From granjeau at tagc.univ-mrs.fr  Thu Mar  1 02:36:43 2007
From: granjeau at tagc.univ-mrs.fr (Samuel GRANJEAUD - IR/IFR137)
Date: Thu, 01 Mar 2007 08:36:43 +0100
Subject: [Bioperl-l] retrieven ids
In-Reply-To: <58ff33550702280921s25f749aagd6e62b1a5cc34edb@mail.gmail.com>
References: <58ff33550702280921s25f749aagd6e62b1a5cc34edb@mail.gmail.com>
Message-ID: <45E6828B.4080808@tagc.univ-mrs.fr>

Hi,

I am not sure it's the key answer but the FAQ may help you

http://www.bioperl.org/wiki/FAQ#How_do_I_retrieve_a_nucleotide_coding_sequence_when_I_have_a_protein_gi_number.3F

Cheers,
--Samuel

Luba Pardo wrote:
> Hi everyone,
> I wonder if someone could give an advice of the following:
> I want to retrieve the DNA coding sequence of a RefSeq protein id. I do not
> want to translate the protein back to DNA, but rather get the DNA coding
> sequence ID and then retrieve the DNA sequence from Gen Bank. Is there any
> module that allow to get all possible ids for a sequence given a gi protein
> ?
>
> Thank you very much in advance,
> L. Pardo
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>   

From lubapardo at gmail.com  Thu Mar  1 02:48:27 2007
From: lubapardo at gmail.com (Luba Pardo)
Date: Thu, 1 Mar 2007 08:48:27 +0100
Subject: [Bioperl-l] retrieven ids
In-Reply-To: <57419.10.0.7.57.1172691089.squirrel@gscmail.wustl.edu>
References: <58ff33550702280921s25f749aagd6e62b1a5cc34edb@mail.gmail.com>
	<57419.10.0.7.57.1172691089.squirrel@gscmail.wustl.edu>
Message-ID: <58ff33550702282348w7263f9c1o8a1d4bd6270c4fd0@mail.gmail.com>

Thank you very much.
L. Pardo

On 28/02/07, Dave Messina <dmessina at wustl.edu> wrote:
>
> Whenever I'm unsure of how to do something, I first look to see if one of
> the  HOWTOs on bioperl.org covers it. In this case, the Features HOWTO has
> example code which I think will do what you want.
>
> Genbank records typically have the coding sequence of a protein as a
> feature, so I would do something like:
>
> - use the RefSeq protein IDs to query Entrez and get back the Genbank
> records.
>
> - read the Features HOWTO to refresh my memory on the syntax for grabbing
> features.
>
> That HOWTO is at:
> http://www.bioperl.org/wiki/HOWTO:Feature-Annotation
>
> - whip up a little script to loop through the Genbank records one at a
> time with SeqIO and pull out the cDNA sequence features.
>
>
> Dave
>
>
>

From granjeau at tagc.univ-mrs.fr  Thu Mar  1 05:09:11 2007
From: granjeau at tagc.univ-mrs.fr (Samuel GRANJEAUD - IR/IFR137)
Date: Thu, 01 Mar 2007 11:09:11 +0100
Subject: [Bioperl-l] _rearrange
In-Reply-To: <Pine.LNX.4.58.0702281624380.8207@localhost.localdomain>
References: <Pine.LNX.4.58.0702281624380.8207@localhost.localdomain>
Message-ID: <45E6A647.4060605@tagc.univ-mrs.fr>

Hi,

May be you will find information in

http://www.bioperl.org/wiki/Advanced_BioPerl#rearrange.28.29

http://www.bioperl.org/wiki/Bioperl_Best_Practices

Cheers,
--Samuel

Caroline Johnston wrote:
> hi,
>
> Is there a discussion of the rationale behind the _rearrange method
> somewhere? I'm probably just being gormless, but I think I'm missing the
> point a bit.
>
> Is it okay for a method just to expect named params like
> ->foo(arg1=>'stuff', arg2=>'things'); ?
>
> Cxx
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>   

From michael.watson at bbsrc.ac.uk  Thu Mar  1 05:58:16 2007
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Thu, 1 Mar 2007 10:58:16 -0000
Subject: [Bioperl-l] The axis of GC content in Bio::Graphics::glyph:dna
In-Reply-To: <6dce9a0b0702151053v19ab190fh1f752fea3b2ed722@mail.gmail.com>
References: <8975119BCD0AC5419D61A9CF1A923E9503E2EB70@iahce2ksrv1.iah.bbsrc.ac.uk>
	<6dce9a0b0702151053v19ab190fh1f752fea3b2ed722@mail.gmail.com>
Message-ID: <8975119BCD0AC5419D61A9CF1A923E9503E2EBE3@iahce2ksrv1.iah.bbsrc.ac.uk>

In fact, those pad_left and pad_right arguments have no effect
whatsoever (using bioperl 1.5.2_100)
 
 my $panel = Bio::Graphics::Panel->new(-key_style => between,
     -offset    => $start,
     -length    => $stop - $start + 1,
     -width     => 800
     -pad_left =>5000,
     -pad_right =>5000
     );

Even if I set them to 5000, the image looks exactly as if I had not set
them.
 
The only way I can get around this is to edit Glyph/dna.pm lines 184 and
186 such that $x2+3 is changed to $x2-20 - then the axes are drawn on
the image instead of outside of it.   This is obviously a hack, which
upsets my karma.
 
Mick

________________________________

From: lincoln.stein at gmail.com [mailto:lincoln.stein at gmail.com] On Behalf
Of Lincoln Stein
Sent: 15 February 2007 18:53
To: michael watson (IAH-C)
Cc: BioPerl-List
Subject: Re: [Bioperl-l] The axis of GC content in
Bio::Graphics::glyph:dna


Hi Michael,

When you set up the panel, do this:

 Bio::Graphics::Panel->new(-blah -blah,
                                         -pad_left => 20,
                                          -pad_right => 20); 

This will leave enough room on the left and right for you to see the Y
axis. Otherwise it runs off the edge of the image (ok, this is a
mis-design, but it was the only way to solve a chicken-and-egg problem
about who gets to say how wide the panel is) 

Lincoln


On 2/15/07, michael watson (IAH-C) <michael.watson at bbsrc.ac.uk> wrote: 

	Hi
	
	OK I have some great images out of this glyph, but I can't see
the axis,
	and nor is it labelled (ie does it go from 0 - 100%?) so isn't
great for
	publication.  The docs say:
	
	"NOTE: -gc_window=>'auto' gives nice results and is recommended
for 
	drawing GC content. The GC content axes draw slightly outside
the
	panel, so you may wish to add some extra padding on the right
and
	left. "
	
	Any idea how to do this?
	
	Basically, I want a nice GC graph with the axis quite clearly
labelled, 
	and a nice "%GC" title next to it :)
	
	Thanks
	
	Mick
	
	The information contained in this message may be confidential or
legally
	privileged and is intended solely for the addressee. If you have

	received this message in error please delete it & notify the
originator
	immediately.
	Unauthorised use, disclosure, copying or alteration of this
message is
	forbidden & may be unlawful.
	The contents of this e-mail are the views of the sender and do
not 
	necessarily represent the views of the Institute.
	This email and associated attachments has been checked locally
for
	viruses but we can accept no responsibility once it has left our
	systems.
	Communications on Institute computers are monitored to secure
the 
	effective operation of the systems and for other lawful
purposes.
	
	_______________________________________________
	Bioperl-l mailing list
	Bioperl-l at lists.open-bio.org 
	http://lists.open-bio.org/mailman/listinfo/bioperl-l
	




-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory 
1 Bungtown Road
Cold Spring Harbor, NY 11724
(516) 367-8380 (voice)
(516) 367-8389 (fax)
FOR URGENT MESSAGES & SCHEDULING, 
PLEASE CONTACT MY ASSISTANT, 
SANDRA MICHELSEN, AT michelse at cshl.edu 


From michael.watson at bbsrc.ac.uk  Thu Mar  1 06:01:39 2007
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Thu, 1 Mar 2007 11:01:39 -0000
Subject: [Bioperl-l] The axis of GC content in Bio::Graphics::glyph:dna
In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E9503E2EBE3@iahce2ksrv1.iah.bbsrc.ac.uk>
References: <8975119BCD0AC5419D61A9CF1A923E9503E2EB70@iahce2ksrv1.iah.bbsrc.ac.uk>
	<6dce9a0b0702151053v19ab190fh1f752fea3b2ed722@mail.gmail.com>
	<8975119BCD0AC5419D61A9CF1A923E9503E2EBE3@iahce2ksrv1.iah.bbsrc.ac.uk>
Message-ID: <8975119BCD0AC5419D61A9CF1A923E9503E2EBE4@iahce2ksrv1.iah.bbsrc.ac.uk>

On further inspection, the lack of a comma was causing my karma upset -
apologies.
 
Mick

________________________________

From: michael watson (IAH-C) 
Sent: 01 March 2007 10:58
To: 'lincoln.stein at gmail.com'
Cc: BioPerl-List
Subject: RE: [Bioperl-l] The axis of GC content in
Bio::Graphics::glyph:dna


In fact, those pad_left and pad_right arguments have no effect
whatsoever (using bioperl 1.5.2_100)
 
 my $panel = Bio::Graphics::Panel->new(-key_style => between,
     -offset    => $start,
     -length    => $stop - $start + 1,
     -width     => 800
     -pad_left =>5000,
     -pad_right =>5000
     );

Even if I set them to 5000, the image looks exactly as if I had not set
them.
 
The only way I can get around this is to edit Glyph/dna.pm lines 184 and
186 such that $x2+3 is changed to $x2-20 - then the axes are drawn on
the image instead of outside of it.   This is obviously a hack, which
upsets my karma.
 
Mick

________________________________

From: lincoln.stein at gmail.com [mailto:lincoln.stein at gmail.com] On Behalf
Of Lincoln Stein
Sent: 15 February 2007 18:53
To: michael watson (IAH-C)
Cc: BioPerl-List
Subject: Re: [Bioperl-l] The axis of GC content in
Bio::Graphics::glyph:dna


Hi Michael,

When you set up the panel, do this:

 Bio::Graphics::Panel->new(-blah -blah,
                                         -pad_left => 20,
                                          -pad_right => 20); 

This will leave enough room on the left and right for you to see the Y
axis. Otherwise it runs off the edge of the image (ok, this is a
mis-design, but it was the only way to solve a chicken-and-egg problem
about who gets to say how wide the panel is) 

Lincoln


On 2/15/07, michael watson (IAH-C) <michael.watson at bbsrc.ac.uk> wrote: 

	Hi
	
	OK I have some great images out of this glyph, but I can't see
the axis,
	and nor is it labelled (ie does it go from 0 - 100%?) so isn't
great for
	publication.  The docs say:
	
	"NOTE: -gc_window=>'auto' gives nice results and is recommended
for 
	drawing GC content. The GC content axes draw slightly outside
the
	panel, so you may wish to add some extra padding on the right
and
	left. "
	
	Any idea how to do this?
	
	Basically, I want a nice GC graph with the axis quite clearly
labelled, 
	and a nice "%GC" title next to it :)
	
	Thanks
	
	Mick
	
	The information contained in this message may be confidential or
legally
	privileged and is intended solely for the addressee. If you have

	received this message in error please delete it & notify the
originator
	immediately.
	Unauthorised use, disclosure, copying or alteration of this
message is
	forbidden & may be unlawful.
	The contents of this e-mail are the views of the sender and do
not 
	necessarily represent the views of the Institute.
	This email and associated attachments has been checked locally
for
	viruses but we can accept no responsibility once it has left our
	systems.
	Communications on Institute computers are monitored to secure
the 
	effective operation of the systems and for other lawful
purposes.
	
	_______________________________________________
	Bioperl-l mailing list
	Bioperl-l at lists.open-bio.org 
	http://lists.open-bio.org/mailman/listinfo/bioperl-l
	




-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory 
1 Bungtown Road
Cold Spring Harbor, NY 11724
(516) 367-8380 (voice)
(516) 367-8389 (fax)
FOR URGENT MESSAGES & SCHEDULING, 
PLEASE CONTACT MY ASSISTANT, 
SANDRA MICHELSEN, AT michelse at cshl.edu 


From heikki at sanbi.ac.za  Thu Mar  1 06:02:30 2007
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Thu, 1 Mar 2007 13:02:30 +0200
Subject: [Bioperl-l] Bio::SeqIO::FTHelper
In-Reply-To: <D6922F04-A349-41C4-B4DC-6763E3195B05@uiuc.edu>
References: <D6922F04-A349-41C4-B4DC-6763E3195B05@uiuc.edu>
Message-ID: <200703011302.30855.heikki@sanbi.ac.za>

Chris,

It was meant to collect code that was common to all three main databases using 
similar feature tables.

Now might be the time to optimise the parsing speed by removing it. Do you 
have a plan how to do it?

	-Heikki

On Tuesday 27 February 2007 22:57:40 Chris Fields wrote:
> Could anyone tell me what FTHelper is used for?  From what I gather
> it rolls up seqfeature data into a lightweight object but then
> creates a SeqFeature::Generic anyway (at least for GenBank/EMBL/
> Swiss), which seems to be a waste of memory and time.  Is there
> something I'm missing (besides my sanity of course)?
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________

From lubapardo at gmail.com  Thu Mar  1 09:47:23 2007
From: lubapardo at gmail.com (Luba Pardo)
Date: Thu, 1 Mar 2007 15:47:23 +0100
Subject: [Bioperl-l] (no subject)
Message-ID: <58ff33550703010647j1e7908f3sf3c01a74eeceaca4@mail.gmail.com>

Dear all,
Sorry if the questions is too basic but I am trying to learn BioPerl
modules. So I am trying to get the CDS sequence from a gi identification
protein using the "features" method. I started to run the example of the FAQ
doc (How do I retrieve a nucleotide coding sequence when I have a protein gi
number?)  , but I can not get the script to run.
the script is:

use Bio::Factory::FTLocationFactory;
use Bio::DB::GenPept;
use Bio::DB::GenBank;

my $gp = Bio::DB::GenPept->new;
my $gb = Bio::DB::GenBank->new;
# factory to turn strings into Bio::Location objects
my $loc_factory = Bio::Factory::FTLocationFactory->new;
my $protein_gi = '405830';
my $prot_obj = $gp->get_Seq_by_id($protein_gi);;
foreach my $feat ( $prot_obj->top_SeqFeatures ) {
   if ( $feat->primary_tag eq 'CDS' ) {
   # example: 'coded_by="U05729.1:1..122"'
   my @coded_by = $feat->each_tag_value('coded_by');
   my ($nuc_acc,$loc_str) = split /\:/, $coded_by[0];
   my $nuc_obj = $gb->get_Seq_by_acc($nuc_acc);
   # create Bio::Location object from a string
   my $loc_object = $loc_factory->from_string($loc_str);
   # create a Feature object by using a Location
   my $feat_obj = Bio::SeqFeature::Generic->new(-location =>$loc_object);
   # associate the Feature object with the nucleotide Seq object
   $nuc_obj->add_SeqFeature($feat_obj);
    my $cds_obj = $feat_obj->spliced_seq;
    print "CDS sequence is ",$cds_obj->seq,"\n";
   }
}

The error I got is

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Must specify a query or list of uids to fetch
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/lib/perl5/site_perl/5.8.1/Bio/Root/Root.pm:359
STACK: Bio::DB::NCBIHelper::get_request
/usr/lib/perl5/site_perl/5.8.1/Bio/DB/NCBIHelper.pm:192
STACK: Bio::DB::WebDBSeqI::get_seq_stream
/usr/lib/perl5/site_perl/5.8.1/Bio/DB/WebDBSeqI.pm:432
STACK: Bio::DB::NCBIHelper::get_Stream_by_acc
/usr/lib/perl5/site_perl/5.8.1/Bio/DB/NCBIHelper.pm:361
STACK: Bio::DB::WebDBSeqI::get_Seq_by_acc
/usr/lib/perl5/site_perl/5.8.1/Bio/DB/WebDBSeqI.pm:172
STACK: feature1.pl:16


But I can not see where part of the script is that I have to specify a list
of gi. That very odd. Am I interpreting the script wrong? I also tried :
get_Seq_by_acc



------------- EXCEPTION: Bio::Root::Exception -------------
MSG: acc complement(join(AL593843.9 does not exist
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/lib/perl5/site_perl/5.8.1/Bio/Root/Root.pm:359
STACK: Bio::DB::WebDBSeqI::get_Seq_by_acc
/usr/lib/perl5/site_perl/5.8.1/Bio/DB/WebDBSeqI.pm:181
STACK: feature1.pl:16

Can anyone let me know what am I doing wromg?

Thank you very much in advance

L. Pardo

From jay at jays.net  Thu Mar  1 10:51:38 2007
From: jay at jays.net (Jay Hannah)
Date: Thu, 1 Mar 2007 09:51:38 -0600 (CST)
Subject: [Bioperl-l] Enhance Bio::PrimarySeqI::trunc() for
	Bio::Location::Split ?
Message-ID: <Pine.LNX.4.64.0703010907370.27396@ferret.jays.net>

In my GenBank files when I'm sitting on a CDS usually I can just call

    $feature->seq->seq;

and out pops the exact nucleotide sequence which codes my protein. Very 
cool.

