From bmoore at genetics.utah.edu  Thu Dec  1 08:14:44 2005
From: bmoore at genetics.utah.edu (Barry Moore)
Date: Thu Dec  1 08:11:54 2005
Subject: [Bioperl-l] clustalw.pm: could not open sequence file error
Message-ID: <CFE1DF3BA20F424689DA0881A14055BECF2EE7@m.hg.genetics.utah.edu>

Olena,

Does the filename for the file in question have any spaces anywhere in
the path?  I know clustalx won't open files with a space in the path
even though Windows allows that.  Don't know for sure on clustalw, but
seems like it might behave the same way.

Barry
-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Olena
Morozova
Sent: Tuesday, November 29, 2005 3:34 PM
To: bioperl-ml List
Subject: [Bioperl-l] clustalw.pm: could not open sequence file error

Hi all,

I am trying to use this script

use Bio::Tools::Run::Alignment::Clustalw;

$ENV{CLUSTALDIR} = 'C:/perl/clustalw1.8/';
 my @params = ('ktuple' => 2, 'matrix' => 'BLOSUM',

'outfile'=> 'al_mouse.txt');
 my $factory =

Bio::Tools::Run::Alignment::Clustalw->new(@params);
 $inputfilename = 'c:/perl/mouse_unique.txt';
 my $aln = $factory->align($inputfilename);

to do a MSA, and it works for a test file with 2 or 3 sequences.
However, when I try to run it on my actual file (has 97 sequences)
which is in exactly the same format as the test file (fasta), I get a
"could not open the sequence file" error.
Is this because the file is too big and is there a way to fix this?
Thanks a lot for your help!

Olena

On 11/29/05, Jason Stajich <jason.stajich@duke.edu> wrote:
>
>
> Begin forwarded message:
>
> > From: neeti somaiya <neetisomaiya@gmail.com>
> > Date: November 29, 2005 1:27:27 AM EST
> > To: Jason Stajich <jason.stajich@duke.edu>
> > Subject: Re: [Bioperl-l] need BLAT parse code
> >
> > I use the following code :
> >
> > open(FH,"output.psl");
> > while(<FH>)
> > {
> >     if( /^psLayout/ )
> >     {
> >           for( 1..4 ) { <> }
> >       }
> >      my @line = split;
> >      my ( $matches,$mismatches,$rep_matches,$n_count,
> >             $q_num_insert,$q_base_insert,
> >             $t_num_insert, $t_base_insert,
> >             $strand, $q_name, $q_length, $q_start,
> >             $q_end, $t_name, $t_length,$t_start, $t_end,
$block_count,
> >             $block_sizes,  $q_starts,      $t_starts
> >             ) = split;
> >
> >
> >       print $t_start;
> >       print "\n";
> >       print $t_end;
> >
> > }
> >
> > for output.psl file :
> >
> > match   mis-    rep.    N's     Q gap   Q gap   T gap   T gap
> > strand  Q               Q       Q       Q       T
> > T       T       T       block   blockSizes      qStarts  tStarts
> >         match   match           count   bases   count
> > bases           name            size    start   end
> > name            size    start   end     count
> >
----------------------------------------------------------------------
> >
----------------------------------------------------------------------
> > -------------------
> > 27025   0       0       0       0       0       0       0
> > +       query_sequence3 27025   0       27025
> > database_sequence3      57701691        132995  160020  1
> > 27025,  0,      132995,
> > ~
> >
> >
> > It gave me output :
> >
> > Q
> > Q
> >
> > 132995
> > 160020
> >
> > What is the Q? Cant I obtain the coordinates (132995, 160020) alone?
> >
> > Please let me know.
> > Thanks.
> >
> > On 11/28/05, Jason Stajich <jason.stajich@duke.edu> wrote:
> > Bio::SearchIO::psl can parse psl output.
> >
> > or more simply:
> >
> > while(<>) {
> >    if( /^psLayout/ ) { # if there is a header
> >    for( 1..4 ) { <> }  # take next 4 lines to skip the header
> >    }
> >   my @line = split;
> >   my ( $matches,$mismatches,$rep_matches,$n_count,
> >              $q_num_insert,$q_base_insert,
> >              $t_num_insert, $t_base_insert,
> >              $strand, $q_name, $q_length, $q_start,
> >              $q_end, $t_name, $t_length,$t_start, $t_end,
> > $block_count,
> >              $block_sizes,  $q_starts,      $t_starts
> >              ) = split;
> >
> >   #  query aln vals are  $q_start, and $q_end values
> >   # hit aln vals are $t_start, $t_end
> > }
> >
> > On Nov 28, 2005, at 8:06 AM, neeti somaiya wrote:
> >
> > > Hi,
> > >
> > > I am using BLAT in a project.I am having simple .psl output files
> > > after
> > > running BLAT of a gene sequences against full chromosomal
> > > sequences.Doesanyone have a simple BLAT parse code. I am only
> > > interested in obtaining the
> > > alignment start and end positions on the target.
> > > --
> > > -Neeti
> > > Even my blood says, B positive
> > >
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l@portal.open-bio.org
> > > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> > --
> > Jason Stajich
> > Duke University
> > http://www.duke.edu/~jes12
> >
> >
> >
> >
> >
> > --
> > -Neeti
> > Even my blood says, B positive
>
> --
> Jason Stajich
> Duke University
> http://www.duke.edu/~jes12
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l

