-live and current
> ensembl/modules/Bio:
>
> -------------------- EXCEPTION --------------------
> MSG: Operator overloading of AnnotationI is deprecated
> STACK Bio::Annotation::DBLink::__ANON__
> /home/mec/cvs/bioperl-live/Bio/Annotation/DBLink.pm:59
> STACK Bio::EnsEMBL::DBSQL::DBEntryAdaptor::_fetch_by_object_type
> /home/mec/cvs/foo/ensembl/modules/Bio/EnsEMBL/DBSQL/ 
> DBEntryAdaptor.pm:77
> 8
>
>
> Obtaining version 1.2.3 fixes the issue for me.
>
> This is just a warning to others....
>
> Your milage may vary....
>
> --
>
> Malcolm Cook
> Stowers Institute for Medical Research - Kansas City, Missouri




From MEC at stowers-institute.org  Mon Sep 17 22:14:41 2007
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Mon, 17 Sep 2007 17:14:41 -0500
Subject: [Bioperl-l] Bioperl -- why so old? ... or ...
	Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
In-Reply-To: <1CAA1977-45AE-4A8F-815C-4C726DB0E6E4@uiuc.edu>
References: <CED81D34E37D5043A1211565277A51E509514EAA@exchkc02.stowers-institute.org>
	<1CAA1977-45AE-4A8F-815C-4C726DB0E6E4@uiuc.edu>
Message-ID: <CED81D34E37D5043A1211565277A51E509514EB3@exchkc02.stowers-institute.org>

Chris,

Removing those exceptions makes my application work with current
bioperl-live again.  Hooray!  Thanks.

But!  I have been warned!

Regards,

Malcolm Cook
Stowers Institute for Medical Research - Kansas City, Missouri
  

> -----Original Message-----
> From: Chris Fields [mailto:cjfields at uiuc.edu] 
> Sent: Monday, September 17, 2007 4:53 PM
> To: Cook, Malcolm
> Cc: bioperl list; ensembl-dev at ebi.ac.uk
> Subject: Re: [Bioperl-l] Bioperl -- why so old? ... or ... 
> Feature/Annotation rollback breaks Bioperl/Ensembl compatibility
> 
> Malcolm,
> 
> I have removed the Bio::Annotation overloading exceptions 
> from bioperl-live; they're just more trouble than they're 
> worth right now.  Could you try it out and see if that 
> suffices, and drop us a note if it doesn't or if you run into 
> other odd issues?  I'll be busy until the end of the month 
> but I'll do the best I can to help out.
> 
> The rollbacks were fairly simple and essentially reversed, 
> corrected, or simplified many changes made prior to the 1.5 
> release (most of which were undocumented and not completely 
> implemented).  They pass all current tests and should make 
> BioPerl classes (particularly Annotations and SeqFeatures) 
> behave more like 1.4.  Beyond the now- removed exceptions it 
> should be fine unless it is in an area of already-known 
> incompatibility between BioPerl and Ensembl, some of which 
> you've already outlined.
> 
> chris
> 
> On Sep 17, 2007, at 3:15 PM, Cook, Malcolm wrote:
> 
> > ...
> > FWIW, I have just discovered that the round of bioperl changes in 
> > service of http://www.bioperl.org/wiki/Feature_Annotation_rollback
> > introduce (additional?) incompatibilities between current 
> bioperl and 
> > the Ensembl Core API.  The changes bring me to obtain and 
> use Bioperl 
> > version 1.2.3 for use in conjunction with Ensemble API 
> application (as 
> > is recommended by Ensembl).
> >
> > Until now, the ways I have used the Ensembl API appear not to have 
> > been effected by changes in Bioperl; I have successfully used it in 
> > conjunction with the bioperl's leading edge.  Of course 
> there may be 
> > other incompatibilities that I have just not noticed yet.
> >
> > Evidence of the new incompatibility is present in this back trace, 
> > which bridges between code in current bioperl-live and current
> > ensembl/modules/Bio:
> >
> > -------------------- EXCEPTION --------------------
> > MSG: Operator overloading of AnnotationI is deprecated STACK 
> > Bio::Annotation::DBLink::__ANON__
> > /home/mec/cvs/bioperl-live/Bio/Annotation/DBLink.pm:59
> > STACK Bio::EnsEMBL::DBSQL::DBEntryAdaptor::_fetch_by_object_type
> > /home/mec/cvs/foo/ensembl/modules/Bio/EnsEMBL/DBSQL/
> > DBEntryAdaptor.pm:77
> > 8
> >
> >
> > Obtaining version 1.2.3 fixes the issue for me.
> >
> > This is just a warning to others....
> >
> > Your milage may vary....
> >
> > --
> >
> > Malcolm Cook
> > Stowers Institute for Medical Research - Kansas City, Missouri
> 
> 
> 



From neetisomaiya at gmail.com  Tue Sep 18 10:30:34 2007
From: neetisomaiya at gmail.com (neeti somaiya)
Date: Tue, 18 Sep 2007 16:00:34 +0530
Subject: [Bioperl-l] A perl regex query
Message-ID: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>

Hi,

This isnt really a bioperl query.
But does anyone know how I can substitute all special characters (+ some
other things) in a string with nothing in perl?
I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.

-- 
-Neeti
Even my blood says, B positive


From spiros at lokku.com  Tue Sep 18 10:57:18 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 18 Sep 2007 11:57:18 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
Message-ID: <bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>

Heya, seperate the items you want to remove by a pipe and add the g
regex flag. For example:

spiros$ echo Cyclic-2,3-bisphospho-D-glycerate | perl -ne ' $_ =~
s at -D-|Cyclic\-@@g ; print $_ ;'
2,3-bisphosphoglycerate

IMHO this is ugly. Best to make an array of all the elements you want
to remove and then iterate through the array, calling the regex each
time with a different element. This way it will be much more easy to
read, debug and maintain.

For example

my $ra_bad_terms = [  '-D-', 'Cyclic-' ] ;

foreach (@$ra_bad_terms) {
   $string =~ s@$_@@g ;
}

etc.

Dont forget escaping and \Q \E if needed.

Spiros



On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
> Hi,
>
> This isnt really a bioperl query.
> But does anyone know how I can substitute all special characters (+ some
> other things) in a string with nothing in perl?
> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
>
> --
> -Neeti
> Even my blood says, B positive
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From n.haigh at sheffield.ac.uk  Tue Sep 18 11:44:14 2007
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Tue, 18 Sep 2007 12:44:14 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
Message-ID: <46EFBA0E.4030104@sheffield.ac.uk>

An even better way is to use the array as Spiros suggested, but you
should then be able to use that in the regex like this:

my @ra_bad_terms = (  '-D-', 'Cyclic-' );
$string =~ s/@ra_bad_terms//g;

Again you might need escaping with \Q and \E - can't remember off hand.

You might also want to look here:
http://www.perl.com/pub/a/2002/06/04/apo5.html?page=15

Cheers
Nath



Spiros Denaxas wrote:
> Heya, seperate the items you want to remove by a pipe and add the g
> regex flag. For example:
>
> spiros$ echo Cyclic-2,3-bisphospho-D-glycerate | perl -ne ' $_ =~
> s at -D-|Cyclic\-@@g ; print $_ ;'
> 2,3-bisphosphoglycerate
>
> IMHO this is ugly. Best to make an array of all the elements you want
> to remove and then iterate through the array, calling the regex each
> time with a different element. This way it will be much more easy to
> read, debug and maintain.
>
> For example
>
> my $ra_bad_terms = [  '-D-', 'Cyclic-' ] ;
>
> foreach (@$ra_bad_terms) {
>    $string =~ s@$_@@g ;
> }
>
> etc.
>
> Dont forget escaping and \Q \E if needed.
>
> Spiros
>
>
>
> On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
>   
>> Hi,
>>
>> This isnt really a bioperl query.
>> But does anyone know how I can substitute all special characters (+ some
>> other things) in a string with nothing in perl?
>> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
>> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
>>
>> --
>> -Neeti
>> Even my blood says, B positive
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>     
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>   



From neetisomaiya at gmail.com  Tue Sep 18 12:13:42 2007
From: neetisomaiya at gmail.com (neeti somaiya)
Date: Tue, 18 Sep 2007 17:43:42 +0530
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFBE8A.6080402@cam.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
Message-ID: <764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>

Thanks.
It might work, but not always, because the string could be somthing like
Cyclic-2,3-Bisphospho-D-Glycerate.
Here I will first convert the full thing to a lower case and would then try
to get what I want.

Nothing seems to work, when I try to substitute -D- with nothing, "D" and
"-" when occuring separately also get substituted with nothing.

On 9/18/07, Roy Chaudhuri <rrc22 at cam.ac.uk> wrote:
>
> > This isnt really a bioperl query.
> > But does anyone know how I can substitute all special characters (+ some
> > other things) in a string with nothing in perl?
> > I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I
> want
> > ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
> >
>
> A more general approach that might work is to keep lower case words (I
> don't know if that will be true for all your cases):
>
> $_='Cyclic-2,3-bisphospho-D-glycerate';
> print join '', /\b[a-z]+\b/g;
>
> Roy.
> --
> Dr. Roy Chaudhuri
> Department of Veterinary Medicine
> University of Cambridge, U.K.
>



-- 
-Neeti
Even my blood says, B positive


From ak at ebi.ac.uk  Tue Sep 18 12:20:32 2007
From: ak at ebi.ac.uk (Andreas Kahari)
Date: Tue, 18 Sep 2007 13:20:32 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
Message-ID: <20070918122032.GV14066@ebi.ac.uk>

On Tue, Sep 18, 2007 at 04:00:34PM +0530, neeti somaiya wrote:
> Hi,
> 
> This isnt really a bioperl query.
> But does anyone know how I can substitute all special characters (+ some
> other things) in a string with nothing in perl?
> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.

This is in additions to the suggestions you've already had.

If you always want to concatenate the 3rd and 5th part of the string, as
delimited by dashes, then you could do this:

  my $string = 'Cyclic-2,3-bisphospho-D-glycerate';
  my $newstring = join( '', ( split( /-/, $string ) )[ 2, 4 ] );


Cheers,
Andreas

-- 
Andreas K?h?ri :: Ensembl Software Developer
European Bioinformatics Institute (EMBL-EBI)
--------------------------------------------


From spiros at lokku.com  Tue Sep 18 12:23:49 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 18 Sep 2007 13:23:49 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
Message-ID: <bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>

Its not impossibe, you just have to use \b to denote the word boundaries :)

echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'

this-is-a_teststring-D

It only gets rid of -D- , all other occurrences of D and - remain intact.

Spiros


On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
> Thanks.
> It might work, but not always, because the string could be somthing like
> Cyclic-2,3-Bisphospho-D-Glycerate.
> Here I will first convert the full thing to a lower case and would then try
> to get what I want.
>
> Nothing seems to work, when I try to substitute -D- with nothing, "D" and
> "-" when occuring separately also get substituted with nothing.
>
> On 9/18/07, Roy Chaudhuri <rrc22 at cam.ac.uk> wrote:
> >
> > > This isnt really a bioperl query.
> > > But does anyone know how I can substitute all special characters (+ some
> > > other things) in a string with nothing in perl?
> > > I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I
> > want
> > > ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
> > >
> >
> > A more general approach that might work is to keep lower case words (I
> > don't know if that will be true for all your cases):
> >
> > $_='Cyclic-2,3-bisphospho-D-glycerate';
> > print join '', /\b[a-z]+\b/g;
> >
> > Roy.
> > --
> > Dr. Roy Chaudhuri
> > Department of Veterinary Medicine
> > University of Cambridge, U.K.
> >
>
>
>
> --
> -Neeti
> Even my blood says, B positive
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From rrc22 at cam.ac.uk  Tue Sep 18 12:03:22 2007
From: rrc22 at cam.ac.uk (Roy Chaudhuri)
Date: Tue, 18 Sep 2007 13:03:22 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
Message-ID: <46EFBE8A.6080402@cam.ac.uk>

> This isnt really a bioperl query.
> But does anyone know how I can substitute all special characters (+ some
> other things) in a string with nothing in perl?
> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
> 

A more general approach that might work is to keep lower case words (I 
don't know if that will be true for all your cases):

$_='Cyclic-2,3-bisphospho-D-glycerate';
print join '', /\b[a-z]+\b/g;

Roy.
--
Dr. Roy Chaudhuri
Department of Veterinary Medicine
University of Cambridge, U.K.


From neetisomaiya at gmail.com  Tue Sep 18 12:47:18 2007
From: neetisomaiya at gmail.com (neeti somaiya)
Date: Tue, 18 Sep 2007 18:17:18 +0530
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
Message-ID: <764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>

My actual problem is a bit more complicated.
It is not just one string, nut lakhs of them, they are actually names of
chemical compounds.

THe problem is there are 2 different data sources, I need to match the
compond names between them, but the problem is though the compound may be
the same in the two, they use different naming formats for them.

eg 1 : Glucose
DB1 : D-glucose
DB2 : alpha-D-Glucose

eg2 : 2,3-bisphosphoglycerate
DB1 : Cyclic-2,3-bisphospho-D-Glycerate
DB2 : 2,3 bisphoshpglycerate

And there are some simple examples, there are even more complicated ones,
with many digits, alhas, betas, hyphens, S, R, cis, trans etc etc.

I just want to see if the basic compond is the same, i.e. the first one will
be glucose and second one will be 2,3-biphosphoglycerate (can't take just
bisphosphoglycerate because 1,3-bisphosphoglycerate would mean something
else).

Anyone has any suggestions how to tackle this?

Thanks.

On 9/18/07, Spiros Denaxas <spiros at lokku.com> wrote:
>
> Its not impossibe, you just have to use \b to denote the word boundaries
> :)
>
> echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'
>
> this-is-a_teststring-D
>
> It only gets rid of -D- , all other occurrences of D and - remain intact.
>
> Spiros
>
>
> On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
> > Thanks.
> > It might work, but not always, because the string could be somthing like
> > Cyclic-2,3-Bisphospho-D-Glycerate.
> > Here I will first convert the full thing to a lower case and would then
> try
> > to get what I want.
> >
> > Nothing seems to work, when I try to substitute -D- with nothing, "D"
> and
> > "-" when occuring separately also get substituted with nothing.
> >
> > On 9/18/07, Roy Chaudhuri <rrc22 at cam.ac.uk> wrote:
> > >
> > > > This isnt really a bioperl query.
> > > > But does anyone know how I can substitute all special characters (+
> some
> > > > other things) in a string with nothing in perl?
> > > > I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and
> I
> > > want
> > > > ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3-
> etc.
> > > >
> > >
> > > A more general approach that might work is to keep lower case words (I
> > > don't know if that will be true for all your cases):
> > >
> > > $_='Cyclic-2,3-bisphospho-D-glycerate';
> > > print join '', /\b[a-z]+\b/g;
> > >
> > > Roy.
> > > --
> > > Dr. Roy Chaudhuri
> > > Department of Veterinary Medicine
> > > University of Cambridge, U.K.
> > >
> >
> >
> >
> > --
> > -Neeti
> > Even my blood says, B positive
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
>



-- 
-Neeti
Even my blood says, B positive


From spiros at lokku.com  Tue Sep 18 12:56:44 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 18 Sep 2007 13:56:44 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFCA4E.5090605@sendu.me.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<46EFCA4E.5090605@sendu.me.uk>
Message-ID: <bba689ec0709180556q5f23e8a7ub50302891e0c3849@mail.gmail.com>

On 9/18/07, Sendu Bala <bix at sendu.me.uk> wrote:
> Spiros Denaxas wrote:
> > Its not impossibe, you just have to use \b to denote the word boundaries :)
> >
> > echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'
> >
> > this-is-a_teststring-D
> >
> > It only gets rid of -D- , all other occurrences of D and - remain intact.
>
> I'm confused. The simpler:
>
> echo 'this-is-a_test-D-string-D' | perl -ne ' s/-D-//g ; print ;'
>
> gives the same answer. You'd have to something very strange for a regex
> on -D- to match D or - alone.
>

Its the same thing. He was just mixing up character classes in the regex.

Spiros


From bix at sendu.me.uk  Tue Sep 18 12:53:34 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 18 Sep 2007 13:53:34 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<46EFBE8A.6080402@cam.ac.uk>	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
Message-ID: <46EFCA4E.5090605@sendu.me.uk>

Spiros Denaxas wrote:
> Its not impossibe, you just have to use \b to denote the word boundaries :)
> 
> echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'
> 
> this-is-a_teststring-D
> 
> It only gets rid of -D- , all other occurrences of D and - remain intact.

I'm confused. The simpler:

echo 'this-is-a_test-D-string-D' | perl -ne ' s/-D-//g ; print ;'

gives the same answer. You'd have to something very strange for a regex 
on -D- to match D or - alone.


From rrc22 at cam.ac.uk  Tue Sep 18 13:26:47 2007
From: rrc22 at cam.ac.uk (Roy Chaudhuri)
Date: Tue, 18 Sep 2007 14:26:47 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	
	<46EFBE8A.6080402@cam.ac.uk>	
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>	
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
Message-ID: <46EFD217.1030103@cam.ac.uk>

> My actual problem is a bit more complicated.
> It is not just one string, nut lakhs of them, they are actually names of 
> chemical compounds.
> 
> THe problem is there are 2 different data sources, I need to match the 
> compond names between them, but the problem is though the compound may 
> be the same in the two, they use different naming formats for them.

Unless you can define in simple and precise terms exactly which parts of 
the string you need then there is no way that you will be able to code a 
solution in Perl.

Maybe you could look for a database that contains the synonyms for each 
molecule? A quick Google finds ChEBI (http://www.ebi.ac.uk/chebi), which 
is available to download as flat files.

Roy.
--
Dr. Roy Chaudhuri
Department of Veterinary Medicine
University of Cambridge, U.K.


From js5 at sanger.ac.uk  Tue Sep 18 12:58:36 2007
From: js5 at sanger.ac.uk (James Smith)
Date: Tue, 18 Sep 2007 13:58:36 +0100 (BST)
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <20070918122032.GV14066@ebi.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<20070918122032.GV14066@ebi.ac.uk>
Message-ID: <Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>


Neeti,

This isn't really a bioperl query - but I will try and explain a simple
solution...

warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );

sub simplify {
   local $_ = "-$_[0]-";
         ## Quick hack add -'s at start and end! as always match "-string-"
   s/-(
     Cyclic | # The prefix "cyclic"
     \d+    | # a single number between two "-"s
     \d+,\d+| # number,number between two "-"s
     \w       # a single letter between two "-"s
   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
         ## 0-width +ve lookahead assertion - so can match
         ## multiple consecutive -x- constructions in same regexp!
   s/-//g;
         ## remove remaining "-"s from string...
}

Not sure what other test strings you may want - but most should be able to
fit in the () brackets in the first regexp of simplify

James

On Tue, 18 Sep 2007, Andreas Kahari wrote:

> On Tue, Sep 18, 2007 at 04:00:34PM +0530, neeti somaiya wrote:
>> Hi,
>>
>> This isnt really a bioperl query.
>> But does anyone know how I can substitute all special characters (+ some
>> other things) in a string with nothing in perl?
>> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and I want
>> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3- etc.
>
> This is in additions to the suggestions you've already had.
>
> If you always want to concatenate the 3rd and 5th part of the string, as
> delimited by dashes, then you could do this:
>
>  my $string = 'Cyclic-2,3-bisphospho-D-glycerate';
>  my $newstring = join( '', ( split( /-/, $string ) )[ 2, 4 ] );
>
>
> Cheers,
> Andreas
>
> -- 
> Andreas K?h?ri :: Ensembl Software Developer
> European Bioinformatics Institute (EMBL-EBI)
> --------------------------------------------
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 


From stefan.kirov at bms.com  Tue Sep 18 13:05:16 2007
From: stefan.kirov at bms.com (Stefan Kirov)
Date: Tue, 18 Sep 2007 09:05:16 -0400
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
Message-ID: <46EFCD0C.3010306@bms.com>

neeti somaiya wrote:
> My actual problem is a bit more complicated.
> It is not just one string, nut lakhs of them, they are actually names of
> chemical compounds.
>
> THe problem is there are 2 different data sources, I need to match the
> compond names between them, but the problem is though the compound may be
> the same in the two, they use different naming formats for them.
>
> eg 1 : Glucose
> DB1 : D-glucose
> DB2 : alpha-D-Glucose
>
> eg2 : 2,3-bisphosphoglycerate
> DB1 : Cyclic-2,3-bisphospho-D-Glycerate
> DB2 : 2,3 bisphoshpglycerate
>   
It seems to me you are trying to match 2 collections of chemical
compounds. If you need to do this reliably you need to use canonical
smiles (perhaps there are other solutions but I am not aware of them).
There are many resources for that, including open-source:
http://openbabel.sourceforge.net/wiki/Main_Page
It is not really bioperl's cup of tea, this is much more a
chemi-informatics problem. I am not sure if there is a need for bioperl
to be extended this way- any thoughts on that?
Hope this helps, regards
Stefan
> And there are some simple examples, there are even more complicated ones,
> with many digits, alhas, betas, hyphens, S, R, cis, trans etc etc.
>
> I just want to see if the basic compond is the same, i.e. the first one will
> be glucose and second one will be 2,3-biphosphoglycerate (can't take just
> bisphosphoglycerate because 1,3-bisphosphoglycerate would mean something
> else).
>
> Anyone has any suggestions how to tackle this?
>
> Thanks.
>
> On 9/18/07, Spiros Denaxas <spiros at lokku.com> wrote:
>   
>> Its not impossibe, you just have to use \b to denote the word boundaries
>> :)
>>
>> echo 'this-is-a_test-D-string-D' | perl -ne ' s/\b\-D\-\b//g ; print ;'
>>
>> this-is-a_teststring-D
>>
>> It only gets rid of -D- , all other occurrences of D and - remain intact.
>>
>> Spiros
>>
>>
>> On 9/18/07, neeti somaiya <neetisomaiya at gmail.com> wrote:
>>     
>>> Thanks.
>>> It might work, but not always, because the string could be somthing like
>>> Cyclic-2,3-Bisphospho-D-Glycerate.
>>> Here I will first convert the full thing to a lower case and would then
>>>       
>> try
>>     
>>> to get what I want.
>>>
>>> Nothing seems to work, when I try to substitute -D- with nothing, "D"
>>>       
>> and
>>     
>>> "-" when occuring separately also get substituted with nothing.
>>>
>>> On 9/18/07, Roy Chaudhuri <rrc22 at cam.ac.uk> wrote:
>>>       
>>>>> This isnt really a bioperl query.
>>>>> But does anyone know how I can substitute all special characters (+
>>>>>           
>> some
>>     
>>>>> other things) in a string with nothing in perl?
>>>>> I mean if I have a string like Cyclic-2,3-bisphospho-D-glycerate and
>>>>>           
>> I
>>     
>>>> want
>>>>         
>>>>> ouput as bisphosphoglycerate. I want to remove -D-, Cyclic-, 2,3-
>>>>>           
>> etc.
>>     
>>>> A more general approach that might work is to keep lower case words (I
>>>> don't know if that will be true for all your cases):
>>>>
>>>> $_='Cyclic-2,3-bisphospho-D-glycerate';
>>>> print join '', /\b[a-z]+\b/g;
>>>>
>>>> Roy.
>>>> --
>>>> Dr. Roy Chaudhuri
>>>> Department of Veterinary Medicine
>>>> University of Cambridge, U.K.
>>>>
>>>>         
>>>
>>> --
>>> -Neeti
>>> Even my blood says, B positive
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>       
>
>
>
>   



From stephane.teletchea at jouy.inra.fr  Tue Sep 18 13:48:05 2007
From: stephane.teletchea at jouy.inra.fr (=?ISO-8859-1?Q?St=E9phane_T=E9letch=E9a?=)
Date: Tue, 18 Sep 2007 15:48:05 +0200
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<46EFBE8A.6080402@cam.ac.uk>	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
Message-ID: <46EFD715.4060308@jouy.inra.fr>

neeti somaiya a ?crit :
> My actual problem is a bit more complicated.
> It is not just one string, nut lakhs of them, they are actually names of
> chemical compounds.
> 
> THe problem is there are 2 different data sources, I need to match the
> compond names between them, but the problem is though the compound may be
> the same in the two, they use different naming formats for them.
> 
> eg 1 : Glucose
> DB1 : D-glucose
> DB2 : alpha-D-Glucose
> 
> eg2 : 2,3-bisphosphoglycerate
> DB1 : Cyclic-2,3-bisphospho-D-Glycerate
> DB2 : 2,3 bisphoshpglycerate
> 
> And there are some simple examples, there are even more complicated ones,
> with many digits, alhas, betas, hyphens, S, R, cis, trans etc etc.
> 
> I just want to see if the basic compond is the same, i.e. the first one will
> be glucose and second one will be 2,3-biphosphoglycerate (can't take just
> bisphosphoglycerate because 1,3-bisphosphoglycerate would mean something
> else).
> 
> Anyone has any suggestions how to tackle this?
> 

I would use a two step approach :
1 - filter the entries, use a convention, for instance translata all '+' 
into their 'plus' literal equivalent, change spaces by '_', change all 
'-' for '_' also, etc
2 - try matching the result, if the match does not work, try to match 
some characters (for instance, try to remove all non alphabetical 
characters and see if the resulting produces a match).