Unfortunately, I have a crazy GenBank file which contains a CDS with a 
split range like this:  CDS join(1959..2355,1..92)

When I try to use $feature->seq->seq I don't end up with just the properly 
pieced together coding region, I end up with the *entire* nucleotide 
sequence.

This seems to be happening because

   Bio::SeqFeature::Generic::seq
   506:  my $seq = $self->{'_gsf_seq'}->trunc($self->start(), $self->end());
   (which is calling Bio::PrimarySeqI::trunc)

works fine when Bio::SeqFeature::Generic is using

    '_location' => Bio::Location::Simple=HASH(0x1804344)
       '_end' => 2842
       '_location_type' => 'EXACT'
       '_root_verbose' => 0
       '_seqid' => 'AE015930'
       '_start' => 1601
       '_strand' => 1

but when things get complicated and Bio::SeqFeature::Generic is using

    '_location' => Bio::Location::Split=HASH(0x1d1f130)
       '_seqid' => 'PNECG'
       '_splittype' => 'JOIN'
       '_sublocations' => ARRAY(0x1d1e654)
          0  Bio::Location::Simple=HASH(0x1d1f290)
             '_end' => 2355
             '_location_type' => 'EXACT'
             '_root_verbose' => 0
             '_seqid' => 'PNECG'
             '_start' => 1959
             '_strand' => 1
          1  Bio::Location::Simple=HASH(0x1d1f338)
             '_end' => 92
             '_location_type' => 'EXACT'
             '_root_verbose' => 0
             '_seqid' => 'PNECG'
             '_start' => 1
             '_strand' => 1

Simply passing $self->start and $self->end into trunc() will not pull 
off the appropriate magic.

Question 1: Perhaps my data was bad and I should refuse to process 
join(1959..2355,1..92)? My accession is M12730, and if I download that 
from NCBI now it looks like they've changed it so my problem no longer 
exists in that sequence anyway. There are already 71 examples of CDS join 
in various files in t/data, and *none* of those examples jump backwards. 
Should I write this off as bad data or try to enhance BioPerl? I'm happy 
to throw my painful M12730 on the end of t/data/test.genbank and write 
tests for it if anyone thinks it is important.

Question 2: Even if we can just ignore my M12730, though, I think there's 
still a problem afoot. Below I demo L26462 (already siting in 
t/data/test.genbank) which has a

    CDS join(866..957,1088..1310,2161..2289)

In this case (as my tests below demonstrate), $feature->seq->seq is 
pulling the right range of nucleotide, but it's also pulling the gaps 
(introns). Isn't that wrong? Shouldn't it skip the introns?

So... is the appropriate approach to try to enhance 
Bio::PrimarySeqI::trunc() for Bio::Location::Split? Or should trunc() be 
left alone and Bio::SeqFeature::Generic::seq() needs to get smarter?

Or...?

Thanks, oh mighty BioWizards!  :)

j
seqlab.net
http://www.bioperl.org/wiki/User:Jhannah



-----------------
Tack this on the end of t/genbank.t and the length test at the end fails:
-----------------
# Enhance Bio::PrimarySeqI::trunc() for Bio::Location::Split ?
my $stream = Bio::SeqIO->new(-file => Bio::Root::IO->catfile
                                       ("t","data","test.genbank"),
                                       -verbose => $verbose,
                              -format => 'genbank');
my $seq = $stream->next_seq;
while ($seq->accession ne "M37762") {
    $seq = $stream->next_seq;
}
# M37762 has a CDS 76..819, which should work fine.
ok(my @features = $seq->get_SeqFeatures(), "get_SeqFeatures()");
my $feat;
foreach my $feat2 ( @features ) {
    next unless ($feat2->primary_tag eq "CDS");
    my @db_xrefs = $feat2->annotation->get_Annotations("db_xref");
    if (grep { $_ eq "GI:179403" } @db_xrefs) {
       $feat = $feat2;
       last;
    }
}
my ($protein_seq) = $feat->annotation->get_Annotations("translation");
ok($protein_seq    =~ /^MTILFLTMVISYFGCMKA.*GWRFIRIDTSCVCTLTIKRGR$/,   "protein sequence");
my ($nucleotide_seq) = $feat->seq->seq;
ok($nucleotide_seq =~ /^ATGACCATCCTTTTCCTT.*ACCATTAAAAGGGGAAGATAG$/,   "nucleotide sequence");
is(length($nucleotide_seq), 744,                                       "nucleotide length");

# Jump down to L26462 which has a CDS join(866..957,1088..1310,2161..2289), which is broken?
while ($seq->accession ne "L26462") {
    $seq = $stream->next_seq;
}
ok(my @features = $seq->get_SeqFeatures(), "get_SeqFeatures()");
my $feat;
foreach my $feat2 ( @features ) {
    next unless ($feat2->primary_tag eq "CDS");
    my @db_xrefs = $feat2->annotation->get_Annotations("db_xref");
    if (grep { $_ eq "GI:532506" } @db_xrefs) {
       $feat = $feat2;
       last;
    }
}
my ($protein_seq) = $feat->annotation->get_Annotations("translation");
ok($protein_seq    =~ /^MVHLTPEEKSAVTALWGK.*VQAAYQKVVAGVANALAHKYH$/,   "protein sequence");
my ($nucleotide_seq) = $feat->seq->seq;
ok($nucleotide_seq =~ /^ATGGTGCATCTGACTCCT.*CTGGCCCACAAGTATCACTAA$/,   "nucleotide sequence - correct CDS range");
#print "[$nucleotide_seq]\n";
ok($nucleotide_seq !~ /^ACCTCCTATTTGACACCA.*TGCTAGTCTCCCGGAACTATC$/,   "nucleotide sequence - full nucleotide should not match");
is(length($nucleotide_seq), 444,                                       "nucleotide length");

# I have an old(?) version of M12730 which lists
#    CDS join(1959..2355,1..92)
#    /db_xref="GI:150830"
# Crazy ranges like that don't work at all, you end up with the full nucleotide sequence...
# But NCBI doesn't list M12730 that way any more, so now I would be OK?

# ------------------


From cjfields at uiuc.edu  Thu Mar  1 10:24:03 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 1 Mar 2007 09:24:03 -0600
Subject: [Bioperl-l] Bio::SeqIO::FTHelper
In-Reply-To: <200703011302.30855.heikki@sanbi.ac.za>
References: <D6922F04-A349-41C4-B4DC-6763E3195B05@uiuc.edu>
	<200703011302.30855.heikki@sanbi.ac.za>
Message-ID: <8AA2B586-4C2B-4379-BFF0-0CEB15FAE68E@uiuc.edu>

I do have a rough outline of what I think could be done:

http://www.bioperl.org/wiki/Handler-based_SeqIO_parsers

where you could switch out handlers to deal with incoming data  
chunks.  Any suggestions there are welcome.

I'll probably commit examples of the above in the next week or two  
(GenBank, EMBL, Swiss parsers using the same handlers) which don't  
use FTHelper.  So far I have all three passing tests based on genbank/ 
embl/swiss.t but they need a few more tweaks before I commit.

chris

On Mar 1, 2007, at 5:02 AM, Heikki Lehvaslaiho wrote:

> Chris,
>
> It was meant to collect code that was common to all three main  
> databases using
> similar feature tables.
>
> Now might be the time to optimise the parsing speed by removing it.  
> Do you
> have a plan how to do it?
>
> 	-Heikki
>
> On Tuesday 27 February 2007 22:57:40 Chris Fields wrote:
>> Could anyone tell me what FTHelper is used for?  From what I gather
>> it rolls up seqfeature data into a lightweight object but then
>> creates a SeqFeature::Generic anyway (at least for GenBank/EMBL/
>> Swiss), which seems to be a waste of memory and time.  Is there
>> something I'm missing (besides my sanity of course)?
>>
>> chris
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> -- 
> ______ _/      _/_____________________________________________________
>       _/      _/
>      _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
>     _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
>    _/  _/  _/  SANBI, South African National Bioinformatics Institute
>   _/  _/  _/  University of Western Cape, South Africa
>      _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
> ___ _/_/_/_/_/________________________________________________________
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From cjfields at uiuc.edu  Thu Mar  1 10:57:02 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 1 Mar 2007 09:57:02 -0600
Subject: [Bioperl-l] Enhance Bio::PrimarySeqI::trunc() for
	Bio::Location::Split ?
In-Reply-To: <Pine.LNX.4.64.0703010907370.27396@ferret.jays.net>
References: <Pine.LNX.4.64.0703010907370.27396@ferret.jays.net>
Message-ID: <A23A3595-98E0-4628-8F56-BFC589AC90CF@uiuc.edu>

Jay,

Have you tried using $feature->spliced_seq() instead of seq()?  Using  
seq() retrieves the full sequence for the split location (from start  
of first sublocation to end of last), while spliced_seq() splices the  
sublocation sequences together, which is what I think you want.

chris

On Mar 1, 2007, at 9:51 AM, Jay Hannah wrote:

> In my GenBank files when I'm sitting on a CDS usually I can just call
>
>     $feature->seq->seq;
>
> and out pops the exact nucleotide sequence which codes my protein.  
> Very
> cool.
>
> Unfortunately, I have a crazy GenBank file which contains a CDS with a
> split range like this:  CDS join(1959..2355,1..92)
>
> When I try to use $feature->seq->seq I don't end up with just the  
> properly
> pieced together coding region, I end up with the *entire* nucleotide
> sequence.
>
> This seems to be happening because
>
>    Bio::SeqFeature::Generic::seq
>    506:  my $seq = $self->{'_gsf_seq'}->trunc($self->start(), $self- 
> >end());
>    (which is calling Bio::PrimarySeqI::trunc)
>
> works fine when Bio::SeqFeature::Generic is using
>
>     '_location' => Bio::Location::Simple=HASH(0x1804344)
>        '_end' => 2842
>        '_location_type' => 'EXACT'
>        '_root_verbose' => 0
>        '_seqid' => 'AE015930'
>        '_start' => 1601
>        '_strand' => 1
>
> but when things get complicated and Bio::SeqFeature::Generic is using
>
>     '_location' => Bio::Location::Split=HASH(0x1d1f130)
>        '_seqid' => 'PNECG'
>        '_splittype' => 'JOIN'
>        '_sublocations' => ARRAY(0x1d1e654)
>           0  Bio::Location::Simple=HASH(0x1d1f290)
>              '_end' => 2355
>              '_location_type' => 'EXACT'
>              '_root_verbose' => 0
>              '_seqid' => 'PNECG'
>              '_start' => 1959
>              '_strand' => 1
>           1  Bio::Location::Simple=HASH(0x1d1f338)
>              '_end' => 92
>              '_location_type' => 'EXACT'
>              '_root_verbose' => 0
>              '_seqid' => 'PNECG'
>              '_start' => 1
>              '_strand' => 1
>
> Simply passing $self->start and $self->end into trunc() will not pull
> off the appropriate magic.
>
> Question 1: Perhaps my data was bad and I should refuse to process
> join(1959..2355,1..92)? My accession is M12730, and if I download that
> from NCBI now it looks like they've changed it so my problem no longer
> exists in that sequence anyway. There are already 71 examples of  
> CDS join
> in various files in t/data, and *none* of those examples jump  
> backwards.
> Should I write this off as bad data or try to enhance BioPerl? I'm  
> happy
> to throw my painful M12730 on the end of t/data/test.genbank and write
> tests for it if anyone thinks it is important.
>
> Question 2: Even if we can just ignore my M12730, though, I think  
> there's
> still a problem afoot. Below I demo L26462 (already siting in
> t/data/test.genbank) which has a
>
>     CDS join(866..957,1088..1310,2161..2289)
>
> In this case (as my tests below demonstrate), $feature->seq->seq is
> pulling the right range of nucleotide, but it's also pulling the gaps
> (introns). Isn't that wrong? Shouldn't it skip the introns?
>
> So... is the appropriate approach to try to enhance
> Bio::PrimarySeqI::trunc() for Bio::Location::Split? Or should trunc 
> () be
> left alone and Bio::SeqFeature::Generic::seq() needs to get smarter?
>
> Or...?
>
> Thanks, oh mighty BioWizards!  :)
>
> j
> seqlab.net
> http://www.bioperl.org/wiki/User:Jhannah
>
>
>
> -----------------
> Tack this on the end of t/genbank.t and the length test at the end  
> fails:
> -----------------
> # Enhance Bio::PrimarySeqI::trunc() for Bio::Location::Split ?
> my $stream = Bio::SeqIO->new(-file => Bio::Root::IO->catfile
>                                        ("t","data","test.genbank"),
>                                        -verbose => $verbose,
>                               -format => 'genbank');
> my $seq = $stream->next_seq;
> while ($seq->accession ne "M37762") {
>     $seq = $stream->next_seq;
> }
> # M37762 has a CDS 76..819, which should work fine.
> ok(my @features = $seq->get_SeqFeatures(), "get_SeqFeatures()");
> my $feat;
> foreach my $feat2 ( @features ) {
>     next unless ($feat2->primary_tag eq "CDS");
>     my @db_xrefs = $feat2->annotation->get_Annotations("db_xref");
>     if (grep { $_ eq "GI:179403" } @db_xrefs) {
>        $feat = $feat2;
>        last;
>     }
> }
> my ($protein_seq) = $feat->annotation->get_Annotations("translation");
> ok($protein_seq    =~ /^MTILFLTMVISYFGCMKA.*GWRFIRIDTSCVCTLTIKRGR 
> $/,   "protein sequence");
> my ($nucleotide_seq) = $feat->seq->seq;
> ok($nucleotide_seq =~ /^ATGACCATCCTTTTCCTT.*ACCATTAAAAGGGGAAGATAG 
> $/,   "nucleotide sequence");
> is(length($nucleotide_seq),  
> 744,                                       "nucleotide length");
>
> # Jump down to L26462 which has a CDS join 
> (866..957,1088..1310,2161..2289), which is broken?
> while ($seq->accession ne "L26462") {
>     $seq = $stream->next_seq;
> }
> ok(my @features = $seq->get_SeqFeatures(), "get_SeqFeatures()");
> my $feat;
> foreach my $feat2 ( @features ) {
>     next unless ($feat2->primary_tag eq "CDS");
>     my @db_xrefs = $feat2->annotation->get_Annotations("db_xref");
>     if (grep { $_ eq "GI:532506" } @db_xrefs) {
>        $feat = $feat2;
>        last;
>     }
> }
> my ($protein_seq) = $feat->annotation->get_Annotations("translation");
> ok($protein_seq    =~ /^MVHLTPEEKSAVTALWGK.*VQAAYQKVVAGVANALAHKYH 
> $/,   "protein sequence");
> my ($nucleotide_seq) = $feat->seq->seq;
> ok($nucleotide_seq =~ /^ATGGTGCATCTGACTCCT.*CTGGCCCACAAGTATCACTAA 
> $/,   "nucleotide sequence - correct CDS range");
> #print "[$nucleotide_seq]\n";
> ok($nucleotide_seq !~ /^ACCTCCTATTTGACACCA.*TGCTAGTCTCCCGGAACTATC 
> $/,   "nucleotide sequence - full nucleotide should not match");
> is(length($nucleotide_seq),  
> 444,                                       "nucleotide length");
>
> # I have an old(?) version of M12730 which lists
> #    CDS join(1959..2355,1..92)
> #    /db_xref="GI:150830"
> # Crazy ranges like that don't work at all, you end up with the  
> full nucleotide sequence...
> # But NCBI doesn't list M12730 that way any more, so now I would be  
> OK?
>
> # ------------------



From sac at bioperl.org  Thu Mar  1 11:30:59 2007
From: sac at bioperl.org (Steve Chervitz)
Date: Thu, 1 Mar 2007 09:30:59 -0700
Subject: [Bioperl-l] [Bioperl-announce-l] BioPerl leadership additions
In-Reply-To: <41922044-0BDA-4F29-B045-5E544A4F679F@bioperl.org>
References: <41922044-0BDA-4F29-B045-5E544A4F679F@bioperl.org>
Message-ID: <000101c75c1e$fecb7770$6400a8c0@CodonSolutions.local>

Welcome to the club, Chris & Sendu. Always good to have an infusion of new
blood and capable, motivated hands.