From qfdong at iastate.edu  Thu Dec  1 15:04:44 2005
From: qfdong at iastate.edu (Qunfeng)
Date: Thu Dec  1 15:02:33 2005
Subject: solved Re: [Bioperl-l] Deep recursion on subroutine
In-Reply-To: <438E2A2D.6010305@med.usyd.edu.au>
References: <6.1.2.0.2.20051130154054.04161190@qfdong.mail.iastate.edu>
	<438E2A2D.6010305@med.usyd.edu.au>
Message-ID: <6.1.2.0.2.20051201140243.040b25c8@qfdong.mail.iastate.edu>

Hello Jason and Jonathan,

Thanks for your help. Jason figures out the problem "
This is just Perl complaining because the recursion is deep because there are
so many levels in your tree (449 deep).  It thinks it hit a snag because it
doesn't expect to usually have a recursive call go that many levels.

You can make the warnings go away by adding this
no warnings 'recursion';"

Qunfeng
At 04:39 PM 11/30/2005, Jonathan Arthur wrote:
>Hello Qunfeng,
>
>I have not seen this specifically with bioperl, but have had it occur once 
>or twice in my own code and have always traced the problem back to an 
>error in the tree where one node is its own ancestor, thereby causing an 
>infinite recursion when you attempt to find all descendants from that node.
>
>If each node has a unique identifier, and if the tree is not too large, 
>you could find the offedning node with a small script to traverse the 
>tree, testing the unique identifer of each node against a list of all the 
>nodes seen before and dying when it sees offending node again.
>
>Cheers,
>
>Jonathan
>
>Qunfeng wrote:
>
>>Hi,
>>
>>I am using bioperl (5.8.0, linux) to work on a UPGMA tree (newick format, 
>>generated by PHYLIP).  My code works well on a small tree. However, when 
>>I applied it to a big (ugly) tree, it produces the following error msg. 
>>Has anybody encountered a similar problem? Is this triggered by any 
>>invalid part of my tree? Thanks!
>>
>>Qunfeng
>>===========Error message begins =====================
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::each_Descendent" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 495, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 201, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 201, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 496, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 496, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::each_Descendent" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 495, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 201, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 201, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 496, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 496, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::each_Descendent" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 495, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 201, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 201, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 496, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 496, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::each_Descendent" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 495, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 201, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 201, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 496, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 496, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::each_Descendent" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 495, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 201, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 201, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 496, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::Node::height" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/Node.pm line 496, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Tree::NodeI::get_all_Descendents" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Tree/NodeI.pm line 172, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Root::Root::DESTROY" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Root/Root.pm