That's theory, now, you have some time for errors and trials, but i 
think there is not essay, one shot solution, neither a bioperl facility 
for handling (bio)chemical compounds.

Cheers,
St?phane

-- 
St?phane T?letch?a, PhD.                  http://www.steletch.org
Unit? Math?matique Informatique et G?nome http://migale.jouy.inra.fr/mig
INRA, Domaine de Vilvert                  T?l : (33) 134 652 891
78352 Jouy-en-Josas cedex, France         Fax : (33) 134 652 901


From puetz at mpipsykl.mpg.de  Tue Sep 18 14:12:47 2007
From: puetz at mpipsykl.mpg.de (Benno Puetz)
Date: Tue, 18 Sep 2007 16:12:47 +0200
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<20070918122032.GV14066@ebi.ac.uk>
	<Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
Message-ID: <46EFDCDF.6030309@mpipsykl.mpg.de>

James Smith wrote:
>
> Neeti,
>
> This isn't really a bioperl query - but I will try and explain a simple
> solution...
>
> warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );
>
> sub simplify {
>   local $_ = "-$_[0]-";
>         ## Quick hack add -'s at start and end! as always match 
> "-string-"
>   s/-(
>     Cyclic | # The prefix "cyclic"
>     \d+    | # a single number between two "-"s
>     \d+,\d+| # number,number between two "-"s
>     \w       # a single letter between two "-"s
>   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
>         ## 0-width +ve lookahead assertion - so can match
>         ## multiple consecutive -x- constructions in same regexp!
>   s/-//g;
>         ## remove remaining "-"s from string...
> }
>
> Not sure what other test strings you may want - but most should be 
> able to
> fit in the () brackets in the first regexp of simplify
>
> James
Along the same line

# some test for most of the removals below
my $string = "Alpha-Cyclic-2,3-bi-sphos-1,2,5-pho-D-beta-glycerate";
my @ra_bad_terms = (  '-?(D|R|S)-',
                      '-?([aA]lpha|[bB]eta|[gG]amma)-',
                      '-?([cC]is|[tT]rans)-',
                      '-?[cC]yclic-',
                    # '-?\d+(,\d+)+-',   # uncomment to remove numbers, too
                      '(?<!\d)-' );          # '-' following number
print "$string\n";
foreach ( @ra_bad_terms ){

  eval { $string =~ s/$_//g; };
  print "$_:$string\n";   # for feedback only
}
#$string =~ s/<@ra_bad_terms>//g;

print lc($string),"\n";


-- 
Benno P?tz
Statistische Genetik
Max-Planck-Institut f. Psychiatrie            Tel.: +49-89-30622-222
Kraepelinstr. 10                              Fax : +49-89-30622-601
80804 M?nchen, Germany



From spiros at lokku.com  Tue Sep 18 14:41:20 2007
From: spiros at lokku.com (Spiros Denaxas)
Date: Tue, 18 Sep 2007 15:41:20 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFDCDF.6030309@mpipsykl.mpg.de>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<20070918122032.GV14066@ebi.ac.uk>
	<Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
	<46EFDCDF.6030309@mpipsykl.mpg.de>
Message-ID: <bba689ec0709180741s13b358e3l1b326a47700259a6@mail.gmail.com>

On 9/18/07, Benno Puetz <puetz at mpipsykl.mpg.de> wrote:
> James Smith wrote:
> >
> > Neeti,
> >
> > This isn't really a bioperl query - but I will try and explain a simple
> > solution...
> >
> > warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );
> >
> > sub simplify {
> >   local $_ = "-$_[0]-";
> >         ## Quick hack add -'s at start and end! as always match
> > "-string-"
> >   s/-(
> >     Cyclic | # The prefix "cyclic"
> >     \d+    | # a single number between two "-"s
> >     \d+,\d+| # number,number between two "-"s
> >     \w       # a single letter between two "-"s
> >   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
> >         ## 0-width +ve lookahead assertion - so can match
> >         ## multiple consecutive -x- constructions in same regexp!
> >   s/-//g;
> >         ## remove remaining "-"s from string...
> > }
> >
> > Not sure what other test strings you may want - but most should be
> > able to
> > fit in the () brackets in the first regexp of simplify
> >
> > James
> Along the same line
>
> # some test for most of the removals below
> my $string = "Alpha-Cyclic-2,3-bi-sphos-1,2,5-pho-D-beta-glycerate";
> my @ra_bad_terms = (  '-?(D|R|S)-',
>                       '-?([aA]lpha|[bB]eta|[gG]amma)-',
>                       '-?([cC]is|[tT]rans)-',
>                       '-?[cC]yclic-',
>                     # '-?\d+(,\d+)+-',   # uncomment to remove numbers, too
>                       '(?<!\d)-' );          # '-' following number
> print "$string\n";
> foreach ( @ra_bad_terms ){
>
>   eval { $string =~ s/$_//g; };
>   print "$_:$string\n";   # for feedback only
> }
> #$string =~ s/<@ra_bad_terms>//g;
>
> print lc($string),"\n";
>
>
> --
> Benno P?tz

My humble opinion would be to avoid using regular expressions to do
your task and try and locate a more valid and centralized information
repository to use, be it a database of synonyms or some other indexing
code. This will add the required domain knowledge in your solution.
Using regular expressions will almost certainly lead to problems and
bugs which will be very hard to resolve.
Should you decide to go forward and treat everything simply as strings
and compare them, I feel this is more of an NLP problem.

Spiros



From cjfields at uiuc.edu  Tue Sep 18 15:24:52 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 10:24:52 -0500
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFD217.1030103@cam.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	
	<46EFBE8A.6080402@cam.ac.uk>	
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>	
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
	<46EFD217.1030103@cam.ac.uk>
Message-ID: <155C67C0-1F81-4A1C-AD68-A21B4E6918C9@uiuc.edu>


On Sep 18, 2007, at 8:26 AM, Roy Chaudhuri wrote:

>> My actual problem is a bit more complicated.
>> It is not just one string, nut lakhs of them, they are actually  
>> names of
>> chemical compounds.
>>
>> THe problem is there are 2 different data sources, I need to match  
>> the
>> compond names between them, but the problem is though the compound  
>> may
>> be the same in the two, they use different naming formats for them.
>
> Unless you can define in simple and precise terms exactly which  
> parts of
> the string you need then there is no way that you will be able to  
> code a
> solution in Perl.
>
> Maybe you could look for a database that contains the synonyms for  
> each
> molecule? A quick Google finds ChEBI (http://www.ebi.ac.uk/chebi),  
> which
> is available to download as flat files.
>
> Roy.
> --
> Dr. Roy Chaudhuri
> Department of Veterinary Medicine
> University of Cambridge, U.K.

D'oh!  Roy beat me to it; that's what I was going to suggest.  I  
agree; don't trust simple word munging to always get you the correct  
answer in this case, it's just too complicated to try and catch every  
case.

ChEBI is a good choice; Stefan's suggestion of OpenBabel is also a  
good one.  I would also try not to reinvent the wheel; there may be  
some modules available via CPAN which do what you need, such as these:

http://search.cpan.org/search?query=chem&mode=module

or this:

http://search.cpan.org/~ghutchis/Chemistry-OpenBabel-1.2.0/

chris


From shameer at ncbs.res.in  Tue Sep 18 14:57:55 2007
From: shameer at ncbs.res.in (Shameer Khadar)
Date: Tue, 18 Sep 2007 20:27:55 +0530 (IST)
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFDCDF.6030309@mpipsykl.mpg.de>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<20070918122032.GV14066@ebi.ac.uk>
	<Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
	<46EFDCDF.6030309@mpipsykl.mpg.de>
Message-ID: <53713.192.168.1.1.1190127475.squirrel@mail.ncbs.res.in>

I used this module for my simple chemoinformatics tasks,

http://www.perlmol.org/ - PerlMol - Perl Modules for Molecular Chemistry
Please explore, you may find something useful.

-- 



> James Smith wrote:
>>
>> Neeti,
>>
>> This isn't really a bioperl query - but I will try and explain a simple
>> solution...
>>
>> warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );
>>
>> sub simplify {
>>   local $_ = "-$_[0]-";
>>         ## Quick hack add -'s at start and end! as always match
>> "-string-"
>>   s/-(
>>     Cyclic | # The prefix "cyclic"
>>     \d+    | # a single number between two "-"s
>>     \d+,\d+| # number,number between two "-"s
>>     \w       # a single letter between two "-"s
>>   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
>>         ## 0-width +ve lookahead assertion - so can match
>>         ## multiple consecutive -x- constructions in same regexp!
>>   s/-//g;
>>         ## remove remaining "-"s from string...
>> }
>>
>> Not sure what other test strings you may want - but most should be
>> able to
>> fit in the () brackets in the first regexp of simplify
>>
>> James
> Along the same line
>
> # some test for most of the removals below
> my $string = "Alpha-Cyclic-2,3-bi-sphos-1,2,5-pho-D-beta-glycerate";
> my @ra_bad_terms = (  '-?(D|R|S)-',
>                       '-?([aA]lpha|[bB]eta|[gG]amma)-',
>                       '-?([cC]is|[tT]rans)-',
>                       '-?[cC]yclic-',
>                     # '-?\d+(,\d+)+-',   # uncomment to remove numbers,
> too
>                       '(?<!\d)-' );          # '-' following number
> print "$string\n";
> foreach ( @ra_bad_terms ){
>
>   eval { $string =~ s/$_//g; };
>   print "$_:$string\n";   # for feedback only
> }
> #$string =~ s/<@ra_bad_terms>//g;
>
> print lc($string),"\n";
>
>
> --
> Benno P?tz
> Statistische Genetik
> Max-Planck-Institut f. Psychiatrie            Tel.: +49-89-30622-222
> Kraepelinstr. 10                              Fax : +49-89-30622-601
> 80804 M?nchen, Germany
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


-- 
Shameer Khadar
Prof. R. Sowdhamini's Lab (# 25) The Computational Biology Group
National Centre for Biological Sciences (TIFR)
GKVK Campus, Bellary Road, Bangalore - 65, Karnataka - India
T - 91-080-23666001 EXT - 6251
W - http://www.ncbs.res.in



From js5 at sanger.ac.uk  Tue Sep 18 15:37:57 2007
From: js5 at sanger.ac.uk (James Smith)
Date: Tue, 18 Sep 2007 16:37:57 +0100 (BST)
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <bba689ec0709180741s13b358e3l1b326a47700259a6@mail.gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<20070918122032.GV14066@ebi.ac.uk>
	<Pine.LNX.4.64.0709181347500.28437@cbi4a.internal.sanger.ac.uk>
	<46EFDCDF.6030309@mpipsykl.mpg.de>
	<bba689ec0709180741s13b358e3l1b326a47700259a6@mail.gmail.com>
Message-ID: <Pine.LNX.4.64.0709181632450.28437@cbi4a.internal.sanger.ac.uk>



On Tue, 18 Sep 2007, Spiros Denaxas wrote:

> On 9/18/07, Benno Puetz <puetz at mpipsykl.mpg.de> wrote:
> James Smith wrote:
> >
> > Neeti,
> >
> > This isn't really a bioperl query - but I will try and explain a simple
> > solution...
> >
> > warn simplify( 'Cyclic-2,3-bisphospho-D-glycerate' );
> >
> > sub simplify {
> >   local $_ = "-$_[0]-";
> >         ## Quick hack add -'s at start and end! as always match
> > "-string-"
> >   s/-(
> >     Cyclic | # The prefix "cyclic"
> >     \d+    | # a single number between two "-"s
> >     \d+,\d+| # number,number between two "-"s
> >     \w       # a single letter between two "-"s
> >   )(?=-)//ixg;  ## case-insensitive, commented, multiple matches!
> >         ## 0-width +ve lookahead assertion - so can match
> >         ## multiple consecutive -x- constructions in same regexp!
> >   s/-//g;
> >         ## remove remaining "-"s from string...
> > }
> >
> > Not sure what other test strings you may want - but most should be
> > able to
> > fit in the () brackets in the first regexp of simplify
> >
> > James
> Along the same line
>

But the point is you don't need to loop over things....


Updated regexp...


sub simplify {
   local $_ = "-$_[0]-";             # Add '-' at start and end!
   s{-(
     [cC]yclic                     | # The prefix "cyclic"
     [aA]lpha | [bB]eta | [gG]amma | # Alpha/beta/gamma
     [tT]rans | [cC]is             | # Trans/cis
     [DRS]                         | # Single letter "D","R" or "S"
#    \d+(,\d+)*                   | # list of 1 or more "," separated nos
   )(?=-)}{}xg;                      # No. list currently commented out!
   s/-//g;                           # remove all "-"
   s/([^\d,])([\d,])/\1-\2/g;        # re-introduce "-" between number/
   s/([\d,])([^\d,])/\1-\2/g;        #  comma and letters
   s/--/-/g;                         # remove duplicate "-" signs..
   return $_;
}




-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 


From cjfields at uiuc.edu  Tue Sep 18 15:38:04 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 10:38:04 -0500
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFCD0C.3010306@bms.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
	<46EFCD0C.3010306@bms.com>
Message-ID: <68EC5D58-9D84-4692-BD99-F53FC75FD0E7@uiuc.edu>


On Sep 18, 2007, at 8:05 AM, Stefan Kirov wrote:

> neeti somaiya wrote:
>> ...
> It seems to me you are trying to match 2 collections of chemical
> compounds. If you need to do this reliably you need to use canonical
> smiles (perhaps there are other solutions but I am not aware of them).
> There are many resources for that, including open-source:
> http://openbabel.sourceforge.net/wiki/Main_Page
> It is not really bioperl's cup of tea, this is much more a
> chemi-informatics problem. I am not sure if there is a need for  
> bioperl
> to be extended this way- any thoughts on that?
> Hope this helps, regards
> Stefan

I would vote nyet myself unless I was convinced that this would be  
beneficial to bioperl core.  Right now I'm not yet there, primarily b/ 
c of the already available OpenBabel (with available CPAN interface)  
and other resources, not to mention there are too many areas in  
bioperl which need more focus (tests, documentation, etc).

However, if we do want to incorporate chemi-informatics at some point  
it could be something which is not integrated into the core  
architecture and can be installed separately (like network, ext, db,  
etc).

chris


From bioperl-list at superfrink.net  Tue Sep 18 16:16:48 2007
From: bioperl-list at superfrink.net (bioperl-list at superfrink.net)
Date: Tue, 18 Sep 2007 10:16:48 -0600 (MDT)
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46EFBA0E.4030104@sheffield.ac.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
	<46EFBA0E.4030104@sheffield.ac.uk>
Message-ID: <Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>

On Tue, 18 Sep 2007, Nathan Haigh wrote:

> An even better way is to use the array as Spiros suggested, but you
> should then be able to use that in the regex like this:
>
> my @ra_bad_terms = (  '-D-', 'Cyclic-' );
> $string =~ s/@ra_bad_terms//g;

I didn't know one could do that.  I couldn't get it to work so I asked 
around.  In case anyone else read it and thought about using that code it 
might only work in Perl 6.

Regards,
Chad


From bix at sendu.me.uk  Tue Sep 18 17:21:06 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 18 Sep 2007 18:21:06 +0100
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>
	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
Message-ID: <46F00902.9070401@sendu.me.uk>

bioperl-list at superfrink.net wrote:
> On Tue, 18 Sep 2007, Nathan Haigh wrote:
> 
>> An even better way is to use the array as Spiros suggested, but you
>> should then be able to use that in the regex like this:
>>
>> my @ra_bad_terms = (  '-D-', 'Cyclic-' );
>> $string =~ s/@ra_bad_terms//g;
> 
> I didn't know one could do that.  I couldn't get it to work so I asked 
> around.  In case anyone else read it and thought about using that code it 
> might only work in Perl 6.

I assumed it was a typo. You can get it to work by adding

$" = '|';

before the regex;


From cjfields at uiuc.edu  Tue Sep 18 17:52:00 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 12:52:00 -0500
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
	<46EFBA0E.4030104@sheffield.ac.uk>
	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
Message-ID: <F7ADCFDC-D065-4401-AF1F-F53D6958CF37@uiuc.edu>


On Sep 18, 2007, at 11:16 AM, bioperl-list at superfrink.net wrote:

> On Tue, 18 Sep 2007, Nathan Haigh wrote:
>
>> An even better way is to use the array as Spiros suggested, but you
>> should then be able to use that in the regex like this:
>>
>> my @ra_bad_terms = (  '-D-', 'Cyclic-' );
>> $string =~ s/@ra_bad_terms//g;
>
> I didn't know one could do that.  I couldn't get it to work so I asked
> around.  In case anyone else read it and thought about using that  
> code it
> might only work in Perl 6.
>
> Regards,
> Chad

I think the problem is what s/@terms//g means.  To most it means  
group substitutions, which you can get by using s/(?:a|b|c|d)//g; to  
others it means stepwise 's/$old//g for $old (@terms)'.

To go from an array of terms to an optimized group regex, use  
Regexp::List (CPAN to the rescue!):

http://search.cpan.org/~dankogai/Regexp-Optimizer-0.15/lib/Regexp/ 
List.pm

chris


From cjfields at uiuc.edu  Tue Sep 18 18:23:37 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 13:23:37 -0500
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <46F00902.9070401@sendu.me.uk>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>
	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
	<46F00902.9070401@sendu.me.uk>
Message-ID: <5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>


On Sep 18, 2007, at 12:21 PM, Sendu Bala wrote:

> bioperl-list at superfrink.net wrote:
>> On Tue, 18 Sep 2007, Nathan Haigh wrote:
>>
>>> An even better way is to use the array as Spiros suggested, but you
>>> should then be able to use that in the regex like this:
>>>
>>> my @ra_bad_terms = (  '-D-', 'Cyclic-' );
>>> $string =~ s/@ra_bad_terms//g;
>>
>> I didn't know one could do that.  I couldn't get it to work so I  
>> asked
>> around.  In case anyone else read it and thought about using that  
>> code it
>> might only work in Perl 6.
>
> I assumed it was a typo. You can get it to work by adding
>
> $" = '|';
>
> before the regex;

Ah, didn't know that one.  Nice, though shouldn't it be localized?

The (supposed) advantage of Regexp::List is the regex is optimized  
for speed; I haven't tried it out myself, so YMMV.

chris


From stefan.kirov at bms.com  Tue Sep 18 18:54:49 2007
From: stefan.kirov at bms.com (Stefan Kirov)
Date: Tue, 18 Sep 2007 14:54:49 -0400
Subject: [Bioperl-l] A perl regex query
In-Reply-To: <155C67C0-1F81-4A1C-AD68-A21B4E6918C9@uiuc.edu>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<46EFBE8A.6080402@cam.ac.uk>
	<764978cf0709180513r4bf44ea3gcd183a5aadcacb23@mail.gmail.com>
	<bba689ec0709180523r7e3a30eg8a01ee3e25570721@mail.gmail.com>
	<764978cf0709180547w69e0fcfbp67976254e19ab253@mail.gmail.com>
	<46EFD217.1030103@cam.ac.uk>
	<155C67C0-1F81-4A1C-AD68-A21B4E6918C9@uiuc.edu>
Message-ID: <46F01EF9.80003@bms.com>

Actually, smiles can be tricky too- you can easily generate
non-canonical keys, where InChi is unique (as I understand it at least).
It is promoted by IUAPC:
http://www.iupac.org/inchi/
and can be generated by OpenBabel.
My take is that if you need to map between small molecules InChi might
be the best way..
Stefan

Chris Fields wrote:
> On Sep 18, 2007, at 8:26 AM, Roy Chaudhuri wrote:
>
>   
>>> My actual problem is a bit more complicated.
>>> It is not just one string, nut lakhs of them, they are actually  
>>> names of
>>> chemical compounds.
>>>
>>> THe problem is there are 2 different data sources, I need to match  
>>> the
>>> compond names between them, but the problem is though the compound  
>>> may
>>> be the same in the two, they use different naming formats for them.
>>>       
>> Unless you can define in simple and precise terms exactly which  
>> parts of
>> the string you need then there is no way that you will be able to  
>> code a
>> solution in Perl.
>>
>> Maybe you could look for a database that contains the synonyms for  
>> each
>> molecule? A quick Google finds ChEBI (http://www.ebi.ac.uk/chebi),  
>> which
>> is available to download as flat files.
>>
>> Roy.
>> --
>> Dr. Roy Chaudhuri
>> Department of Veterinary Medicine
>> University of Cambridge, U.K.
>>     
>
> D'oh!  Roy beat me to it; that's what I was going to suggest.  I  
> agree; don't trust simple word munging to always get you the correct  
> answer in this case, it's just too complicated to try and catch every  
> case.
>
> ChEBI is a good choice; Stefan's suggestion of OpenBabel is also a  
> good one.  I would also try not to reinvent the wheel; there may be  
> some modules available via CPAN which do what you need, such as these:
>
> http://search.cpan.org/search?query=chem&mode=module
>
> or this:
>
> http://search.cpan.org/~ghutchis/Chemistry-OpenBabel-1.2.0/
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>   



From jason at bioperl.org  Wed Sep 19 00:04:05 2007
From: jason at bioperl.org (Jason Stajich)
Date: Tue, 18 Sep 2007 17:04:05 -0700
Subject: [Bioperl-l] bioperl + GFF3 audit
Message-ID: <C7895984-E679-4079-A584-9EB013F22EB5@bioperl.org>

Something to throw out there for discussion with GFF3 gurus.  Maybe  
we can have a little STATE-OF-GFF3 and compliance at the GMOD  
workshop after Genome Informatics in Nov?

I propose after we get the next stable release out we consider doing  
a systematic code audit to insure that we can really generate proper  
GFF3 compliant data from all of our parsers.  This would include both  
good ID/Parent as well as .  I'd be happy to also think about making  
sure we can generate proper GTF/GFF2.5 - whether this means we have a  
translator that works on these objects or we have to code this into  
the parser software that creating the sequence features, not sure.   
The whole Bio::Tools mishmash is a little unsettling when trying to  
generate standardized output.  I'm not really clear if Bio::FeatureIO  
actually tries to do this properly, but 'gene_id'/'transcript_id' for  
GTF and ID/Parent 3-level Features for gene->transcript->exon/CDS  
doesn't really come out properly and I end up writing workarounds on  
the downstream data.

One aspect that is biting is the flat versus multi-level features  
(genes -> transcripts -> exons) and how we handle them.  I think this  
ought to get fleshed out better so we can really support .  A lot of  
the Bio::Tools parsers are generally pretty laissez fair here about  
things and we have a variety of non-standard and non-compliant aspects.

For example, I am playing with tRNA parsing and I assume that proper  
GFF3 here is three levels of :
gene -> tRNA -> exon
with those being the primary_tag names that correspond to the  
Sequence Ontology.

I have modified the code locally to report generic features but which  
have sub-features that must be extracted.  In addition the ID/Parent  
fields are explicitly filled in and I wonder if we want to do a  
better job insuring these are meaningfully entered?

So if there are interested people out there we can try and hammer out  
a todo list on the wiki and see if we're generating proper GFF3 in  
the first place and trying to make sure all the features that get fed  
out to Bio::FeatureIO or Bio::Tools::GFF can get properly transformed  
into GFF3 and GTF output.

Comments/Volunteers?

-jason

--
Jason Stajich
jason at bioperl.org



From cjfields at uiuc.edu  Wed Sep 19 03:37:30 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Sep 2007 22:37:30 -0500
Subject: [Bioperl-l] bioperl + GFF3 audit
In-Reply-To: <C7895984-E679-4079-A584-9EB013F22EB5@bioperl.org>
References: <C7895984-E679-4079-A584-9EB013F22EB5@bioperl.org>
Message-ID: <D6630AE3-B968-462C-9CED-D09C90BE786B@uiuc.edu>

On Sep 18, 2007, at 7:04 PM, Jason Stajich wrote:

> Something to throw out there for discussion with GFF3 gurus.  Maybe
> we can have a little STATE-OF-GFF3 and compliance at the GMOD
> workshop after Genome Informatics in Nov?
>
> I propose after we get the next stable release out we consider doing
> a systematic code audit to insure that we can really generate proper
> GFF3 compliant data from all of our parsers.  This would include both
> good ID/Parent as well as .  I'd be happy to also think about making
> sure we can generate proper GTF/GFF2.5 - whether this means we have a
> translator that works on these objects or we have to code this into
> the parser software that creating the sequence features, not sure.
> The whole Bio::Tools mishmash is a little unsettling when trying to
> generate standardized output.  I'm not really clear if Bio::FeatureIO
> actually tries to do this properly, but 'gene_id'/'transcript_id' for
> GTF and ID/Parent 3-level Features for gene->transcript->exon/CDS
> doesn't really come out properly and I end up writing workarounds on
> the downstream data.