Steve

On 2/26/07, Jason Stajich <jason at bioperl.org> wrote:
>
> Dear BioPerl Users and Developers,
>
> I want to announce a addition in the leadership of BioPerl.
> Christopher Fields and and Sendu Bala are now members of the BioPerl
> Core developer group to recognize their ongoing leadership in the
> project.  Chris and Sendu were instrumental in the 1.5.2 Developer
> release and have made a significant commitment and contribution to
> the quality of the code and the documentation of the project.  We
> have invited them to be part of the core to recognize their work and
> to feel comfortable to ask them to do more. ;-)
>
> The Core group was established to insure that someone was responsible
> for making code releases, vetting new developers for CVS write
> accounts, and generally dealing with things that might otherwise slip
> through the cracks.  We are very excited to have more people
> contributing to and maintaining the toolkit.  We look forward to
> their help along with all the other developers, as we work towards a
> 1.6 release release this year.
>
> As always, while their is a need for some individuals to lead the
> project, we encourage contributions from all levels of expertise to
> improve the code, documentation, and tutorials of the project.
>
> We plan to discuss the progress of the toolkit at this year's
> Bioinformatics Open Source Conference held in Vienna, Austria in
> conjunction with the SIG meetings at ISMB.   We are trying to use
> BOSC 2007 as a chance for the developers of Open Bioinformatics
> Foundation sponsored and related projects to coordinate future
> development and release cycles.
>
> Jason Stajich on behalf of the Core developers
>
> _______________________________________________
> Bioperl-announce-l mailing list
> Bioperl-announce-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-announce-l
>
_______________________________________________
Bioperl-announce-l mailing list
Bioperl-announce-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-announce-l


From arareko at campus.iztacala.unam.mx  Thu Mar  1 11:30:59 2007
From: arareko at campus.iztacala.unam.mx (Mauricio Herrera Cuadra)
Date: Thu, 1 Mar 2007 09:30:59 -0700
Subject: [Bioperl-l] [Bioperl-announce-l]  BioPerl leadership additions
In-Reply-To: <41922044-0BDA-4F29-B045-5E544A4F679F@bioperl.org>
References: <41922044-0BDA-4F29-B045-5E544A4F679F@bioperl.org>
Message-ID: <000001c75c1e$fec90670$6400a8c0@CodonSolutions.local>

Congrats Chris & Sendu! Very well-deserved. Keep up the great work.

Cheers!
Mauricio.

Jason Stajich wrote:
> Dear BioPerl Users and Developers,
> 
> I want to announce a addition in the leadership of BioPerl.   
> Christopher Fields and and Sendu Bala are now members of the BioPerl  
> Core developer group to recognize their ongoing leadership in the  
> project.  Chris and Sendu were instrumental in the 1.5.2 Developer  
> release and have made a significant commitment and contribution to  
> the quality of the code and the documentation of the project.  We  
> have invited them to be part of the core to recognize their work and  
> to feel comfortable to ask them to do more. ;-)
> 
> The Core group was established to insure that someone was responsible  
> for making code releases, vetting new developers for CVS write  
> accounts, and generally dealing with things that might otherwise slip  
> through the cracks.  We are very excited to have more people  
> contributing to and maintaining the toolkit.  We look forward to  
> their help along with all the other developers, as we work towards a  
> 1.6 release release this year.
> 
> As always, while their is a need for some individuals to lead the  
> project, we encourage contributions from all levels of expertise to  
> improve the code, documentation, and tutorials of the project.
> 
> We plan to discuss the progress of the toolkit at this year's  
> Bioinformatics Open Source Conference held in Vienna, Austria in  
> conjunction with the SIG meetings at ISMB.   We are trying to use  
> BOSC 2007 as a chance for the developers of Open Bioinformatics  
> Foundation sponsored and related projects to coordinate future  
> development and release cycles.
> 
> Jason Stajich on behalf of the Core developers
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 

-- 
MAURICIO HERRERA CUADRA
arareko at campus.iztacala.unam.mx
Laboratorio de Gen?tica
Unidad de Morfofisiolog?a y Funci?n
Facultad de Estudios Superiores Iztacala, UNAM

_______________________________________________
Bioperl-announce-l mailing list
Bioperl-announce-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-announce-l



From johnsonm at gmail.com  Thu Mar  1 11:49:20 2007
From: johnsonm at gmail.com (Mark Johnson)
Date: Thu, 1 Mar 2007 10:49:20 -0600
Subject: [Bioperl-l] Issues with new Bio::Tools::Run modules for
	Genemark and Glimmer
In-Reply-To: <EE9CB4BA-3C6C-4F38-85DB-E0A21FCD8B07@gmx.net>
References: <ebf5eb170702281159y7dcedd88n7bdef2c8bb9d3288@mail.gmail.com>
	<894754FB-2B20-415F-A6FC-7ACE839C6540@uiuc.edu>
	<ebf5eb170702281454i52cea9eeqbcaebee5e4ec5e0e@mail.gmail.com>
	<EE9CB4BA-3C6C-4F38-85DB-E0A21FCD8B07@gmx.net>
Message-ID: <ebf5eb170703010849x3605adfcsf710516e07076eaf@mail.gmail.com>

On 2/28/07, Hilmar Lapp <hlapp at gmx.net> wrote:
>
>
> I'm not sure how the user would be able to take out the child hitting
> ctrl-c if you run it through system() (except if the parent
> terminates first - but maybe then terminating a run-away child is in
> good order).


Quoting the perlfunc docs on system:

 Since "SIGINT" and "SIGQUIT" are ignored during the execution
               of "system", if you expect your program to terminate on
receipt
               of these signals you will need to arrange to do so yourself
               based on the return value.

                   @args = ("command", "arg1", "arg2");
                   system(@args) == 0
                        or die "system @args failed: $?"

               You can check all the failure possibilities by inspecting $?
               like this:

                   if ($? == -1) {
                       print "failed to execute: $!\n";
                   }
                   elsif ($? & 127) {
                       printf "child died with signal %d, %s coredump\n",
                           ($? & 127),  ($? & 128) ? 'with' : 'without';
                   }
                   else {
                       printf "child exited with value %d\n", $? >> 8;
                   }

               or more portably by using the W*() calls of the POSIX exten?
               sion; see perlport for more information.

               When the arguments get executed via the system shell, results
               and return codes will be subject to its quirks and capabili?
               ties.  See "'STRING'" in perlop and "exec" for details.

So, during a call to system(), a CTRL-C (SIGINT) won't take out the parent,
but it will take out the child, unless the child has caught it and handled
it.  If you don't care why the child failed, just that it did, I suppose the
distinction is a subtle one.


> I haven't read the IPC::run POD in full detail but you will want to
> make sure that if the parent gets killed the child does get killed
> too, or otherwise you'll have a run-away process that novices will
> have trouble with understanding or terminating.


I'll double check.


> Other than that though IPC::run seems like a useful module, so
> incurring this as a dependency should be fine.
>

From thiago.venancio at gmail.com  Thu Mar  1 13:02:14 2007
From: thiago.venancio at gmail.com (Thiago Venancio)
Date: Thu, 1 Mar 2007 15:02:14 -0300
Subject: [Bioperl-l] frac_aligned_query returning results >1.
Message-ID: <44255ea80703011002l245e9576s66319ee695d3bd5b@mail.gmail.com>

Hi all,

I have read a lot of threads regarding my issue, but still didn't get any
efficient answer yet.

I am with problems with frac_aligned_query(). It is returning  "> 1"
results.
I have just updated my SearhUtils.pm from:
http://code.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/Bio/Search/SearchUtils.pm


The problem persists and, additionally, I get several warnings like:

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Undefined sub-sequence (1507,1507) . Valid range = 1444 - 1507
STACK: Error::throw
STACK: Bio::Root::Root::throw /usr/share/perl5/Bio/Root/Root.pm:328
STACK: Bio::Search::HSP::HSPI::matches
/usr/share/perl5/Bio/Search/HSP/HSPI.pm:711
STACK: Bio::Search::SearchUtils::_adjust_contigs
/usr/share/perl5/Bio/Search/SearchUtils.pm:489
STACK: Bio::Search::SearchUtils::tile_hsps
/usr/share/perl5/Bio/Search/SearchUtils.pm:200
STACK: Bio::Search::Hit::GenericHit::frac_aligned_query
/usr/share/perl5/Bio/Search/Hit/GenericHit.pm:1145
STACK: ./geraStatGenome.pl:17

My code is pretty clean:

   while( my $hit = $result->next_hit ) {
    print
$result->query_name."\t".$hit->frac_aligned_query('query')."\t".$hit->frac_identical(
'query' )."\n";
    last;
    }


Thanks.

Thiago


-- 
"The way to get started is to quit talking and begin doing."
      Walt Disney

========================
Thiago Motta Venancio, MSc
PhD student in Bioinformatics
University of Sao Paulo
========================

From cjfields at uiuc.edu  Thu Mar  1 13:27:10 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 1 Mar 2007 12:27:10 -0600
Subject: [Bioperl-l] frac_aligned_query returning results >1.
In-Reply-To: <44255ea80703011002l245e9576s66319ee695d3bd5b@mail.gmail.com>
References: <44255ea80703011002l245e9576s66319ee695d3bd5b@mail.gmail.com>
Message-ID: <8D7B0767-46A6-4083-B94E-D6490B241B84@uiuc.edu>

This is related to a reported bug:

http://bugzilla.open-bio.org/show_bug.cgi?id=2193

The relevant code used to tile HSPs is a bit brittle and sometimes  
leads to errors like this.  The error (which is actually a thrown  
exception) is wrapped in an eval block and converted to a warn for  
that reason.  I'm not familiar with the tiling algorithm used, maybe  
Steve can add some input?

chris

On Mar 1, 2007, at 12:02 PM, Thiago Venancio wrote:

> Hi all,
>
> I have read a lot of threads regarding my issue, but still didn't  
> get any
> efficient answer yet.
>
> I am with problems with frac_aligned_query(). It is returning  "> 1"
> results.
> I have just updated my SearhUtils.pm from:
> http://code.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/ 
> Bio/Search/SearchUtils.pm
>
>
> The problem persists and, additionally, I get several warnings like:
>
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: Undefined sub-sequence (1507,1507) . Valid range = 1444 - 1507
> STACK: Error::throw
> STACK: Bio::Root::Root::throw /usr/share/perl5/Bio/Root/Root.pm:328
> STACK: Bio::Search::HSP::HSPI::matches
> /usr/share/perl5/Bio/Search/HSP/HSPI.pm:711
> STACK: Bio::Search::SearchUtils::_adjust_contigs
> /usr/share/perl5/Bio/Search/SearchUtils.pm:489
> STACK: Bio::Search::SearchUtils::tile_hsps
> /usr/share/perl5/Bio/Search/SearchUtils.pm:200
> STACK: Bio::Search::Hit::GenericHit::frac_aligned_query
> /usr/share/perl5/Bio/Search/Hit/GenericHit.pm:1145
> STACK: ./geraStatGenome.pl:17
>
> My code is pretty clean:
>
>    while( my $hit = $result->next_hit ) {
>     print
> $result->query_name."\t".$hit->frac_aligned_query('query')."\t". 
> $hit->frac_identical(
> 'query' )."\n";
>     last;
>     }
>
>
> Thanks.
>
> Thiago
>
>
> -- 
> "The way to get started is to quit talking and begin doing."
>       Walt Disney
>
> ========================
> Thiago Motta Venancio, MSc
> PhD student in Bioinformatics
> University of Sao Paulo
> ========================
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From Kevin.M.Brown at asu.edu  Thu Mar  1 13:28:22 2007
From: Kevin.M.Brown at asu.edu (Kevin Brown)
Date: Thu, 1 Mar 2007 11:28:22 -0700
Subject: [Bioperl-l] SVG output with Bio::Graphics::Panel fails
In-Reply-To: <45E5F43C.9080902@sendu.me.uk>
References: <45E5F43C.9080902@sendu.me.uk>
Message-ID: <1A4207F8295607498283FE9E93B775B402CC9D60@EX02.asurite.ad.asu.edu>

Are you certain that GD has SVG enabled in it?  Sounds like this error
is from outside the bioperl panel and is instead from GD and the GD perl
module. 

> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org 
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Sendu Bala
> Sent: Wednesday, February 28, 2007 2:30 PM
> To: bioperl list
> Cc: Lincoln Stein
> Subject: [Bioperl-l] SVG output with Bio::Graphics::Panel fails
> 
> I have GD 2.35 and GD::SVG 2.33 installed.
> 
> I have a working script in which a Bio::Graphics::Panel 
> object is made and output with:
> 
> print $panel->png;
> 
> This is fine. Changing it to:
> 
> print $panel->svg;
> 
> Gives the error:
> 
> Can't locate object method "svg" via package "GD:Image" at 
> /.../Bio/Graphics/Panel.pm line 971, <DATA> line 192.
> 
> 
> Am I supposed to do something else to get this to work?
> 
> 
> Cheers,
> Sendu.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 


From cjfields at uiuc.edu  Thu Mar  1 14:51:19 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 1 Mar 2007 13:51:19 -0600
Subject: [Bioperl-l] SVG output with Bio::Graphics::Panel fails
In-Reply-To: <1A4207F8295607498283FE9E93B775B402CC9D60@EX02.asurite.ad.asu.edu>
References: <45E5F43C.9080902@sendu.me.uk>
	<1A4207F8295607498283FE9E93B775B402CC9D60@EX02.asurite.ad.asu.edu>
Message-ID: <A0AB5FA0-078E-4B3D-BB21-EE7811A6CE60@uiuc.edu>

Does SVG output via GD still require GD::SVG (or SVG::GD, I can't  
remember which)?

chris

On Mar 1, 2007, at 12:28 PM, Kevin Brown wrote:

> Are you certain that GD has SVG enabled in it?  Sounds like this error
> is from outside the bioperl panel and is instead from GD and the GD  
> perl
> module.
..

From stefan.kirov at bms.com  Thu Mar  1 15:11:11 2007
From: stefan.kirov at bms.com (Stefan Kirov)
Date: Thu, 01 Mar 2007 15:11:11 -0500
Subject: [Bioperl-l] SVG output with Bio::Graphics::Panel fails
In-Reply-To: <A0AB5FA0-078E-4B3D-BB21-EE7811A6CE60@uiuc.edu>
References: <45E5F43C.9080902@sendu.me.uk>
	<1A4207F8295607498283FE9E93B775B402CC9D60@EX02.asurite.ad.asu.edu>
	<A0AB5FA0-078E-4B3D-BB21-EE7811A6CE60@uiuc.edu>
Message-ID: <45E7335F.8070102@bms.com>

Chris Fields wrote:
> Does SVG output via GD still require GD::SVG (or SVG::GD, I can't  
> remember which)?
>
> chris
>
> On Mar 1, 2007, at 12:28 PM, Kevin Brown wrote:
>
>   
>> Are you certain that GD has SVG enabled in it?  Sounds like this error
>> is from outside the bioperl panel and is instead from GD and the GD  
>> perl
>> module.
>>     
> ..
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>   
Guys, I think you missed parts of the discussion yesterday, it was the 
object constructor, which decides if it should use GD or GD::SVG...
Stefan

From cjfields at uiuc.edu  Thu Mar  1 15:14:41 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 1 Mar 2007 14:14:41 -0600
Subject: [Bioperl-l] SVG output with Bio::Graphics::Panel fails
In-Reply-To: <45E7335F.8070102@bms.com>
References: <45E5F43C.9080902@sendu.me.uk>
	<1A4207F8295607498283FE9E93B775B402CC9D60@EX02.asurite.ad.asu.edu>
	<A0AB5FA0-078E-4B3D-BB21-EE7811A6CE60@uiuc.edu>
	<45E7335F.8070102@bms.com>
Message-ID: <5D75FAFC-F71A-4528-8650-818C2CFC85FF@uiuc.edu>

Nope, I saw that.  I was just curious; I hadn't used GD in a while  
but will be soon...

chris

On Mar 1, 2007, at 2:11 PM, Stefan Kirov wrote:

> Chris Fields wrote:
>> Does SVG output via GD still require GD::SVG (or SVG::GD, I can't   
>> remember which)?
>>
>> chris
>>
>> On Mar 1, 2007, at 12:28 PM, Kevin Brown wrote:
>>
>>
>>> Are you certain that GD has SVG enabled in it?  Sounds like this  
>>> error
>>> is from outside the bioperl panel and is instead from GD and the  
>>> GD  perl
>>> module.
>>>
>> ..
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
> Guys, I think you missed parts of the discussion yesterday, it was  
> the object constructor, which decides if it should use GD or  
> GD::SVG...
> Stefan



From stefan.kirov at bms.com  Thu Mar  1 15:20:46 2007
From: stefan.kirov at bms.com (Stefan Kirov)
Date: Thu, 01 Mar 2007 15:20:46 -0500
Subject: [Bioperl-l] SVG output with Bio::Graphics::Panel fails
In-Reply-To: <45E7335F.8070102@bms.com>
References: <45E5F43C.9080902@sendu.me.uk>
	<1A4207F8295607498283FE9E93B775B402CC9D60@EX02.asurite.ad.asu.edu>
	<A0AB5FA0-078E-4B3D-BB21-EE7811A6CE60@uiuc.edu>
	<45E7335F.8070102@bms.com>
Message-ID: <45E7359E.5030104@bms.com>

Stefan Kirov wrote:
> Chris Fields wrote:
>   
>> Does SVG output via GD still require GD::SVG (or SVG::GD, I can't  
>> remember which)?
>>
>> chris
>>
>> On Mar 1, 2007, at 12:28 PM, Kevin Brown wrote:
>>
>>   
>>     
>>> Are you certain that GD has SVG enabled in it?  Sounds like this error
>>> is from outside the bioperl panel and is instead from GD and the GD  
>>> perl
>>> module.
>>>     
>>>       
>> ..
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>   
>>     
> Guys, I think you missed parts of the discussion yesterday, it was the 
> object constructor, which decides if it should use GD or GD::SVG...
> Stefan
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>   
OK, sorry..
In any case yes, it requires GD::SVG since the constructor instantiate 
GD::SVG object if you pass  -image_class=~'svg'
Stefan

From jay at jays.net  Thu Mar  1 16:15:03 2007
From: jay at jays.net (Jay Hannah)
Date: Thu, 1 Mar 2007 15:15:03 -0600 (CST)
Subject: [Bioperl-l] Enhance Bio::PrimarySeqI::trunc() for
 Bio::Location::Split ?
In-Reply-To: <A23A3595-98E0-4628-8F56-BFC589AC90CF@uiuc.edu>
References: <Pine.LNX.4.64.0703010907370.27396@ferret.jays.net>
	<A23A3595-98E0-4628-8F56-BFC589AC90CF@uiuc.edu>
Message-ID: <Pine.LNX.4.64.0703011503160.28477@ferret.jays.net>

On Thu, 1 Mar 2007, Chris Fields wrote:
> Have you tried using $feature->spliced_seq() instead of seq()?  Using
> seq() retrieves the full sequence for the split location (from start
> of first sublocation to end of last), while spliced_seq() splices the
> sublocation sequences together, which is what I think you want.