line 407, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Root::Root::DESTROY" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Root/Root.pm line 407, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Root::Root::DESTROY" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Root/Root.pm line 407, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Root::Root::DESTROY" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Root/Root.pm line 407, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Root::Root::DESTROY" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Root/Root.pm line 407, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Root::Root::DESTROY" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Root/Root.pm line 407, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Root::Root::DESTROY" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Root/Root.pm line 407, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Root::Root::DESTROY" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Root/Root.pm line 407, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Root::Root::DESTROY" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Root/Root.pm line 407, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Root::Root::DESTROY" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Root/Root.pm line 407, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Root::Root::DESTROY" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Root/Root.pm line 407, <GEN0> line 1.
>>Deep recursion on subroutine "Bio::Root::Root::DESTROY" at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/Root/Root.pm line 407, <GEN0> line 1.
>>=========Error msg ends==============================================
>>
>>_______________________________________________
>>Bioperl-l mailing list
>>Bioperl-l@portal.open-bio.org
>>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
>--
>Dr Jonathan Arthur
>Sesqui Lecturer in Bioinformatics
>Central Clinical School, Faculty of Medicine and SUBIT
>Medical Foundation Building, K25
>University of Sydney
>Ph: +61 2 9036 3132
>Email: jarthur@med.usyd.edu.au
>
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l
From chen_li3 at yahoo.com  Fri Dec  2 00:00:10 2005
From: chen_li3 at yahoo.com (chen li)
Date: Fri Dec  2 00:04:32 2005
Subject: [Bioperl-l] bioperl-db and MySQL
In-Reply-To: <545bf9a43c75b54463ffd2077e9b562e@gmx.net>
Message-ID: <20051202050010.58169.qmail@web36812.mail.mud.yahoo.com>

Very special thanks to Hilmar and Barry who help me
out for installing bioperl-db.


The follwoings are my experience for installing
bioperl-db:

1) Have a Linux operation system (in my case)
2) Use anonymouse CVS to install bioperl and follow
the HOWTO
3) the CPAN method doesn't work in my case



Li




		
__________________________________________ 
Yahoo! DSL ? Something to write home about. 
Just $16.99/mo. or less. 
dsl.yahoo.com 

From hubert.prielinger at gmx.at  Thu Dec  1 17:49:21 2005
From: hubert.prielinger at gmx.at (Hubert Prielinger)
Date: Fri Dec  2 10:44:48 2005
Subject: [Bioperl-l] remoteblast doesn't save the Output File
Message-ID: <438F7DF1.5060000@gmx.at>

Hi,
I'm quite desperated, because since two days I'm trying to save my 
remoteblast Output and it doesn't work
here we go....

#!/usr/bin/perl -w

use strict;
use warnings;
use Bio::SeqIO;
use Bio::Tools::Run::RemoteBlast;
use Bio::Seq;
use IO::String;
use Bio::SearchIO;



my $prog = 'blastp';
my $db   = 'swissprot';
my $e_val= '20000';
my $matrix = 'PAM30';
#my $outfile = 'Output';

my @data;
my $line_dataArray;
my $rid;
my $count = 1;


my @params = ( '-prog' => $prog,
                '-data' => $db,
                '-expect' => $e_val,
                '-matrix' => $matrix);

               

my $seqio_obj = Bio::SeqIO->new(-file => "Perm.txt",
                                -format => "raw",
                                 );


print "entering blast....";
    my $factory = Bio::Tools::Run::RemoteBlast->new (@params);
    print "Blast entered successfully \n";