This suggests we should try to get a stable out fairly quickly and  
work on the next dev straight away.  I'm okay with that, though it  
would be nice to finish up a few loose ends first, the svn move  
foremost.

The Feature/Annotation stuff has been pretty much rolled back so  
maybe a stable release can be done fairly quickly.  My main concern  
was that any rollback would break FeatureIO or SF::Annotated, but so  
far FeatureIO and SF::Annotated both pass tests.  However, I think  
both also need better documentation and possibly more/better test  
coverage.

> One aspect that is biting is the flat versus multi-level features
> (genes -> transcripts -> exons) and how we handle them.  I think this
> ought to get fleshed out better so we can really support .  A lot of
> the Bio::Tools parsers are generally pretty laissez fair here about
> things and we have a variety of non-standard and non-compliant  
> aspects.

Agreed.

> For example, I am playing with tRNA parsing and I assume that proper
> GFF3 here is three levels of :
> gene -> tRNA -> exon
> with those being the primary_tag names that correspond to the
> Sequence Ontology.
>
> I have modified the code locally to report generic features but which
> have sub-features that must be extracted.  In addition the ID/Parent
> fields are explicitly filled in and I wonder if we want to do a
> better job insuring these are meaningfully entered?

Would a factory approach work here?  For instance, have a Factory  
which generates the SeqFeature type you want on the fly if passed  
appropriate parameters and location, say flattened vs unflattened,  
strictly typed vs lightweight, etc.  For that matter, maybe we could  
reimplement FTHelper in SeqIO to do the same...

> So if there are interested people out there we can try and hammer out
> a todo list on the wiki and see if we're generating proper GFF3 in
> the first place and trying to make sure all the features that get fed
> out to Bio::FeatureIO or Bio::Tools::GFF can get properly transformed
> into GFF3 and GTF output.
>
> Comments/Volunteers?
>
> -jason
>
> --
> Jason Stajich
> jason at bioperl.org

I'll be busy 'til mid-Oct but I'll chip in.  I'll keep tabs on the wiki.

chris


From harryzs1981 at yahoo.com.cn  Fri Sep 21 14:40:55 2007
From: harryzs1981 at yahoo.com.cn (sheng zhao)
Date: Fri, 21 Sep 2007 22:40:55 +0800 (CST)
Subject: [Bioperl-l] Help for extracting CDS sequences from FASTA form
Message-ID: <815154.22486.qm@web15901.mail.cnb.yahoo.com>

              Dear all:      
I have got a set of DAN sequences in FASTA form as following: 
   
  >gnl|UG|Bt#S37443275 Bos taurus cathelicidin 4, mRNA (cDNA clone MGC:157131 IMAGE:8442308), complete cds /cds=p(18,452) /gb=BC133480 /gi=126717494 /ug=Bt.3 /len=572
  TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................................
  >gnl|UG|Bt#S11932596 B.taurus mRNA for interleukin-5 /cds=p(1,405) /gb=Z67872 /gi=1113120 /ug=Bt.5 /len=405
  TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC...................................
  >gnl|UG|Bt#S29311270 Hw_Loin_11_0520_C11 Bos taurus CF-24-HW loin cDNA library Bos taurus cDNA, mRNA sequence /gb=DV796078 /gi=82648993 /ug=Bt.10 /len=1332
  AACCGGGAGCACGCCGTGTACCCGCCAGTGGGGCTTCTGAGGACATGGGGGCCACCGTCA...................................
   
  I would like to know how to extract CDS sequences from them? Or a Perl program?
   
  Thank you for your reply and help.
   
  Sincerely yours,
  Best wishes,
  Harry 




       
---------------------------------
 @yahoo.cn ?????????????


From bix at sendu.me.uk  Fri Sep 21 15:28:30 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 21 Sep 2007 16:28:30 +0100
Subject: [Bioperl-l] Help for extracting CDS sequences from FASTA form
In-Reply-To: <815154.22486.qm@web15901.mail.cnb.yahoo.com>
References: <815154.22486.qm@web15901.mail.cnb.yahoo.com>
Message-ID: <46F3E31E.2010606@sendu.me.uk>

sheng zhao wrote:
> >gnl|UG|Bt#S37443275 [snip] /gb=BC133480 /gi=126717494 /ug=Bt.3 /len=572
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGC
[snip]
> I would like to know how to extract CDS sequences from them? Or a Perl program?

Where did you get the fasta sequences from? It would be easiest to go to 
the source that originally generated them and get it to give you the CDS 
coordinates as well.

Failing that you can get them from the NCBI database using the gb or gi ids.

Someone else will be along to give you the Bioperl code to do that, I'm 
sure :)


From harryzs1981 at yahoo.com.cn  Fri Sep 21 16:30:45 2007
From: harryzs1981 at yahoo.com.cn (sheng zhao)
Date: Sat, 22 Sep 2007 00:30:45 +0800 (CST)
Subject: [Bioperl-l]  Help for extracting CDS sequences from FASTA form
Message-ID: <352861.19969.qm@web15909.mail.cnb.yahoo.com>

Dear sir:
   
  Thank you for your relp.
   
  I got these sequences from NCBI(ftp.ncbi.nlm.nih.gov/repository/UniGene/Bos_taurus/Bt.seq.uniq.gz).
   
  Would you mind to tell me how to get gb or gi ids from this form?
  Thank you again.
   
  Best wishes.
  Harry
  


Sendu Bala <bix at sendu.me.uk> ???
    sheng zhao wrote:
> >gnl|UG|Bt#S37443275 [snip] /gb=BC133480 /gi=126717494 /ug=Bt.3 /len=572
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGC
[snip]
> I would like to know how to extract CDS sequences from them? Or a Perl program?

Where did you get the fasta sequences from? It would be easiest to go to 
the source that originally generated them and get it to give you the CDS 
coordinates as well.

Failing that you can get them from the NCBI database using the gb or gi ids.

Someone else will be along to give you the Bioperl code to do that, I'm 
sure :)
   


       
---------------------------------
?????????? 


From harryzs1981 at yahoo.com.cn  Fri Sep 21 16:32:21 2007
From: harryzs1981 at yahoo.com.cn (sheng zhao)
Date: Sat, 22 Sep 2007 00:32:21 +0800 (CST)
Subject: [Bioperl-l]
 =?gb2312?q?=BB=D8=B8=B4=A3=BA=20Re:=20=20Help=20for=20extracti?=
 =?gb2312?q?ng=20CDS=20sequences=20from=20FASTA=20form?=
In-Reply-To: <C319614A.FB06%bosborne11@verizon.net>
Message-ID: <548016.71302.qm@web15914.mail.cnb.yahoo.com>

Dear Brian O.:
   
   Thank you for your reple.
  I just want to get CDS sequences (DNA sequence) from them according to the CDS information in the title for each sequence. 
   
  For example, for the first sequence, the information is "complete cds /cds=p(18,452)" .

  Thank you again!
   
  Best wishes!
  Harry



Brian Osborne <bosborne11 at verizon.net> ???
  Harry,

Do you mean find an ORF starting at the first initiation codon and translate
that? Or some other approach?

Take a look at the translate() method:

http://www.bioperl.org/wiki/Bptutorial.pl#Translating


Brian O.


On 9/21/07 10:40 AM, "sheng zhao" wrote:

> Dear all:
> I have got a set of DAN sequences in FASTA form as following:
> 
>> gnl|UG|Bt#S37443275 Bos taurus cathelicidin 4, mRNA (cDNA clone MGC:157131
>> IMAGE:8442308), complete cds /cds=p(18,452) /gb=BC133480 /gi=126717494
>> /ug=Bt.3 /len=572
> 
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................
> ................
>> gnl|UG|Bt#S11932596 B.taurus mRNA for interleukin-5 /cds=p(1,405) /gb=Z67872
>> /gi=1113120 /ug=Bt.5 /len=405
> 
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................
> .................
>> gnl|UG|Bt#S29311270 Hw_Loin_11_0520_C11 Bos taurus CF-24-HW loin cDNA library
>> Bos taurus cDNA, mRNA sequence /gb=DV796078 /gi=82648993 /ug=Bt.10 /len=1332
> 
> AACCGGGAGCACGCCGTGTACCCGCCAGTGGGGCTTCTGAGGACATGGGGGCCACCGTCA..................
> .................
> 
> I would like to know how to extract CDS sequences from them? Or a Perl
> program?
> 
> Thank you for your reply and help.
> 
> Sincerely yours,
> Best wishes,
> Harry 
> 
> 
> 
> 
> 
> ---------------------------------
> @yahoo.cn ?????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




       
---------------------------------
?????????? 


From bosborne11 at verizon.net  Fri Sep 21 15:53:46 2007
From: bosborne11 at verizon.net (Brian Osborne)
Date: Fri, 21 Sep 2007 11:53:46 -0400
Subject: [Bioperl-l] Help for extracting CDS sequences from FASTA form
In-Reply-To: <815154.22486.qm@web15901.mail.cnb.yahoo.com>
Message-ID: <C319614A.FB06%bosborne11@verizon.net>

Harry,

Do you mean find an ORF starting at the first initiation codon and translate
that? Or some other approach?

Take a look at the translate() method:

http://www.bioperl.org/wiki/Bptutorial.pl#Translating


Brian O.


On 9/21/07 10:40 AM, "sheng zhao" <harryzs1981 at yahoo.com.cn> wrote:

>               Dear all:
> I have got a set of DAN sequences in FASTA form as following:
>    
>> gnl|UG|Bt#S37443275 Bos taurus cathelicidin 4, mRNA (cDNA clone MGC:157131
>> IMAGE:8442308), complete cds /cds=p(18,452) /gb=BC133480 /gi=126717494
>> /ug=Bt.3 /len=572
>   
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................
> ................
>> gnl|UG|Bt#S11932596 B.taurus mRNA for interleukin-5 /cds=p(1,405) /gb=Z67872
>> /gi=1113120 /ug=Bt.5 /len=405
>   
> TAGGCAGACTGGGGACCATGCAAACCCAGAGGGCCAGCCTCTCACTGGGGCGGTGGTCAC..................
> .................
>> gnl|UG|Bt#S29311270 Hw_Loin_11_0520_C11 Bos taurus CF-24-HW loin cDNA library
>> Bos taurus cDNA, mRNA sequence /gb=DV796078 /gi=82648993 /ug=Bt.10 /len=1332
>   
> AACCGGGAGCACGCCGTGTACCCGCCAGTGGGGCTTCTGAGGACATGGGGGCCACCGTCA..................
> .................
>    
>   I would like to know how to extract CDS sequences from them? Or a Perl
> program?
>    
>   Thank you for your reply and help.
>    
>   Sincerely yours,
>   Best wishes,
>   Harry 
> 
> 
> 
> 
>        
> ---------------------------------
>  @yahoo.cn ?????????????
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l





From florent.angly at gmail.com  Sat Sep 22 05:02:28 2007
From: florent.angly at gmail.com (Florent Angly)
Date: Fri, 21 Sep 2007 22:02:28 -0700
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
Message-ID: <46F4A1E4.7020002@gmail.com>

Hi,
I need to quantify how good some overlaps in contigs are. I have 
extracted the alignment of the overlapping region and only need to score 
it. I noticed the Bio::Tools::dpAlign has a scoring function.
Is it the right tool for the right tool? Is there anything else?
Thank you,
Florent


From florent.angly at gmail.com  Sun Sep 23 01:41:40 2007
From: florent.angly at gmail.com (Florent Angly)
Date: Sat, 22 Sep 2007 18:41:40 -0700
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <46F4A1E4.7020002@gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com>
Message-ID: <46F5C454.3050005@gmail.com>

Eventually, I gave Bio::Tools::dpAlign a try. I had no luck running it 
when installing its dependency, bioperl-ext v1.4 or v1.5.1. However all 
the tests passed when installing the CVS version.
So finally, here I am trying to score my alignments. For alignments of 2 
small sequences, it works, but as soon as the sequences get bigger than 
a few dozen nucleotides, it crashes:
Segmentation fault (core dumped)

I did not find any help in the documentation...

Can I fix this? Is this a bug?

Thanks for your help,

Florent

Florent Angly wrote:
> Hi,
> I need to quantify how good some overlaps in contigs are. I have 
> extracted the alignment of the overlapping region and only need to 
> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
> Is it the right tool for the right tool? Is there anything else?
> Thank you,
> Florent
>



From bioperl-list at superfrink.net  Sun Sep 23 16:21:44 2007
From: bioperl-list at superfrink.net (Chad Clark)
Date: Sun, 23 Sep 2007 10:21:44 -0600 (MDT)
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <46F5C454.3050005@gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>
	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>
	<46EFBA0E.4030104@sheffield.ac.uk>
	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>
	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
Message-ID: <Pine.LNX.4.64.0709231013340.21280@gurchecyrohssnyb.arg>

On Sat, 22 Sep 2007, Florent Angly wrote:

> So finally, here I am trying to score my alignments. For alignments of 2
> small sequences, it works, but as soon as the sequences get bigger than
> a few dozen nucleotides, it crashes:
> Segmentation fault (core dumped)

In my experience if a program runs on small sets of data and segfaults on 
larger sets it is likely running out of stack space.  You can try changing 
the allowed stack size with "ulimit" before running your program and see 
if it works with more data.

   [chad at water ~]$ ulimit -a | grep -i stack
   stack size              (kbytes, -s) 10240
   [chad at water ~]$ ulimit -s 40960
   [chad at water ~]$ ulimit -a | grep -i stack
   stack size              (kbytes, -s) 40960

I don't know the code / algorithm in question but it might require 
significantly more stack space as the data set grows in size so this 
change might not help enough.

Good luck,
Chad


From bix at sendu.me.uk  Mon Sep 24 09:35:39 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Mon, 24 Sep 2007 10:35:39 +0100
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
Message-ID: <46F784EB.9050507@sendu.me.uk>

Hi,

I'm finding that when writing GFF files the version header line gets 
printed out twice. This is because:

sub _initialize {
   # [snip]

   if ($arg{-file} =~ /^>.*/ ) {
     $self->_print("##gff-version " . $self->version() . "\n");
   }
   else {
     my $directive;
     while(($directive = $self->_readline()) && ( $directive =~ /^##/ || 
$directive =~ /^>/)){
       $self->_handle_directive($directive);
     }
     $self->_pushback($directive);
   }

   if ($arg{-file} =~ /^>.*/ ) {
     $self->_print("##gff-version " . $self->version() . "\n");
   }

   # [snip]
}

Does it make sense for if ($arg{-file} =~ /^>.*/ ) to appear twice like 
that? If not, which one should be removed? The independent one, or the 
if/else one?


Cheers,
Sendu.


From awitney at sgul.ac.uk  Mon Sep 24 12:40:07 2007
From: awitney at sgul.ac.uk (Adam Witney)
Date: Mon, 24 Sep 2007 13:40:07 +0100
Subject: [Bioperl-l] Minor docs discrepancy?
In-Reply-To: <E8CEAD6A-9F6B-43B8-94A3-95A1C96E872D@duke.edu>
Message-ID: <C31D6EB7.1A1BD%awitney@sgul.ac.uk>


Hi,

I was just going through the BlastHSP.pm POD and lines 23-24 say

"For Bio::SearchIO BLAST parsing usage examples, see the
"examples/search-blast" directory of the Bioperl distribution."

However in the distribution (1.4 and 1.5.2_102) it looks to be
"examples/searchio"

Is this in need of updating, or am I looking in the wrong place?

Thanks

Adam




From cjfields at uiuc.edu  Mon Sep 24 13:09:46 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 08:09:46 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <46F784EB.9050507@sendu.me.uk>
References: <46F784EB.9050507@sendu.me.uk>
Message-ID: <7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>

It looks like the first is a cut-and-paste revision of the second, so  
I would say the second independent if block is redundant.

Should we be printing output in _initialize()?  I would think any  
output would be handled in a write_* method of some sort and not in a  
common method used for initializing both input and output stream  
data.  What happens here if you use '-fh' and want output redirected  
to STDOUT?

chris

On Sep 24, 2007, at 4:35 AM, Sendu Bala wrote:

> Hi,
>
> I'm finding that when writing GFF files the version header line gets
> printed out twice. This is because:
>
> sub _initialize {
>    # [snip]
>
>    if ($arg{-file} =~ /^>.*/ ) {
>      $self->_print("##gff-version " . $self->version() . "\n");
>    }
>    else {
>      my $directive;
>      while(($directive = $self->_readline()) && ( $directive =~ / 
> ^##/ ||
> $directive =~ /^>/)){
>        $self->_handle_directive($directive);
>      }
>      $self->_pushback($directive);
>    }
>
>    if ($arg{-file} =~ /^>.*/ ) {
>      $self->_print("##gff-version " . $self->version() . "\n");
>    }
>
>    # [snip]
> }
>
> Does it make sense for if ($arg{-file} =~ /^>.*/ ) to appear twice  
> like
> that? If not, which one should be removed? The independent one, or the
> if/else one?
>
>
> Cheers,
> Sendu.



From cjfields at uiuc.edu  Mon Sep 24 13:13:53 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 08:13:53 -0500
Subject: [Bioperl-l] Minor docs discrepancy?
In-Reply-To: <C31D6EB7.1A1BD%awitney@sgul.ac.uk>
References: <C31D6EB7.1A1BD%awitney@sgul.ac.uk>
Message-ID: <B692F0F5-7CA3-4D32-B588-78087B25D193@uiuc.edu>

I have updated that in CVS.  Thanks for pointing that out!

chris

On Sep 24, 2007, at 7:40 AM, Adam Witney wrote:

>
> Hi,
>
> I was just going through the BlastHSP.pm POD and lines 23-24 say
>
> "For Bio::SearchIO BLAST parsing usage examples, see the
> "examples/search-blast" directory of the Bioperl distribution."
>
> However in the distribution (1.4 and 1.5.2_102) it looks to be
> "examples/searchio"
>
> Is this in need of updating, or am I looking in the wrong place?
>
> Thanks
>
> Adam


From bix at sendu.me.uk  Mon Sep 24 13:20:33 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Mon, 24 Sep 2007 14:20:33 +0100
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
Message-ID: <46F7B9A1.9080206@sendu.me.uk>

Chris Fields wrote:
> It looks like the first is a cut-and-paste revision of the second, so I 
> would say the second independent if block is redundant.

I agree. I'll make that change.


> Should we be printing output in _initialize()?  I would think any output 
> would be handled in a write_* method of some sort and not in a common 
> method used for initializing both input and output stream data.  What 
> happens here if you use '-fh' and want output redirected to STDOUT?

I think the problem is that the method is write_feature(), which can be 
called many times for a single output file, but the version should only 
be printed once at the very start of the file.

I suppose it just needs better capturing of when we're intending to 
write... Hmmm... didn't I fix a method related to that?...

Yes, yes I did:
Bio::Root::IO->mode
;)

Any objections to me replacing the if clause with one using that method?


From cjfields at uiuc.edu  Mon Sep 24 13:35:22 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 08:35:22 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <46F7B9A1.9080206@sendu.me.uk>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
Message-ID: <EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>


On Sep 24, 2007, at 8:20 AM, Sendu Bala wrote:

> Chris Fields wrote:
>> It looks like the first is a cut-and-paste revision of the second,  
>> so I would say the second independent if block is redundant.
>
> I agree. I'll make that change.
>
>
>> Should we be printing output in _initialize()?  I would think any  
>> output would be handled in a write_* method of some sort and not  
>> in a common method used for initializing both input and output  
>> stream data.  What happens here if you use '-fh' and want output  
>> redirected to STDOUT?
>
> I think the problem is that the method is write_feature(), which  
> can be called many times for a single output file, but the version  
> should only be printed once at the very start of the file.
>
> I suppose it just needs better capturing of when we're intending to  
> write... Hmmm... didn't I fix a method related to that?...
>
> Yes, yes I did:
> Bio::Root::IO->mode
> ;)
>
> Any objections to me replacing the if clause with one using that  
> method?

I think that'll work fine.  The other option would be call a  
print_gff_header() function within write_feature() with the intent to  
print the header only once, using a flag or similar:

if (!$self->header_printed) {
     $self->print_gff_header;
     $self->header_printed(1);
}

chris


From hlapp at gmx.net  Mon Sep 24 17:41:34 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Mon, 24 Sep 2007 13:41:34 -0400
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
Message-ID: <234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>

I'd lean toward this or a similar approach too. Writing stuff out in  
the constructor doesn't feel like the best design.

	-hilmar

On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:

>
> On Sep 24, 2007, at 8:20 AM, Sendu Bala wrote:
>
>> Chris Fields wrote:
>>> It looks like the first is a cut-and-paste revision of the second,
>>> so I would say the second independent if block is redundant.
>>
>> I agree. I'll make that change.
>>
>>
>>> Should we be printing output in _initialize()?  I would think any
>>> output would be handled in a write_* method of some sort and not
>>> in a common method used for initializing both input and output
>>> stream data.  What happens here if you use '-fh' and want output
>>> redirected to STDOUT?
>>
>> I think the problem is that the method is write_feature(), which
>> can be called many times for a single output file, but the version
>> should only be printed once at the very start of the file.
>>
>> I suppose it just needs better capturing of when we're intending to
>> write... Hmmm... didn't I fix a method related to that?...
>>
>> Yes, yes I did:
>> Bio::Root::IO->mode
>> ;)
>>
>> Any objections to me replacing the if clause with one using that
>> method?
>
> I think that'll work fine.  The other option would be call a
> print_gff_header() function within write_feature() with the intent to
> print the header only once, using a flag or similar:
>
> if (!$self->header_printed) {
>      $self->print_gff_header;
>      $self->header_printed(1);
> }
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From cjfields at uiuc.edu  Mon Sep 24 18:11:47 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 13:11:47 -0500
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <46F5C454.3050005@gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
Message-ID: <9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>

As Chad mentioned it could be a stack issue, but it might be worth  
filing a bug on.  I will note that bioperl-ext has seen very little  
use in the last few years, so don't expect it to be fixed unless you  
can contact the ext module author.

chris

On Sep 22, 2007, at 8:41 PM, Florent Angly wrote:

> Eventually, I gave Bio::Tools::dpAlign a try. I had no luck running it
> when installing its dependency, bioperl-ext v1.4 or v1.5.1. However  
> all
> the tests passed when installing the CVS version.
> So finally, here I am trying to score my alignments. For alignments  
> of 2
> small sequences, it works, but as soon as the sequences get bigger  
> than
> a few dozen nucleotides, it crashes:
> Segmentation fault (core dumped)
>
> I did not find any help in the documentation...
>
> Can I fix this? Is this a bug?
>
> Thanks for your help,
>
> Florent
>
> Florent Angly wrote:
>> Hi,
>> I need to quantify how good some overlaps in contigs are. I have
>> extracted the alignment of the overlapping region and only need to
>> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
>> Is it the right tool for the right tool? Is there anything else?
>> Thank you,
>> Florent
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From florent.angly at gmail.com  Mon Sep 24 19:07:35 2007
From: florent.angly at gmail.com (Florent Angly)
Date: Mon, 24 Sep 2007 12:07:35 -0700
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
	<9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>
Message-ID: <46F80AF7.4090109@gmail.com>

I see... Thanks for the replies Chad and Chris. Then I have two more 
questions!
1/ Do you know how to get a core dump that could help debug my 
segmentation fault? I have produced dumps of binary C programs before 
with gdb. I have used the Perl debugger for Perl scripts. But how to 
deal with C functions called by Perl?
2/ Is there an easier method to calculate an alignment score in BioPerl 
than using Bio::Tools::dpAlign? I didn't seem to locate something else, 
but who knows...
I have workarounds for quantifying the quality of the overlap, so 
calculating a score is not critical for me (though I believe this would 
be the most accurate/adapted method).
Florent

Chris Fields wrote:
> As Chad mentioned it could be a stack issue, but it might be worth 
> filing a bug on.  I will note that bioperl-ext has seen very little 
> use in the last few years, so don't expect it to be fixed unless you 
> can contact the ext module author.
>
> chris
>
> On Sep 22, 2007, at 8:41 PM, Florent Angly wrote:
>
>> Eventually, I gave Bio::Tools::dpAlign a try. I had no luck running it
>> when installing its dependency, bioperl-ext v1.4 or v1.5.1. However all
>> the tests passed when installing the CVS version.
>> So finally, here I am trying to score my alignments. For alignments of 2
>> small sequences, it works, but as soon as the sequences get bigger than
>> a few dozen nucleotides, it crashes:
>> Segmentation fault (core dumped)
>>
>> I did not find any help in the documentation...
>>
>> Can I fix this? Is this a bug?
>>
>> Thanks for your help,
>>
>> Florent
>>
>> Florent Angly wrote:
>>> Hi,
>>> I need to quantify how good some overlaps in contigs are. I have
>>> extracted the alignment of the overlapping region and only need to
>>> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
>>> Is it the right tool for the right tool? Is there anything else?
>>> Thank you,
>>> Florent
>>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
>