Genius. No wonder they promoted you into the core developer group. :)

Using this:
   my ($nucleotide_seq) = $feat->spliced_seq(-nosort => 1)->seq;

Gives me what I expected against these:

# M37762 CDS 76..819
# L26462 CDS join(866..957,1088..1310,2161..2289)
# M12730 CDS join(1959..2355,1..92)

I'm happy to submit my patches for t/genbank.t and t/data/test.genbank if 
that would make the universe a slightly better place. (...or 
t/SeqFeature.t or t/splicedseq.t, which appear to be the tests that have 
spliced_seq calls in them so far...)

Thanks!

j
seqlab.net
http://www.bioperl.org/wiki/User:Jhannah

From lstein at cshl.edu  Thu Mar  1 15:39:12 2007
From: lstein at cshl.edu (Lincoln Stein)
Date: Thu, 1 Mar 2007 15:39:12 -0500
Subject: [Bioperl-l] SVG output with Bio::Graphics::Panel fails
In-Reply-To: <45E7359E.5030104@bms.com>
References: <45E5F43C.9080902@sendu.me.uk>
	<1A4207F8295607498283FE9E93B775B402CC9D60@EX02.asurite.ad.asu.edu>
	<A0AB5FA0-078E-4B3D-BB21-EE7811A6CE60@uiuc.edu>
	<45E7335F.8070102@bms.com> <45E7359E.5030104@bms.com>
Message-ID: <6dce9a0b0703011239m7065a570l6d19e6c7065fca45@mail.gmail.com>

You need to have GD::SVG installed and then instantiate the panel with:
-image_class=>'GD::SVG'

Lincoln

On 3/1/07, Stefan Kirov <stefan.kirov at bms.com> wrote:
>
> Stefan Kirov wrote:
> > Chris Fields wrote:
> >
> >> Does SVG output via GD still require GD::SVG (or SVG::GD, I can't
> >> remember which)?
> >>
> >> chris
> >>
> >> On Mar 1, 2007, at 12:28 PM, Kevin Brown wrote:
> >>
> >>
> >>
> >>> Are you certain that GD has SVG enabled in it?  Sounds like this error
> >>> is from outside the bioperl panel and is instead from GD and the GD
> >>> perl
> >>> module.
> >>>
> >>>
> >> ..
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>
> >>
> >>
> > Guys, I think you missed parts of the discussion yesterday, it was the
> > object constructor, which decides if it should use GD or GD::SVG...
> > Stefan
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> OK, sorry..
> In any case yes, it requires GD::SVG since the constructor instantiate
> GD::SVG object if you pass  -image_class=~'svg'
> Stefan
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
(516) 367-8380 (voice)
(516) 367-8389 (fax)
FOR URGENT MESSAGES & SCHEDULING,
PLEASE CONTACT MY ASSISTANT,
SANDRA MICHELSEN, AT michelse at cshl.edu

From stefan.kirov at bms.com  Thu Mar  1 16:03:03 2007
From: stefan.kirov at bms.com (Stefan Kirov)
Date: Thu, 01 Mar 2007 16:03:03 -0500
Subject: [Bioperl-l] SVG output with Bio::Graphics::Panel fails
In-Reply-To: <6dce9a0b0703011239m7065a570l6d19e6c7065fca45@mail.gmail.com>
References: <45E5F43C.9080902@sendu.me.uk>
	<1A4207F8295607498283FE9E93B775B402CC9D60@EX02.asurite.ad.asu.edu>
	<A0AB5FA0-078E-4B3D-BB21-EE7811A6CE60@uiuc.edu>
	<45E7335F.8070102@bms.com> <45E7359E.5030104@bms.com>
	<6dce9a0b0703011239m7065a570l6d19e6c7065fca45@mail.gmail.com>
Message-ID: <45E73F87.1090104@bms.com>

Lincoln Stein wrote:
> You need to have GD::SVG installed and then instantiate the panel with:
> -image_class=>'GD::SVG'
>   
Yes, silly me I was looking at the code and did not realize that =~/svg/ 
is only to check, and the actual class name is taken of the arg list.
Sorry Chris.
Stefan
> Lincoln
>
> On 3/1/07, Stefan Kirov <stefan.kirov at bms.com> wrote:
>   
>> Stefan Kirov wrote:
>>     
>>> Chris Fields wrote:
>>>
>>>       
>>>> Does SVG output via GD still require GD::SVG (or SVG::GD, I can't
>>>> remember which)?
>>>>
>>>> chris
>>>>
>>>> On Mar 1, 2007, at 12:28 PM, Kevin Brown wrote:
>>>>
>>>>
>>>>
>>>>         
>>>>> Are you certain that GD has SVG enabled in it?  Sounds like this error
>>>>> is from outside the bioperl panel and is instead from GD and the GD
>>>>> perl
>>>>> module.
>>>>>
>>>>>
>>>>>           
>>>> ..
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>>
>>>>
>>>>         
>>> Guys, I think you missed parts of the discussion yesterday, it was the
>>> object constructor, which decides if it should use GD or GD::SVG...
>>> Stefan
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>
>>>       
>> OK, sorry..
>> In any case yes, it requires GD::SVG since the constructor instantiate
>> GD::SVG object if you pass  -image_class=~'svg'
>> Stefan
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>     
>
>
>
>   


From lstein at cshl.edu  Thu Mar  1 16:10:52 2007
From: lstein at cshl.edu (Lincoln Stein)
Date: Thu, 1 Mar 2007 16:10:52 -0500
Subject: [Bioperl-l] [Bioperl-announce-l] BioPerl leadership additions
In-Reply-To: <8f200b4c0702270959n7521f693l915bfabe7ccb7ef7@mail.gmail.com>
References: <41922044-0BDA-4F29-B045-5E544A4F679F@bioperl.org>
	<8f200b4c0702270959n7521f693l915bfabe7ccb7ef7@mail.gmail.com>
Message-ID: <6dce9a0b0703011310n6c4ec150hfb7835ed576461d4@mail.gmail.com>

Hear hear!

Lincoln

On 2/27/07, Steve Chervitz <sac at bioperl.org> wrote:
>
> Welcome to the club, Chris & Sendu. Always good to have an infusion of new
> blood and capable, motivated hands.
>
> Steve
>
> On 2/26/07, Jason Stajich <jason at bioperl.org> wrote:
> >
> > Dear BioPerl Users and Developers,
> >
> > I want to announce a addition in the leadership of BioPerl.
> > Christopher Fields and and Sendu Bala are now members of the BioPerl
> > Core developer group to recognize their ongoing leadership in the
> > project.  Chris and Sendu were instrumental in the 1.5.2 Developer
> > release and have made a significant commitment and contribution to
> > the quality of the code and the documentation of the project.  We
> > have invited them to be part of the core to recognize their work and
> > to feel comfortable to ask them to do more. ;-)
> >
> > The Core group was established to insure that someone was responsible
> > for making code releases, vetting new developers for CVS write
> > accounts, and generally dealing with things that might otherwise slip
> > through the cracks.  We are very excited to have more people
> > contributing to and maintaining the toolkit.  We look forward to
> > their help along with all the other developers, as we work towards a
> > 1.6 release release this year.
> >
> > As always, while their is a need for some individuals to lead the
> > project, we encourage contributions from all levels of expertise to
> > improve the code, documentation, and tutorials of the project.
> >
> > We plan to discuss the progress of the toolkit at this year's
> > Bioinformatics Open Source Conference held in Vienna, Austria in
> > conjunction with the SIG meetings at ISMB.   We are trying to use
> > BOSC 2007 as a chance for the developers of Open Bioinformatics
> > Foundation sponsored and related projects to coordinate future
> > development and release cycles.
> >
> > Jason Stajich on behalf of the Core developers
> >
> > _______________________________________________
> > Bioperl-announce-l mailing list
> > Bioperl-announce-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-announce-l
> >
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
(516) 367-8380 (voice)
(516) 367-8389 (fax)
FOR URGENT MESSAGES & SCHEDULING,
PLEASE CONTACT MY ASSISTANT,
SANDRA MICHELSEN, AT michelse at cshl.edu

From lstein at cshl.edu  Thu Mar  1 16:23:49 2007
From: lstein at cshl.edu (Lincoln Stein)
Date: Thu, 1 Mar 2007 16:23:49 -0500
Subject: [Bioperl-l] The axis of GC content in Bio::Graphics::glyph:dna
In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E9503E2EBE3@iahce2ksrv1.iah.bbsrc.ac.uk>
References: <8975119BCD0AC5419D61A9CF1A923E9503E2EB70@iahce2ksrv1.iah.bbsrc.ac.uk>
	<6dce9a0b0702151053v19ab190fh1f752fea3b2ed722@mail.gmail.com>
	<8975119BCD0AC5419D61A9CF1A923E9503E2EBE3@iahce2ksrv1.iah.bbsrc.ac.uk>
Message-ID: <6dce9a0b0703011323i44dea645ha5aba6361dbc964@mail.gmail.com>

I'm glad you picked that up. I would have never noticed the missing comma.

NB: if you set "use warnings" at the top of your script, then you would have
gotten an error message about subtraction with an undefined variable.

Lincoln

On 3/1/07, michael watson (IAH-C) <michael.watson at bbsrc.ac.uk> wrote:
>
>  In fact, those pad_left and pad_right arguments have no effect whatsoever
> (using bioperl 1.5.2_100)
>
>  my $panel = Bio::Graphics::Panel->new(-key_style => between,
>      -offset    => $start,
>      -length    => $stop - $start + 1,
>      -width     => 800
>      -pad_left =>5000,
>      -pad_right =>5000
>      );
> Even if I set them to 5000, the image looks exactly as if I had not set
> them.
>
> The only way I can get around this is to edit Glyph/dna.pm lines 184 and
> 186 such that $x2+3 is changed to $x2-20 - then the axes are drawn on the
> image instead of outside of it.   This is obviously a hack, which upsets my
> karma.
>
> Mick
>
>  ------------------------------
> *From:* lincoln.stein at gmail.com [mailto:lincoln.stein at gmail.com] *On
> Behalf Of *Lincoln Stein
> *Sent:* 15 February 2007 18:53
> *To:* michael watson (IAH-C)
> *Cc:* BioPerl-List
> *Subject:* Re: [Bioperl-l] The axis of GC content in
> Bio::Graphics::glyph:dna
>
> Hi Michael,
>
> When you set up the panel, do this:
>
>  Bio::Graphics::Panel->new(-blah -blah,
>                                          -pad_left => 20,
>                                           -pad_right => 20);
>
> This will leave enough room on the left and right for you to see the Y
> axis. Otherwise it runs off the edge of the image (ok, this is a mis-design,
> but it was the only way to solve a chicken-and-egg problem about who gets to
> say how wide the panel is)
>
> Lincoln
>
> On 2/15/07, michael watson (IAH-C) <michael.watson at bbsrc.ac.uk> wrote:
> >
> > Hi
> >
> > OK I have some great images out of this glyph, but I can't see the axis,
> > and nor is it labelled (ie does it go from 0 - 100%?) so isn't great for
> > publication.  The docs say:
> >
> > "NOTE: -gc_window=>'auto' gives nice results and is recommended for
> > drawing GC content. The GC content axes draw slightly outside the
> > panel, so you may wish to add some extra padding on the right and
> > left. "
> >
> > Any idea how to do this?
> >
> > Basically, I want a nice GC graph with the axis quite clearly labelled,
> > and a nice "%GC" title next to it :)
> >
> > Thanks
> >
> > Mick
> >
> > The information contained in this message may be confidential or legally
> > privileged and is intended solely for the addressee. If you have
> > received this message in error please delete it & notify the originator
> > immediately.
> > Unauthorised use, disclosure, copying or alteration of this message is
> > forbidden & may be unlawful.
> > The contents of this e-mail are the views of the sender and do not
> > necessarily represent the views of the Institute.
> > This email and associated attachments has been checked locally for
> > viruses but we can accept no responsibility once it has left our
> > systems.
> > Communications on Institute computers are monitored to secure the
> > effective operation of the systems and for other lawful purposes.
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
>
>
>
> --
> Lincoln D. Stein
> Cold Spring Harbor Laboratory
> 1 Bungtown Road
> Cold Spring Harbor, NY 11724
> (516) 367-8380 (voice)
> (516) 367-8389 (fax)
> FOR URGENT MESSAGES & SCHEDULING,
> PLEASE CONTACT MY ASSISTANT,
> SANDRA MICHELSEN, AT michelse at cshl.edu
>



-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
(516) 367-8380 (voice)
(516) 367-8389 (fax)
FOR URGENT MESSAGES & SCHEDULING,
PLEASE CONTACT MY ASSISTANT,
SANDRA MICHELSEN, AT michelse at cshl.edu

From cjfields at uiuc.edu  Thu Mar  1 16:25:09 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 1 Mar 2007 15:25:09 -0600
Subject: [Bioperl-l] SVG output with Bio::Graphics::Panel fails
In-Reply-To: <45E73F87.1090104@bms.com>
References: <45E5F43C.9080902@sendu.me.uk>
	<1A4207F8295607498283FE9E93B775B402CC9D60@EX02.asurite.ad.asu.edu>
	<A0AB5FA0-078E-4B3D-BB21-EE7811A6CE60@uiuc.edu>
	<45E7335F.8070102@bms.com> <45E7359E.5030104@bms.com>
	<6dce9a0b0703011239m7065a570l6d19e6c7065fca45@mail.gmail.com>
	<45E73F87.1090104@bms.com>
Message-ID: <6727E8E1-F2D9-4C4E-843F-FC6D53ADAAA7@uiuc.edu>

No problemo.

chris

On Mar 1, 2007, at 3:03 PM, Stefan Kirov wrote:

> Lincoln Stein wrote:
>> You need to have GD::SVG installed and then instantiate the panel  
>> with:
>> -image_class=>'GD::SVG'
>>
> Yes, silly me I was looking at the code and did not realize that =~/ 
> svg/
> is only to check, and the actual class name is taken of the arg list.
> Sorry Chris.
> Stefan
>> Lincoln
>>
>> On 3/1/07, Stefan Kirov <stefan.kirov at bms.com> wrote:
>>
>>> Stefan Kirov wrote:
>>>
>>>> Chris Fields wrote:
>>>>
>>>>
>>>>> Does SVG output via GD still require GD::SVG (or SVG::GD, I can't
>>>>> remember which)?
>>>>>
>>>>> chris
>>>>>
>>>>> On Mar 1, 2007, at 12:28 PM, Kevin Brown wrote:
>>>>>
>>>>>
>>>>>
>>>>>
>>>>>> Are you certain that GD has SVG enabled in it?  Sounds like  
>>>>>> this error
>>>>>> is from outside the bioperl panel and is instead from GD and  
>>>>>> the GD
>>>>>> perl
>>>>>> module.
>>>>>>
>>>>>>
>>>>>>
>>>>> ..
>>>>> _______________________________________________
>>>>> Bioperl-l mailing list
>>>>> Bioperl-l at lists.open-bio.org
>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>>
>>>>>
>>>>>
>>>>>
>>>> Guys, I think you missed parts of the discussion yesterday, it  
>>>> was the
>>>> object constructor, which decides if it should use GD or GD::SVG...
>>>> Stefan
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>>
>>>>
>>> OK, sorry..
>>> In any case yes, it requires GD::SVG since the constructor  
>>> instantiate
>>> GD::SVG object if you pass  -image_class=~'svg'
>>> Stefan
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>
>>
>>
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From cjfields at uiuc.edu  Thu Mar  1 16:29:18 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 1 Mar 2007 15:29:18 -0600
Subject: [Bioperl-l] Enhance Bio::PrimarySeqI::trunc() for
	Bio::Location::Split ?
In-Reply-To: <Pine.LNX.4.64.0703011503160.28477@ferret.jays.net>
References: <Pine.LNX.4.64.0703010907370.27396@ferret.jays.net>
	<A23A3595-98E0-4628-8F56-BFC589AC90CF@uiuc.edu>
	<Pine.LNX.4.64.0703011503160.28477@ferret.jays.net>
Message-ID: <A392E60B-36D4-4F32-BD80-524355949445@uiuc.edu>


On Mar 1, 2007, at 3:15 PM, Jay Hannah wrote:

> On Thu, 1 Mar 2007, Chris Fields wrote:
>> Have you tried using $feature->spliced_seq() instead of seq()?  Using
>> seq() retrieves the full sequence for the split location (from start
>> of first sublocation to end of last), while spliced_seq() splices the
>> sublocation sequences together, which is what I think you want.
>
> Genius. No wonder they promoted you into the core developer group. :)
>
> Using this:
>    my ($nucleotide_seq) = $feat->spliced_seq(-nosort => 1)->seq;
>
> Gives me what I expected against these:
>
> # M37762 CDS 76..819
> # L26462 CDS join(866..957,1088..1310,2161..2289)
> # M12730 CDS join(1959..2355,1..92)
>
> I'm happy to submit my patches for t/genbank.t and t/data/ 
> test.genbank if
> that would make the universe a slightly better place. (...or
> t/SeqFeature.t or t/splicedseq.t, which appear to be the tests that  
> have
> spliced_seq calls in them so far...)
>
> Thanks!
>
> j
> seqlab.net
> http://www.bioperl.org/wiki/User:Jhannah

The more the merrier tests the better, I say.  I would only put in  
one example, though (maybe the last one, M12730, since it's from a  
gene in a circular sequence split across the start).