 
   

while( my $query = $seqio_obj->next_seq ) {
           print "submit Sequence...just do it....\n";
            my $r = $factory->submit_blast($query);
            print $query->seq;
            print "\n";
        

   # Wait for the reply and save the output file
    print "entering while loop for saving Output.... \n";
    while ( my @rids = $factory->each_rid ) {
    foreach my $rid ( @rids ) {
        my $rc = $factory->retrieve_blast($rid);
       
        print "retrieved Results successfully \n";
       if( !ref($rc) ) {
            if( $rc < 0 ) {
                $factory->remove_rid($rid);
            }
            sleep 5;
       } else {
           #my $result = $rc->next_result;
           print $rid;
           print "\n";
             
           
            my $filename = " $count .out";
            $factory->save_output($filename);
            print "File saved successfully \n";
            $count++;
            $factory->remove_rid($rid);
        #    }
        }
    }
    print "\n";
    print "\n";

   

   
    }
}

I hope somebody can help me, thanks in advance

sincereley
Hubert

From erik.sjolund at gmail.com  Fri Dec  2 11:47:22 2005
From: erik.sjolund at gmail.com (=?ISO-8859-1?Q?Erik_Sj=F6lund?=)
Date: Fri Dec  2 19:33:32 2005
Subject: [Bioperl-l] abi2xml a new parser for abi trace files
Message-ID: <ddaa1890512020847n6d2d8cc6i89d4c526c5474b0b@mail.gmail.com>

Bioperl contains a module to parse abi trace files, called

Bio::SeqIO::abi

http://doc.bioperl.org/releases/bioperl-1.4/Bio/SeqIO/abi.html

So you might be interested to know that a new command line utility has
been released

http://abi2xml.sourceforge.net

that converts abi trace files to xml files. This bioinformatics
utility is written in C++ and released under the GPL license. A perl
programmer could first convert the abi files to xml files and then
access the information over a DOM interface  or over XPATH. The
advantage with this over Bio::SeqIO::abi is to get access to more
information of the abi file. Like for instance the time when the
experiment was done. I don't think that is possible with
Bio::SeqIO:abi ( correct me if I'm wrong ).

cheers,
Erik Sj?lund

From saldroubi at yahoo.com  Sun Dec  4 15:17:34 2005
From: saldroubi at yahoo.com (Sam Al-Droubi)
Date: Sun Dec  4 15:21:57 2005
Subject: [Bioperl-l] Bio:Seq $seq_obj->accession_number not returning
	accession number?
Message-ID: <20051204201734.20504.qmail@web34305.mail.mud.yahoo.com>

