[Bioperl-l] a problem with standalone blast
zhihua li
lzhtom at hotmail.com
Sun Mar 11 22:33:44 EDT 2007
HI all,
I know this is probably not a right question to ask here, 'cause it's
solely blast, although i did try using standalone blastall module. But I
couldn't find any other suitable mailing lists. So i hope guys here could
help me out.
Recently I got a problem when I tried to blast a nucleotide sequence
against a database. The problem occured when I was using blast module in
perl, but then i realized it was caused by blast directly.
The database was generated with formatdb and is correct, 'cause all other
queries went through quite well.
The problematic query sequence is:
>ENSG00000162825.7
GGGGAAGAAGATCAAAGAAGAAAGAAGAAGGGGAAGAAAAGAAGGGGAAGAAG
The only difference it has compared with other successful queries is that
it's shorter .
After running blastn I got the following message:
[blastall] WARNING: ENSG00000162825.7: Could not calculate ungapped
Karlin-Altschul parameters due to an invalid query sequence or its
translation. Please verify the query sequence(s) and/or filtering options.
At first I thought it might have been masked out too much during the
filtering process. So I ran it again with the filtering switched off.
After that I got following error:
[blastall] ERROR: Threshold for extending hits, default if zero
blastp 11, blastn 0, blastx 12, tblastn 13
tblastx 13, megablast 0 [F] is bad or out of range [? to ?]
Could you help me out with this?
Thanks a lot!
Zhihua Li
_________________________________________________________________
ÓëÁª»úµÄÅóÓѽøÐн»Á÷£¬ÇëʹÓà MSN Messenger: http://messenger.msn.com/cn
More information about the Bioperl-l
mailing list