[Bioperl-l] seq doesn't validate error
Sheri Simmons
sheris at eps.berkeley.edu
Fri Jun 15 18:58:12 EDT 2007
Hi,
I'm getting an error as follows when I try to reverse complement a sequence
string stored in a hash of arrays. The storage code is:
$nstarthash{$key} = [$sortchecks[0], join("", @nseq),
join("",@{$seqhash{$key}})];
the sequence of interest is the element at index 1.
Later, I try to retrieve this string for a subset of keys so I can reverse
complement it based on input from another hash (%complement):
my %revcomphash = map { my $read = $_;
grep $complement{$read} eq 'C', %complement;
{$_, (Bio::Seq->new(-seq =>$nstarthash{$_}[1]))->revcom->seq()};}
keys(%nstarthash);
I get the following warning (long sequence edited for clarity):
-- -------------------- WARNING ---------------------
MSG: seq doesn't validate, mismatch is 1
---------------------------------------------------
------------- EXCEPTION -------------
MSG: Attempting to set the sequence to [GCCCCTGTAATCGCTTTTATATCGTCAGCGATC]
which does not look healthy
STACK Bio::PrimarySeq::seq /usr/share/perl5/Bio/PrimarySeq.pm:268
STACK Bio::PrimarySeq::new /usr/share/perl5/Bio/PrimarySeq.pm:217
STACK Bio::Seq::new /usr/share/perl5/Bio/Seq.pm:498
STACK toplevel ../quality_wrapper.pl:103
I cannot find any non-allowed characters in the sequence, and the
de-referencing appears to work correctly. Can anyone help me?
I'm using the latest Bioperl installation (1.5.2) with ActivePerl5.8 on a
Mepis 6.5 system.
Thanks
Sheri
---------------------------------------------------------------------
Sheri Simmons
Department of Earth and Planetary Sciences
University of California, Berkeley
Berkeley, CA 94720-4767
More information about the Bioperl-l
mailing list