The fasta format for this sequence AF410462 from NCBI looks like this
 
 
>gi|17066572|gb|AF410462.1|AF410462 Mus musculus PEM homeobox (Pem) gene, promoter region and partial cds
ATGCGTGTGGGCATGCGCTCATGCCCACTTGCTTGAGCACATGTGTGCTCACATGGACGTTAGAGGCAAC
TTTCAGGAGTTATTTTTTTCCCTTCTAACTTGAGTTCCTGGACCTCAGACTTGTATAATAGGTACTTTCC
CAACTTAAGTCTTACTGGCTCCAGGGTATCTGGTATACTCTTCTAGCCTCCAAGGGCAGCCACTCATGCT
TCTTCAGGTGTGAAGAGGTGAGCCAGATACAACGGTGGGAGGCAGTGTGCCCTCAGTGTGTAGACTCTTT
ATGCCCTTGGGGATTAGCGCCTCTAGCTGCCAGTCGGGTCTCTGGGTCCCTCCTGCTAAGGCCACTCTCG
TCATGGTTCCTCTTGTCCTGGTGAGCCATTACGACCCTCTCACTTCCTTGTGTTCTCTTCCCTGTGTTCT
CTCTCTGCTGCTGTGGCCATTCTAGCTCCCTGCACAGTCCTTCAAGCTCACCTCCTGCCTTCCGTGGACA
AGAGGAAGCACAAAGAATCATCCAGTATGTATGCTCATGGCATAAGGGGATCCTGGGGAAGGGCTGAAGC
CTGAGCCGGGCTGGTCAACAGAATCTCCCTCTCCCTAACTCCATCTCCCTCTCCTTCCCTCTTCCTCTCT
CTATCCCTCCCCCCTCTCTCCCCCCACCACCGCATGTTTTGGGTCAGCTGACTGCTCTAGCCTTGATGAG
ATATCTTCCCAGGAAGAGTTGGTGCTGACTGTACAGATTGAGTTAGAGGGAGGGAAGAAAGCTCCTGTTT
GATCACTGGAGATCTTTATGCCTAGCTACATGTCTTACCAAAGCCAGGGGAGTCAGCTGAGCTGTAACTG
GGCACCCTAAGTTCTGCACACCCACATGCCCATGAACTGTGTCCATCTTGCAAGCACATCGTGCTCATTA
CATCCCCAAACTGCTATCACTTGTGTACCCCAAAGGCTCGGCCCACAGGAACGTCCTGTGAGCAAATCAC
AAAGACCAGCTTAGGGCTGGAAACATTGTAACCTGAAGTAGGCCAGAGGAGATCCCTGCCAGGTTGAGCA
TCACAGATCTCATTCTGTTCCCGGGGACACCAGGGGCCCAAGCTCAGAATCTGCCGAAGCATAACTTCAT
CATTGATCCTATTCAGGGTATGGAAGCTGAGGGTTCCAGCCGCAAGGTCACCAGGCTACTCCGCCTGGGA
GTCAAGGAAG
 
 When I read this from a file as a sequence object using Bio::Seq I get accession_number unknow.  The 
 accession number is in the header of the fasta file.  Anyone knows why this happens. 
 
 My code looks like this:
 
 print "primary id is: ",$seq_obj->primary_id."\n";
 print "Description is ",$seq_obj->desc."\n";
 print "Accession Number is ",$seq_obj->accession_number."\n";
 
 Output looks like this:
 
 primary id is: gi|17066572|gb|AF410462.1|AF410462
 Description is Mus musculus PEM homeobox (Pem) gene, promoter region and partial cds
 Accession Number is unknown
 
 
 Thank you.
 
 
 


Sincerely, 
Sam Al-Droubi, M.S.
saldroubi@yahoo.com
From bmoore at genetics.utah.edu  Sun Dec  4 16:23:48 2005
From: bmoore at genetics.utah.edu (Barry Moore)
Date: Sun Dec  4 16:32:49 2005
Subject: [Bioperl-l] Bio:Seq $seq_obj->accession_number not
	returningaccession number?
Message-ID: <CFE1DF3BA20F424689DA0881A14055BECF2EEF@m.hg.genetics.utah.edu>

Sam-

The fasta parser makes no attempt to parse the fasta header since there
is no standard format for what should be in a fasta header.  Parse the
accession out of the primary_id field with a regular expression in your
script or use GenBank or ENSEMBL format sequences to get all the goodies
parsed for you.  Google on "accession fasta parse site:bioperl.org" to
read other posts on this topic.

Barry

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Sam
Al-Droubi
Sent: Sunday, December 04, 2005 1:18 PM
To: BioPerl list BioPerl list
Subject: [Bioperl-l] Bio:Seq $seq_obj->accession_number not
returningaccession number?

