[Bioperl-l] Primer maps?

Thu Feb 16 17:32:51 UTC 2006

Mike,

Marc's suggestion is the best I've heard.

We really do not have any kind of pretty print functionality within BioPerl.
I guess there has not been a pressing need.  Bio::Graphics has filled in the 
need for sequence display.

I think Bio::Seq::PrettyPrint could be a great way to design prettyprinting in 
very modular way so that it can print out anything mapped to a sequence 
location. The EMBOSS showseq would be a great  help in there. A student 
project?

Would anyone be interested? 

   -Heikki

On Thursday 16 February 2006 17:47, Marc Logghe wrote:
> Hi Mike,
> Another route you might take is mapping your primers into
> Bio::SeqFeature::Generic objects and add them to the seq object. Then
> you dump the object into a rich sequence format like genbank and pass
> that to EMBOSS's showseq application
> Or you might do it completely with showseq. Here the only thing you need
> is an annotation file containing the positions of the primers, followed
> by any text (e.g. primer name).
> Then you do:
> showseq  <your seq file> -translate <cds_start>-<cds_stop> -format 4
> -annotation <your_primer_file>
> Have a look at http://emboss.sourceforge.net/apps/showseq.html for more
> options
>
> HTH,
> Marc
>
>
> Marc Logghe, PhD
> Expert Scientist Bioinformatics
> deVGen NV
> Technologiepark 30
> B - 9052 Ghent-Zwijnaarde
> Tel. +32 9 324 24 83
> Fax. +32 9 324 24 25
> Web: www.devgen.com
>
>  --- Disclaimer start ---
> This e-mail and any attachments thereto may contain information which is
> confidential and/or which is proprietary to the sender. Accordingly,
> this e-mail and any attachments thereto, as well as any and all
> information contained therein, are intended for the sole use of the
> recipient or recipients designated above. Any use of this e-mail, of any
> attachments thereto, of any and all information contained therein,
> and/or of any part(s) thereof (including, without limitation, total or
> partial reproduction, communication and/or distribution in any form) by
> persons other than the designated recipient(s) is prohibited. If you
> have received this e-mail in error, please notify the sender either by
> telephone or by e-mail and delete the material from any computer.
> Thank you for your cooperation.
> --- Disclaimer end ---
>
>
>
>
>
> ________________________________
>
> 	From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Michael Coyne
> 	Sent: Wednesday, February 15, 2006 10:20 PM
> 	To: bioperl-l at lists.open-bio.org
> 	Subject: [Bioperl-l] Primer maps?
>
>
> 	Hello all --
>
> 	I'm having a devil of a time figuring out how to make
> restriction maps using BioPerl.  What I'm going for is output similar to
> GCG's map program, but instead of using a set of defined restriction
> enzymes, I'd like to use a set of primers, to create a primer map rather
> than a restriction map.  I do not need a table of restriction enzymes
> that cut or don't cut (or primers that match or don't match, in this
> case), but an honest-to-goodness map, something like:
>
> 	                                       FKP-5->
>
>
> CGTTCTATCGATATGGGTGCTATGGAAATAGTATCTACGTTTGATGAATTGCAAGATTAT
> 	1921
> ---------+---------+---------+---------+---------+---------+ 1980
>
> GCAAGATAGCTATACCCACGATACCTTTATCATAGATGCAAACTACTTAACGTTCTAATA
>
> 	a                         M  E  I  V  S  T  F  D  E  L  Q  D  Y
> -
>
> 	I also need translations of orfs, but I can use GenBank files as
> input to the program and thus the CDS translations are already there, so
> I'm guessing that shouldn't be too hard....  How does one create such a
> map using the BioPerl modules?
>
> 	There are intriguing indications out there that such a thing is
> possible (e.g. the Bio::Map:: * and Bio::Restriction:: * modules), but I
> can't find a single example of code that creates such a basic,
> bread-and-butter thing as a restriction map with orf translations.  The
> documentation to these modules is fairly useless to me, consisting
> mostly of internal methods and function prototypes.  Perhaps my skills
> as a Perl programmer are to blame, but a clear example of how a map like
> this is constructed would be a big help.
>
> 	Right now, I'm generating primer maps with system calls to
> EMBOSS's remap, pointing it at a file of primer sequences rather than a
> file of restriction enzyme sequences, but the results are less than
> desired.  I'm considering trying to adapt tacg 4.1.0 or sequence
> extractor 1.1 web-based code to my needs, but this seems like a lot of
> work for an operation I suspect is possible in BioPerl.
>
> 	Any help greatly appreciated...
>
> 	Mike
>
>
>
> ---------------------------------------------------------------------
> 	 //=\   Michael J. Coyne                       phone: (617)
> 525-7820
> 	 \=//   Channing Laboratory                    FAX:   (617)
> 264-5193
> 	  //=\  EBRC, Room 617
> 	  \=//  221 Longwood Avenue
> email:mcoyne at channing.harvard.edu
> 	   //=\ Boston, MA 02115                 mjcoyne at comcast.net
> 	   \=//
>
> ---------------------------------------------------------------------
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________