From cjfields at uiuc.edu  Mon Sep 24 19:26:46 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Sep 2007 14:26:46 -0500
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <46F80AF7.4090109@gmail.com>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
	<9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>
	<46F80AF7.4090109@gmail.com>
Message-ID: <0C6508FB-4765-4E4E-AFD1-6E5BFE8F9368@uiuc.edu>

I suppose if you can find a way to export the contig data into a  
Bio::SimpleAlign you look at the methods in  
Bio::Align::DNAStatistics.  SimpleAlign also has some builtin methods  
like average_percentage_identity, percentage_identity, etc, which may  
be worth a look.

chris

On Sep 24, 2007, at 2:07 PM, Florent Angly wrote:

> I see... Thanks for the replies Chad and Chris. Then I have two more
> questions!
> 1/ Do you know how to get a core dump that could help debug my
> segmentation fault? I have produced dumps of binary C programs before
> with gdb. I have used the Perl debugger for Perl scripts. But how to
> deal with C functions called by Perl?
> 2/ Is there an easier method to calculate an alignment score in  
> BioPerl
> than using Bio::Tools::dpAlign? I didn't seem to locate something  
> else,
> but who knows...
> I have workarounds for quantifying the quality of the overlap, so
> calculating a score is not critical for me (though I believe this  
> would
> be the most accurate/adapted method).
> Florent
>
> Chris Fields wrote:
>> As Chad mentioned it could be a stack issue, but it might be worth
>> filing a bug on.  I will note that bioperl-ext has seen very little
>> use in the last few years, so don't expect it to be fixed unless you
>> can contact the ext module author.
>>
>> chris
>>
>> On Sep 22, 2007, at 8:41 PM, Florent Angly wrote:
>>
>>> Eventually, I gave Bio::Tools::dpAlign a try. I had no luck  
>>> running it
>>> when installing its dependency, bioperl-ext v1.4 or v1.5.1.  
>>> However all
>>> the tests passed when installing the CVS version.
>>> So finally, here I am trying to score my alignments. For  
>>> alignments of 2
>>> small sequences, it works, but as soon as the sequences get  
>>> bigger than
>>> a few dozen nucleotides, it crashes:
>>> Segmentation fault (core dumped)
>>>
>>> I did not find any help in the documentation...
>>>
>>> Can I fix this? Is this a bug?
>>>
>>> Thanks for your help,
>>>
>>> Florent
>>>
>>> Florent Angly wrote:
>>>> Hi,
>>>> I need to quantify how good some overlaps in contigs are. I have
>>>> extracted the alignment of the overlapping region and only need to
>>>> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
>>>> Is it the right tool for the right tool? Is there anything else?
>>>> Thank you,
>>>> Florent
>>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From florent.angly at gmail.com  Mon Sep 24 19:46:36 2007
From: florent.angly at gmail.com (Florent Angly)
Date: Mon, 24 Sep 2007 12:46:36 -0700
Subject: [Bioperl-l] Scoring an overlap
In-Reply-To: <0C6508FB-4765-4E4E-AFD1-6E5BFE8F9368@uiuc.edu>
References: <764978cf0709180330i232c2f04yf033414ad0dba655@mail.gmail.com>	<bba689ec0709180357q335277dbg4344101a6051aaa@mail.gmail.com>	<46EFBA0E.4030104@sheffield.ac.uk>	<Pine.LNX.4.64.0709180946100.22607@gurchecyrohssnyb.arg>	<46F00902.9070401@sendu.me.uk>
	<5C811C68-D049-407A-946D-061DD8951B54@uiuc.edu>
	<46F4A1E4.7020002@gmail.com> <46F5C454.3050005@gmail.com>
	<9347CF3A-7F01-4C73-82A4-3B164420EF04@uiuc.edu>
	<46F80AF7.4090109@gmail.com>
	<0C6508FB-4765-4E4E-AFD1-6E5BFE8F9368@uiuc.edu>
Message-ID: <46F8141C.8010507@gmail.com>

Yes, right! That's the methods I use as my workarounds. =)
Thanks for suggesting.
Florent

Chris Fields wrote:
> I suppose if you can find a way to export the contig data into a 
> Bio::SimpleAlign you look at the methods in 
> Bio::Align::DNAStatistics.  SimpleAlign also has some builtin methods 
> like average_percentage_identity, percentage_identity, etc, which may 
> be worth a look.
>
> chris
>
> On Sep 24, 2007, at 2:07 PM, Florent Angly wrote:
>
>> I see... Thanks for the replies Chad and Chris. Then I have two more
>> questions!
>> 1/ Do you know how to get a core dump that could help debug my
>> segmentation fault? I have produced dumps of binary C programs before
>> with gdb. I have used the Perl debugger for Perl scripts. But how to
>> deal with C functions called by Perl?
>> 2/ Is there an easier method to calculate an alignment score in BioPerl
>> than using Bio::Tools::dpAlign? I didn't seem to locate something else,
>> but who knows...
>> I have workarounds for quantifying the quality of the overlap, so
>> calculating a score is not critical for me (though I believe this would
>> be the most accurate/adapted method).
>> Florent
>>
>> Chris Fields wrote:
>>> As Chad mentioned it could be a stack issue, but it might be worth
>>> filing a bug on.  I will note that bioperl-ext has seen very little
>>> use in the last few years, so don't expect it to be fixed unless you
>>> can contact the ext module author.
>>>
>>> chris
>>>
>>> On Sep 22, 2007, at 8:41 PM, Florent Angly wrote:
>>>
>>>> Eventually, I gave Bio::Tools::dpAlign a try. I had no luck running it
>>>> when installing its dependency, bioperl-ext v1.4 or v1.5.1. However 
>>>> all
>>>> the tests passed when installing the CVS version.
>>>> So finally, here I am trying to score my alignments. For alignments 
>>>> of 2
>>>> small sequences, it works, but as soon as the sequences get bigger 
>>>> than
>>>> a few dozen nucleotides, it crashes:
>>>> Segmentation fault (core dumped)
>>>>
>>>> I did not find any help in the documentation...
>>>>
>>>> Can I fix this? Is this a bug?
>>>>
>>>> Thanks for your help,
>>>>
>>>> Florent
>>>>
>>>> Florent Angly wrote:
>>>>> Hi,
>>>>> I need to quantify how good some overlaps in contigs are. I have
>>>>> extracted the alignment of the overlapping region and only need to
>>>>> score it. I noticed the Bio::Tools::dpAlign has a scoring function.
>>>>> Is it the right tool for the right tool? Is there anything else?
>>>>> Thank you,
>>>>> Florent
>>>>>
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>> Christopher Fields
>>> Postdoctoral Researcher
>>> Lab of Dr. Robert Switzer
>>> Dept of Biochemistry
>>> University of Illinois Urbana-Champaign
>>>
>>>
>>>
>>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
>



From bix at sendu.me.uk  Tue Sep 25 10:00:20 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Tue, 25 Sep 2007 11:00:20 +0100
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
Message-ID: <46F8DC34.6020908@sendu.me.uk>

Hilmar Lapp wrote:
> On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:
>> I think that'll work fine.  The other option would be call a
>> print_gff_header() function within write_feature() with the intent to
>> print the header only once, using a flag or similar:
>>
>> if (!$self->header_printed) {
>>      $self->print_gff_header;
>>      $self->header_printed(1);
>> }
 >
> I'd lean toward this or a similar approach too. Writing stuff out in the 
> constructor doesn't feel like the best design.

I'd argue that the alternative is just inefficient with no compensating 
benefit. You have something that must only be done once, and a method 
(_initialize) that is only called once. The constructor is used to set 
up the file, getting it into a state ready to add features. This 
involves opening it for writing with the correct filename and setting 
the desired GFF version. Why wouldn't it also output what ever else was 
necessary it initialize the file?

Also, what do we expect should happen when we use Bioperl to create a 
GFF file and don't write any features to it? Should it be an empty file, 
or should it contain whatever GFF information the user had managed to 
supply (the version)?


From cjfields at uiuc.edu  Tue Sep 25 14:14:04 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 25 Sep 2007 09:14:04 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <46F8DC34.6020908@sendu.me.uk>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
Message-ID: <22FB7AE5-2E1C-450C-A48C-6014CC5EB786@uiuc.edu>


On Sep 25, 2007, at 5:00 AM, Sendu Bala wrote:

> Hilmar Lapp wrote:
>> On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:
>>> I think that'll work fine.  The other option would be call a
>>> print_gff_header() function within write_feature() with the  
>>> intent to
>>> print the header only once, using a flag or similar:
>>>
>>> if (!$self->header_printed) {
>>>      $self->print_gff_header;
>>>      $self->header_printed(1);
>>> }
>>
>> I'd lean toward this or a similar approach too. Writing stuff out  
>> in the
>> constructor doesn't feel like the best design.
>
> I'd argue that the alternative is just inefficient with no  
> compensating
> benefit. You have something that must only be done once, and a method
> (_initialize) that is only called once. The constructor is used to set
> up the file, getting it into a state ready to add features. This
> involves opening it for writing with the correct filename and setting
> the desired GFF version. Why wouldn't it also output what ever else  
> was
> necessary it initialize the file?

It's great to have someone picking this up, so anything that works is  
fine by me, to tell the truth.  I'll state my piece, though, and  
stand out of the way.

In my opinion there are a couple of compensating benefits.  One is  
long-term maintenance, primarily being all calls to generate output  
are contained within the write_features method and are thus easier to  
find and more maintainable.  The logic goes, if there were a bug I  
would expect to find output in a write_* method or a method called  
from within write_* method, not in the constructor or something  
called from the constructor, like _initialize().  I've always been  
told the constructor in any OO language is typically limited to  
setting state data and behavior, not generating new data (i.e.  
generating output).

Related to that, the other benefit is expected behavior when calling  
a method.  I don't know of cases in other IO classes in Bioperl which  
generate output when a new() instance is created; output is expected  
specifically when calling a particular write_* method.  Therefore I  
wouldn't expect any output be generated until write_feature() were  
called (or calling similarly named methods where output would be  
expected, like a print_* method).

Saying all that, I'm probably not the best one to bang the 'best  
practices' drum right now as I haven't had time to finish up several  
modules I've been working on!  Speaking of (going back to work...)

> Also, what do we expect should happen when we use Bioperl to create a
> GFF file and don't write any features to it? Should it be an empty  
> file,
> or should it contain whatever GFF information the user had managed to
> supply (the version)?

As mentioned above, I would expect no output generated at all unless  
explicitly calling write_features(), just like any of the other IOs;  
the header info would be generated then.  BioPerl has traditionally  
been for whatever works though, which is fine by me.

chris


From forrest_zhang at 163.com  Thu Sep 27 07:41:44 2007
From: forrest_zhang at 163.com (Forrest)
Date: Thu, 27 Sep 2007 15:41:44 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
Message-ID: <000501c800d9$dc9c8e90$95d5abb0$@com>

Hi, all
    I install the biosql, and bioperl-db. I want to import swissport data.
But the programe show some error as below:
============================================================================
===============================================
>perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
-namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
Loading /home/forrest/uniprot/uniprot_sprot.dat ...
Could not store Q6DAH5:
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: The supplied lineage does not start near 'Erwinia carotovora subsp.
atroseptica' (I was supplied 'Erwinia carotovora subsp. | Pectobacterium |
Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
Proteobacteria | Bacteria')
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
STACK: Bio::Species::classification
/usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:552
STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:1305
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:973
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:852
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:182
STACK: Bio::DB::Persistent::PersistentObject::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:244
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:169
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:251
STACK: Bio::DB::Persistent::PersistentObject::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:271
STACK: load_seqdatabase.pl:620
-----------------------------------------------------------

 at load_seqdatabase.pl line 633
============================================================================
===============================================

How can I solve it, please help me, Thank you.

Thanks
Forrest zhang





From bix at sendu.me.uk  Thu Sep 27 08:38:00 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 27 Sep 2007 09:38:00 +0100
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000501c800d9$dc9c8e90$95d5abb0$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
Message-ID: <46FB6BE8.9050203@sendu.me.uk>

Forrest wrote:
> Hi, all
>     I install the biosql, and bioperl-db. I want to import swissport data.
> But the programe show some error as below:
> ============================================================================
> ===============================================
>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
> Could not store Q6DAH5:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: The supplied lineage does not start near 'Erwinia carotovora subsp.
> atroseptica' (I was supplied 'Erwinia carotovora subsp. | Pectobacterium |
> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
> Proteobacteria | Bacteria')

From:
OS   Erwinia carotovora subsp. atroseptica (Pectobacterium atrosepticum).
OC   Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales;
OC   Enterobacteriaceae; Pectobacterium.

I'm guessing some oddity in the Swissprot parser where in one place it 
truncates the OS to the first '.', and in another it doesn't?

Can someone confirm this with CVS versions of bioperl-live and -db in 
case Chris already fixed it in recent parser changes?


From cjfields at uiuc.edu  Thu Sep 27 12:47:00 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 07:47:00 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <46FB6BE8.9050203@sendu.me.uk>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<46FB6BE8.9050203@sendu.me.uk>
Message-ID: <AB3D3A39-0B66-4C22-9EE1-98429A958598@uiuc.edu>


On Sep 27, 2007, at 3:38 AM, Sendu Bala wrote:

> Forrest wrote:
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import  
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora  
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |  
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>
> From:
> OS   Erwinia carotovora subsp. atroseptica (Pectobacterium  
> atrosepticum).
> OC   Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales;
> OC   Enterobacteriaceae; Pectobacterium.
>
> I'm guessing some oddity in the Swissprot parser where in one place it
> truncates the OS to the first '.', and in another it doesn't?
>
> Can someone confirm this with CVS versions of bioperl-live and -db in
> case Chris already fixed it in recent parser changes?

It looks suspiciously like he isn't using bioperl-live code (I  
changed the exception to a warning a while back, and I think the '.'  
truncation was fixed).  This is still an outstanding issue with  
bioperl-db which hasn't been fully fixed yet, though; we may have to  
move the priority up on this one.

chris


From bix at sendu.me.uk  Thu Sep 27 13:47:06 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 27 Sep 2007 14:47:06 +0100
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
Message-ID: <46FBB45A.10505@sendu.me.uk>

I want to create a Bio::SeqFeature::Annotated object where the 'type' is 
'conserved_region'.

I got the idea that 'conserved_region' might be ok from here:
http://song.sourceforge.net/SOterm_tables.html#SO:0000330

However, this doesn't work since:

------------- EXCEPTION -------------
MSG: couldn't find a SOFA term matching type 'conserved_region'.
STACK Bio::SeqFeature::Annotated::type 
/data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/Annotated.pm:371
[snip]


I'm guessing Bio::Ontology::OntologyStore is getting its allowed SOFA 
terms from:
http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition


I don't know much about this area. Can someone offer a little guidance 
as to what the significance of these two different files is, why they 
don't contain the same terms, and why I can't use 'conserved_region'?

What's the closest alternative term?


From cain.cshl at gmail.com  Thu Sep 27 14:20:50 2007
From: cain.cshl at gmail.com (Scott Cain)
Date: Thu, 27 Sep 2007 10:20:50 -0400
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
In-Reply-To: <46FBB45A.10505@sendu.me.uk>
References: <46FBB45A.10505@sendu.me.uk>
Message-ID: <1190902850.12078.26.camel@localhost.localdomain>

Hi Sendu,

I believe that BSFA uses SOFA but the growing consensus is that SOFA
should be pitched and all of SO should be used where SOFA was being
used.  I also suspect that BioPerl is using a very old version of SOFA,
since at the time BSFA was written, BioPerl couldn't parse OBO files
(can it now?), so it was using the very old file format (whose name I
can't even remember now) and that file hasn't been updated in a long
time (which is why it isn't finding conserved_region).

If BioPerl can parse OBO files, we should switch BSFA to validate
against 

http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo

Scott


On Thu, 2007-09-27 at 14:47 +0100, Sendu Bala wrote:
> I want to create a Bio::SeqFeature::Annotated object where the 'type' is 
> 'conserved_region'.
> 
> I got the idea that 'conserved_region' might be ok from here:
> http://song.sourceforge.net/SOterm_tables.html#SO:0000330
> 
> However, this doesn't work since:
> 
> ------------- EXCEPTION -------------
> MSG: couldn't find a SOFA term matching type 'conserved_region'.
> STACK Bio::SeqFeature::Annotated::type 
> /data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/Annotated.pm:371
> [snip]
> 
> 
> I'm guessing Bio::Ontology::OntologyStore is getting its allowed SOFA 
> terms from:
> http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition
> 
> 
> I don't know much about this area. Can someone offer a little guidance 
> as to what the significance of these two different files is, why they 
> don't contain the same terms, and why I can't use 'conserved_region'?
> 
> What's the closest alternative term?
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain at cshl.edu
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory



From cjfields at uiuc.edu  Thu Sep 27 15:25:13 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 10:25:13 -0500
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
In-Reply-To: <1190902850.12078.26.camel@localhost.localdomain>
References: <46FBB45A.10505@sendu.me.uk>
	<1190902850.12078.26.camel@localhost.localdomain>
Message-ID: <29DFE331-33F5-47ED-9A6D-AF488E5F0689@uiuc.edu>


On Sep 27, 2007, at 9:20 AM, Scott Cain wrote:

> Hi Sendu,
>
> I believe that BSFA uses SOFA but the growing consensus is that SOFA
> should be pitched and all of SO should be used where SOFA was being
> used.  I also suspect that BioPerl is using a very old version of  
> SOFA,
> since at the time BSFA was written, BioPerl couldn't parse OBO files
> (can it now?), so it was using the very old file format (whose name I
> can't even remember now) and that file hasn't been updated in a long
> time (which is why it isn't finding conserved_region).
>
> If BioPerl can parse OBO files, we should switch BSFA to validate
> against
>
> http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo
>
> Scott

I agree, this would definitely be for the best.  BioPerl can parse  
obo; not sure how often it's used or what the tests are like, but  
switching to SO should give it a good workout and might wring out any  
issues.

chris

> On Thu, 2007-09-27 at 14:47 +0100, Sendu Bala wrote:
>> I want to create a Bio::SeqFeature::Annotated object where the  
>> 'type' is
>> 'conserved_region'.
>>
>> I got the idea that 'conserved_region' might be ok from here:
>> http://song.sourceforge.net/SOterm_tables.html#SO:0000330
>>
>> However, this doesn't work since:
>>
>> ------------- EXCEPTION -------------
>> MSG: couldn't find a SOFA term matching type 'conserved_region'.
>> STACK Bio::SeqFeature::Annotated::type
>> /data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/ 
>> Annotated.pm:371
>> [snip]
>>
>>
>> I'm guessing Bio::Ontology::OntologyStore is getting its allowed SOFA
>> terms from:
>> http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition
>>
>>
>> I don't know much about this area. Can someone offer a little  
>> guidance
>> as to what the significance of these two different files is, why they
>> don't contain the same terms, and why I can't use 'conserved_region'?
>>
>> What's the closest alternative term?
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> -- 
> ---------------------------------------------------------------------- 
> --
> Scott Cain, Ph. D.                                          
> cain at cshl.edu
> GMOD Coordinator (http://www.gmod.org/)                      
> 216-392-3087
> Cold Spring Harbor Laboratory
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Research Associate
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From cain.cshl at gmail.com  Thu Sep 27 15:34:57 2007
From: cain.cshl at gmail.com (Scott Cain)
Date: Thu, 27 Sep 2007 11:34:57 -0400
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
In-Reply-To: <29DFE331-33F5-47ED-9A6D-AF488E5F0689@uiuc.edu>
References: <46FBB45A.10505@sendu.me.uk>
	<1190902850.12078.26.camel@localhost.localdomain>
	<29DFE331-33F5-47ED-9A6D-AF488E5F0689@uiuc.edu>
Message-ID: <1190907297.12078.32.camel@localhost.localdomain>

OK--while I would normal volunteer to do this, I don't think I am going
to have time until after the Genome Informatics and GMOD meetings in
November :-/  If it is still not done then, somebody poke me and remind
me that I said that.

Scott


On Thu, 2007-09-27 at 10:25 -0500, Chris Fields wrote:
> On Sep 27, 2007, at 9:20 AM, Scott Cain wrote:
> 
> > Hi Sendu,
> >
> > I believe that BSFA uses SOFA but the growing consensus is that SOFA
> > should be pitched and all of SO should be used where SOFA was being
> > used.  I also suspect that BioPerl is using a very old version of  
> > SOFA,
> > since at the time BSFA was written, BioPerl couldn't parse OBO files
> > (can it now?), so it was using the very old file format (whose name I
> > can't even remember now) and that file hasn't been updated in a long
> > time (which is why it isn't finding conserved_region).
> >
> > If BioPerl can parse OBO files, we should switch BSFA to validate
> > against
> >
> > http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo
> >
> > Scott
> 
> I agree, this would definitely be for the best.  BioPerl can parse  
> obo; not sure how often it's used or what the tests are like, but  
> switching to SO should give it a good workout and might wring out any  
> issues.
> 
> chris
> 
> > On Thu, 2007-09-27 at 14:47 +0100, Sendu Bala wrote:
> >> I want to create a Bio::SeqFeature::Annotated object where the  
> >> 'type' is
> >> 'conserved_region'.
> >>
> >> I got the idea that 'conserved_region' might be ok from here:
> >> http://song.sourceforge.net/SOterm_tables.html#SO:0000330
> >>
> >> However, this doesn't work since:
> >>
> >> ------------- EXCEPTION -------------
> >> MSG: couldn't find a SOFA term matching type 'conserved_region'.
> >> STACK Bio::SeqFeature::Annotated::type
> >> /data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/ 
> >> Annotated.pm:371
> >> [snip]
> >>
> >>
> >> I'm guessing Bio::Ontology::OntologyStore is getting its allowed SOFA
> >> terms from:
> >> http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition
> >>
> >>
> >> I don't know much about this area. Can someone offer a little  
> >> guidance
> >> as to what the significance of these two different files is, why they
> >> don't contain the same terms, and why I can't use 'conserved_region'?
> >>
> >> What's the closest alternative term?
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > -- 
> > ---------------------------------------------------------------------- 
> > --
> > Scott Cain, Ph. D.                                          
> > cain at cshl.edu
> > GMOD Coordinator (http://www.gmod.org/)                      
> > 216-392-3087
> > Cold Spring Harbor Laboratory
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> Christopher Fields
> Research Associate
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
> 
> 
> 
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   cain.cshl at gmail.com
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory




From cjfields at uiuc.edu  Thu Sep 27 15:43:06 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 10:43:06 -0500
Subject: [Bioperl-l] Bio::SeqFeature::Annotated / SOFA question
In-Reply-To: <1190907297.12078.32.camel@localhost.localdomain>
References: <46FBB45A.10505@sendu.me.uk>
	<1190902850.12078.26.camel@localhost.localdomain>
	<29DFE331-33F5-47ED-9A6D-AF488E5F0689@uiuc.edu>
	<1190907297.12078.32.camel@localhost.localdomain>
Message-ID: <FE3DC3B9-E202-4C92-9618-90D0BF4E3B52@uiuc.edu>

Actually, I just added 'Sequence Ontology OBO' to  
Bio::Ontology::DocumentRegistry and switched BSFA over to use that in  
bioperl-live.  So far it still passes tests checking SO using obo.   
Sendu, does that work or crash-and-burn?

chris

On Sep 27, 2007, at 10:34 AM, Scott Cain wrote:

> OK--while I would normal volunteer to do this, I don't think I am  
> going
> to have time until after the Genome Informatics and GMOD meetings in
> November :-/  If it is still not done then, somebody poke me and  
> remind
> me that I said that.
>
> Scott
>
>
> On Thu, 2007-09-27 at 10:25 -0500, Chris Fields wrote:
>> On Sep 27, 2007, at 9:20 AM, Scott Cain wrote:
>>
>>> Hi Sendu,
>>>
>>> I believe that BSFA uses SOFA but the growing consensus is that SOFA
>>> should be pitched and all of SO should be used where SOFA was being
>>> used.  I also suspect that BioPerl is using a very old version of
>>> SOFA,
>>> since at the time BSFA was written, BioPerl couldn't parse OBO files
>>> (can it now?), so it was using the very old file format (whose  
>>> name I
>>> can't even remember now) and that file hasn't been updated in a long
>>> time (which is why it isn't finding conserved_region).
>>>
>>> If BioPerl can parse OBO files, we should switch BSFA to validate
>>> against
>>>
>>> http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo
>>>
>>> Scott
>>
>> I agree, this would definitely be for the best.  BioPerl can parse
>> obo; not sure how often it's used or what the tests are like, but
>> switching to SO should give it a good workout and might wring out any
>> issues.
>>
>> chris
>>
>>> On Thu, 2007-09-27 at 14:47 +0100, Sendu Bala wrote:
>>>> I want to create a Bio::SeqFeature::Annotated object where the
>>>> 'type' is
>>>> 'conserved_region'.
>>>>
>>>> I got the idea that 'conserved_region' might be ok from here:
>>>> http://song.sourceforge.net/SOterm_tables.html#SO:0000330
>>>>
>>>> However, this doesn't work since:
>>>>
>>>> ------------- EXCEPTION -------------
>>>> MSG: couldn't find a SOFA term matching type 'conserved_region'.
>>>> STACK Bio::SeqFeature::Annotated::type
>>>> /data/bioinf/home/sb/current/bioperl-core/Bio/SeqFeature/
>>>> Annotated.pm:371
>>>> [snip]
>>>>
>>>>
>>>> I'm guessing Bio::Ontology::OntologyStore is getting its allowed  
>>>> SOFA
>>>> terms from:
>>>> http://umn.dl.sourceforge.net/sourceforge/song/sofa.definition
>>>>
>>>>
>>>> I don't know much about this area. Can someone offer a little
>>>> guidance
>>>> as to what the significance of these two different files is, why  
>>>> they
>>>> don't contain the same terms, and why I can't use  
>>>> 'conserved_region'?
>>>>
>>>> What's the closest alternative term?
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>> -- 
>>> -------------------------------------------------------------------- 
>>> --
>>> --
>>> Scott Cain, Ph. D.
>>> cain at cshl.edu
>>> GMOD Coordinator (http://www.gmod.org/)
>>> 216-392-3087
>>> Cold Spring Harbor Laboratory
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Research Associate
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
> -- 
> ---------------------------------------------------------------------- 
> --
> Scott Cain, Ph. D.                                    
> cain.cshl at gmail.com
> GMOD Coordinator (http://www.gmod.org/)                      
> 216-392-3087
> Cold Spring Harbor Laboratory
>
>

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From hlapp at gmx.net  Thu Sep 27 22:17:16 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu, 27 Sep 2007 18:17:16 -0400
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000501c800d9$dc9c8e90$95d5abb0$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
Message-ID: <2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>

Forrest,

have you preloaded the NCBI taxonomy as suggested in the BioSQL  
installation guidelines? SwissProt format has NCBI taxon IDs, and the  
code will try to use it to look up species and their lineage, rather  
than inserting the lineage from whatever BioPerl parses out of the  
sequence record.