The fasta format for this sequence AF410462 from NCBI looks like this
 
 
>gi|17066572|gb|AF410462.1|AF410462 Mus musculus PEM homeobox (Pem)
gene, promoter region and partial cds
ATGCGTGTGGGCATGCGCTCATGCCCACTTGCTTGAGCACATGTGTGCTCACATGGACGTTAGAGGCAAC
TTTCAGGAGTTATTTTTTTCCCTTCTAACTTGAGTTCCTGGACCTCAGACTTGTATAATAGGTACTTTCC
CAACTTAAGTCTTACTGGCTCCAGGGTATCTGGTATACTCTTCTAGCCTCCAAGGGCAGCCACTCATGCT
TCTTCAGGTGTGAAGAGGTGAGCCAGATACAACGGTGGGAGGCAGTGTGCCCTCAGTGTGTAGACTCTTT
ATGCCCTTGGGGATTAGCGCCTCTAGCTGCCAGTCGGGTCTCTGGGTCCCTCCTGCTAAGGCCACTCTCG
TCATGGTTCCTCTTGTCCTGGTGAGCCATTACGACCCTCTCACTTCCTTGTGTTCTCTTCCCTGTGTTCT
CTCTCTGCTGCTGTGGCCATTCTAGCTCCCTGCACAGTCCTTCAAGCTCACCTCCTGCCTTCCGTGGACA
AGAGGAAGCACAAAGAATCATCCAGTATGTATGCTCATGGCATAAGGGGATCCTGGGGAAGGGCTGAAGC
CTGAGCCGGGCTGGTCAACAGAATCTCCCTCTCCCTAACTCCATCTCCCTCTCCTTCCCTCTTCCTCTCT
CTATCCCTCCCCCCTCTCTCCCCCCACCACCGCATGTTTTGGGTCAGCTGACTGCTCTAGCCTTGATGAG
ATATCTTCCCAGGAAGAGTTGGTGCTGACTGTACAGATTGAGTTAGAGGGAGGGAAGAAAGCTCCTGTTT
GATCACTGGAGATCTTTATGCCTAGCTACATGTCTTACCAAAGCCAGGGGAGTCAGCTGAGCTGTAACTG
GGCACCCTAAGTTCTGCACACCCACATGCCCATGAACTGTGTCCATCTTGCAAGCACATCGTGCTCATTA
CATCCCCAAACTGCTATCACTTGTGTACCCCAAAGGCTCGGCCCACAGGAACGTCCTGTGAGCAAATCAC
AAAGACCAGCTTAGGGCTGGAAACATTGTAACCTGAAGTAGGCCAGAGGAGATCCCTGCCAGGTTGAGCA
TCACAGATCTCATTCTGTTCCCGGGGACACCAGGGGCCCAAGCTCAGAATCTGCCGAAGCATAACTTCAT
CATTGATCCTATTCAGGGTATGGAAGCTGAGGGTTCCAGCCGCAAGGTCACCAGGCTACTCCGCCTGGGA
GTCAAGGAAG
 
 When I read this from a file as a sequence object using Bio::Seq I get
accession_number unknow.  The 
 accession number is in the header of the fasta file.  Anyone knows why
this happens. 
 
 My code looks like this:
 
 print "primary id is: ",$seq_obj->primary_id."\n";
 print "Description is ",$seq_obj->desc."\n";
 print "Accession Number is ",$seq_obj->accession_number."\n";
 
 Output looks like this:
 
 primary id is: gi|17066572|gb|AF410462.1|AF410462
 Description is Mus musculus PEM homeobox (Pem) gene, promoter region
and partial cds
 Accession Number is unknown
 
 
 Thank you.
 
 
 


Sincerely, 
Sam Al-Droubi, M.S.
saldroubi@yahoo.com
_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l

From jason.stajich at duke.edu  Sun Dec  4 16:49:40 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Sun Dec  4 16:47:21 2005
Subject: [Bioperl-l] Bio:Seq $seq_obj->accession_number not
	returningaccession number?
In-Reply-To: <CFE1DF3BA20F424689DA0881A14055BECF2EEF@m.hg.genetics.utah.edu>
References: <CFE1DF3BA20F424689DA0881A14055BECF2EEF@m.hg.genetics.utah.edu>
Message-ID: <539A294D-C541-4BF2-A501-17F69BCA34C6@duke.edu>

Sam -
Yeah what Barry said.