I'm still planning on testing out some variations of  
Bio::Location::SplitLocationI (which impacts sliced_seq() ) and have  
started a page on it, so any added tests would be great.

chris

From harris at cshl.edu  Thu Mar  1 15:09:16 2007
From: harris at cshl.edu (Todd Harris)
Date: Thu, 1 Mar 2007 13:09:16 -0700
Subject: [Bioperl-l] SVG output with Bio::Graphics::Panel fails
In-Reply-To: <A0AB5FA0-078E-4B3D-BB21-EE7811A6CE60@uiuc.edu>
References: <45E5F43C.9080902@sendu.me.uk>
	<A0AB5FA0-078E-4B3D-BB21-EE7811A6CE60@uiuc.edu>
Message-ID: <1172779760.7B32453@fd9.dngr.org>

Hi Chris -

I don't believe that GD or gd for that matter can generate SVG but I 
could be wrong.

SVG output can be generated from GD using either GD::SVG or SVG::GD, two 
modules that accomplish the same task through a similar strategy.

Todd



On Thu, 1 Mar 2007 2:05 pm, Chris Fields wrote:
> Does SVG output via GD still require GD::SVG (or SVG::GD, I can't
> remember which)?
>
> chris
>
> On Mar 1, 2007, at 12:28 PM, Kevin Brown wrote:
>
>>  Are you certain that GD has SVG enabled in it?  Sounds like this error
>>  is from outside the bioperl panel and is instead from GD and the GD
>>  perl
>>  module.
> ..
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

From johnsonm at gmail.com  Thu Mar  1 17:46:12 2007
From: johnsonm at gmail.com (Mark Johnson)
Date: Thu, 1 Mar 2007 16:46:12 -0600
Subject: [Bioperl-l] Issues with new Bio::Tools::Run modules for
	Genemark and Glimmer
In-Reply-To: <45E61AA9.9030906@sendu.me.uk>
References: <ebf5eb170702281159y7dcedd88n7bdef2c8bb9d3288@mail.gmail.com>
	<894754FB-2B20-415F-A6FC-7ACE839C6540@uiuc.edu>
	<ebf5eb170702281454i52cea9eeqbcaebee5e4ec5e0e@mail.gmail.com>
	<45E61AA9.9030906@sendu.me.uk>
Message-ID: <ebf5eb170703011446i7a0d2107g3c9c8d8cf5c23863@mail.gmail.com>

Now that I'm using _set_from_args() and trying to get all the options and
switches working that I never use, it occurs to me that a 4-in-1 module for
Glimmer2/Glimmer3/GlimmerM/GllimmerHMM is not going to fly due to the
options and switches being different.  At this point, I think I'm going to
end up with a Genemark module, a Glimmer2 module, and a Glimmer3 module.
Feh.

On 2/28/07, Sendu Bala <bix at sendu.me.uk> wrote:
>
> Mark Johnson wrote:
> > I'm using _rearrange() now.  I'll look at _set_from_args().  Is either
> one
> > preferred to the other?
>
> _set_from_args() is implemented using _rearrange() iirc. In any case,
> they do different things but _set_from_args() just makes creating
> wrapper modules a lot simpler. Another example: compare revisions 1.15
> and 1.16 of Bio::Tools::Run::Alignment::Lagan where I reimplemented it
> to use _set_from_args() and _setparams().
>
>
> http://code.open-bio.org/cgi/viewcvs.cgi/bioperl-run/Bio/Tools/Run/Alignment/Lagan.pm.diff?r1=text&tr1=1.15&r2=text&tr2=1.16&diff_format=h
>
> So, its new, but I'd recommend new modules, especially wrappers, make
> use of it.
>

From bix at sendu.me.uk  Thu Mar  1 18:06:54 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Thu, 01 Mar 2007 23:06:54 +0000
Subject: [Bioperl-l] Issues with new Bio::Tools::Run modules for
 Genemark and Glimmer
In-Reply-To: <ebf5eb170703011446i7a0d2107g3c9c8d8cf5c23863@mail.gmail.com>
References: <ebf5eb170702281159y7dcedd88n7bdef2c8bb9d3288@mail.gmail.com>	
	<894754FB-2B20-415F-A6FC-7ACE839C6540@uiuc.edu>	
	<ebf5eb170702281454i52cea9eeqbcaebee5e4ec5e0e@mail.gmail.com>	
	<45E61AA9.9030906@sendu.me.uk>
	<ebf5eb170703011446i7a0d2107g3c9c8d8cf5c23863@mail.gmail.com>
Message-ID: <45E75C8E.7010809@sendu.me.uk>

Mark Johnson wrote:
> Now that I'm using _set_from_args() and trying to get all the options 
> and switches working that I never use, it occurs to me that a 4-in-1 
> module for Glimmer2/Glimmer3/GlimmerM/GllimmerHMM is not going to fly 
> due to the options and switches being different.  At this point, I think 
> I'm going to end up with a Genemark module, a Glimmer2 module, and a 
> Glimmer3 module.  Feh. 

I think a 4in1 would still be possible. Presumably at some point you 
know which one you will run, so let the user set everything in the 
single new() even if it doesn't make sense, but then form argument 
strings with

sub _setparams {
   ...
   if ($glimmer2) {
     my $param_string = $self->SUPER::_setparams(
       -params => [@glim2params], -dash => 1);
   }
   elsif ($glimmer3) {
     ...


Or if you want to be stricter in new(), do something like:

sub new {
   my($class, @args) = @_;
   my $self = $class->SUPER::new(@args);

   my ($type) = $self->_rearrange([qw(TYPE)], @args);

   if ($type eq 'glimmer2') }
     $self->_set_from_args(\@args, -methods => [@glim2params],
                                   -create => 1);
   }
   elsif ($type eq ...


You'll have to figure out something yourself if you want to warn about 
the user supplying args that their requested type doesn't use.


All that said, if these Glimmer things are different programs with 
different uses (and not simply different versions of the same thing with 
the same function), by all means make separate modules.

From cjfields at uiuc.edu  Thu Mar  1 18:08:46 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 1 Mar 2007 17:08:46 -0600
Subject: [Bioperl-l] Issues with new Bio::Tools::Run modules for
	Genemark and Glimmer
In-Reply-To: <ebf5eb170703011446i7a0d2107g3c9c8d8cf5c23863@mail.gmail.com>
References: <ebf5eb170702281159y7dcedd88n7bdef2c8bb9d3288@mail.gmail.com>
	<894754FB-2B20-415F-A6FC-7ACE839C6540@uiuc.edu>
	<ebf5eb170702281454i52cea9eeqbcaebee5e4ec5e0e@mail.gmail.com>
	<45E61AA9.9030906@sendu.me.uk>
	<ebf5eb170703011446i7a0d2107g3c9c8d8cf5c23863@mail.gmail.com>
Message-ID: <9CE93EC0-A9DB-4A5B-8CE7-F15795375587@uiuc.edu>

I have been working on an Infernal wrapper (not finished yet but  
getting there) which does this:

# when run() is called, cmsearch is the program run...
my $factory = Bio::Tools::Run::Infernal->new('-program' =>'cmsearch',
                                               @params);

in Infernal.pm:

# for each program...
my %INFERNAL_PROGRAM = (
     ...
     cmsearch => [qw(h W informat toponly local noalign dumptrees  
thresh X inside
                 null2 learninserts hmmfb hmmweinberg hmmpad hmmonly  
hthresh beta noqdb
                 qdbfile hbanded hbandp banddump sums scan2bands)],
     ...
     );

then set in new() based on only the parameters listed for the  
program; I'm still toying with whether the program needs to be  
specified in the constructor prior to a run.  There are prob. other  
variations on this using AUTOLOAD and _set_from_args() etc.

chris

On Mar 1, 2007, at 4:46 PM, Mark Johnson wrote:

> Now that I'm using _set_from_args() and trying to get all the  
> options and switches working that I never use, it occurs to me that  
> a 4-in-1 module for Glimmer2/Glimmer3/GlimmerM/GllimmerHMM is not  
> going to fly due to the options and switches being different.  At  
> this point, I think I'm going to end up with a Genemark module, a  
> Glimmer2 module, and a Glimmer3 module.  Feh.



From lstein at cshl.edu  Thu Mar  1 18:12:29 2007
From: lstein at cshl.edu (Lincoln Stein)
Date: Thu, 1 Mar 2007 18:12:29 -0500
Subject: [Bioperl-l] Bio::Factory::EMBOSS, CGI and taint
In-Reply-To: <45E55884.9010908@uq.edu.au>
References: <45E55884.9010908@uq.edu.au>
Message-ID: <6dce9a0b0703011512k360bd94dv82e143d4477ebcea@mail.gmail.com>

You'll need to set the %ENV hash to a known safe state. e.g.:

 $ENV{PATH}="/bin:/usr/bin:/usr/local/bin";

Lincoln

On 2/28/07, Neil Saunders <n.saunders at uq.edu.au> wrote:
>
> Dear Bioperlers,
>
> I'm trying to understand an error that occurs when Bio::Factory::EMBOSS is
> used
> in a CGI script.  Using BioPerl 1.5.2 on Ubuntu Dapper, Apache 2.0.55,
> Perl 5.8.7.
>
> If I load this test CGI script (cgi.pl) in a browser:
>
> BEGIN CODE
> ----------
> #!/usr/bin/perl -Tw
> use strict;
> use CGI;
> use Bio::Factory::EMBOSS;
>
> my $cgi = new CGI;
> my $f   = new Bio::Factory::EMBOSS;
>
> print $cgi->header,
>        $cgi->start_html,
>        $cgi->end_html;
> --------
> END CODE
>
> I get a 500 server error and the Apache error log reads:
> [error] [client 192.168.0.3] Premature end of script headers: cgi.pl
>
> I can fix this in 2 ways:
>
> (1) Move the "my $f = new Bio::Factory::EMBOSS" line to the end of the
> script,
> which isn't a very useful fix.
> (2) Remove the -T switch from the shebang line
>
> There seem to be a few old posts on the list regarding "taint-safe"
> modules.  It
> seems that the new Bio::Factory::EMBOSS object is interfering with the
> headers
> in some way, but I'm no CGI.pm guru and wondered if anyone could shed
> light on this.
>
> thanks,
> Neil
> --
>   School of Molecular and Microbial Sciences
>   University of Queensland
>   Brisbane 4072 Australia
>
> http://nsaunders.wordpress.com
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
(516) 367-8380 (voice)
(516) 367-8389 (fax)
FOR URGENT MESSAGES & SCHEDULING,
PLEASE CONTACT MY ASSISTANT,
SANDRA MICHELSEN, AT michelse at cshl.edu

From arareko at campus.iztacala.unam.mx  Thu Mar  1 21:52:49 2007
From: arareko at campus.iztacala.unam.mx (Mauricio Herrera Cuadra)
Date: Thu, 01 Mar 2007 20:52:49 -0600
Subject: [Bioperl-l] BioPerl in MiniCPAN
Message-ID: <45E79181.9090404@campus.iztacala.unam.mx>

Folks,

Just found this post by Brian D Foy at the O'Reilly ONLamp Blog, BioPerl 
takes a reasonable part in the picture:

http://www.oreillynet.com/onlamp/blog/2007/02/minicpan_and_grandperspective.html

It would be interesting to see the same graphic for the whole CPAN 
repository... :)

Cheers,
Mauricio.

-- 
MAURICIO HERRERA CUADRA
arareko at campus.iztacala.unam.mx
Laboratorio de Gen?tica
Unidad de Morfofisiolog?a y Funci?n
Facultad de Estudios Superiores Iztacala, UNAM


From heikki at sanbi.ac.za  Fri Mar  2 01:08:15 2007
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Fri, 2 Mar 2007 08:08:15 +0200
Subject: [Bioperl-l] Bio::SeqIO::FTHelper
In-Reply-To: <8AA2B586-4C2B-4379-BFF0-0CEB15FAE68E@uiuc.edu>
References: <D6922F04-A349-41C4-B4DC-6763E3195B05@uiuc.edu>
	<200703011302.30855.heikki@sanbi.ac.za>
	<8AA2B586-4C2B-4379-BFF0-0CEB15FAE68E@uiuc.edu>
Message-ID: <200703020808.15664.heikki@sanbi.ac.za>

This sounds great. Is the speed increase noticeable?

	-Heikki


On Thursday 01 March 2007 17:24:03 Chris Fields wrote:
> I do have a rough outline of what I think could be done:
>
> http://www.bioperl.org/wiki/Handler-based_SeqIO_parsers
>
> where you could switch out handlers to deal with incoming data
> chunks.  Any suggestions there are welcome.
>
> I'll probably commit examples of the above in the next week or two
> (GenBank, EMBL, Swiss parsers using the same handlers) which don't
> use FTHelper.  So far I have all three passing tests based on genbank/
> embl/swiss.t but they need a few more tweaks before I commit.
>
> chris
>
> On Mar 1, 2007, at 5:02 AM, Heikki Lehvaslaiho wrote:
> > Chris,
> >
> > It was meant to collect code that was common to all three main
> > databases using
> > similar feature tables.
> >
> > Now might be the time to optimise the parsing speed by removing it.
> > Do you
> > have a plan how to do it?
> >
> > 	-Heikki
> >
> > On Tuesday 27 February 2007 22:57:40 Chris Fields wrote:
> >> Could anyone tell me what FTHelper is used for?  From what I gather
> >> it rolls up seqfeature data into a lightweight object but then
> >> creates a SeqFeature::Generic anyway (at least for GenBank/EMBL/
> >> Swiss), which seems to be a waste of memory and time.  Is there
> >> something I'm missing (besides my sanity of course)?
> >>
> >> chris
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> > --
> > ______ _/      _/_____________________________________________________
> >       _/      _/
> >      _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
> >     _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
> >    _/  _/  _/  SANBI, South African National Bioinformatics Institute
> >   _/  _/  _/  University of Western Cape, South Africa
> >      _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
> > ___ _/_/_/_/_/________________________________________________________
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign



-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________

From bix at sendu.me.uk  Fri Mar  2 06:23:45 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 02 Mar 2007 11:23:45 +0000
Subject: [Bioperl-l] frac_aligned_query returning results >1.
In-Reply-To: <44255ea80703011002l245e9576s66319ee695d3bd5b@mail.gmail.com>
References: <44255ea80703011002l245e9576s66319ee695d3bd5b@mail.gmail.com>
Message-ID: <45E80941.6020406@sendu.me.uk>

Thiago Venancio wrote:
> Hi all,
> 
> I have read a lot of threads regarding my issue, but still didn't get any
> efficient answer yet.
> 
> I am with problems with frac_aligned_query(). It is returning  "> 1"
> results.
> I have just updated my SearhUtils.pm from:
> http://code.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/Bio/Search/SearchUtils.pm

It shouldn't return results greater than 1. Please send me a minimal 
blast report that gives such results.

Make sure you only have one copy of SearchUtils.pm and that is the 
latest version (or that you are definitely using that latest version).


> The problem persists and, additionally, I get several warnings like:
> 
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: Undefined sub-sequence (1507,1507) . Valid range = 1444 - 1507
> STACK: Error::throw

I don't know about that problem. See Chris's reply.