	-hilmar

On Sep 27, 2007, at 3:41 AM, Forrest wrote:

> Hi, all
>     I install the biosql, and bioperl-db. I want to import  
> swissport data.
> But the programe show some error as below:
> ====================================================================== 
> ======
> ===============================================
>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
> Could not store Q6DAH5:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: The supplied lineage does not start near 'Erwinia carotovora  
> subsp.
> atroseptica' (I was supplied 'Erwinia carotovora subsp. |  
> Pectobacterium |
> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
> Proteobacteria | Bacteria')
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
> STACK: Bio::Species::classification
> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:552
> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:1305
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:973
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:852
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:182
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: load_seqdatabase.pl:620
> -----------------------------------------------------------
>
>  at load_seqdatabase.pl line 633
> ====================================================================== 
> ======
> ===============================================
>
> How can I solve it, please help me, Thank you.
>
> Thanks
> Forrest zhang
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From wcnelson at usc.edu  Thu Sep 27 19:20:47 2007
From: wcnelson at usc.edu (William C. Nelson)
Date: Thu, 27 Sep 2007 15:20:47 -0400
Subject: [Bioperl-l] cpan install
Message-ID: <46FC028F.3050000@usc.edu>

Hello,

I tried to install v1.5.2 using cpan.

My urllist looks like:

cpan[2]> o conf urllist
    urllist
        0 [ftp://cpan.cs.utah.edu/pub/CPAN/]
        1 [ftp://cpan.mirrors.tds.net/pub/CPAN]
        2 [ftp://ftp.open-bio.org/pub/bioperl/DIST/]
Type 'o conf' to view all configuration items


And when I look for bioperl, I see:

cpan[1]> d /bioperl/
CPAN: Storable loaded ok (v2.16)
Going to read /root/.cpan/Metadata
  Database was generated on Thu, 27 Sep 2007 18:36:44 GMT
Distribution    BIRNEY/bioperl-1.2.1.tar.gz
Distribution    BIRNEY/bioperl-1.2.2.tar.gz
Distribution    BIRNEY/bioperl-1.2.3.tar.gz
Distribution    BIRNEY/bioperl-1.2.tar.gz
Distribution    BIRNEY/bioperl-1.4.tar.gz
Distribution    BIRNEY/bioperl-db-0.1.tar.gz
Distribution    BIRNEY/bioperl-ext-1.4.tar.gz
Distribution    BIRNEY/bioperl-gui-0.7.tar.gz
Distribution    BIRNEY/bioperl-run-1.2.2.tar.gz
Distribution    BIRNEY/bioperl-run-1.4.tar.gz
Distribution    BOZO/Fry-Lib-BioPerl-0.15.tar.gz
Distribution    CRAFFI/Bundle-BioPerl-2.1.8.tar.gz
12 items found


No v 1.5.2.  This may be because it can't see the distribution at 
ftp://ftp.open-bio.org/pub/bioperl/DIST/. When I try to reload the 
index, I get messages saying cpan can't find the files 
ftp://ftp.open-bio.org/pub/bioperl/DIST/authors/01mailrc.txt.gz or 
ftp://ftp.open-bio.org/pub/bioperl/DIST/modules/02packages.details.txt.gz 
or ftp://ftp.open-bio.org/pub/bioperl/DIST/modules/03modlist.data.gz.

Am I doing something wrong?
Does the FTP site need to be updated?

Thanks,
Bill

-- 
-----------------------------------------------------
William C. Nelson, PhD
Research Asst Professor
Wrigely Institute for Environmental Studies
University of Southern California LAS/MEB
310-510-4097
wcnelson at usc.edu



From wgallin at ualberta.ca  Fri Sep 28 02:51:12 2007
From: wgallin at ualberta.ca (Warren Gallin)
Date: Thu, 27 Sep 2007 20:51:12 -0600
Subject: [Bioperl-l] A couple Eutilities questions
Message-ID: <98B80D80-AF6F-424B-81B7-5B0CFD8D6CB2@ualberta.ca>

I've just started using Bio::DB::Eutilities and I have encountered  
two things that seem like problems.

I am using the latest (retrieved Wednesday September 26, 2007) CVS  
version, running in an Apple Xserver.

Problem 1:  When I execute the following code:


#Create new EUTILS object for retrieving sets of entries, given an  
array of accession numbers
	my $gpeptfactory = Bio::DB::EUtilities -> new(	-eutil => 'efetch',
													-db => 'protein',
													-rettype =>'genbank',
													-id => \@pro_acc) ;
	my $file = 'temp_hold.gb';
	
	$gpeptfactory -> get_Response(-file => $file);
	
	my $retr_seq = Bio::SeqIO->new(	-file => $file,
                             		-format => 'genbank');


I get the following warning, consistently:

Use of uninitialized value in concatenation (.) or string at /Library/ 
Perl/5.8.1/Bio/DB/GenericWebAgent.pm line 92.


Also, about half the time I get a crash with the following error  
message:


------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Response Error
Bad Gateway
STACK: Error::throw
STACK: Bio::Root::Root::throw /Library/Perl/5.8.1/Bio/Root/Root.pm:357
STACK: Bio::DB::GenericWebAgent::get_Response /Library/Perl/5.8.1/Bio/ 
DB/GenericWebAgent.pm:184
STACK: gb_update_v4.pl:118
-----------------------------------------------------------



The other half of the time the script runs fine through to the end.   
I have no idea whether the crash is related to the warning or not.  I  
looked at the line where the warning is generated, and it appears to  
be the "new" method for the GenericWebAgent.pm  .  I can't see how  
the call to Eutilities is can be passing an undefined value through  
to this method.


Problem #2:

When the code runs, I retrieve an incorrect record.  I am retrieving  
using accessions, and accession I51532 retrieves two records.  One is  
the record I am after, an ion channel protein, the other comes from a  
patent application; the problem is that, although the accession  
number for the unwanted record is AAB76204, the LOCUS entry in the  
record is I51532.

So, is it possible that the efetch function is collecting on the  
basis of LOCUS, not ACCESSION?  I realize that the two are almost  
always the same, but not apparently in this case.

Any advice and/or explanation is appreciated.

Warren Gallin


From forrest_zhang at 163.com  Fri Sep 28 02:50:53 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 10:50:53 +0800
Subject: [Bioperl-l] cpan install
In-Reply-To: <46FC028F.3050000@usc.edu>
References: <46FC028F.3050000@usc.edu>
Message-ID: <000001c8017a$6384bae0$2a8e30a0$@com>

Try 
cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz

other question you should browse
http://www.bioperl.org/wiki/Installing_Bioperl_for_Unix

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of William C. Nelson
Sent: Friday, September 28, 2007 3:21 AM
To: bioperl-l at bioperl.org
Subject: [Bioperl-l] cpan install

Hello,

I tried to install v1.5.2 using cpan.

My urllist looks like:

cpan[2]> o conf urllist
    urllist
        0 [ftp://cpan.cs.utah.edu/pub/CPAN/]
        1 [ftp://cpan.mirrors.tds.net/pub/CPAN]
        2 [ftp://ftp.open-bio.org/pub/bioperl/DIST/]
Type 'o conf' to view all configuration items


And when I look for bioperl, I see:

cpan[1]> d /bioperl/
CPAN: Storable loaded ok (v2.16)
Going to read /root/.cpan/Metadata
  Database was generated on Thu, 27 Sep 2007 18:36:44 GMT
Distribution    BIRNEY/bioperl-1.2.1.tar.gz
Distribution    BIRNEY/bioperl-1.2.2.tar.gz
Distribution    BIRNEY/bioperl-1.2.3.tar.gz
Distribution    BIRNEY/bioperl-1.2.tar.gz
Distribution    BIRNEY/bioperl-1.4.tar.gz
Distribution    BIRNEY/bioperl-db-0.1.tar.gz
Distribution    BIRNEY/bioperl-ext-1.4.tar.gz
Distribution    BIRNEY/bioperl-gui-0.7.tar.gz
Distribution    BIRNEY/bioperl-run-1.2.2.tar.gz
Distribution    BIRNEY/bioperl-run-1.4.tar.gz
Distribution    BOZO/Fry-Lib-BioPerl-0.15.tar.gz
Distribution    CRAFFI/Bundle-BioPerl-2.1.8.tar.gz
12 items found


No v 1.5.2.  This may be because it can't see the distribution at 
ftp://ftp.open-bio.org/pub/bioperl/DIST/. When I try to reload the 
index, I get messages saying cpan can't find the files 
ftp://ftp.open-bio.org/pub/bioperl/DIST/authors/01mailrc.txt.gz or 
ftp://ftp.open-bio.org/pub/bioperl/DIST/modules/02packages.details.txt.gz 
or ftp://ftp.open-bio.org/pub/bioperl/DIST/modules/03modlist.data.gz.

Am I doing something wrong?
Does the FTP site need to be updated?

Thanks,
Bill

-- 
-----------------------------------------------------
William C. Nelson, PhD
Research Asst Professor
Wrigely Institute for Environmental Studies
University of Southern California LAS/MEB
310-510-4097
wcnelson at usc.edu

_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





From forrest_zhang at 163.com  Fri Sep 28 03:15:03 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 11:15:03 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
Message-ID: <000101c8017d$c4643360$4d2c9a20$@com>

Hilmar,
	I have already pre-loaded the NCBI taxonomy using
load_ncbi_taxonomy.pl yet. The error message show:

--------------------- WARNING ---------------------
MSG: The supplied lineage does not start near 'Phaseolus aureus' (I was
supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I | rosids
| core eudicotyledons | eudicotyledons | Magnoliophyta | Euphyllophyta |
Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
---------------------------------------------------
Could not store Q40784: 
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: create: object (Bio::Species) failed to insert or to be found by unique
key
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:206
STACK: Bio::DB::Persistent::PersistentObject::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:244
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:169
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:251
STACK: Bio::DB::Persistent::PersistentObject::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:271
STACK: /usr/bin/bp_load_seqdatabase.pl:633
-----------------------------------------------------------
Sigh~~~~~~

Forrest Zhang


-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
Sent: Friday, September 28, 2007 6:17 AM
To: Forrest
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

Forrest,

have you preloaded the NCBI taxonomy as suggested in the BioSQL  
installation guidelines? SwissProt format has NCBI taxon IDs, and the  
code will try to use it to look up species and their lineage, rather  
than inserting the lineage from whatever BioPerl parses out of the  
sequence record.

	-hilmar

On Sep 27, 2007, at 3:41 AM, Forrest wrote:

> Hi, all
>     I install the biosql, and bioperl-db. I want to import  
> swissport data.
> But the programe show some error as below:
> ====================================================================== 
> ======
> ===============================================
>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
> Could not store Q6DAH5:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: The supplied lineage does not start near 'Erwinia carotovora  
> subsp.
> atroseptica' (I was supplied 'Erwinia carotovora subsp. |  
> Pectobacterium |
> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
> Proteobacteria | Bacteria')
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
> STACK: Bio::Species::classification
> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:552
> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:1305
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:973
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:852
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:182
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: load_seqdatabase.pl:620
> -----------------------------------------------------------
>
>  at load_seqdatabase.pl line 633
> ====================================================================== 
> ======
> ===============================================
>
> How can I solve it, please help me, Thank you.
>
> Thanks
> Forrest zhang
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================





_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





From forrest_zhang at 163.com  Fri Sep 28 03:33:21 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 11:33:21 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000101c8017d$c4643360$4d2c9a20$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
Message-ID: <000201c80180$54762650$fd6272f0$@com>

I reinstall the bioperl-db, I found some error.

t/01dbadaptor.....ok

t/02species.......FAILED tests 66-95

        Failed 30/65 tests, 53.85% okay
t/03simpleseq.....ok

t/04swiss.........ok

t/05seqfeature....ok

t/06comment.......ok

t/07dblink........ok

t/08genbank.......ok

t/09fuzzy2........ok

t/10ensembl.......ok

t/11locuslink.....ok

t/12ontology......ok

t/13remove........ok

t/14query.........ok

t/15cluster.......ok 9/160

--------------------- WARNING ---------------------
MSG: failed to store one or more child objects for an instance of class
Bio::Cluster::UniGene (PK=320)
---------------------------------------------------
t/15cluster.......ok

t/16obda..........ok

Failed Test   Stat Wstat Total Fail  List of Failed
----------------------------------------------------------------------------
---
t/02species.t               65   30  66-95
Failed 1/16 test scripts. -30/1423 subtests failed.
Files=16, Tests=1423, 35 wallclock secs (16.67 cusr +  0.63 csys = 17.30
CPU)
Failed 1/16 test programs. -30/1423 subtests failed.
make: *** [test] Error 255

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Forrest Zhang
Sent: Friday, September 28, 2007 11:15 AM
To: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

Hilmar,
	I have already pre-loaded the NCBI taxonomy using
load_ncbi_taxonomy.pl yet. The error message show:

--------------------- WARNING ---------------------
MSG: The supplied lineage does not start near 'Phaseolus aureus' (I was
supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I | rosids
| core eudicotyledons | eudicotyledons | Magnoliophyta | Euphyllophyta |
Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
---------------------------------------------------
Could not store Q40784: 
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: create: object (Bio::Species) failed to insert or to be found by unique
key
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:206
STACK: Bio::DB::Persistent::PersistentObject::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:244
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:169
STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:251
STACK: Bio::DB::Persistent::PersistentObject::store
/usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/PersistentObject.pm:271
STACK: /usr/bin/bp_load_seqdatabase.pl:633
-----------------------------------------------------------
Sigh~~~~~~

Forrest Zhang


-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
Sent: Friday, September 28, 2007 6:17 AM
To: Forrest
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

Forrest,

have you preloaded the NCBI taxonomy as suggested in the BioSQL  
installation guidelines? SwissProt format has NCBI taxon IDs, and the  
code will try to use it to look up species and their lineage, rather  
than inserting the lineage from whatever BioPerl parses out of the  
sequence record.

	-hilmar

On Sep 27, 2007, at 3:41 AM, Forrest wrote:

> Hi, all
>     I install the biosql, and bioperl-db. I want to import  
> swissport data.
> But the programe show some error as below:
> ====================================================================== 
> ======
> ===============================================
>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
> Could not store Q6DAH5:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: The supplied lineage does not start near 'Erwinia carotovora  
> subsp.
> atroseptica' (I was supplied 'Erwinia carotovora subsp. |  
> Pectobacterium |
> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
> Proteobacteria | Bacteria')
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
> STACK: Bio::Species::classification
> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:552
> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:1305
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:973
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:852
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:182
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: load_seqdatabase.pl:620
> -----------------------------------------------------------
>
>  at load_seqdatabase.pl line 633
> ====================================================================== 
> ======
> ===============================================
>
> How can I solve it, please help me, Thank you.
>
> Thanks
> Forrest zhang
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================





_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l



_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





From cjfields at uiuc.edu  Fri Sep 28 04:58:27 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 23:58:27 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000201c80180$54762650$fd6272f0$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
	<000201c80180$54762650$fd6272f0$@com>
Message-ID: <9535284F-2DC5-4361-81A2-0B739A7E89E4@uiuc.edu>

Bio::Species will have problems if you test on a database with  
taxonomy loaded (it's mentioned in the install docs I think).

The UniGene warning has always popped up and isn't anything to worry  
about.

chris

On Sep 27, 2007, at 10:33 PM, Forrest Zhang wrote:

> I reinstall the bioperl-db, I found some error.
>
> t/01dbadaptor.....ok
>
> t/02species.......FAILED tests 66-95
>
>         Failed 30/65 tests, 53.85% okay
> t/03simpleseq.....ok
>
> t/04swiss.........ok
>
> t/05seqfeature....ok
>
> t/06comment.......ok
>
> t/07dblink........ok
>
> t/08genbank.......ok
>
> t/09fuzzy2........ok
>
> t/10ensembl.......ok
>
> t/11locuslink.....ok
>
> t/12ontology......ok
>
> t/13remove........ok
>
> t/14query.........ok
>
> t/15cluster.......ok 9/160
>
> --------------------- WARNING ---------------------
> MSG: failed to store one or more child objects for an instance of  
> class
> Bio::Cluster::UniGene (PK=320)
> ---------------------------------------------------
> t/15cluster.......ok
>
> t/16obda..........ok
>
> Failed Test   Stat Wstat Total Fail  List of Failed
> ---------------------------------------------------------------------- 
> ------
> ---
> t/02species.t               65   30  66-95
> Failed 1/16 test scripts. -30/1423 subtests failed.
> Files=16, Tests=1423, 35 wallclock secs (16.67 cusr +  0.63 csys =  
> 17.30
> CPU)
> Failed 1/16 test programs. -30/1423 subtests failed.
> make: *** [test] Error 255
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Forrest  
> Zhang
> Sent: Friday, September 28, 2007 11:15 AM
> To: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From cjfields at uiuc.edu  Fri Sep 28 04:57:55 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 27 Sep 2007 23:57:55 -0500
Subject: [Bioperl-l] A couple Eutilities questions
In-Reply-To: <98B80D80-AF6F-424B-81B7-5B0CFD8D6CB2@ualberta.ca>
References: <98B80D80-AF6F-424B-81B7-5B0CFD8D6CB2@ualberta.ca>
Message-ID: <A8E3D712-1159-43F7-91A6-16BA6103AB7B@uiuc.edu>


On Sep 27, 2007, at 9:51 PM, Warren Gallin wrote:

> I've just started using Bio::DB::Eutilities and I have encountered
> two things that seem like problems.
>
> I am using the latest (retrieved Wednesday September 26, 2007) CVS
> version, running in an Apple Xserver.
>
> Problem 1:  When I execute the following code:
>
>
> #Create new EUTILS object for retrieving sets of entries, given an
> array of accession numbers
> 	my $gpeptfactory = Bio::DB::EUtilities -> new(	-eutil => 'efetch',
> 													-db => 'protein',
> 													-rettype =>'genbank',
> 													-id => \@pro_acc) ;
> 	my $file = 'temp_hold.gb';
> 	
> 	$gpeptfactory -> get_Response(-file => $file);
> 	
> 	my $retr_seq = Bio::SeqIO->new(	-file => $file,
>                              		-format => 'genbank');
>
>
> I get the following warning, consistently:
>
> Use of uninitialized value in concatenation (.) or string at /Library/
> Perl/5.8.1/Bio/DB/GenericWebAgent.pm line 92.

The above works for me w/o problems.  The error itself doesn't make  
much sense; the line is:

     $self->ua(LWP::UserAgent->new(env_proxy => 1,
             agent => ref($self).':'.$self->VERSION));

so either $self isn't a ref (which it appears to be) or there is no  
version (which is odd but may be a perl bug).  What happens if you  
hard-code the version number to something simple?

Also, I noticed you're using perl 5.8.1; which version of Mac OS X  
are you using?  I remember something was off about that perl version  
but I can't remember what it was...

> Also, about half the time I get a crash with the following error
> message:
>
>
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: Response Error
> Bad Gateway
> STACK: Error::throw
> STACK: Bio::Root::Root::throw /Library/Perl/5.8.1/Bio/Root/Root.pm:357
> STACK: Bio::DB::GenericWebAgent::get_Response /Library/Perl/5.8.1/Bio/
> DB/GenericWebAgent.pm:184
> STACK: gb_update_v4.pl:118
> -----------------------------------------------------------

I have seen it sometimes pop up when the NCBI server is under heavy  
server load.  It may also be related to your local ISP or setup; see  
here:

http://www.checkupdown.com/status/E502.html

Supposedly this may pop up with mod_perl but I haven't seen/heard  
anything myself related to this.

> The other half of the time the script runs fine through to the end.
> I have no idea whether the crash is related to the warning or not.  I
> looked at the line where the warning is generated, and it appears to
> be the "new" method for the GenericWebAgent.pm  .  I can't see how
> the call to Eutilities is can be passing an undefined value through
> to this method.

EUtilities is-a GenericWebAgent; the new() constructors are chained  
using SUPER::new().  Also, you can call VERSION from any variable so  
it could be a problem there if VERSION is undef, though again I can't  
think why this would fail.  Regardless, the 'Use of undefined'  
warning is not a fatal error.

> Problem #2:
>
> When the code runs, I retrieve an incorrect record.  I am retrieving
> using accessions, and accession I51532 retrieves two records.  One is
> the record I am after, an ion channel protein, the other comes from a
> patent application; the problem is that, although the accession
> number for the unwanted record is AAB76204, the LOCUS entry in the
> record is I51532.
>
> So, is it possible that the efetch function is collecting on the
> basis of LOCUS, not ACCESSION?  I realize that the two are almost
> always the same, but not apparently in this case.
>
> Any advice and/or explanation is appreciated.
>
> Warren Gallin

The only means NCBI guarantees to retrieve a unique record every time  
is by using the primary ID, which for sequence records is the GI.   
The accession works most of the time, and efetch accepts accs in the  
place of GI (it's the only eutil that does).  However, every once in  
a while you get stung and retrieve multiple seqs.