It doesn't get set when reading fasta files - see Hilmar's link below  
for more info - all the info is in the display id, available in $seq- 
 >display_id

my ($gi,$acc,$locus);
(undef,$gi,undef,$acc,$locus) = split(/\|/,$seq->display_id);
$seq->accession_number($acc);

I thought there was a function already to do this for you, but I  
guess not.  There is something Search::Hit objects to parse accession  
number so maybe we can consolidate this if someone volunteers to do it.

See also Hilmar's response about this:
http://bioperl.org/pipermail/bioperl-l/2005-August/019579.html

I've added it as a Q&A to the new wiki FAQ which we'll roll out soon.

-jason

On Dec 4, 2005, at 4:23 PM, Barry Moore wrote:

> Sam-
>
> The fasta parser makes no attempt to parse the fasta header since  
> there
> is no standard format for what should be in a fasta header.  Parse the
> accession out of the primary_id field with a regular expression in  
> your
> script or use GenBank or ENSEMBL format sequences to get all the  
> goodies
> parsed for you.  Google on "accession fasta parse site:bioperl.org" to
> read other posts on this topic.
>
> Barry
>
> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org
> [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Sam
> Al-Droubi
> Sent: Sunday, December 04, 2005 1:18 PM
> To: BioPerl list BioPerl list
> Subject: [Bioperl-l] Bio:Seq $seq_obj->accession_number not
> returningaccession number?
>
> The fasta format for this sequence AF410462 from NCBI looks like this
>
>
>> gi|17066572|gb|AF410462.1|AF410462 Mus musculus PEM homeobox (Pem)
> gene, promoter region and partial cds
> ATGCGTGTGGGCATGCGCTCATGCCCACTTGCTTGAGCACATGTGTGCTCACATGGACGTTAGAGGCAAC
> TTTCAGGAGTTATTTTTTTCCCTTCTAACTTGAGTTCCTGGACCTCAGACTTGTATAATAGGTACTTTCC
> CAACTTAAGTCTTACTGGCTCCAGGGTATCTGGTATACTCTTCTAGCCTCCAAGGGCAGCCACTCATGCT
> TCTTCAGGTGTGAAGAGGTGAGCCAGATACAACGGTGGGAGGCAGTGTGCCCTCAGTGTGTAGACTCTTT
> ATGCCCTTGGGGATTAGCGCCTCTAGCTGCCAGTCGGGTCTCTGGGTCCCTCCTGCTAAGGCCACTCTCG
> TCATGGTTCCTCTTGTCCTGGTGAGCCATTACGACCCTCTCACTTCCTTGTGTTCTCTTCCCTGTGTTCT
> CTCTCTGCTGCTGTGGCCATTCTAGCTCCCTGCACAGTCCTTCAAGCTCACCTCCTGCCTTCCGTGGACA
> AGAGGAAGCACAAAGAATCATCCAGTATGTATGCTCATGGCATAAGGGGATCCTGGGGAAGGGCTGAAGC
> CTGAGCCGGGCTGGTCAACAGAATCTCCCTCTCCCTAACTCCATCTCCCTCTCCTTCCCTCTTCCTCTCT
> CTATCCCTCCCCCCTCTCTCCCCCCACCACCGCATGTTTTGGGTCAGCTGACTGCTCTAGCCTTGATGAG
> ATATCTTCCCAGGAAGAGTTGGTGCTGACTGTACAGATTGAGTTAGAGGGAGGGAAGAAAGCTCCTGTTT
> GATCACTGGAGATCTTTATGCCTAGCTACATGTCTTACCAAAGCCAGGGGAGTCAGCTGAGCTGTAACTG
> GGCACCCTAAGTTCTGCACACCCACATGCCCATGAACTGTGTCCATCTTGCAAGCACATCGTGCTCATTA
> CATCCCCAAACTGCTATCACTTGTGTACCCCAAAGGCTCGGCCCACAGGAACGTCCTGTGAGCAAATCAC
> AAAGACCAGCTTAGGGCTGGAAACATTGTAACCTGAAGTAGGCCAGAGGAGATCCCTGCCAGGTTGAGCA
> TCACAGATCTCATTCTGTTCCCGGGGACACCAGGGGCCCAAGCTCAGAATCTGCCGAAGCATAACTTCAT
> CATTGATCCTATTCAGGGTATGGAAGCTGAGGGTTCCAGCCGCAAGGTCACCAGGCTACTCCGCCTGGGA
> GTCAAGGAAG
>
>  When I read this from a file as a sequence object using Bio::Seq I  
> get
> accession_number unknow.  The
>  accession number is in the header of the fasta file.  Anyone knows  
> why
> this happens.
>
>  My code looks like this:
>
>  print "primary id is: ",$seq_obj->primary_id."\n";
>  print "Description is ",$seq_obj->desc."\n";
>  print "Accession Number is ",$seq_obj->accession_number."\n";
>
>  Output looks like this:
>
>  primary id is: gi|17066572|gb|AF410462.1|AF410462
>  Description is Mus musculus PEM homeobox (Pem) gene, promoter region
> and partial cds
>  Accession Number is unknown
>
>
>  Thank you.
>
>
>
>
>
> Sincerely,
> Sam Al-Droubi, M.S.
> saldroubi@yahoo.com
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12