From bix at sendu.me.uk  Fri Mar  2 06:25:25 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 02 Mar 2007 11:25:25 +0000
Subject: [Bioperl-l] frac_aligned_query returning results >1.
In-Reply-To: <8D7B0767-46A6-4083-B94E-D6490B241B84@uiuc.edu>
References: <44255ea80703011002l245e9576s66319ee695d3bd5b@mail.gmail.com>
	<8D7B0767-46A6-4083-B94E-D6490B241B84@uiuc.edu>
Message-ID: <45E809A5.9060407@sendu.me.uk>

Chris Fields wrote:
> This is related to a reported bug:
> 
> http://bugzilla.open-bio.org/show_bug.cgi?id=2193
> 
> The relevant code used to tile HSPs is a bit brittle and sometimes  
> leads to errors like this.  The error (which is actually a thrown  
> exception) is wrapped in an eval block and converted to a warn for  
> that reason.  I'm not familiar with the tiling algorithm used, maybe  
> Steve can add some input?

Depending on what exactly you're talking about here, I may have 
re-written that algorithm. Nice to know the bug survived ;)

From bix at sendu.me.uk  Fri Mar  2 06:42:26 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 02 Mar 2007 11:42:26 +0000
Subject: [Bioperl-l] Problem of Installing Bioperl
In-Reply-To: <405300.74546.qm@web60523.mail.yahoo.com>
References: <405300.74546.qm@web60523.mail.yahoo.com>
Message-ID: <45E80DA2.6050303@sendu.me.uk>

Chan Kuang Lim wrote:
> Thank you for your reply, but still cant solve my problem. The folder 
> 'ppm-VzM4DH' do not exist in my system. so, there is no 
> bioperl-1.5.2_100.tgz. How i can get it?

You should post back to the mailing list; I don't have a Windows machine 
to test things out on. Others with more Windows experience may be able 
to help you.

I can suggest making sure you have the latest version of (ActiveState) 
perl and the GUI PPM installer. As a last resort you can ensure you have 
nmake installed and try installing with CPAN on the command-line.

It will no doubt be helpful if you supply complete, unedited details of 
what you do and the errors you receive so we can diagnose your problem 
successfully.

From n.haigh at sheffield.ac.uk  Fri Mar  2 07:43:04 2007
From: n.haigh at sheffield.ac.uk (Nathan S. Haigh)
Date: Fri, 02 Mar 2007 12:43:04 +0000
Subject: [Bioperl-l] Problem of Installing Bioperl
In-Reply-To: <459942.77644.qm@web60518.mail.yahoo.com>
References: <459942.77644.qm@web60518.mail.yahoo.com>
Message-ID: <45E81BD8.3030304@sheffield.ac.uk>

Chan Kuang Lim wrote:
> I have problem of installing bioperl in windows using command-line installation.
> In the cmd windows, after 
> ppm-shell
> search bioperl
> install 2
>
> many downloading had done, but the next line is:
> Unpacking bioperl-1.5.2_100...ppm install failed: Can't extract files from C:.............../Bioperl-1.5.2_100.tgz
>
>
> Hope you can answer my question. Thank you.
>
> Regards,
> Chan Kuang Lim
> Malaysia
>
>  

I should be able to help out, but I'm a little busy at the moment. If 
you are still having problems, let us know the details of your system, 
e.g. what version of windows, if you are logged in as an administrator, 
what version of activeperl and what version of Perl.

Cheers
Nath

From cjfields at uiuc.edu  Fri Mar  2 08:33:08 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 2 Mar 2007 07:33:08 -0600
Subject: [Bioperl-l] frac_aligned_query returning results >1.
In-Reply-To: <45E809A5.9060407@sendu.me.uk>
References: <44255ea80703011002l245e9576s66319ee695d3bd5b@mail.gmail.com>
	<8D7B0767-46A6-4083-B94E-D6490B241B84@uiuc.edu>
	<45E809A5.9060407@sendu.me.uk>
Message-ID: <BC3BCC70-20DE-45BD-AA78-6775E2B41402@uiuc.edu>


On Mar 2, 2007, at 5:25 AM, Sendu Bala wrote:

> Chris Fields wrote:
>> This is related to a reported bug:
>> http://bugzilla.open-bio.org/show_bug.cgi?id=2193
>> The relevant code used to tile HSPs is a bit brittle and  
>> sometimes  leads to errors like this.  The error (which is  
>> actually a thrown  exception) is wrapped in an eval block and  
>> converted to a warn for  that reason.  I'm not familiar with the  
>> tiling algorithm used, maybe  Steve can add some input?
>
> Depending on what exactly you're talking about here, I may have re- 
> written that algorithm. Nice to know the bug survived ;)

Yep, I saw your commits (revs. 1.16, 1.17, 1.19, and 1.20).  I can  
check code prior to that to see if it changes anything for better or  
worse or gets rid of the bug (prob. later today or tomorrow), though  
I can't see why your revisions would make it worse.  If anything  
they're now more accurate.

Thiago can also try; just pull up a revision prior to the ones listed  
above and see if it helps:

http://code.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/Bio/ 
Search/SearchUtils.pm?cvsroot=bioperl

Jason had previously indicted problems with tiling (i.e. similar  
exceptions were thrown) prior to your commits so I don't think your  
changes are related, but one never knows.

Chris


From bix at sendu.me.uk  Fri Mar  2 08:35:34 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 02 Mar 2007 13:35:34 +0000
Subject: [Bioperl-l] (no subject)
In-Reply-To: <58ff33550703010647j1e7908f3sf3c01a74eeceaca4@mail.gmail.com>
References: <58ff33550703010647j1e7908f3sf3c01a74eeceaca4@mail.gmail.com>
Message-ID: <45E82826.30007@sendu.me.uk>

Luba Pardo wrote:
> Dear all,
> Sorry if the questions is too basic but I am trying to learn BioPerl
> modules. So I am trying to get the CDS sequence from a gi identification
> protein using the "features" method. I started to run the example of the FAQ
> doc (How do I retrieve a nucleotide coding sequence when I have a protein gi
> number?)

[ 
http://www.bioperl.org/wiki/FAQ#How_do_I_retrieve_a_nucleotide_coding_sequence_when_I_have_a_protein_gi_number.3F 
]

[snip]
> my $protein_gi = '405830';
> my $prot_obj = $gp->get_Seq_by_id($protein_gi);;
> foreach my $feat ( $prot_obj->top_SeqFeatures ) {
>    if ( $feat->primary_tag eq 'CDS' ) {
>    # example: 'coded_by="U05729.1:1..122"'
>    my @coded_by = $feat->each_tag_value('coded_by');
>    my ($nuc_acc, $loc_str) = split /\:/, $coded_by[0];
[snip]
> The error I got is
> 
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: Must specify a query or list of uids to fetch
[snip]
> But I can not see where part of the script is that I have to specify a list
> of gi. That very odd. Am I interpreting the script wrong?

If you use warnings you'd have seen a problem on the line with the 
split: @coded_by is empty. This is because you aren't supplying a 
protein GI. In this case it would be 405831, not 405830. 405830 is 
already the nucleotide GI so you don't need to do this stuff with 
coded_by. Use the code in the next section of the FAQ instead:

http://www.bioperl.org/wiki/FAQ#How_do_I_get_the_complete_spliced_nucleotide_sequence_from_the_CDS_section.3F


From lubapardo at gmail.com  Fri Mar  2 08:47:26 2007
From: lubapardo at gmail.com (Luba Pardo)
Date: Fri, 2 Mar 2007 14:47:26 +0100
Subject: [Bioperl-l] (no subject)
In-Reply-To: <45E82826.30007@sendu.me.uk>
References: <58ff33550703010647j1e7908f3sf3c01a74eeceaca4@mail.gmail.com>
	<45E82826.30007@sendu.me.uk>
Message-ID: <58ff33550703020547r26edb40pb9af8dc6556e27d1@mail.gmail.com>

Thank you all for your advice. It certaintly made my weekend!
Indeed, I could run the example using the RefSeq accesion number. As
suggested earlier by Samuel, I run the command over RefSeq (get_Seq_by_id )
method and it worked even without taking out the version last numbers.
I am attaching the modified script I run (I checked the translated protein
also to verify I got the correct CDS)

use Bio::Factory::FTLocationFactory;
use Bio::DB::RefSeq;
use Bio::DB::GenBank;

my $gp = Bio::DB::RefSeq->new;

my $gb = Bio::DB::GenBank->new;
# factory to turn strings into Bio::Location objects

my $loc_factory = Bio::Factory::FTLocationFactory->new;
 open (IN,"refids.txt") or die "\n I can't open the file\n";
 open (OUT, ">>refseqfast.txt") or die "\n I can write it\n";
 while (<IN>) {
 chomp;

my $protein_acc = $_;

#print "que onda $protein_acc\n";


#die;
my $prot_obj = $gp->get_Seq_by_id($protein_acc);

foreach my $feat ( $prot_obj->top_SeqFeatures ) {

   if ( $feat->primary_tag eq 'CDS' ) {
   # example: 'coded_by="U05729.1:1..122"'

   my @coded_by = $feat->each_tag_value('coded_by');

   my ($nuc_acc,$loc_str) = split /\:/, $coded_by[0];
   print "  $nuc_acc\n";
 #   $nuc_acc = ~s/(\w+).\d+/\1/;


    print "  $nuc_acc\n";

   my $nuc_obj = $gb->get_Seq_by_id($nuc_acc);
   # create Bio::Location object from a string

   my $loc_object = $loc_factory->from_string($loc_str);
   # create a Feature object by using a Location

   my $feat_obj = Bio::SeqFeature::Generic->new(-location =>$loc_object);
   # associate the Feature object with the nucleotide Seq object

   $nuc_obj->add_SeqFeature($feat_obj);

    my $cds_obj = $feat_obj->spliced_seq;

    print OUT  ">",$nuc_acc,"\n",$cds_obj->seq,"\n";
   }
}
  }



On 02/03/07, Sendu Bala <bix at sendu.me.uk> wrote:
>
> Luba Pardo wrote:
> > Dear all,
> > Sorry if the questions is too basic but I am trying to learn BioPerl
> > modules. So I am trying to get the CDS sequence from a gi identification
> > protein using the "features" method. I started to run the example of the
> FAQ
> > doc (How do I retrieve a nucleotide coding sequence when I have a
> protein gi
> > number?)
>
> [
>
> http://www.bioperl.org/wiki/FAQ#How_do_I_retrieve_a_nucleotide_coding_sequence_when_I_have_a_protein_gi_number.3F
> ]
>
> [snip]
> > my $protein_gi = '405830';
> > my $prot_obj = $gp->get_Seq_by_id($protein_gi);;
> > foreach my $feat ( $prot_obj->top_SeqFeatures ) {
> >    if ( $feat->primary_tag eq 'CDS' ) {
> >    # example: 'coded_by="U05729.1:1..122"'
> >    my @coded_by = $feat->each_tag_value('coded_by');
> >    my ($nuc_acc, $loc_str) = split /\:/, $coded_by[0];
> [snip]
> > The error I got is
> >
> > ------------- EXCEPTION: Bio::Root::Exception -------------
> > MSG: Must specify a query or list of uids to fetch
> [snip]
> > But I can not see where part of the script is that I have to specify a
> list
> > of gi. That very odd. Am I interpreting the script wrong?
>
> If you use warnings you'd have seen a problem on the line with the
> split: @coded_by is empty. This is because you aren't supplying a
> protein GI. In this case it would be 405831, not 405830. 405830 is
> already the nucleotide GI so you don't need to do this stuff with
> coded_by. Use the code in the next section of the FAQ instead:
>
>
> http://www.bioperl.org/wiki/FAQ#How_do_I_get_the_complete_spliced_nucleotide_sequence_from_the_CDS_section.3F
>
>

From thiago.venancio at gmail.com  Fri Mar  2 06:38:48 2007
From: thiago.venancio at gmail.com (Thiago Venancio)
Date: Fri, 2 Mar 2007 08:38:48 -0300
Subject: [Bioperl-l] Bioperl-l] frac_aligned_query returning results >1.
Message-ID: <44255ea80703020338t608c1d71k810baf92ede1180e@mail.gmail.com>

Hi Sendu and Chris,

Thanks for the help.
As I mentioned, I have updated my SearchUtils file from:
http://code.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/Bio/Search/SearchUtils.pm


I am also using the lates BioPerl version, installed from CPAN.

Please find a buggy blast report attached.
In this case, the frac_aligned_query() outputs "1.04", but I have others
with " 1.57" for example.

Just for a quantitative aspect, I got ">1" values in only 61 / 53,377.

The line where I call the function is :

print
$result->query_name."\t".$hit->frac_aligned_query()."\t".$hit->frac_identical(
'query' )."\n";

Thiago


-- 
"The way to get started is to quit talking and begin doing."
      Walt Disney

========================
Thiago Motta Venancio, MSc
PhD student in Bioinformatics
University of Sao Paulo
========================
-------------- next part --------------
BLASTN 2.2.6 [Apr-09-2003]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= AEDES_02704.C
         (1069 letters)

Database: aaegypti.SCAFFOLDS-MASKED.AEDES1.fa
           4758 sequences; 1,383,971,543 total letters

Searching..........done

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

supercontig:1:supercont1.157:1:2064756:1 supercontig supercont1.157   858   0.0

>supercontig:1:supercont1.157:1:2064756:1 supercontig supercont1.157
          Length = 2064756

 Score =  858 bits (433), Expect = 0.0
 Identities = 448/453 (98%)
 Strand = Plus / Plus


Query: 12     cattttaaatgcatatattgggtgccatcatgactgcctgactcctaaacttgacctcga 71
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 759400 cattttaaatgcatatattgggtgccatcatgactgcctgactcctaaacttgacctcga 759459


Query: 72     ggcctatattctatcccttcttacatgtagtggcttaatcctagattgctggtactcacg 131
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 759460 ggcctatattctatcccttcttacatgtagtggcttaatcctagattgctggtactcacg 759519


Query: 132    gcaccggctattatgctcccgccgcctctagctccaccagcctctgcatcctttctgacg 191
              |||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||
Sbjct: 759520 gcaccggccattatgctcccgccgcctttagctccaccagcctccgcatcctttctgacg 759579


Query: 192    gtctgcgctcgccgtcgtcgcacgctctgtgctcctgcaccacctcagctgaagcggcta 251
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 759580 gtctgcgctcgccgtcgtcgcacgctctgtgctcctgcaccacctcagctgaagcggctg 759639


Query: 252    gctctcgacggtcattcaccgccgacgaccttgcactactgtgttgggaacccctggtcg 311
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 759640 gctctcgacggtcattcaccgccgacgaccttgcactactgtgttgggaacccctggtcg 759699


Query: 312    tgagtcacagtccgctcttcctccgatgtgccaaatgtcaaacgctgatatggctacgga 371
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 759700 tgagtcacagtccgctcttcctccgatgtgtcaaatgtcaaacgctgatatggctacgga 759759


Query: 372    cgatcctccaccgcggtgttgggaacccctgagtgtagactcgctgggccttccttcgat 431
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 759760 cgatcctccaccgcggtgttgggaacccctgagtgtagactcgctgggccttccttcgat 759819


Query: 432    gagccaaagaacgaaactgcaacgaaaaaaccc 464
              |||||||||||||||||||||||||||||||||
Sbjct: 759820 gagccaaagaacgaaactgcaacgaaaaaaccc 759852



 Score =  803 bits (405), Expect = 0.0
 Identities = 441/453 (97%)
 Strand = Plus / Plus


Query: 12     cattttaaatgcatatattgggtgccatcatgactgcctgactcctaaacttgacctcga 71
              ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 768455 cattttaaatgcatatattgggtgccatcatgactacctgactcctaaacttgacctcga 768514


Query: 72     ggcctatattctatcccttcttacatgtagtggcttaatcctagattgctggtactcacg 131
              ||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 768515 ggcctatattctatctcttcttacatgtagtggcttaatcctagatttctggtactcacg 768574


Query: 132    gcaccggctattatgctcccgccgcctctagctccaccagcctctgcatcctttctgacg 191
              |||||||| |||||||||||||||||| |||||||||||||||| |||| ||||||||||
Sbjct: 768575 gcaccggccattatgctcccgccgcctttagctccaccagcctccgcattctttctgacg 768634


Query: 192    gtctgcgctcgccgtcgtcgcacgctctgtgctcctgcaccacctcagctgaagcggcta 251
              ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 768635 gtctgcgctcgccgtcgtcgcacgctctgtgctcctgcaccccctcagctgaagcggctg 768694


Query: 252    gctctcgacggtcattcaccgccgacgaccttgcactactgtgttgggaacccctggtcg 311
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 768695 gctctcgacggtcattcaccgccgacgaccttgcactactgtgttgggaacccctggtcg 768754


Query: 312    tgagtcacagtccgctcttcctccgatgtgccaaatgtcaaacgctgatatggctacgga 371
              |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||
Sbjct: 768755 tgagtcacagtccgctcttcctccgatgtgccaaatgtcaactgctgatatggctacgga 768814


Query: 372    cgatcctccaccgcggtgttgggaacccctgagtgtagactcgctgggccttccttcgat 431
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 768815 cgatcctccaccgcggtgttgggaacccctgagtgtagactcgctgggccttccttcgat 768874


