[Bioperl-l] seq doesn't validate error

[Sheri Simmons]

Hi,
I'm getting an error as follows when I try to reverse complement a sequence 
string stored in a hash of arrays. The storage code is: 

		$nstarthash{$key} = [$sortchecks[0], join("", @nseq), 		
join("",@{$seqhash{$key}})];

the sequence of interest is the element at index 1. 

Later, I try to retrieve this string for a subset of keys so I can reverse 
complement it based on input from another hash (%complement):

			my %revcomphash = map { my $read = $_;
			grep $complement{$read} eq 'C', %complement;
			{$_, (Bio::Seq->new(-seq =>$nstarthash{$_}[1]))->revcom->seq()};}
			 keys(%nstarthash); 


I get the following warning (long sequence edited for clarity):

-- -------------------- WARNING ---------------------
MSG: seq doesn't validate, mismatch is 1
---------------------------------------------------

------------- EXCEPTION  -------------
MSG: Attempting to set the sequence to [GCCCCTGTAATCGCTTTTATATCGTCAGCGATC] 
which does not look healthy
STACK Bio::PrimarySeq::seq /usr/share/perl5/Bio/PrimarySeq.pm:268
STACK Bio::PrimarySeq::new /usr/share/perl5/Bio/PrimarySeq.pm:217
STACK Bio::Seq::new /usr/share/perl5/Bio/Seq.pm:498
STACK toplevel ../quality_wrapper.pl:103

I cannot find any non-allowed characters in the sequence, and the 
de-referencing appears to work correctly. Can anyone help me?
I'm using the latest Bioperl installation (1.5.2) with ActivePerl5.8 on a 
Mepis 6.5 system. 

Thanks
Sheri

---------------------------------------------------------------------
Sheri Simmons
Department of Earth and Planetary Sciences
University of California, Berkeley
Berkeley, CA 94720-4767