BTW, I entered your sequence into Entrez and it popped up as  
discontinued (which could be part of the problem); the current acc is  
Q91781.

chris


From cjfields at uiuc.edu  Fri Sep 28 05:00:18 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 00:00:18 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <000101c8017d$c4643360$4d2c9a20$@com>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
Message-ID: <8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>

If this is occurring using bioperl from CVS then I'll try taking a  
look at it.

chris

On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:

> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From forrest_zhang at 163.com  Fri Sep 28 05:34:21 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 13:34:21 +0800
Subject: [Bioperl-l] FW:  load_seqdatabase.pl error
Message-ID: <000101c80191$3b300e70$b1902b50$@com>

Oh, my God!  I am tring reinstall bioperl-live using CVS, so many error
shown below.

biocc bioperl-live # perl Build.PL 
Checking whether your kit is complete...
Looks good

Checking prerequisites...
Looks good

Checking features:
  BioDBGFF.................enabled
  BioDBSeqFeature_mysql....enabled
  Network..................enabled
  BioDBSeqFeature_BDB......enabled

Install [a]ll Bioperl scripts, [n]one, or choose groups [i]nteractively? [a]

  - will install all scripts

Do you want to run the BioDBGFF live database tests? y/n [n] y
Which database should I use for testing the mysql driver? [test] 
On which host is database 'test' running (hostname, ip address or host:port)
[localhost] 
User name for connecting to database 'test'? [undef] root
Password for connecting to database 'test'? [undef] 
  - will run the BioDBGFF tests with database driver 'mysql' and these
settings:
    Database test
    Host     localhost
    DSN      dbi:mysql:database=test
    User     root
    Password undef

Do you want to run tests that require connection to servers across the
internet
(likely to cause some failures)? y/n [n] y
  - will run internet-requiring tests
Deleting Build
Removed previous script 'Build'

Creating new 'Build' script for 'bioperl' version '1.0050021'
biocc bioperl-live # ./Build test
Copying Bio/Align/Utilities.pm -> blib/lib/Bio/Align/Utilities.pm
Copying Bio/Search/HSP/ModelHSP.pm -> blib/lib/Bio/Search/HSP/ModelHSP.pm
Copying Bio/Ontology/DocumentRegistry.pm ->
blib/lib/Bio/Ontology/DocumentRegistry.pm
Copying Bio/SeqFeature/Annotated.pm -> blib/lib/Bio/SeqFeature/Annotated.pm
Copying Bio/SimpleAlign.pm -> blib/lib/Bio/SimpleAlign.pm
Copying Bio/AlignIO/stockholm.pm -> blib/lib/Bio/AlignIO/stockholm.pm
Copying scripts/utilities/bp_sreformat.PLS -> blib/script/bp_sreformat.PLS
Deleting blib/script/bp_sreformat.PLS.bak
blib/script/bp_sreformat.PLS -> blib/script/bp_sreformat.pl
Copying scripts/graphics/contig_draw.PLS -> blib/script/contig_draw.PLS
Deleting blib/script/contig_draw.PLS.bak
blib/script/contig_draw.PLS -> blib/script/bp_contig_draw.pl
Copying scripts/Bio-DB-GFF/meta_gff.PLS -> blib/script/meta_gff.PLS
Deleting blib/script/meta_gff.PLS.bak
blib/script/meta_gff.PLS -> blib/script/bp_meta_gff.pl
Copying scripts/tree/tree2pag.PLS -> blib/script/tree2pag.PLS
Deleting blib/script/tree2pag.PLS.bak
blib/script/tree2pag.PLS -> blib/script/bp_tree2pag.pl
Copying scripts/Bio-SeqFeature-Store/bp_seqfeature_gff3.PLS ->
blib/script/bp_seqfeature_gff3.PLS
blib/script/bp_seqfeature_gff3.PLS -> blib/script/bp_seqfeature_gff3.pl
Copying scripts/popgen/heterogeneity_test.PLS ->
blib/script/heterogeneity_test.PLS
Deleting blib/script/heterogeneity_test.PLS.bak
blib/script/heterogeneity_test.PLS -> blib/script/bp_heterogeneity_test.pl
Copying scripts/DB/flanks.PLS -> blib/script/flanks.PLS
Deleting blib/script/flanks.PLS.bak
blib/script/flanks.PLS -> blib/script/bp_flanks.pl
Copying scripts/graphics/feature_draw.PLS -> blib/script/feature_draw.PLS
Deleting blib/script/feature_draw.PLS.bak
blib/script/feature_draw.PLS -> blib/script/bp_feature_draw.pl
Copying scripts/DB/biogetseq.PLS -> blib/script/biogetseq.PLS
Deleting blib/script/biogetseq.PLS.bak
blib/script/biogetseq.PLS -> blib/script/bp_biogetseq.pl
Copying scripts/Bio-SeqFeature-Store/bp_seqfeature_load.PLS ->
blib/script/bp_seqfeature_load.PLS
Deleting blib/script/bp_seqfeature_load.PLS.bak
blib/script/bp_seqfeature_load.PLS -> blib/script/bp_seqfeature_load.pl
Copying scripts/searchio/fastam9_to_table.PLS ->
blib/script/fastam9_to_table.PLS
Deleting blib/script/fastam9_to_table.PLS.bak
blib/script/fastam9_to_table.PLS -> blib/script/bp_fastam9_to_table.pl
Copying scripts/utilities/seq_length.PLS -> blib/script/seq_length.PLS
Deleting blib/script/seq_length.PLS.bak
blib/script/seq_length.PLS -> blib/script/bp_seq_length.pl
Copying scripts/Bio-DB-GFF/genbank2gff.PLS -> blib/script/genbank2gff.PLS
Deleting blib/script/genbank2gff.PLS.bak
blib/script/genbank2gff.PLS -> blib/script/bp_genbank2gff.pl
Copying scripts/taxa/taxid4species.PLS -> blib/script/taxid4species.PLS
Deleting blib/script/taxid4species.PLS.bak
blib/script/taxid4species.PLS -> blib/script/bp_taxid4species.pl
Copying scripts/biographics/bp_glyphs1-demo.PLS ->
blib/script/bp_glyphs1-demo.PLS
Deleting blib/script/bp_glyphs1-demo.PLS.bak
blib/script/bp_glyphs1-demo.PLS -> blib/script/bp_glyphs1-demo.pl
Copying scripts/tree/blast2tree.PLS -> blib/script/blast2tree.PLS
Deleting blib/script/blast2tree.PLS.bak
blib/script/blast2tree.PLS -> blib/script/bp_blast2tree.pl
Copying scripts/graphics/frend.PLS -> blib/script/frend.PLS
Deleting blib/script/frend.PLS.bak
blib/script/frend.PLS -> blib/script/bp_frend.pl
Copying scripts/taxa/query_entrez_taxa.PLS ->
blib/script/query_entrez_taxa.PLS
Deleting blib/script/query_entrez_taxa.PLS.bak
blib/script/query_entrez_taxa.PLS -> blib/script/bp_query_entrez_taxa.pl
Copying scripts/biographics/bp_glyphs2-demo.PLS ->
blib/script/bp_glyphs2-demo.PLS
Deleting blib/script/bp_glyphs2-demo.PLS.bak
blib/script/bp_glyphs2-demo.PLS -> blib/script/bp_glyphs2-demo.pl
Copying scripts/taxa/taxonomy2tree.PLS -> blib/script/taxonomy2tree.PLS
Deleting blib/script/taxonomy2tree.PLS.bak
blib/script/taxonomy2tree.PLS -> blib/script/bp_taxonomy2tree.pl
Copying scripts/utilities/search2alnblocks.PLS ->
blib/script/search2alnblocks.PLS
Deleting blib/script/search2alnblocks.PLS.bak
blib/script/search2alnblocks.PLS -> blib/script/bp_search2alnblocks.pl
Copying scripts/utilities/mask_by_search.PLS ->
blib/script/mask_by_search.PLS
Deleting blib/script/mask_by_search.PLS.bak
blib/script/mask_by_search.PLS -> blib/script/bp_mask_by_search.pl
Copying scripts/seqstats/gccalc.PLS -> blib/script/gccalc.PLS
Deleting blib/script/gccalc.PLS.bak
blib/script/gccalc.PLS -> blib/script/bp_gccalc.pl
Copying scripts/popgen/composite_LD.PLS -> blib/script/composite_LD.PLS
Deleting blib/script/composite_LD.PLS.bak
blib/script/composite_LD.PLS -> blib/script/bp_composite_LD.pl
Copying scripts/seqstats/aacomp.PLS -> blib/script/aacomp.PLS
Deleting blib/script/aacomp.PLS.bak
blib/script/aacomp.PLS -> blib/script/bp_aacomp.pl
Copying scripts/Bio-DB-GFF/process_wormbase.PLS ->
blib/script/process_wormbase.PLS
Deleting blib/script/process_wormbase.PLS.bak
blib/script/process_wormbase.PLS -> blib/script/bp_process_wormbase.pl
Copying scripts/taxa/local_taxonomydb_query.PLS ->
blib/script/local_taxonomydb_query.PLS
Deleting blib/script/local_taxonomydb_query.PLS.bak
blib/script/local_taxonomydb_query.PLS ->
blib/script/bp_local_taxonomydb_query.pl
Copying scripts/biblio/biblio.PLS -> blib/script/biblio.PLS
Deleting blib/script/biblio.PLS.bak
blib/script/biblio.PLS -> blib/script/bp_biblio.pl
Copying scripts/biographics/bp_embl2picture.PLS ->
blib/script/bp_embl2picture.PLS
Deleting blib/script/bp_embl2picture.PLS.bak
blib/script/bp_embl2picture.PLS -> blib/script/bp_embl2picture.pl
Copying scripts/Bio-DB-GFF/genbank2gff3.PLS -> blib/script/genbank2gff3.PLS
Deleting blib/script/genbank2gff3.PLS.bak
blib/script/genbank2gff3.PLS -> blib/script/bp_genbank2gff3.pl
Copying scripts/utilities/search2BSML.PLS -> blib/script/search2BSML.PLS
Deleting blib/script/search2BSML.PLS.bak
blib/script/search2BSML.PLS -> blib/script/bp_search2BSML.pl
Copying scripts/seq/seqconvert.PLS -> blib/script/seqconvert.PLS
Deleting blib/script/seqconvert.PLS.bak
blib/script/seqconvert.PLS -> blib/script/bp_seqconvert.pl
Copying scripts/searchio/parse_hmmsearch.PLS ->
blib/script/parse_hmmsearch.PLS
Deleting blib/script/parse_hmmsearch.PLS.bak
blib/script/parse_hmmsearch.PLS -> blib/script/bp_parse_hmmsearch.pl
Copying scripts/index/bp_seqret.PLS -> blib/script/bp_seqret.PLS
Deleting blib/script/bp_seqret.PLS.bak
blib/script/bp_seqret.PLS -> blib/script/bp_seqret.pl
Copying scripts/searchio/filter_search.PLS -> blib/script/filter_search.PLS
Deleting blib/script/filter_search.PLS.bak
blib/script/filter_search.PLS -> blib/script/bp_filter_search.pl
Copying scripts/tree/nexus2nh.PLS -> blib/script/nexus2nh.PLS
Deleting blib/script/nexus2nh.PLS.bak
blib/script/nexus2nh.PLS -> blib/script/bp_nexus2nh.pl
Copying scripts/Bio-DB-GFF/generate_histogram.PLS ->
blib/script/generate_histogram.PLS
Deleting blib/script/generate_histogram.PLS.bak
blib/script/generate_histogram.PLS -> blib/script/bp_generate_histogram.pl
Copying scripts/seq/split_seq.PLS -> blib/script/split_seq.PLS
Deleting blib/script/split_seq.PLS.bak
blib/script/split_seq.PLS -> blib/script/bp_split_seq.pl
Copying scripts/Bio-DB-GFF/load_gff.PLS -> blib/script/load_gff.PLS
Deleting blib/script/load_gff.PLS.bak
blib/script/load_gff.PLS -> blib/script/bp_load_gff.pl
Copying scripts/index/bp_fetch.PLS -> blib/script/bp_fetch.PLS
Deleting blib/script/bp_fetch.PLS.bak
blib/script/bp_fetch.PLS -> blib/script/bp_fetch.pl
Copying scripts/utilities/mutate.PLS -> blib/script/mutate.PLS
Deleting blib/script/mutate.PLS.bak
blib/script/mutate.PLS -> blib/script/bp_mutate.pl
Copying scripts/Bio-DB-GFF/process_sgd.PLS -> blib/script/process_sgd.PLS
Deleting blib/script/process_sgd.PLS.bak
blib/script/process_sgd.PLS -> blib/script/bp_process_sgd.pl
Copying scripts/index/bp_index.PLS -> blib/script/bp_index.PLS
Deleting blib/script/bp_index.PLS.bak
blib/script/bp_index.PLS -> blib/script/bp_index.pl
Copying scripts/utilities/dbsplit.PLS -> blib/script/dbsplit.PLS
Deleting blib/script/dbsplit.PLS.bak
blib/script/dbsplit.PLS -> blib/script/bp_dbsplit.pl
Copying scripts/seqstats/oligo_count.PLS -> blib/script/oligo_count.PLS
Deleting blib/script/oligo_count.PLS.bak
blib/script/oligo_count.PLS -> blib/script/bp_oligo_count.pl
Copying scripts/searchio/hmmer_to_table.PLS ->
blib/script/hmmer_to_table.PLS
Deleting blib/script/hmmer_to_table.PLS.bak
blib/script/hmmer_to_table.PLS -> blib/script/bp_hmmer_to_table.pl
Copying scripts/Bio-DB-GFF/process_gadfly.PLS ->
blib/script/process_gadfly.PLS
Deleting blib/script/process_gadfly.PLS.bak
blib/script/process_gadfly.PLS -> blib/script/bp_process_gadfly.pl
Copying scripts/DB/biofetch_genbank_proxy.PLS ->
blib/script/biofetch_genbank_proxy.PLS
Deleting blib/script/biofetch_genbank_proxy.PLS.bak
blib/script/biofetch_genbank_proxy.PLS ->
blib/script/bp_biofetch_genbank_proxy.pl
Copying scripts/seq/extract_feature_seq.PLS ->
blib/script/extract_feature_seq.PLS
Deleting blib/script/extract_feature_seq.PLS.bak
blib/script/extract_feature_seq.PLS -> blib/script/bp_extract_feature_seq.pl
Copying scripts/Bio-DB-GFF/bulk_load_gff.PLS ->
blib/script/bulk_load_gff.PLS
Deleting blib/script/bulk_load_gff.PLS.bak
blib/script/bulk_load_gff.PLS -> blib/script/bp_bulk_load_gff.pl
Copying scripts/utilities/search2gff.PLS -> blib/script/search2gff.PLS
Deleting blib/script/search2gff.PLS.bak
blib/script/search2gff.PLS -> blib/script/bp_search2gff.pl
Copying scripts/seq/make_mrna_protein.PLS ->
blib/script/make_mrna_protein.PLS
Deleting blib/script/make_mrna_protein.PLS.bak
blib/script/make_mrna_protein.PLS -> blib/script/bp_make_mrna_protein.pl
Copying scripts/seq/unflatten_seq.PLS -> blib/script/unflatten_seq.PLS
Deleting blib/script/unflatten_seq.PLS.bak
blib/script/unflatten_seq.PLS -> blib/script/bp_unflatten_seq.pl
Copying scripts/utilities/search2tribe.PLS -> blib/script/search2tribe.PLS
Deleting blib/script/search2tribe.PLS.bak
blib/script/search2tribe.PLS -> blib/script/bp_search2tribe.pl
Copying scripts/DB/bioflat_index.PLS -> blib/script/bioflat_index.PLS
Deleting blib/script/bioflat_index.PLS.bak
blib/script/bioflat_index.PLS -> blib/script/bp_bioflat_index.pl
Copying scripts/utilities/pairwise_kaks.PLS -> blib/script/pairwise_kaks.PLS
Deleting blib/script/pairwise_kaks.PLS.bak
blib/script/pairwise_kaks.PLS -> blib/script/bp_pairwise_kaks.pl
Copying scripts/Bio-DB-GFF/fast_load_gff.PLS ->
blib/script/fast_load_gff.PLS
Deleting blib/script/fast_load_gff.PLS.bak
blib/script/fast_load_gff.PLS -> blib/script/bp_fast_load_gff.pl
Copying scripts/seqstats/chaos_plot.PLS -> blib/script/chaos_plot.PLS
Deleting blib/script/chaos_plot.PLS.bak
blib/script/chaos_plot.PLS -> blib/script/bp_chaos_plot.pl
Copying scripts/utilities/bp_mrtrans.PLS -> blib/script/bp_mrtrans.PLS
Deleting blib/script/bp_mrtrans.PLS.bak
blib/script/bp_mrtrans.PLS -> blib/script/bp_mrtrans.pl
Copying scripts/utilities/bp_nrdb.PLS -> blib/script/bp_nrdb.PLS
Deleting blib/script/bp_nrdb.PLS.bak
blib/script/bp_nrdb.PLS -> blib/script/bp_nrdb.pl
Copying scripts/taxa/classify_hits_kingdom.PLS ->
blib/script/classify_hits_kingdom.PLS
Deleting blib/script/classify_hits_kingdom.PLS.bak
blib/script/classify_hits_kingdom.PLS ->
blib/script/bp_classify_hits_kingdom.pl
Copying scripts/utilities/remote_blast.PLS -> blib/script/remote_blast.PLS
Deleting blib/script/remote_blast.PLS.bak
blib/script/remote_blast.PLS -> blib/script/bp_remote_blast.pl
Copying scripts/searchio/search2table.PLS -> blib/script/search2table.PLS
Deleting blib/script/search2table.PLS.bak
blib/script/search2table.PLS -> blib/script/bp_search2table.pl
Copying scripts/seq/translate_seq.PLS -> blib/script/translate_seq.PLS
Deleting blib/script/translate_seq.PLS.bak
blib/script/translate_seq.PLS -> blib/script/bp_translate_seq.pl
Copying scripts/graphics/search_overview.PLS ->
blib/script/search_overview.PLS
Deleting blib/script/search_overview.PLS.bak
blib/script/search_overview.PLS -> blib/script/bp_search_overview.pl
t/AAChange...................ok

t/AAReverseMutate............ok

t/AlignIO....................ok

t/AlignStats.................ok

t/AlignUtil..................ok

t/Allele.....................ok

t/Alphabet...................ok

t/Annotation.................ok 1/112

#   Failed (TODO) test 'The object isa Bio::Annotation::Comment'
#   at t/Annotation.t line 214.
#     The object isn't a 'Bio::Annotation::Comment' it's a
'Bio::Annotation::OntologyTerm'
t/Annotation.................ok

        1/112 unexpectedly succeeded
TODO PASSED test 96

t/AnnotationAdaptor..........ok

t/Assembly...................ok 1/35

#   Failed (TODO) test 'get_nof_singlets'
#   at t/Assembly.t line 44.
#          got: '0'
#     expected: '1'

#   Failed (TODO) test 'get_seq_ids'
#   at t/Assembly.t line 48.
#          got: '0'
#     expected: '2'

#   Failed (TODO) test at t/Assembly.t line 53.
#     '0'
#         ne
#     '0'

#   Failed test at t/Assembly.t line 145.
#          got: '_main_contig_feature:106'
#     expected: '_aligned_coord:sdsu|SDSU_RFPERU_006_E04.x01.phd.1'
t/Assembly...................NOK 31/35# Looks like you failed 1 test of 35.

t/Assembly...................dubious

        Test returned status 1 (wstat 256, 0x100)
DIED. FAILED test 31
        Failed 1/35 tests, 97.14% okay
t/Biblio.....................ok

t/BiblioReferences...........ok

t/Biblio_biofetch............ok

t/Biblio_eutils..............ok

t/BioDBGFF...................ok

        3/277 skipped: various reasons
t/BioDBSeqFeature............ok

t/BioDBSeqFeature_BDB........ok

t/BioDBSeqFeature_mysql......ok

t/BioFetch_DB................ok

t/BioGraphics................ok

t/BlastIndex.................ok

t/Chain......................ok

t/ClusterIO..................ok

t/Coalescent.................ok

t/CodonTable.................ok

t/Compatible.................ok

t/CoordinateGraph............ok

t/CoordinateMapper...........ok

t/Correlate..................ok

t/CytoMap....................ok

t/DB.........................ok 104/116Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 491.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 565.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 565.
t/DB.........................ok 107/116Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 565.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 372.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/Bio/SeqIO/entrezgene.pm line 565.
t/DB.........................ok

t/DBCUTG.....................ok

t/DBFasta....................ok

t/DNAMutation................ok

t/Domcut.....................ok

t/ECnumber...................ok

t/ELM........................ok

t/EMBL_DB....................ok

t/EMBOSS_Tools...............ok

t/ESEfinder..................ok

t/EUtilities.................skipped
        all skipped: Must set BIOPERLDEBUG=1 for network tests
t/EncodedSeq.................ok

t/Exception..................ok

t/Exonerate..................ok

        4/45 skipped: various reasons
t/FeatureIO..................ok

t/FootPrinter................ok

t/GDB........................ok

t/GFF........................ok

t/GOR4.......................ok

t/GOterm.....................ok

t/GbrowseGFF.................ok

t/Gel........................ok

t/GeneCoordinateMapper.......ok

t/Geneid.....................ok

t/Genewise...................ok 1/53

#   Failed (TODO) test at t/Genewise.t line 79.
#          got: 'Scaffold_2042.1'
#     expected: 'SINFRUP00000067802'

#   Failed (TODO) test at t/Genewise.t line 80.
#          got: 'SINFRUP00000067802'
#     expected: 'Scaffold_2042.1'
t/Genewise...................NOK 37/53

#   Failed test at t/Genewise.t line 82.
#          got: ''
#     expected: '2054.68'
t/Genewise...................NOK 41/53

#   Failed test at t/Genewise.t line 88.
#          got: ''
#     expected: '2054.68'
t/Genewise...................NOK 45/53

#   Failed test at t/Genewise.t line 93.
#          got: ''
#     expected: '2054.68'
# Looks like you failed 3 tests of 53.
t/Genewise...................dubious

        Test returned status 3 (wstat 768, 0x300)
DIED. FAILED tests 37, 41, 45
        Failed 3/53 tests, 94.34% okay
t/Genomewise.................ok

t/Genpred....................ok 1/157Argument "<1" isn't numeric in numeric
gt (>) at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/Tools/Glimmer.pm line
519, <GEN11> line 2.
t/Genpred....................ok

t/GraphAdaptor...............ok

t/GuessSeqFormat.............ok

t/HNN........................ok

t/Handler....................ok 288/545

#   Failed (TODO) test at t/Handler.t line 696.
t/Handler....................ok

t/HtSNP......................ok

t/IUPAC......................ok

t/Index......................ok

t/InstanceSite...............ok

t/InterProParser.............ok

t/LargeLocatableSeq..........ok

t/LinkageMap.................ok

t/LiveSeq....................ok

t/LocatableSeq...............ok

t/Location...................ok

t/LocationFactory............ok

t/LocusLink..................ok

t/MK.........................ok

        4/46 skipped: various reasons
t/Map........................ok

t/MapIO......................ok

t/Matrix.....................ok

t/MeSH.......................ok

t/Measure....................ok

t/MetaSeq....................ok

t/MicrosatelliteMarker.......ok

t/MiniMIMentry...............ok

t/MitoProt...................ok

t/Molphy.....................ok

t/MultiFile..................ok

t/Mutation...................ok

t/Mutator....................ok

t/NetPhos....................ok

t/Node.......................ok

t/OMIMentry..................ok

t/OMIMentryAllelicVariant....ok

t/OMIMparser.................ok

t/OddCodes...................ok

t/Ontology...................ok

t/OntologyEngine.............ok

t/OntologyStore..............ok

t/PAML.......................ok

t/Perl.......................ok

t/Phenotype..................ok

t/PhylipDist.................ok

t/PhysicalMap................ok

t/Pictogram..................ok

t/PodSyntax..................skipped
        all skipped: Test::Pod 1.00 required for testing POD
t/PopGen.....................ok 1/99

#   Failed (TODO) test at t/PopGen.t line 242.
t/PopGen.....................ok

        2/99 unexpectedly succeeded
TODO PASSED tests 97-98

t/PopGenSims.................ok

t/PrimarySeq.................ok

t/Primer.....................ok

t/Promoterwise...............ok

t/ProtDist...................ok

t/ProtMatrix.................ok

t/ProtPsm....................ok

        10/14 skipped: various reasons
t/Pseudowise.................ok

t/QRNA.......................ok

t/RNAChange..................ok

t/RNA_SearchIO...............ok 2/496

#   Failed (TODO) test 'HSP meta'
#   at t/RNA_SearchIO.t line 798.
#     undef
#         ne
#     undef

#   Failed (TODO) test at t/RNA_SearchIO.t line 800.
#     undef
#         ne
#     undef

#   Failed (TODO) test at t/RNA_SearchIO.t line 802.
#     undef
#         ne
#     undef

#   Failed (TODO) test 'HSP meta'
#   at t/RNA_SearchIO.t line 848.
#     undef
#         ne
#     undef

#   Failed (TODO) test at t/RNA_SearchIO.t line 850.
#     undef
#         ne
#     undef

#   Failed (TODO) test at t/RNA_SearchIO.t line 852.
#     undef
#         ne
#     undef
t/RNA_SearchIO...............ok

t/RandDistFunctions..........ok

t/RandomTreeFactory..........ok

t/Range......................ok

t/RangeI.....................ok

t/RefSeq.....................ok

t/Registry...................ok 1/14

--------------------- WARNING ---------------------
MSG: Couldn't call new_from_registry() on [Bio::DB::Flat]

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: you must specify an indexing scheme
STACK: Error::throw
STACK: Bio::Root::Root::throw
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/Root/Root.pm:357
STACK: Bio::DB::Flat::new
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/DB/Flat.pm:160
STACK: Bio::DB::Flat::new_from_registry
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/DB/Flat.pm:252
STACK: Bio::DB::Registry::_load_registry
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/DB/Registry.pm:164
STACK: Bio::DB::Registry::new
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/DB/Registry.pm:95
STACK: t/Registry.t:51
-----------------------------------------------------------

