[Bioperl-l] seq doesn't validate error
Kevin Brown
Kevin.M.Brown at asu.edu
Fri Jun 15 19:11:34 EDT 2007
> I'm getting an error as follows when I try to reverse
> complement a sequence string stored in a hash of arrays. The
> storage code is:
>
> $nstarthash{$key} = [$sortchecks[0], join("",
> @nseq),
> join("",@{$seqhash{$key}})];
>
> the sequence of interest is the element at index 1.
>
> Later, I try to retrieve this string for a subset of keys so
> I can reverse complement it based on input from another hash
> (%complement):
>
> my %revcomphash = map { my $read = $_;
> grep $complement{$read} eq 'C', %complement;
> {$_, (Bio::Seq->new(-seq
> =>$nstarthash{$_}[1]))->revcom->seq()};}
> keys(%nstarthash);
>
>
> I get the following warning (long sequence edited for clarity):
>
> -- -------------------- WARNING ---------------------
> MSG: seq doesn't validate, mismatch is 1
> ---------------------------------------------------
>
> ------------- EXCEPTION -------------
> MSG: Attempting to set the sequence to
> [GCCCCTGTAATCGCTTTTATATCGTCAGCGATC]
> which does not look healthy
> STACK Bio::PrimarySeq::seq /usr/share/perl5/Bio/PrimarySeq.pm:268
> STACK Bio::PrimarySeq::new /usr/share/perl5/Bio/PrimarySeq.pm:217
> STACK Bio::Seq::new /usr/share/perl5/Bio/Seq.pm:498 STACK
> toplevel ../quality_wrapper.pl:103
>
> I cannot find any non-allowed characters in the sequence, and
> the de-referencing appears to work correctly. Can anyone help me?
> I'm using the latest Bioperl installation (1.5.2) with
> ActivePerl5.8 on a Mepis 6.5 system.
Try telling the Bio::Seq object what alphabet to use when creating it.
I tend to create them like:
Bio::Seq->new(-seq=> $seqvar, -alphabet=>'dna')
More information about the Bioperl-l
mailing list