Query: 432    gagccaaagaacgaaactgcaacgaaaaaaccc 464
              |||||||||||| ||||||||||||||||||||
Sbjct: 768875 gagccaaagaacaaaactgcaacgaaaaaaccc 768907



 Score =  317 bits (160), Expect = 3e-84
 Identities = 170/172 (98%), Gaps = 1/172 (0%)
 Strand = Plus / Plus


Query: 899    ttcctttcaccgtatggccacgtgacgatgatgagctctggcgcctttcgcgtccggatg 958
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 769407 ttcctttcaccgtatggccacgtgacgatgatgagctctggcgcctttcgcgtccggatg 769466


Query: 959    ttttccgccacggccggtaacaactatgtaacctttcactatggaaaactgcaaaagttt 1018
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 769467 ttttccgccacggccggtaacaactatgtaacctttcactatggaaaactgcaaaagttc 769526


Query: 1019   tctttcgccggcttt-aacggcactaactttttgtggcaaaatccgcttatt 1069
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 769527 tctttcgccggctttaaacggcactaactttttgtggcaaaatccgcttatt 769578



 Score =  311 bits (157), Expect = 2e-82
 Identities = 167/169 (98%), Gaps = 1/169 (0%)
 Strand = Plus / Plus


Query: 902    ctttcaccgtatggccacgtgacgatgatgagctctggcgcctttcgcgtccggatgttt 961
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 760355 ctttcaccgtatggccacgtgacgatgatgagctctggcgcctttcgcgtccggatgttt 760414


Query: 962    tccgccacggccggtaacaactatgtaacctttcactatggaaaactgcaaaagttttct 1021
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 760415 tccgccacggccggtaacaactatgtaacctttcactatggaaaactgcaaaagttctct 760474


Query: 1022   ttcgccggcttt-aacggcactaactttttgtggcaaaatccgcttatt 1069
              |||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 760475 ttcgccggctttaaacggcactaactttttgtggcaaaatccgcttatt 760523



 Score =  293 bits (148), Expect = 5e-77
 Identities = 151/152 (99%)
 Strand = Plus / Plus


Query: 587    ccccctttctttccgtcggaatcacgatccgagcagtagcgtcagcagacaatggatttg 646
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 769138 ccccctttctttccgtcggaatcgcgatccgagcagtagcgtcagcagacaatggatttg 769197


Query: 647    cggcgttcttattgttgaacaatgcgtgcccgtcctgatgccagcgatgatctcgtgatc 706
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 769198 cggcgttcttattgttgaacaatgcgtgcccgtcctgatgccagcgatgatctcgtgatc 769257


Query: 707    ggacaatcacgtcggtttcgaagcggttggcc 738
              ||||||||||||||||||||||||||||||||
Sbjct: 769258 ggacaatcacgtcggtttcgaagcggttggcc 769289



 Score =  293 bits (148), Expect = 5e-77
 Identities = 151/152 (99%)
 Strand = Plus / Plus


Query: 587    ccccctttctttccgtcggaatcacgatccgagcagtagcgtcagcagacaatggatttg 646
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 760083 ccccctttctttccgtcggaatcgcgatccgagcagtagcgtcagcagacaatggatttg 760142


Query: 647    cggcgttcttattgttgaacaatgcgtgcccgtcctgatgccagcgatgatctcgtgatc 706
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 760143 cggcgttcttattgttgaacaatgcgtgcccgtcctgatgccagcgatgatctcgtgatc 760202


Query: 707    ggacaatcacgtcggtttcgaagcggttggcc 738
              ||||||||||||||||||||||||||||||||
Sbjct: 760203 ggacaatcacgtcggtttcgaagcggttggcc 760234



 Score =  242 bits (122), Expect = 2e-61
 Identities = 125/126 (99%)
 Strand = Plus / Plus


Query: 463    cccaataaggggtttctcgtcgtgtgtgggtgcttcgagggaagcgacagtcaacctggc 522
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 768959 cccaataaggggtttctcgtcgtgtgtgggtgcttcgagggaagcgacagccaacctggc 769018


Query: 523    tcgcttcgaggtcctcctacggctcttgcagtggctatgcgctattggtggatgcaaaat 582
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 769019 tcgcttcgaggtcctcctacggctcttgcagtggctatgcgctattggtggatgcaaaat 769078


Query: 583    cgtccc 588
              ||||||
Sbjct: 769079 cgtccc 769084



 Score =  242 bits (122), Expect = 2e-61
 Identities = 125/126 (99%)
 Strand = Plus / Plus


Query: 463    cccaataaggggtttctcgtcgtgtgtgggtgcttcgagggaagcgacagtcaacctggc 522
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 759904 cccaataaggggtttctcgtcgtgtgtgggtgcttcgagggaagcgacagccaacctggc 759963


Query: 523    tcgcttcgaggtcctcctacggctcttgcagtggctatgcgctattggtggatgcaaaat 582
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 759964 tcgcttcgaggtcctcctacggctcttgcagtggctatgcgctattggtggatgcaaaat 760023


Query: 583    cgtccc 588
              ||||||
Sbjct: 760024 cgtccc 760029



 Score =  123 bits (62), Expect = 1e-25
 Identities = 65/66 (98%)
 Strand = Plus / Plus


Query: 737    ccactctaaaatgcttcttcgtgccttctaggtcgtcgatatttgccgcgaaaaccgtga 796
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 769344 ccactctaaaatgcttcttcgtgccttctaggtcgttgatatttgccgcgaaaaccgtga 769403


Query: 797    tccttc 802
              ||||||
Sbjct: 769404 tccttc 769409



 Score =  121 bits (61), Expect = 4e-25
 Identities = 64/65 (98%)
 Strand = Plus / Plus


Query: 737    ccactctaaaatgcttcttcgtgccttctaggtcgtcgatatttgccgcgaaaaccgtga 796
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 760289 ccactctaaaatgcttcttcgtgccttctaggtcgttgatatttgccgcgaaaaccgtga 760348


Query: 797    tcctt 801
              |||||
Sbjct: 760349 tcctt 760353



 Score =  105 bits (53), Expect = 2e-20
 Identities = 68/73 (93%)


Query: 806     gttaaaaataatgaagattacacgtcatctaaactccatttatgcgatgtaaacatgacg 865
               ||||||||||||||||||||||| |||| |||||| ||||||||| ||| ||||||||||
Sbjct: 1251522 gttaaaaataatgaagattacacatcatgtaaacttcatttatgcaatgcaaacatgacg 1251463


Query: 866     tcatgtaaattta 878
               |||||||||||||
Sbjct: 1251462 tcatgtaaattta 1251450



 Score = 97.6 bits (49), Expect = 6e-18
 Identities = 70/77 (90%)
 Strand = Plus / Plus


Query: 802     cacagttaaaaataatgaagattacacgtcatctaaactccatttatgcgatgtaaacat 861
               ||||||||||| |||||||||||| |||| |||||||||  || ||||||||||||||||
Sbjct: 1251086 cacagttaaaactaatgaagattaaacgttatctaaactttatatatgcgatgtaaacat 1251145


Query: 862     gacgtcatgtaaattta 878
               || ||||||||||||||
Sbjct: 1251146 gaagtcatgtaaattta 1251162



 Score = 61.9 bits (31), Expect = 3e-07
 Identities = 37/39 (94%)
 Strand = Plus / Minus


Query: 802     cacagttaaaaataatgaagattacacgtcatctaaact 840
               |||||| ||||||||||||||||||||||||| ||||||
Sbjct: 1601368 cacagtaaaaaataatgaagattacacgtcatgtaaact 1601330


From thiago.venancio at gmail.com  Fri Mar  2 07:29:43 2007
From: thiago.venancio at gmail.com (Thiago Venancio)
Date: Fri, 2 Mar 2007 09:29:43 -0300
Subject: [Bioperl-l] frac aligned query
Message-ID: <44255ea80703020429m53a2eb7ek6588011bd8400a0a@mail.gmail.com>

Hi Sendu and Chris,

Sorry for mailing again, my previous email was blocked by the list
(suspicious header).

Thanks for the help.
As I mentioned, I have updated my SearchUtils file from:
http://code.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/Bio/Search/SearchUtils.pm


I am also using the lates BioPerl version, installed from CPAN.

Please find a buggy blast report attached.
In this case, the frac_aligned_query() outputs "1.04", but I have others
with " 1.57" for example.

Just for a quantitative aspect, I got ">1" values in only 61 / 53,377.

The line where I call the function is :

print
$result->query_name."\t".$hit->frac_aligned_query()."\t".$hit->frac_identical(
'query' )."\n";

Thiago

On 3/2/07, Sendu Bala <bix at sendu.me.uk> wrote:
>
> Chris Fields wrote:
> > This is related to a reported bug:
> >
> > http://bugzilla.open-bio.org/show_bug.cgi?id=2193
> >
> > The relevant code used to tile HSPs is a bit brittle and sometimes
> > leads to errors like this.  The error (which is actually a thrown
> > exception) is wrapped in an eval block and converted to a warn for
> > that reason.  I'm not familiar with the tiling algorithm used, maybe
> > Steve can add some input?
>
> Depending on what exactly you're talking about here, I may have
> re-written that algorithm. Nice to know the bug survived ;)
>



-- 
"The way to get started is to quit talking and begin doing."
      Walt Disney

========================
Thiago Motta Venancio, MSc
PhD student in Bioinformatics
University of Sao Paulo
========================
-------------- next part --------------
BLASTN 2.2.6 [Apr-09-2003]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= AEDES_02704.C
         (1069 letters)

Database: aaegypti.SCAFFOLDS-MASKED.AEDES1.fa
           4758 sequences; 1,383,971,543 total letters

Searching..........done

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

supercontig:1:supercont1.157:1:2064756:1 supercontig supercont1.157   858   0.0

>supercontig:1:supercont1.157:1:2064756:1 supercontig supercont1.157
          Length = 2064756

 Score =  858 bits (433), Expect = 0.0
 Identities = 448/453 (98%)
 Strand = Plus / Plus


Query: 12     cattttaaatgcatatattgggtgccatcatgactgcctgactcctaaacttgacctcga 71
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 759400 cattttaaatgcatatattgggtgccatcatgactgcctgactcctaaacttgacctcga 759459


Query: 72     ggcctatattctatcccttcttacatgtagtggcttaatcctagattgctggtactcacg 131
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 759460 ggcctatattctatcccttcttacatgtagtggcttaatcctagattgctggtactcacg 759519


Query: 132    gcaccggctattatgctcccgccgcctctagctccaccagcctctgcatcctttctgacg 191
              |||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||
Sbjct: 759520 gcaccggccattatgctcccgccgcctttagctccaccagcctccgcatcctttctgacg 759579


Query: 192    gtctgcgctcgccgtcgtcgcacgctctgtgctcctgcaccacctcagctgaagcggcta 251
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 759580 gtctgcgctcgccgtcgtcgcacgctctgtgctcctgcaccacctcagctgaagcggctg 759639


Query: 252    gctctcgacggtcattcaccgccgacgaccttgcactactgtgttgggaacccctggtcg 311
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 759640 gctctcgacggtcattcaccgccgacgaccttgcactactgtgttgggaacccctggtcg 759699


Query: 312    tgagtcacagtccgctcttcctccgatgtgccaaatgtcaaacgctgatatggctacgga 371
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 759700 tgagtcacagtccgctcttcctccgatgtgtcaaatgtcaaacgctgatatggctacgga 759759


Query: 372    cgatcctccaccgcggtgttgggaacccctgagtgtagactcgctgggccttccttcgat 431
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 759760 cgatcctccaccgcggtgttgggaacccctgagtgtagactcgctgggccttccttcgat 759819


Query: 432    gagccaaagaacgaaactgcaacgaaaaaaccc 464
              |||||||||||||||||||||||||||||||||
Sbjct: 759820 gagccaaagaacgaaactgcaacgaaaaaaccc 759852



 Score =  803 bits (405), Expect = 0.0
 Identities = 441/453 (97%)
 Strand = Plus / Plus


Query: 12     cattttaaatgcatatattgggtgccatcatgactgcctgactcctaaacttgacctcga 71
              ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 768455 cattttaaatgcatatattgggtgccatcatgactacctgactcctaaacttgacctcga 768514


Query: 72     ggcctatattctatcccttcttacatgtagtggcttaatcctagattgctggtactcacg 131
              ||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 768515 ggcctatattctatctcttcttacatgtagtggcttaatcctagatttctggtactcacg 768574


Query: 132    gcaccggctattatgctcccgccgcctctagctccaccagcctctgcatcctttctgacg 191
              |||||||| |||||||||||||||||| |||||||||||||||| |||| ||||||||||
Sbjct: 768575 gcaccggccattatgctcccgccgcctttagctccaccagcctccgcattctttctgacg 768634


Query: 192    gtctgcgctcgccgtcgtcgcacgctctgtgctcctgcaccacctcagctgaagcggcta 251
              ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 768635 gtctgcgctcgccgtcgtcgcacgctctgtgctcctgcaccccctcagctgaagcggctg 768694


Query: 252    gctctcgacggtcattcaccgccgacgaccttgcactactgtgttgggaacccctggtcg 311
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 768695 gctctcgacggtcattcaccgccgacgaccttgcactactgtgttgggaacccctggtcg 768754


Query: 312    tgagtcacagtccgctcttcctccgatgtgccaaatgtcaaacgctgatatggctacgga 371
              |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||
Sbjct: 768755 tgagtcacagtccgctcttcctccgatgtgccaaatgtcaactgctgatatggctacgga 768814


Query: 372    cgatcctccaccgcggtgttgggaacccctgagtgtagactcgctgggccttccttcgat 431
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 768815 cgatcctccaccgcggtgttgggaacccctgagtgtagactcgctgggccttccttcgat 768874


Query: 432    gagccaaagaacgaaactgcaacgaaaaaaccc 464
              |||||||||||| ||||||||||||||||||||
Sbjct: 768875 gagccaaagaacaaaactgcaacgaaaaaaccc 768907



 Score =  317 bits (160), Expect = 3e-84
 Identities = 170/172 (98%), Gaps = 1/172 (0%)
 Strand = Plus / Plus


Query: 899    ttcctttcaccgtatggccacgtgacgatgatgagctctggcgcctttcgcgtccggatg 958
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 769407 ttcctttcaccgtatggccacgtgacgatgatgagctctggcgcctttcgcgtccggatg 769466


Query: 959    ttttccgccacggccggtaacaactatgtaacctttcactatggaaaactgcaaaagttt 1018
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 769467 ttttccgccacggccggtaacaactatgtaacctttcactatggaaaactgcaaaagttc 769526


Query: 1019   tctttcgccggcttt-aacggcactaactttttgtggcaaaatccgcttatt 1069
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 769527 tctttcgccggctttaaacggcactaactttttgtggcaaaatccgcttatt 769578



 Score =  311 bits (157), Expect = 2e-82
 Identities = 167/169 (98%), Gaps = 1/169 (0%)
 Strand = Plus / Plus


Query: 902    ctttcaccgtatggccacgtgacgatgatgagctctggcgcctttcgcgtccggatgttt 961
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 760355 ctttcaccgtatggccacgtgacgatgatgagctctggcgcctttcgcgtccggatgttt 760414


Query: 962    tccgccacggccggtaacaactatgtaacctttcactatggaaaactgcaaaagttttct 1021
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 760415 tccgccacggccggtaacaactatgtaacctttcactatggaaaactgcaaaagttctct 760474


Query: 1022   ttcgccggcttt-aacggcactaactttttgtggcaaaatccgcttatt 1069
              |||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 760475 ttcgccggctttaaacggcactaactttttgtggcaaaatccgcttatt 760523



 Score =  293 bits (148), Expect = 5e-77
 Identities = 151/152 (99%)
 Strand = Plus / Plus


Query: 587    ccccctttctttccgtcggaatcacgatccgagcagtagcgtcagcagacaatggatttg 646
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 769138 ccccctttctttccgtcggaatcgcgatccgagcagtagcgtcagcagacaatggatttg 769197


Query: 647    cggcgttcttattgttgaacaatgcgtgcccgtcctgatgccagcgatgatctcgtgatc 706
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 769198 cggcgttcttattgttgaacaatgcgtgcccgtcctgatgccagcgatgatctcgtgatc 769257


Query: 707    ggacaatcacgtcggtttcgaagcggttggcc 738
              ||||||||||||||||||||||||||||||||
Sbjct: 769258 ggacaatcacgtcggtttcgaagcggttggcc 769289



 Score =  293 bits (148), Expect = 5e-77
 Identities = 151/152 (99%)
 Strand = Plus / Plus


Query: 587    ccccctttctttccgtcggaatcacgatccgagcagtagcgtcagcagacaatggatttg 646
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 760083 ccccctttctttccgtcggaatcgcgatccgagcagtagcgtcagcagacaatggatttg 760142


Query: 647    cggcgttcttattgttgaacaatgcgtgcccgtcctgatgccagcgatgatctcgtgatc 706
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 760143 cggcgttcttattgttgaacaatgcgtgcccgtcctgatgccagcgatgatctcgtgatc 760202