---------------------------------------------------
t/Registry...................ok

        6/14 skipped: various reasons
t/Relationship...............ok

t/RelationshipType...........ok

t/RemoteBlast................ok

t/RepeatMasker...............ok

t/RestrictionAnalysis........ok

t/RestrictionIO..............ok 1/15

#   Failed (TODO) test at t/RestrictionIO.t line 31.
t/RestrictionIO..............ok

t/Root-Utilities.............ok 1/50

--------------------- WARNING ---------------------
MSG: Not owner of file t/data/test.txt. Compressing to temp file
/tmp/MBKEv1uzJB.tmp.bioperl.gz.
---------------------------------------------------
t/Root-Utilities.............ok

t/RootI......................ok

t/RootIO.....................ok

t/RootStorable...............ok

t/SNP........................ok

t/Scansite...................ok

        5/14 skipped: various reasons
t/SearchDist.................skipped
        all skipped: The optional module Bio::Ext::Align (or dependencies
thereof) was not installed
t/SearchIO...................ok 529/1449

#   Failed (TODO) test at t/SearchIO.t line 989.
#     '0.852'
#         >
#     '0.9'

#   Failed (TODO) test at t/SearchIO.t line 990.
#     '1.599'
#         <=
#     '1'
t/SearchIO...................ok

t/Seg........................ok

t/Seq........................ok

t/SeqAnalysisParser..........ok

t/SeqBuilder.................ok

t/SeqDiff....................ok

t/SeqEvolution...............ok

t/SeqFeatAnnotated...........ok

t/SeqFeatCollection..........ok

t/SeqFeature.................ok

t/SeqHound_DB................ok

t/SeqIO......................ok

t/SeqPattern.................ok

t/SeqStats...................ok

t/SeqUtils...................ok

t/SeqVersion.................ok

t/SeqWords...................ok

t/SequenceFamily.............ok

t/Sigcleave..................ok

t/Signalp....................ok

t/Signalp2...................ok

t/Sim4.......................ok

t/SimilarityPair.............ok

t/SimpleAlign................ok

t/SiteMatrix.................ok

t/Sopma......................ok

t/Species....................ok

t/Spidey.....................ok

t/StandAloneBlast............ok

        11/45 skipped: various reasons
t/StructIO...................ok

t/Structure..................ok

t/Symbol.....................ok

t/TagHaplotype...............ok

t/TandemRepeatsFinder........ok

t/TaxonTree..................skipped
        all skipped: All tests are being skipped, probably because the
module(s) being tested here are now deprecated
t/Taxonomy...................ok

t/Tempfile...................ok

t/Term.......................ok

t/Tmhmm......................ok

t/Tools......................ok

t/Tree.......................ok

t/TreeBuild..................ok

t/TreeIO.....................ok

t/UCSCParsers................ok

t/Unflattener................ok

t/Unflattener2...............ok

t/UniGene....................ok

t/Variation_IO...............ok

t/WABA.......................ok

t/WrapperBase................ok

t/abi........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
t/ace........................ok

t/alignUtilities.............ok

t/asciitree..................ok

t/blast_pull.................ok 1/287

#   Failed (TODO) test at t/blast_pull.t line 258.
#          got: '0.946'
#     expected: '0.943'
t/blast_pull.................ok

t/bsml_sax...................ok

t/chaosxml...................ok

t/cigarstring................ok

t/consed.....................ok

t/ctf........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
t/dblink.....................ok

t/ePCR.......................ok

t/embl.......................ok

t/entrezgene.................ok 542/1422Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/SeqIO/entrezgene.pm line
491.
t/entrezgene.................ok 966/1422Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/SeqIO/entrezgene.pm line
491.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/SeqIO/entrezgene.pm line
491.
Pseudo-hashes are deprecated at
/home/forrest/src/bioperl/bioperl-live/blib/lib/Bio/SeqIO/entrezgene.pm line
491.
t/entrezgene.................ok

t/est2genome.................ok

t/exp........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
t/fasta......................ok

t/flat.......................ok

t/game.......................ok

t/gcg........................ok

t/genbank....................ok

t/hmmer......................ok

t/hmmer_pull.................ok

t/interpro...................ok

t/kegg.......................ok

t/largefasta.................ok

t/largepseq..................ok

t/lasergene..................ok

t/lucy.......................ok

t/masta......................ok

t/metafasta..................ok

t/multiple_fasta.............ok

t/obo_parser.................ok

t/pICalculator...............ok

t/phd........................ok

t/pir........................ok

t/pln........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
t/primaryqual................ok

t/primedseq..................ok

t/primer3....................ok

t/protgraph..................ok 1/70

#   Failed (TODO) test at t/protgraph.t line 55.

#   Failed (TODO) test at t/protgraph.t line 56.
#          got: '13'
#     expected: '14'
t/protgraph..................ok 49/70

#   Failed (TODO) test at t/protgraph.t line 248.
#          got: 'Helicobacter pylori'
#     expected: 'Helicobacter pylori 26695'
t/protgraph..................ok

t/psm........................ok

t/qual.......................ok

t/raw........................ok

t/rnamotif...................ok

t/scf........................ok

t/seq_quality................ok

t/seqfeaturePrimer...........ok

t/seqread_fail...............ok

t/sequencetrace..............ok

t/seqwithquality.............ok

t/simpleGOparser.............ok

t/singlet....................ok

t/sirna......................ok

t/splicedseq.................ok

t/swiss......................ok 1/239

#   Failed (TODO) test at t/swiss.t line 47.
t/swiss......................ok

t/tRNAscanSE.................ok

t/tab........................ok

t/table......................ok

t/targetp....................ok

t/tigrxml....................ok

t/tinyseq....................ok

t/trim.......................ok

t/ztr........................skipped
        all skipped: The optional module Bio::SeqIO::staden::read (or
dependencies thereof) was not installed
Failed Test  Stat Wstat Total Fail  List of Failed
----------------------------------------------------------------------------
---
t/Assembly.t    1   256    35    1  31
t/Genewise.t    3   768    53    3  37 41 45
 (3 subtests UNEXPECTEDLY SUCCEEDED), 9 tests and 43 subtests skipped.
Failed 2/248 test scripts. 4/15415 subtests failed.
Files=248, Tests=15415, 973 wallclock secs (123.75 cusr +  8.58 csys =
132.33 CPU)
Failed 2/248 test programs. 4/15415 subtests failed.



-----Original Message-----
From: Chris Fields [mailto:cjfields at uiuc.edu] 
Sent: Friday, September 28, 2007 1:00 PM
To: Forrest Zhang
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

If this is occurring using bioperl from CVS then I'll try taking a  
look at it.

chris

On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:

> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign








From bix at sendu.me.uk  Fri Sep 28 06:46:48 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 28 Sep 2007 07:46:48 +0100
Subject: [Bioperl-l] FW:  load_seqdatabase.pl error
In-Reply-To: <000101c80191$3b300e70$b1902b50$@com>
References: <000101c80191$3b300e70$b1902b50$@com>
Message-ID: <46FCA358.9070202@sendu.me.uk>

Forrest Zhang wrote:
> Oh, my God!  I am tring reinstall bioperl-live using CVS, so many error
> shown below.
[snip]
> t/Assembly.t    1   256    35    1  31
> t/Genewise.t    3   768    53    3  37 41 45

You failed 4 tests, and this is CVS. Don't worry about the failures if 
they're in tests of modules you're not using. Do you use the Assembly or 
Genewise modules?


From bix at sendu.me.uk  Fri Sep 28 06:40:04 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 28 Sep 2007 07:40:04 +0100
Subject: [Bioperl-l] cpan install
In-Reply-To: <000001c8017a$6384bae0$2a8e30a0$@com>
References: <46FC028F.3050000@usc.edu> <000001c8017a$6384bae0$2a8e30a0$@com>
Message-ID: <46FCA1C4.7030101@sendu.me.uk>

Forrest Zhang wrote:
> Try 
> cpan>install S/SE/SENDU/bioperl-1.5.2_102.tar.gz
> 
> other question you should browse
> http://www.bioperl.org/wiki/Installing_Bioperl_for_Unix

Yes, the explanation for 1.5.2 not showing up in d /bioperl/ being 'only 
stable versions appear in that list'.


From forrest_zhang at 163.com  Fri Sep 28 11:26:56 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 19:26:56 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
Message-ID: <000301c801c2$7deb6080$79c22180$@com>

Yes, it is happened using CVS.

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Chris Fields
Sent: Friday, September 28, 2007 1:00 PM
To: Forrest Zhang
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

If this is occurring using bioperl from CVS then I'll try taking a  
look at it.

chris

On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:

> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign



_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





From forrest_zhang at 163.com  Fri Sep 28 11:28:41 2007
From: forrest_zhang at 163.com (Forrest Zhang)
Date: Fri, 28 Sep 2007 19:28:41 +0800
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
Message-ID: <000401c801c2$ba0bae30$2e230a90$@com>

Message using CVS.

biocc bioperl-db # ./Build test
Copying scripts/biosql/terms/importrelation.pl ->
blib/script/importrelation.pl
blib/script/importrelation.pl -> blib/script/bp_importrelation.pl
Copying scripts/biosql/merge-unique-ann.pl ->
blib/script/merge-unique-ann.pl
blib/script/merge-unique-ann.pl -> blib/script/bp_merge-unique-ann.pl
Copying scripts/biosql/update-on-new-date.pl ->
blib/script/update-on-new-date.pl
blib/script/update-on-new-date.pl -> blib/script/bp_update-on-new-date.pl
Copying scripts/biosql/terms/add-term-annot.pl ->
blib/script/add-term-annot.pl
Deleting blib/script/add-term-annot.pl.bak
blib/script/add-term-annot.pl -> blib/script/bp_add-term-annot.pl
Copying scripts/corba/caching_corba_server.pl ->
blib/script/caching_corba_server.pl
Deleting blib/script/caching_corba_server.pl.bak
blib/script/caching_corba_server.pl ->
blib/script/bp_caching_corba_server.pl
Copying scripts/biosql/load_ontology.pl -> blib/script/load_ontology.pl
Deleting blib/script/load_ontology.pl.bak
blib/script/load_ontology.pl -> blib/script/bp_load_ontology.pl
Copying scripts/biosql/load_seqdatabase.pl ->
blib/script/load_seqdatabase.pl
Deleting blib/script/load_seqdatabase.pl.bak
blib/script/load_seqdatabase.pl -> blib/script/bp_load_seqdatabase.pl
Copying scripts/biosql/terms/interpro2go.pl -> blib/script/interpro2go.pl
blib/script/interpro2go.pl -> blib/script/bp_interpro2go.pl
Copying scripts/biosql/clean_ontology.pl -> blib/script/clean_ontology.pl
blib/script/clean_ontology.pl -> blib/script/bp_clean_ontology.pl
Copying scripts/corba/test_bioenv.pl -> blib/script/test_bioenv.pl
Deleting blib/script/test_bioenv.pl.bak
blib/script/test_bioenv.pl -> blib/script/bp_test_bioenv.pl
Copying scripts/biosql/update-on-new-version.pl ->
blib/script/update-on-new-version.pl
blib/script/update-on-new-version.pl ->
blib/script/bp_update-on-new-version.pl
Copying scripts/biosql/bioentry2flat.pl -> blib/script/bioentry2flat.pl
Deleting blib/script/bioentry2flat.pl.bak
blib/script/bioentry2flat.pl -> blib/script/bp_bioentry2flat.pl
Copying scripts/corba/bioenv_server.pl -> blib/script/bioenv_server.pl
Deleting blib/script/bioenv_server.pl.bak
blib/script/bioenv_server.pl -> blib/script/bp_bioenv_server.pl
Copying scripts/biosql/load_interpro.pl -> blib/script/load_interpro.pl
blib/script/load_interpro.pl -> blib/script/bp_load_interpro.pl
Copying scripts/biosql/cgi-bin/getentry.pl -> blib/script/getentry.pl
Deleting blib/script/getentry.pl.bak
blib/script/getentry.pl -> blib/script/bp_getentry.pl
Copying scripts/biosql/del-assocs-sql.pl -> blib/script/del-assocs-sql.pl
blib/script/del-assocs-sql.pl -> blib/script/bp_del-assocs-sql.pl
Copying scripts/biosql/freshen-annot.pl -> blib/script/freshen-annot.pl
blib/script/freshen-annot.pl -> blib/script/bp_freshen-annot.pl
t/01dbadaptor.....ok

t/02species.......FAILED tests 66-95

        Failed 30/65 tests, 53.85% okay
t/03simpleseq.....ok

t/04swiss.........ok

t/05seqfeature....ok

t/06comment.......ok

t/07dblink........ok

t/08genbank.......ok

t/09fuzzy2........ok

t/10ensembl.......ok

t/11locuslink.....ok

t/12ontology......ok

t/13remove........ok

t/14query.........ok

t/15cluster.......ok 9/160

--------------------- WARNING ---------------------
MSG: failed to store one or more child objects for an instance of class
Bio::Cluster::UniGene (PK=366)
---------------------------------------------------
t/15cluster.......ok

t/16obda..........ok

Failed Test   Stat Wstat Total Fail  List of Failed
----------------------------------------------------------------------------
---
t/02species.t               65   30  66-95
Failed 1/16 test scripts. -30/1423 subtests failed.
Files=16, Tests=1423, 36 wallclock secs (16.64 cusr +  0.65 csys = 17.29
CPU)
Failed 1/16 test programs. -30/1423 subtests failed.

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Chris Fields
Sent: Friday, September 28, 2007 1:00 PM
To: Forrest Zhang
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] load_seqdatabase.pl error

If this is occurring using bioperl from CVS then I'll try taking a  
look at it.

chris

On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:

> Hilmar,
> 	I have already pre-loaded the NCBI taxonomy using
> load_ncbi_taxonomy.pl yet. The error message show:
>
> --------------------- WARNING ---------------------
> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I  
> was
> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I  
> | rosids
> | core eudicotyledons | eudicotyledons | Magnoliophyta |  
> Euphyllophyta |
> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
> ---------------------------------------------------
> Could not store Q40784:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: create: object (Bio::Species) failed to insert or to be found  
> by unique
> key
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:206
> STACK: Bio::DB::Persistent::PersistentObject::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:244
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:169
> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:251
> STACK: Bio::DB::Persistent::PersistentObject::store
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/ 
> PersistentObject.pm:271
> STACK: /usr/bin/bp_load_seqdatabase.pl:633
> -----------------------------------------------------------
> Sigh~~~~~~
>
> Forrest Zhang
>
>
> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar Lapp
> Sent: Friday, September 28, 2007 6:17 AM
> To: Forrest
> Cc: bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>
> Forrest,
>
> have you preloaded the NCBI taxonomy as suggested in the BioSQL
> installation guidelines? SwissProt format has NCBI taxon IDs, and the
> code will try to use it to look up species and their lineage, rather
> than inserting the lineage from whatever BioPerl parses out of the
> sequence record.
>
> 	-hilmar
>
> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>
>> Hi, all
>>     I install the biosql, and bioperl-db. I want to import
>> swissport data.
>> But the programe show some error as below:
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver mysql
>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>> Could not store Q6DAH5:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>> subsp.
>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>> Pectobacterium |
>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>> Proteobacteria | Bacteria')
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>> STACK: Bio::Species::classification
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:552
>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:1305
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:973
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:852
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:182
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: load_seqdatabase.pl:620
>> -----------------------------------------------------------
>>
>>  at load_seqdatabase.pl line 633
>> ===================================================================== 
>> =
>> ======
>> ===============================================
>>
>> How can I solve it, please help me, Thank you.
>>
>> Thanks
>> Forrest zhang
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign



_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





From hlapp at gmx.net  Fri Sep 28 15:36:39 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 28 Sep 2007 11:36:39 -0400
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <46F8DC34.6020908@sendu.me.uk>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
Message-ID: <8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>

You do have a point here. From a design perspective, it feels odd if  
instantiating an object can fail with an I/O exception. But in  
reality that's how it's done all the time, from Bio::SeqIO to  
java.io.*, if I'm not mistaken. I also agree that asking a  
conditional that we know will be false every time except once  
violates the sense of elegance.

So upon second consideration, I think I agree with you. And a GFF3  
file with zero features in it should still be a valid GFF3 file,  
i.e., have the mandatory headers.

Does that make sense?

	-hilmar

On Sep 25, 2007, at 6:00 AM, Sendu Bala wrote:

> Hilmar Lapp wrote:
>> On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:
>>> I think that'll work fine.  The other option would be call a
>>> print_gff_header() function within write_feature() with the  
>>> intent to
>>> print the header only once, using a flag or similar:
>>>
>>> if (!$self->header_printed) {
>>>      $self->print_gff_header;
>>>      $self->header_printed(1);
>>> }
> >
>> I'd lean toward this or a similar approach too. Writing stuff out  
>> in the constructor doesn't feel like the best design.
>
> I'd argue that the alternative is just inefficient with no  
> compensating benefit. You have something that must only be done  
> once, and a method (_initialize) that is only called once. The  
> constructor is used to set up the file, getting it into a state  
> ready to add features. This involves opening it for writing with  
> the correct filename and setting the desired GFF version. Why  
> wouldn't it also output what ever else was necessary it initialize  
> the file?
>
> Also, what do we expect should happen when we use Bioperl to create  
> a GFF file and don't write any features to it? Should it be an  
> empty file, or should it contain whatever GFF information the user  
> had managed to supply (the version)?

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From hlapp at gmx.net  Fri Sep 28 15:53:33 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 28 Sep 2007 11:53:33 -0400
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
Message-ID: <9917490A-B7AF-4AE6-9C78-AD516700155B@gmx.net>

Chris let me know if you get stumped. I'm surprised that the special  
ranks ('eurosids I' etc) show up in the lineage (has NCBI started to  
assign ranks to them? I thought I filter them out. Needs to be looked  
into too.), but at any rate I don't understand why they aren't being  
accepted.

Also, maybe we need a more verbose output here - Forrest, can you run  
this with adding a --printerror argument. (I'm embarrassed to find  
that this doesn't seem to be documented. Sigh.)

	-hilmar

On Sep 28, 2007, at 1:00 AM, Chris Fields wrote:

> If this is occurring using bioperl from CVS then I'll try taking a
> look at it.
>
> chris
>
> On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:
>
>> Hilmar,
>> 	I have already pre-loaded the NCBI taxonomy using
>> load_ncbi_taxonomy.pl yet. The error message show:
>>
>> --------------------- WARNING ---------------------
>> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I
>> was
>> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I
>> | rosids
>> | core eudicotyledons | eudicotyledons | Magnoliophyta |
>> Euphyllophyta |
>> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
>> ---------------------------------------------------
>> Could not store Q40784:
>> ------------- EXCEPTION: Bio::Root::Exception -------------
>> MSG: create: object (Bio::Species) failed to insert or to be found
>> by unique
>> key
>> STACK: Error::throw
>> STACK: Bio::Root::Root::throw
>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:206
>> STACK: Bio::DB::Persistent::PersistentObject::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:244
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:169
>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>> BasePersistenceAdaptor.pm:251
>> STACK: Bio::DB::Persistent::PersistentObject::store
>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>> PersistentObject.pm:271
>> STACK: /usr/bin/bp_load_seqdatabase.pl:633
>> -----------------------------------------------------------
>> Sigh~~~~~~
>>
>> Forrest Zhang
>>
>>
>> -----Original Message-----
>> From: bioperl-l-bounces at lists.open-bio.org
>> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar  
>> Lapp
>> Sent: Friday, September 28, 2007 6:17 AM
>> To: Forrest
>> Cc: bioperl-l at bioperl.org
>> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>>
>> Forrest,
>>
>> have you preloaded the NCBI taxonomy as suggested in the BioSQL
>> installation guidelines? SwissProt format has NCBI taxon IDs, and the
>> code will try to use it to look up species and their lineage, rather
>> than inserting the lineage from whatever BioPerl parses out of the
>> sequence record.
>>
>> 	-hilmar
>>
>> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>>
>>> Hi, all
>>>     I install the biosql, and bioperl-db. I want to import
>>> swissport data.
>>> But the programe show some error as below:
>>> ==================================================================== 
>>> =
>>> =
>>> ======
>>> ===============================================
>>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver  
>>>> mysql
>>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>>> Could not store Q6DAH5:
>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>>> subsp.
>>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>>> Pectobacterium |
>>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>>> Proteobacteria | Bacteria')
>>> STACK: Error::throw
>>> STACK: Bio::Root::Root::throw
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>>> STACK: Bio::Species::classification
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:552
>>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:1305
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:973
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:852
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:182
>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:244
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:169
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:251
>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:271
>>> STACK: load_seqdatabase.pl:620
>>> -----------------------------------------------------------
>>>
>>>  at load_seqdatabase.pl line 633
>>> ==================================================================== 
>>> =
>>> =
>>> ======
>>> ===============================================
>>>
>>> How can I solve it, please help me, Thank you.
>>>
>>> Thanks
>>> Forrest zhang
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> -- 
>> ===========================================================
>> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
>> ===========================================================
>>
>>
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From cjfields at uiuc.edu  Fri Sep 28 16:04:08 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 11:04:08 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
Message-ID: <5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>

On Sep 28, 2007, at 10:36 AM, Hilmar Lapp wrote:

> You do have a point here. From a design perspective, it feels odd  
> if instantiating an object can fail with an I/O exception. But in  
> reality that's how it's done all the time, from Bio::SeqIO to  
> java.io.*, if I'm not mistaken. I also agree that asking a  
> conditional that we know will be false every time except once  
> violates the sense of elegance.

I agree with the lack of elegance from a design perspective on both  
counts, but when have we ever been worried about that? ;>

In general I don't think SeqIO classes generates actual output (like  
the GFF header information) in the constructor, they just initialize  
IO and other state data.  It makes sense to fail in this case if an  
error pops up.  Regardless, one could argue ad infinitum that either  
proposed fix has its benefits/deficiencies, however both will work,  
so I'm happy with either.

chris

> So upon second consideration, I think I agree with you. And a GFF3  
> file with zero features in it should still be a valid GFF3 file,  
> i.e., have the mandatory headers.
>
> Does that make sense?
>
> 	-hilmar
>
> On Sep 25, 2007, at 6:00 AM, Sendu Bala wrote:
>
>> Hilmar Lapp wrote:
>>> On Sep 24, 2007, at 9:35 AM, Chris Fields wrote:
>>>> I think that'll work fine.  The other option would be call a
>>>> print_gff_header() function within write_feature() with the  
>>>> intent to
>>>> print the header only once, using a flag or similar:
>>>>
>>>> if (!$self->header_printed) {
>>>>      $self->print_gff_header;
>>>>      $self->header_printed(1);
>>>> }
>> >
>>> I'd lean toward this or a similar approach too. Writing stuff out  
>>> in the constructor doesn't feel like the best design.
>>
>> I'd argue that the alternative is just inefficient with no  
>> compensating benefit. You have something that must only be done  
>> once, and a method (_initialize) that is only called once. The  
>> constructor is used to set up the file, getting it into a state  
>> ready to add features. This involves opening it for writing with  
>> the correct filename and setting the desired GFF version. Why  
>> wouldn't it also output what ever else was necessary it initialize  
>> the file?
>>
>> Also, what do we expect should happen when we use Bioperl to  
>> create a GFF file and don't write any features to it? Should it be  
>> an empty file, or should it contain whatever GFF information the  
>> user had managed to supply (the version)?
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From cjfields at uiuc.edu  Fri Sep 28 16:10:59 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 11:10:59 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <9917490A-B7AF-4AE6-9C78-AD516700155B@gmx.net>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
	<9917490A-B7AF-4AE6-9C78-AD516700155B@gmx.net>
Message-ID: <EECC931E-C7B5-485E-B059-4A7A9A7C092E@uiuc.edu>

I'm actually getting some odd recursion issues again; not sure what's  
causing it, but a reinstall of both bioperl and bioperl-db fixed it  
last time.  It may be related to the rollback, just not sure yet.

I'll try tracking it down if it persists (bad pun).

t/04swiss....ok 3/52
--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
---------------------------------------------------
t/04swiss....ok
All tests successful.
Files=1, Tests=52,  2 wallclock secs ( 1.33 cusr +  0.18 csys =  1.51  
CPU)

The specific error under verbose running is:

--------------------- WARNING ---------------------
MSG: recursion detected for Bio::Taxon object
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:680
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:677
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:691
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:677
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:691
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:677
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:677
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:658
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:629
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent / 
Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
BasePersistenceAdaptor.pm:586
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store /Users/cjfields/ 
src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:252
STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children /Users/ 
cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
PrimarySeqAdaptor.pm:229
STACK Bio::DB::BioSQL::SeqAdaptor::store_children /Users/cjfields/src/ 
core/bioperl-db/blib/lib/Bio/DB/BioSQL/SeqAdaptor.pm:217
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create /Users/cjfields/ 
src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:213
STACK Bio::DB::Persistent::PersistentObject::create /Users/cjfields/ 
src/core/bioperl-db/blib/lib/Bio/DB/Persistent/PersistentObject.pm:244
STACK toplevel t/04swiss.t:37
---------------------------------------------------


chris

On Sep 28, 2007, at 10:53 AM, Hilmar Lapp wrote:

> Chris let me know if you get stumped. I'm surprised that the special
> ranks ('eurosids I' etc) show up in the lineage (has NCBI started to
> assign ranks to them? I thought I filter them out. Needs to be looked
> into too.), but at any rate I don't understand why they aren't being
> accepted.
>
> Also, maybe we need a more verbose output here - Forrest, can you run
> this with adding a --printerror argument. (I'm embarrassed to find
> that this doesn't seem to be documented. Sigh.)
>
> 	-hilmar
>
> On Sep 28, 2007, at 1:00 AM, Chris Fields wrote:
>
>> If this is occurring using bioperl from CVS then I'll try taking a
>> look at it.
>>
>> chris
>>
>> On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:
>>
>>> Hilmar,
>>> 	I have already pre-loaded the NCBI taxonomy using
>>> load_ncbi_taxonomy.pl yet. The error message show:
>>>
>>> --------------------- WARNING ---------------------
>>> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I
>>> was
>>> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I
>>> | rosids
>>> | core eudicotyledons | eudicotyledons | Magnoliophyta |
>>> Euphyllophyta |
>>> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
>>> ---------------------------------------------------
>>> Could not store Q40784:
>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>> MSG: create: object (Bio::Species) failed to insert or to be found
>>> by unique
>>> key
>>> STACK: Error::throw
>>> STACK: Bio::Root::Root::throw
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:206
>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:244
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:169
>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>> BasePersistenceAdaptor.pm:251
>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>> PersistentObject.pm:271
>>> STACK: /usr/bin/bp_load_seqdatabase.pl:633
>>> -----------------------------------------------------------
>>> Sigh~~~~~~
>>>
>>> Forrest Zhang
>>>
>>>
>>> -----Original Message-----
>>> From: bioperl-l-bounces at lists.open-bio.org
>>> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar
>>> Lapp
>>> Sent: Friday, September 28, 2007 6:17 AM
>>> To: Forrest
>>> Cc: bioperl-l at bioperl.org
>>> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>>>
>>> Forrest,
>>>
>>> have you preloaded the NCBI taxonomy as suggested in the BioSQL
>>> installation guidelines? SwissProt format has NCBI taxon IDs, and  
>>> the
>>> code will try to use it to look up species and their lineage, rather
>>> than inserting the lineage from whatever BioPerl parses out of the
>>> sequence record.
>>>
>>> 	-hilmar
>>>
>>> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>>>
>>>> Hi, all
>>>>     I install the biosql, and bioperl-db. I want to import
>>>> swissport data.
>>>> But the programe show some error as below:
>>>> =================================================================== 
>>>> =
>>>> =
>>>> =
>>>> ======
>>>> ===============================================
>>>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver
>>>>> mysql
>>>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>>>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>>>> Could not store Q6DAH5:
>>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>>>> subsp.
>>>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>>>> Pectobacterium |
>>>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>>>> Proteobacteria | Bacteria')
>>>> STACK: Error::throw
>>>> STACK: Bio::Root::Root::throw
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>>>> STACK: Bio::Species::classification
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>>>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:552
>>>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:1305
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:973
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:852
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:182
>>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:244
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:169
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:251
>>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:271
>>>> STACK: load_seqdatabase.pl:620
>>>> -----------------------------------------------------------
>>>>
>>>>  at load_seqdatabase.pl line 633
>>>> =================================================================== 
>>>> =
>>>> =
>>>> =
>>>> ======
>>>> ===============================================
>>>>
>>>> How can I solve it, please help me, Thank you.
>>>>
>>>> Thanks
>>>> Forrest zhang
>>>>
>>>>
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>> -- 
>>> ===========================================================
>>> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
>>> ===========================================================
>>>
>>>
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> ===========================================================
> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
> ===========================================================
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From hlapp at gmx.net  Fri Sep 28 21:09:28 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 28 Sep 2007 17:09:28 -0400
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
Message-ID: <41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>


On Sep 28, 2007, at 12:04 PM, Chris Fields wrote:

> In general I don't think SeqIO classes generates actual output  
> (like the GFF header information) in the constructor

There's probably two reasons they don't (if really all of them  
don't): i) unless you explicitly test (how?) whether the file has  
been opened for writing, you actually don't know in the SeqIO  
constructor whether someone's going to write to the file or read from  
it. ii) off hand, I don't know of a sequence file format that would  
require a particular header being written just once.

Though thinking about this, I start asking myself whether i) wouldn't  
also apply to FeatureIO (are we not reading gff too in this class?),  
and I'm wondering that there must  be a header (or at least an  
enclosing tag) for SeqIO XML formats - so how is that dealt with there?

	-hilmar
-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From cjfields at uiuc.edu  Fri Sep 28 21:34:13 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 16:34:13 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
Message-ID: <530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>


On Sep 28, 2007, at 4:09 PM, Hilmar Lapp wrote:

>
> On Sep 28, 2007, at 12:04 PM, Chris Fields wrote:
>
>> In general I don't think SeqIO classes generates actual output
>> (like the GFF header information) in the constructor
>
> There's probably two reasons they don't (if really all of them
> don't): i) unless you explicitly test (how?) whether the file has
> been opened for writing, you actually don't know in the SeqIO
> constructor whether someone's going to write to the file or read from
> it. ii) off hand, I don't know of a sequence file format that would
> require a particular header being written just once.
>
> Though thinking about this, I start asking myself whether i) wouldn't
> also apply to FeatureIO (are we not reading gff too in this class?),
> and I'm wondering that there must  be a header (or at least an
> enclosing tag) for SeqIO XML formats - so how is that dealt with  
> there?
>
> 	-hilmar

Re: (i) and FeatureIO: I believe most FeatureIO classes read/write to/ 
from specific feature files (bed, gff, ptt, interpro, etc), which is  
one reason I thought everything I(nput) should go into next_feature 
(), everything O(utput) into write_feature().  The section writing  
the gff header info in _initialize() checks the file specifically for  
'>' prior to output; I think Sendu planned on changing that to use  
mode() instead.

Re: (ii): I'm not sure, actually; I wouldn't be surprised if XML  
output hasn't been tested very well.

If I could go to the Nov. GMOD meeting to help hammer out some of the  
GFF3/FeatureIO/SF::Annotated stuff I would, but I would be traveling  
on my own dime.  Maybe I'll see what I can come up with and stay at  
the no-tell motel...

chris


From cjfields at uiuc.edu  Fri Sep 28 22:03:06 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 17:03:06 -0500
Subject: [Bioperl-l] load_seqdatabase.pl error
In-Reply-To: <EECC931E-C7B5-485E-B059-4A7A9A7C092E@uiuc.edu>
References: <000501c800d9$dc9c8e90$95d5abb0$@com>
	<2461576A-1A15-45E2-A14F-AEED6ACD6007@gmx.net>
	<000101c8017d$c4643360$4d2c9a20$@com>
	<8C9CDFBD-200C-4CD6-8295-7833D2CD3758@uiuc.edu>
	<9917490A-B7AF-4AE6-9C78-AD516700155B@gmx.net>
	<EECC931E-C7B5-485E-B059-4A7A9A7C092E@uiuc.edu>
Message-ID: <FD7C7306-92E1-49D9-93E4-EDFBF09E1A1A@uiuc.edu>

Okay, fixed the recursion (extra copy of a BasePersistentAdaptor  
module I was working which tripped it, so nothing in CVS).

Forrest, I get all tests passing.  I used a database without taxonomy  
loaded with bioperl-db and bioperl from cvs and it worked w/o  
problems.  I'll try working with your sequence when I have time this  
weekend.

chris

On Sep 28, 2007, at 11:10 AM, Chris Fields wrote:

> I'm actually getting some odd recursion issues again; not sure what's
> causing it, but a reinstall of both bioperl and bioperl-db fixed it
> last time.  It may be related to the rollback, just not sure yet.
>
> I'll try tracking it down if it persists (bad pun).
>
> t/04swiss....ok 3/52
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> ---------------------------------------------------
> t/04swiss....ok
> All tests successful.
> Files=1, Tests=52,  2 wallclock secs ( 1.33 cusr +  0.18 csys =  1.51
> CPU)
>
> The specific error under verbose running is:
>
> --------------------- WARNING ---------------------
> MSG: recursion detected for Bio::Taxon object
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:680
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:677
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:691
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:677
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:691
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:677
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:677
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:658
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:629
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /
> Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> BasePersistenceAdaptor.pm:586
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store /Users/cjfields/
> src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:252
> STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children /Users/
> cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/
> PrimarySeqAdaptor.pm:229
> STACK Bio::DB::BioSQL::SeqAdaptor::store_children /Users/cjfields/src/
> core/bioperl-db/blib/lib/Bio/DB/BioSQL/SeqAdaptor.pm:217
> STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create /Users/cjfields/
> src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/ 
> BasePersistenceAdaptor.pm:213
> STACK Bio::DB::Persistent::PersistentObject::create /Users/cjfields/
> src/core/bioperl-db/blib/lib/Bio/DB/Persistent/PersistentObject.pm:244
> STACK toplevel t/04swiss.t:37
> ---------------------------------------------------
>
>
> chris
>
> On Sep 28, 2007, at 10:53 AM, Hilmar Lapp wrote:
>
>> Chris let me know if you get stumped. I'm surprised that the special
>> ranks ('eurosids I' etc) show up in the lineage (has NCBI started to
>> assign ranks to them? I thought I filter them out. Needs to be looked
>> into too.), but at any rate I don't understand why they aren't being
>> accepted.
>>
>> Also, maybe we need a more verbose output here - Forrest, can you run
>> this with adding a --printerror argument. (I'm embarrassed to find
>> that this doesn't seem to be documented. Sigh.)
>>
>> 	-hilmar
>>
>> On Sep 28, 2007, at 1:00 AM, Chris Fields wrote:
>>
>>> If this is occurring using bioperl from CVS then I'll try taking a
>>> look at it.
>>>
>>> chris
>>>
>>> On Sep 27, 2007, at 10:15 PM, Forrest Zhang wrote:
>>>
>>>> Hilmar,
>>>> 	I have already pre-loaded the NCBI taxonomy using
>>>> load_ncbi_taxonomy.pl yet. The error message show:
>>>>
>>>> --------------------- WARNING ---------------------
>>>> MSG: The supplied lineage does not start near 'Phaseolus aureus' (I
>>>> was
>>>> supplied 'Vigna | Papilionoideae | Fabaceae | Fabales | eurosids I
>>>> | rosids
>>>> | core eudicotyledons | eudicotyledons | Magnoliophyta |
>>>> Euphyllophyta |
>>>> Embryophyta | Streptophytina | Viridiplantae | Eukaryota')
>>>> ---------------------------------------------------
>>>> Could not store Q40784:
>>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>>> MSG: create: object (Bio::Species) failed to insert or to be found
>>>> by unique
>>>> key
>>>> STACK: Error::throw
>>>> STACK: Bio::Root::Root::throw
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:206
>>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:244
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:169
>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>> BasePersistenceAdaptor.pm:251
>>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>> PersistentObject.pm:271
>>>> STACK: /usr/bin/bp_load_seqdatabase.pl:633
>>>> -----------------------------------------------------------
>>>> Sigh~~~~~~
>>>>
>>>> Forrest Zhang
>>>>
>>>>
>>>> -----Original Message-----
>>>> From: bioperl-l-bounces at lists.open-bio.org
>>>> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Hilmar
>>>> Lapp
>>>> Sent: Friday, September 28, 2007 6:17 AM
>>>> To: Forrest
>>>> Cc: bioperl-l at bioperl.org
>>>> Subject: Re: [Bioperl-l] load_seqdatabase.pl error
>>>>
>>>> Forrest,
>>>>
>>>> have you preloaded the NCBI taxonomy as suggested in the BioSQL
>>>> installation guidelines? SwissProt format has NCBI taxon IDs, and
>>>> the
>>>> code will try to use it to look up species and their lineage,  
>>>> rather
>>>> than inserting the lineage from whatever BioPerl parses out of the
>>>> sequence record.
>>>>
>>>> 	-hilmar
>>>>
>>>> On Sep 27, 2007, at 3:41 AM, Forrest wrote:
>>>>
>>>>> Hi, all
>>>>>     I install the biosql, and bioperl-db. I want to import
>>>>> swissport data.
>>>>> But the programe show some error as below:
>>>>> ================================================================== 
>>>>> =
>>>>> =
>>>>> =
>>>>> =
>>>>> ======
>>>>> ===============================================
>>>>>> perl load_seqdatabase.pl -dbuser root -dbname bioseqdb -driver
>>>>>> mysql
>>>>> -namespace swissprot -format swiss ~/uniprot/uniprot_sprot.dat
>>>>> Loading /home/forrest/uniprot/uniprot_sprot.dat ...
>>>>> Could not store Q6DAH5:
>>>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>>>> MSG: The supplied lineage does not start near 'Erwinia carotovora
>>>>> subsp.
>>>>> atroseptica' (I was supplied 'Erwinia carotovora subsp. |
>>>>> Pectobacterium |
>>>>> Enterobacteriaceae | Enterobacteriales | Gammaproteobacteria |
>>>>> Proteobacteria | Bacteria')
>>>>> STACK: Error::throw
>>>>> STACK: Bio::Root::Root::throw
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:359
>>>>> STACK: Bio::Species::classification
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/Species.pm:174
>>>>> STACK: Bio::DB::Persistent::PersistentObject::AUTOLOAD
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>>> PersistentObject.pm:552
>>>>> STACK: Bio::DB::BioSQL::SpeciesAdaptor::populate_from_row
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/SpeciesAdaptor.pm:281
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::_build_object
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:1305
>>>>> STACK:  
>>>>> Bio::DB::BioSQL::BasePersistenceAdaptor::_find_by_unique_key
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:973
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::find_by_unique_key
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:852
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:182
>>>>> STACK: Bio::DB::Persistent::PersistentObject::create
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>>> PersistentObject.pm:244
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::create
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:169
>>>>> STACK: Bio::DB::BioSQL::BasePersistenceAdaptor::store
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/BioSQL/
>>>>> BasePersistenceAdaptor.pm:251
>>>>> STACK: Bio::DB::Persistent::PersistentObject::store
>>>>> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/Persistent/
>>>>> PersistentObject.pm:271
>>>>> STACK: load_seqdatabase.pl:620
>>>>> -----------------------------------------------------------
>>>>>
>>>>>  at load_seqdatabase.pl line 633
>>>>> ================================================================== 
>>>>> =
>>>>> =
>>>>> =
>>>>> =
>>>>> ======
>>>>> ===============================================
>>>>>
>>>>> How can I solve it, please help me, Thank you.
>>>>>
>>>>> Thanks
>>>>> Forrest zhang
>>>>>
>>>>>
>>>>>
>>>>> _______________________________________________
>>>>> Bioperl-l mailing list
>>>>> Bioperl-l at lists.open-bio.org
>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>> -- 
>>>> ===========================================================
>>>> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
>>>> ===========================================================
>>>>
>>>>
>>>>
>>>>
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>>
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>> Christopher Fields
>>> Postdoctoral Researcher
>>> Lab of Dr. Robert Switzer
>>> Dept of Biochemistry
>>> University of Illinois Urbana-Champaign
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> -- 
>> ===========================================================
>> : Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
>> ===========================================================
>>
>>
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





From hlapp at gmx.net  Fri Sep 28 22:20:37 2007
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 28 Sep 2007 18:20:37 -0400
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
	<530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
Message-ID: <5FC8F92C-42DD-4DAF-8008-0F8C545065B5@gmx.net>


On Sep 28, 2007, at 5:34 PM, Chris Fields wrote:

> The section writing the gff header info in _initialize() checks the  
> file specifically for '>' prior to output; I think Sendu planned on  
> changing that to use mode() instead.

What if we pass in a file handle?

	-hilmar
-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================







From cjfields at uiuc.edu  Fri Sep 28 23:04:21 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Sep 2007 18:04:21 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <5FC8F92C-42DD-4DAF-8008-0F8C545065B5@gmx.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
	<530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
	<5FC8F92C-42DD-4DAF-8008-0F8C545065B5@gmx.net>
Message-ID: <E351BFD9-57C8-4A62-986F-F5E674B28FC5@uiuc.edu>


On Sep 28, 2007, at 5:20 PM, Hilmar Lapp wrote:

>
> On Sep 28, 2007, at 5:34 PM, Chris Fields wrote:
>
>> The section writing the gff header info in _initialize() checks the
>> file specifically for '>' prior to output; I think Sendu planned on
>> changing that to use mode() instead.
>
> What if we pass in a file handle?
>
> 	-hilmar

The old way def. wouldn't work with filehandles.  Not sure if  
checking Root::IO::mode() would work as expected in this case, but  
it's certainly worth a try.

chris


From jay at jays.net  Fri Sep 28 22:50:29 2007
From: jay at jays.net (Jay Hannah)
Date: Fri, 28 Sep 2007 17:50:29 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
	<530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
Message-ID: <FAFE7FDD-5191-4500-894E-05A11E71D410@jays.net>

On Sep 28, 2007, at 4:34 PM, Chris Fields wrote:
> On Sep 28, 2007, at 4:09 PM, Hilmar Lapp wrote:
>> and I'm wondering that there must  be a header (or at least an
>> enclosing tag) for SeqIO XML formats - so how is that dealt with
>> there?
>
> Re: (ii): I'm not sure, actually; I wouldn't be surprised if XML
> output hasn't been tested very well.

For good or ill I stole what I found in other Bio/SeqIO/* classes  
when I started writing my Bio::SeqIO::solrxml. It is not ready, but  
you can poke it with a stick here if you like:

http://vc.jays.net/viewvc.cgi/SolrGene/solrxml.pm? 
revision=26&root=CLAB&view=markup

In _initialize() it sends XML header goo into $self->_print(), and it  
uses DESTROY to drop an XML closure tag into $self->_print().

Constructing it

$out_solr  = Bio::SeqIO->new(-file => ">seq.solr.xml",
                              -format => 'solrxml');

without writing any sequences to it created a seq.solr.xml file with  
the XML header and footer and nothing in the middle.

If this is not The Right Way I'm happy to change it to do whatever.  :)

> If I could go to the Nov. GMOD meeting to help hammer out some of the
> GFF3/FeatureIO/SF::Annotated stuff I would, but I would be traveling
> on my own dime.  Maybe I'll see what I can come up with and stay at
> the no-tell motel...

I've decided to spend many of my own dimes and make the trek. I hope  
to meet many BioPerl'ers. I'll buy you dinner if you show up.  :)

Take care,

Jay Hannah
http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah





From cjfields at uiuc.edu  Sat Sep 29 18:28:16 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sat, 29 Sep 2007 13:28:16 -0500
Subject: [Bioperl-l] Bio::FeatureIO::gff bug?
In-Reply-To: <FAFE7FDD-5191-4500-894E-05A11E71D410@jays.net>
References: <46F784EB.9050507@sendu.me.uk>
	<7C7D7FB3-86B9-43CF-B506-E66FA8264CFC@uiuc.edu>
	<46F7B9A1.9080206@sendu.me.uk>
	<EEC9B51B-8245-48FA-9C04-D778789107E9@uiuc.edu>
	<234C109D-85FE-4161-8CBA-8E24BE34C5B5@gmx.net>
	<46F8DC34.6020908@sendu.me.uk>
	<8283EF43-2AF0-4B3B-8A00-4DE615186EC7@gmx.net>
	<5298B700-EFDE-45E4-A8F3-674FA673A0C7@uiuc.edu>
	<41A20518-63BC-4D01-8FFC-01C903ADD423@gmx.net>
	<530A0322-A3BC-471D-AE91-17AD8F0EB237@uiuc.edu>
	<FAFE7FDD-5191-4500-894E-05A11E71D410@jays.net>
Message-ID: <E6C9C3D8-9E3F-4740-B590-6F4E5A152C5E@uiuc.edu>


On Sep 28, 2007, at 5:50 PM, Jay Hannah wrote:

> On Sep 28, 2007, at 4:34 PM, Chris Fields wrote:
>> On Sep 28, 2007, at 4:09 PM, Hilmar Lapp wrote:
>>> and I'm wondering that there must  be a header (or at least an
>>> enclosing tag) for SeqIO XML formats - so how is that dealt with
>>> there?
>>
>> Re: (ii): I'm not sure, actually; I wouldn't be surprised if XML
>> output hasn't been tested very well.
>
> For good or ill I stole what I found in other Bio/SeqIO/* classes
> when I started writing my Bio::SeqIO::solrxml. It is not ready, but
> you can poke it with a stick here if you like:
>
> http://vc.jays.net/viewvc.cgi/SolrGene/solrxml.pm?
> revision=26&root=CLAB&view=markup
>
> In _initialize() it sends XML header goo into $self->_print(), and it
> uses DESTROY to drop an XML closure tag into $self->_print().
>
> Constructing it
>
> $out_solr  = Bio::SeqIO->new(-file => ">seq.solr.xml",
>                               -format => 'solrxml');
>
> without writing any sequences to it created a seq.solr.xml file with
> the XML header and footer and nothing in the middle.
>
> If this is not The Right Way I'm happy to change it to do  
> whatever.  :)

If you do it this way you should probably run a check on the mode()  
the object state is in ('r'=read, 'w'=write, '?'=unknown), and only  
_print() on write mode.  Might also be a good idea to implement a  
next_seq with an exception ('Module is write only').

>> If I could go to the Nov. GMOD meeting to help hammer out some of the
>> GFF3/FeatureIO/SF::Annotated stuff I would, but I would be traveling
>> on my own dime.  Maybe I'll see what I can come up with and stay at
>> the no-tell motel...
>
> I've decided to spend many of my own dimes and make the trek. I hope
> to meet many BioPerl'ers. I'll buy you dinner if you show up.  :)
>
> Take care,
>
> Jay Hannah
> http://clab.ist.unomaha.edu/CLAB/index.php/User:Jhannah

I may see what I can scrape up myself but it doesn't look good (lab's  
closing down soon, so money's pretty tight).  If I knew about the  
meeting a while in advance I would probably have made it.  Oh well!

chris



From cjfields at uiuc.edu  Sun Sep 30 20:39:23 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 30 Sep 2007 15:39:23 -0500
Subject: [Bioperl-l] DB::SeqFeature::Store error
Message-ID: <A56E6D20-EF3E-4B5D-B3F2-9F2B7D0178EF@uiuc.edu>

I'm getting the following error on my local MySQL (v 5.0.41) with  
bp_seqfeature_load:

-------------------- EXCEPTION --------------------
MSG: The used table type doesn't support FULLTEXT indexes
STACK Bio::DB::SeqFeature::Store::DBI::mysql::_init_database /Library/ 
Perl/5.8.6/Bio/DB/SeqFeature/Store/DBI/mysql.pm:414
STACK Bio::DB::SeqFeature::Store::init_database /Library/Perl/5.8.6/ 
Bio/DB/SeqFeature/Store.pm:382
STACK Bio::DB::SeqFeature::Store::DBI::mysql::init /Library/Perl/ 
5.8.6/Bio/DB/SeqFeature/Store/DBI/mysql.pm:218
STACK Bio::DB::SeqFeature::Store::new /Library/Perl/5.8.6/Bio/DB/ 
SeqFeature/Store.pm:345
STACK toplevel /usr/local/bin/bp_seqfeature_load.pl:57
-------------------------------------------

The default setting for storage is InnoDB; switching to MyISAM fixes  
the issue.  Should we specify TYPE = MyISAM with the various CREATE  
TABLE queries in Bio::DB::SeqFeature::Store::DBI::mysql to be on the  
safe side?

chris


From ewijaya at gmail.com  Sun Sep 30 14:10:25 2007
From: ewijaya at gmail.com (Edward Wijaya)
Date: Sun, 30 Sep 2007 22:10:25 +0800
Subject: [Bioperl-l] Bio::Graphics - Howto draw graded segments overlap with
	line track
Message-ID: <3521d3670709300710l4a41c47es1c72cc5a450a3736@mail.gmail.com>

Hi,

I want to draw a binding sites hits on sequence of various length.
What I have now is a graded segments only. Is there a way to draw
segments overlapping with the line ? (see attached figure).

--
Edward
-------------- next part --------------
A non-text attachment was scrubbed...
Name: hits.PNG
Type: image/png
Size: 15613 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20070930/2402791e/attachment-0004.png>