Query: 707    ggacaatcacgtcggtttcgaagcggttggcc 738
              ||||||||||||||||||||||||||||||||
Sbjct: 760203 ggacaatcacgtcggtttcgaagcggttggcc 760234



 Score =  242 bits (122), Expect = 2e-61
 Identities = 125/126 (99%)
 Strand = Plus / Plus


Query: 463    cccaataaggggtttctcgtcgtgtgtgggtgcttcgagggaagcgacagtcaacctggc 522
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 768959 cccaataaggggtttctcgtcgtgtgtgggtgcttcgagggaagcgacagccaacctggc 769018


Query: 523    tcgcttcgaggtcctcctacggctcttgcagtggctatgcgctattggtggatgcaaaat 582
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 769019 tcgcttcgaggtcctcctacggctcttgcagtggctatgcgctattggtggatgcaaaat 769078


Query: 583    cgtccc 588
              ||||||
Sbjct: 769079 cgtccc 769084



 Score =  242 bits (122), Expect = 2e-61
 Identities = 125/126 (99%)
 Strand = Plus / Plus


Query: 463    cccaataaggggtttctcgtcgtgtgtgggtgcttcgagggaagcgacagtcaacctggc 522
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 759904 cccaataaggggtttctcgtcgtgtgtgggtgcttcgagggaagcgacagccaacctggc 759963


Query: 523    tcgcttcgaggtcctcctacggctcttgcagtggctatgcgctattggtggatgcaaaat 582
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 759964 tcgcttcgaggtcctcctacggctcttgcagtggctatgcgctattggtggatgcaaaat 760023


Query: 583    cgtccc 588
              ||||||
Sbjct: 760024 cgtccc 760029



 Score =  123 bits (62), Expect = 1e-25
 Identities = 65/66 (98%)
 Strand = Plus / Plus


Query: 737    ccactctaaaatgcttcttcgtgccttctaggtcgtcgatatttgccgcgaaaaccgtga 796
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 769344 ccactctaaaatgcttcttcgtgccttctaggtcgttgatatttgccgcgaaaaccgtga 769403


Query: 797    tccttc 802
              ||||||
Sbjct: 769404 tccttc 769409



 Score =  121 bits (61), Expect = 4e-25
 Identities = 64/65 (98%)
 Strand = Plus / Plus


Query: 737    ccactctaaaatgcttcttcgtgccttctaggtcgtcgatatttgccgcgaaaaccgtga 796
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 760289 ccactctaaaatgcttcttcgtgccttctaggtcgttgatatttgccgcgaaaaccgtga 760348


Query: 797    tcctt 801
              |||||
Sbjct: 760349 tcctt 760353



 Score =  105 bits (53), Expect = 2e-20
 Identities = 68/73 (93%)


Query: 806     gttaaaaataatgaagattacacgtcatctaaactccatttatgcgatgtaaacatgacg 865
               ||||||||||||||||||||||| |||| |||||| ||||||||| ||| ||||||||||
Sbjct: 1251522 gttaaaaataatgaagattacacatcatgtaaacttcatttatgcaatgcaaacatgacg 1251463


Query: 866     tcatgtaaattta 878
               |||||||||||||
Sbjct: 1251462 tcatgtaaattta 1251450



 Score = 97.6 bits (49), Expect = 6e-18
 Identities = 70/77 (90%)
 Strand = Plus / Plus


Query: 802     cacagttaaaaataatgaagattacacgtcatctaaactccatttatgcgatgtaaacat 861
               ||||||||||| |||||||||||| |||| |||||||||  || ||||||||||||||||
Sbjct: 1251086 cacagttaaaactaatgaagattaaacgttatctaaactttatatatgcgatgtaaacat 1251145


Query: 862     gacgtcatgtaaattta 878
               || ||||||||||||||
Sbjct: 1251146 gaagtcatgtaaattta 1251162



 Score = 61.9 bits (31), Expect = 3e-07
 Identities = 37/39 (94%)
 Strand = Plus / Minus


Query: 802     cacagttaaaaataatgaagattacacgtcatctaaact 840
               |||||| ||||||||||||||||||||||||| ||||||
Sbjct: 1601368 cacagtaaaaaataatgaagattacacgtcatgtaaact 1601330


From cjfields at uiuc.edu  Fri Mar  2 09:35:34 2007
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 2 Mar 2007 08:35:34 -0600
Subject: [Bioperl-l] Bio::SeqIO::FTHelper
In-Reply-To: <200703020808.15664.heikki@sanbi.ac.za>
References: <D6922F04-A349-41C4-B4DC-6763E3195B05@uiuc.edu>
	<200703011302.30855.heikki@sanbi.ac.za>
	<8AA2B586-4C2B-4379-BFF0-0CEB15FAE68E@uiuc.edu>
	<200703020808.15664.heikki@sanbi.ac.za>
Message-ID: <7EC38884-D3E1-470D-9FAC-548797433B9D@uiuc.edu>

The current parsers are slightly faster, but not enough to make a  
huge difference unless you're parsing thousands of sequences.   
However, it does demonstrate that a good deal of the performance  
issues stem from object creation and not parsing, an issue that is  
already known.  For instance, if you do everything up to (but skip)  
instantiation of an object, like a SeqFeature/Annotation/Species, the  
parsing speeds up dramatically dependent on the number of objects  
created.  I also saw significant increases in speed when using  
FTHelper (instead of SeqFeatures) or Bio::Taxon (instead of  
Bio::Species), so lighter objects definitely help.

I basically just separate the two key steps into two distinct tasks  
(driver and handler); I haven't thought much about validation though  
I would probably separate that into a third task.  Regardless, the  
current drivers are flexible enough to deal with the occasional  
oddity and not die.  It's much easier to maintain and extend; for  
instance if you wanted to develop lightweight objects it's now easier  
to accomplish (i.e. rewrite/overload a handler vs. rewrite next_seq 
() ), and you can separately develop a faster driver via next_seq()  
as long as it threw the same data structure.

Multiple parsers can also use the same handler.  I currently have  
GenBank/EMBL/SwissProt all sharing the same handler and passing all  
tests.

chris

On Mar 2, 2007, at 12:08 AM, Heikki Lehvaslaiho wrote:

> This sounds great. Is the speed increase noticeable?
>
> 	-Heikki
>
>
> On Thursday 01 March 2007 17:24:03 Chris Fields wrote:
>> I do have a rough outline of what I think could be done:
>>
>> http://www.bioperl.org/wiki/Handler-based_SeqIO_parsers
>>
>> where you could switch out handlers to deal with incoming data
>> chunks.  Any suggestions there are welcome.
>>
>> I'll probably commit examples of the above in the next week or two
>> (GenBank, EMBL, Swiss parsers using the same handlers) which don't
>> use FTHelper.  So far I have all three passing tests based on  
>> genbank/
>> embl/swiss.t but they need a few more tweaks before I commit.
>>
>> chris
>>
>> On Mar 1, 2007, at 5:02 AM, Heikki Lehvaslaiho wrote:
>>> Chris,
>>>
>>> It was meant to collect code that was common to all three main
>>> databases using
>>> similar feature tables.
>>>
>>> Now might be the time to optimise the parsing speed by removing it.
>>> Do you
>>> have a plan how to do it?
>>>
>>> 	-Heikki
>>>
>>> On Tuesday 27 February 2007 22:57:40 Chris Fields wrote:
>>>> Could anyone tell me what FTHelper is used for?  From what I gather
>>>> it rolls up seqfeature data into a lightweight object but then
>>>> creates a SeqFeature::Generic anyway (at least for GenBank/EMBL/
>>>> Swiss), which seems to be a waste of memory and time.  Is there
>>>> something I'm missing (besides my sanity of course)?
>>>>
>>>> chris
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>> --
>>> ______ _/      _/ 
>>> _____________________________________________________
>>>       _/      _/
>>>      _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
>>>     _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
>>>    _/  _/  _/  SANBI, South African National Bioinformatics  
>>> Institute
>>>   _/  _/  _/  University of Western Cape, South Africa
>>>      _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
>>> ___ _/_/_/_/_/ 
>>> ________________________________________________________
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>
>
>
> -- 
> ______ _/      _/_____________________________________________________
>       _/      _/
>      _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
>     _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
>    _/  _/  _/  SANBI, South African National Bioinformatics Institute
>   _/  _/  _/  University of Western Cape, South Africa
>      _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
> ___ _/_/_/_/_/________________________________________________________
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From Kevin.M.Brown at asu.edu  Fri Mar  2 10:21:16 2007
From: Kevin.M.Brown at asu.edu (Kevin Brown)
Date: Fri, 2 Mar 2007 08:21:16 -0700
Subject: [Bioperl-l] SVG output with Bio::Graphics::Panel fails
In-Reply-To: <6dce9a0b0703011239m7065a570l6d19e6c7065fca45@mail.gmail.com>
References: <45E5F43C.9080902@sendu.me.uk><1A4207F8295607498283FE9E93B775B402CC9D60@EX02.asurite.ad.asu.edu><A0AB5FA0-078E-4B3D-BB21-EE7811A6CE60@uiuc.edu><45E7335F.8070102@bms.com>
	<45E7359E.5030104@bms.com>
	<6dce9a0b0703011239m7065a570l6d19e6c7065fca45@mail.gmail.com>
Message-ID: <1A4207F8295607498283FE9E93B775B402CC9E79@EX02.asurite.ad.asu.edu>

> You need to have GD::SVG installed and then instantiate the 
> panel with:
> -image_class=>'GD::SVG'

If this is the case, then why have an SVG method in Bio::Graphics::Panel
if it doesn't do this for you.  Either the method should be removed and
the normal $panel->gd method should be called to get an image out or
calling that method should setup and create the SVG for the user.
Either way I don't see anything in the documentation or wiki that points
out this "gotcha".


From stefan.kirov at bms.com  Fri Mar  2 10:41:34 2007
From: stefan.kirov at bms.com (Stefan Kirov)
Date: Fri, 02 Mar 2007 10:41:34 -0500
Subject: [Bioperl-l] SVG output with Bio::Graphics::Panel fails
In-Reply-To: <1A4207F8295607498283FE9E93B775B402CC9E79@EX02.asurite.ad.asu.edu>
References: <45E5F43C.9080902@sendu.me.uk>
	<1A4207F8295607498283FE9E93B775B402CC9D60@EX02.asurite.ad.asu.edu>
	<A0AB5FA0-078E-4B3D-BB21-EE7811A6CE60@uiuc.edu>
	<45E7335F.8070102@bms.com> <45E7359E.5030104@bms.com>
	<6dce9a0b0703011239m7065a570l6d19e6c7065fca45@mail.gmail.com>
	<1A4207F8295607498283FE9E93B775B402CC9E79@EX02.asurite.ad.asu.edu>
Message-ID: <45E845AE.6060400@bms.com>

Kevin Brown wrote:
>> You need to have GD::SVG installed and then instantiate the 
>> panel with:
>> -image_class=>'GD::SVG'
>>     
>
> If this is the case, then why have an SVG method in Bio::Graphics::Panel
> if it doesn't do this for you.  Either the method should be removed and
> the normal $panel->gd method should be called to get an image out or
> calling that method should setup and create the SVG for the user.
> Either way I don't see anything in the documentation or wiki that points
> out this "gotcha".
>
>   
I don't think it is that easy, since the you cannot simply switch 
between graphics libraries, but perhaps svg method should check the 
class that was used and throw an error if it is not GD::SVG.
Stefan



From bix at sendu.me.uk  Fri Mar  2 11:05:16 2007
From: bix at sendu.me.uk (Sendu Bala)
Date: Fri, 02 Mar 2007 16:05:16 +0000
Subject: [Bioperl-l] frac_aligned_query returning results >1.
In-Reply-To: <44255ea80703020336y7e423b94rd07acd380fe4b8fd@mail.gmail.com>
References: <44255ea80703011002l245e9576s66319ee695d3bd5b@mail.gmail.com>	
	<8D7B0767-46A6-4083-B94E-D6490B241B84@uiuc.edu>	
	<45E809A5.9060407@sendu.me.uk>
	<44255ea80703020336y7e423b94rd07acd380fe4b8fd@mail.gmail.com>
Message-ID: <45E84B3C.5000402@sendu.me.uk>

Thiago Venancio wrote:
> Hi Sendu and Chris,
> 
> Thanks for the help.
> As I mentioned, I have updated my SearchUtils file from:
> http://code.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/Bio/Search/SearchUtils.pm 
> <http://code.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/Bio/Search/SearchUtils.pm>
> 
> I am also using the lates BioPerl version, installed from CPAN.
> 
> Please find a buggy blast report attached.
> In this case, the frac_aligned_query() outputs "1.04", but I have others 
> with " 1.57" for example.
> 
> Just for a quantitative aspect, I got ">1" values in only 61 / 53,377.

Many thanks for that.

I've committed another fix for SearchUtils so please get revision 1.23 
and try again. Hopefully all 61 will no longer be >1, but if any are 
please send me sample blast files again.

For anyone interested, the bug was due to a completely unbelievable 
oversight on my part in the contig merging algorithm: I forgot to deal 
with contigs that were fully contained by others. Wow!

From johnsonm at gmail.com  Fri Mar  2 11:10:55 2007
From: johnsonm at gmail.com (Mark Johnson)
Date: Fri, 2 Mar 2007 10:10:55 -0600
Subject: [Bioperl-l] Issues with new Bio::Tools::Run modules for
	Genemark and Glimmer
In-Reply-To: <45E75C8E.7010809@sendu.me.uk>
References: <ebf5eb170702281159y7dcedd88n7bdef2c8bb9d3288@mail.gmail.com>
	<894754FB-2B20-415F-A6FC-7ACE839C6540@uiuc.edu>
	<ebf5eb170702281454i52cea9eeqbcaebee5e4ec5e0e@mail.gmail.com>
	<45E61AA9.9030906@sendu.me.uk>
	<ebf5eb170703011446i7a0d2107g3c9c8d8cf5c23863@mail.gmail.com>
	<45E75C8E.7010809@sendu.me.uk>
Message-ID: <ebf5eb170703020810s1e13d2bct7ef2930c2a6bc050@mail.gmail.com>

> I think a 4in1 would still be possible. Presumably at some point you
> know which one you will run, so let the user set everything in the
> single new() even if it doesn't make sense, but then form argument
> strings with


<SNIP>

Something like that occurred to me while driving home last night.  That
ought to separate things cleanly enough, especially if I validate the
options against the selected program.  I'm wasn't really thrilled with the
idea of code duplication between multiple modules, either.

All that said, if these Glimmer things are different programs with
> different uses (and not simply different versions of the same thing with
> the same function), by all means make separate modules.
>

It's a 'family' of gene predictors, two eukaryotic, two prokaryotic.
They're just similar enough to need similar solutions, and just different
enough to be slightly annoying.  8)

From thiago.venancio at gmail.com  Fri Mar  2 11:14:20 2007
From: thiago.venancio at gmail.com (Thiago Venancio)
Date: Fri, 2 Mar 2007 13:14:20 -0300
Subject: [Bioperl-l] frac_aligned_query returning results >1.
In-Reply-To: <45E84B3C.5000402@sendu.me.uk>
References: <44255ea80703011002l245e9576s66319ee695d3bd5b@mail.gmail.com>
	<8D7B0767-46A6-4083-B94E-D6490B241B84@uiuc.edu>
	<45E809A5.9060407@sendu.me.uk>
	<44255ea80703020336y7e423b94rd07acd380fe4b8fd@mail.gmail.com>
	<45E84B3C.5000402@sendu.me.uk>
Message-ID: <44255ea80703020814v31495221i72f65db532c0dd9b@mail.gmail.com>

Hi Sendu,

Great to know you fixed the problem.
I have updated the SearchUtils and seems to be correct now.

Best!

Thiago


On 3/2/07, Sendu Bala <bix at sendu.me.uk> wrote:
>
> Thiago Venancio wrote:
> > Hi Sendu and Chris,
> >
> > Thanks for the help.
> > As I mentioned, I have updated my SearchUtils file from:
> >
> http://code.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/Bio/Search/SearchUtils.pm
> > <
> http://code.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/Bio/Search/SearchUtils.pm
> >
> >
> > I am also using the lates BioPerl version, installed from CPAN.
> >
> > Please find a buggy blast report attached.
> > In this case, the frac_aligned_query() outputs "1.04", but I have others
> > with " 1.57" for example.
> >
> > Just for a quantitative aspect, I got ">1" values in only 61 / 53,377.
>
> Many thanks for that.
>
> I've committed another fix for SearchUtils so please get revision 1.23
> and try again. Hopefully all 61 will no longer be >1, but if any are
> please send me sample blast files again.
>
> For anyone interested, the bug was due to a completely unbelievable
> oversight on my part in the contig merging algorithm: I forgot to deal
> with contigs that were fully contained by others. Wow!
>



-- 
"The way to get started is to quit talking and begin doing."
      Walt Disney

========================
Thiago Motta Venancio, MSc
PhD student in Bioinformatics
University of Sao Paulo
========================

From johnsonm at gmail.com  Fri Mar  2 11:15:34 2007
From: johnsonm at gmail.com (Mark Johnso