From angshu96 at gmail.com  Sun Dec  4 20:32:20 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Sun Dec  4 22:11:49 2005
Subject: [Bioperl-l] parsing a BLAST output
Message-ID: <df8328740512041732g9b22143y42f01182357e2e96@mail.gmail.com>

Hi,

To begin with, I'm new to Bioperl.
Now, I've written the following simple piece of code to parse a WU-Blast
output which filters data *for a given e-value and >50% overlap*.

I'm writing the main algorithm here:

my $blast_report = $ARG[1];
my $threshold_evalue = $ARG[2];

my $in = new Bio::SearchIO(-format => 'blast', -file => $blast_report);

while (my $result = $in -> next_result)
   {
      while(my $hit = $result->next_hit)
         {
            if(($line{$hit->name} == $line{$result->query_accession}))
               {
                  next;
               }
            if($hit->hsp->evalue <= $threshold_evalue)
               {
                  if($hit->hsp->frac_indentical>=0.5)
                     {
                        print $line{$result->query_accession} . "\t" .
$line{$hit->name} . "\t" . $hit->hsp-evalue . "\n";
                    }
              }
      }
}

My questions are:

1. does the frac_identical gives the measure of % overlap? Or, are there any
other methods?
2. now, i don't have any blast data sets to test my code upon.could any of
the experienced users let me know whether the algorithm is fine?any
tip-offs on any point (from optimization to syntactical errors) are heartily
welcome.
3. could any one please let me know if i can find sample wu-blast outputs to
test my script upon?

Appreciate your guidance.

Thanks,
Angshu

From jason.stajich at duke.edu  Sun Dec  4 23:00:06 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Sun Dec  4 22:57:57 2005
Subject: [Bioperl-l] parsing a BLAST output
In-Reply-To: <df8328740512041732g9b22143y42f01182357e2e96@mail.gmail.com>
References: <df8328740512041732g9b22143y42f01182357e2e96@mail.gmail.com>
Message-ID: <82B9FC7C-BE37-4961-85BB-6014CEADE8E7@duke.edu>

frac_identical gives the fraction of bases in the HSP that are  
identical.

overlap would be calculated from (length of the query aligned) /  
(length of query) or (length of hit aligned) / (length of hit).

So for an HSP you can calculate this
  $fracqaligned = $hsp->query->length / $result->query_length;
  $frachaligned = $hsp->hit->length / $hit->length;

But remember there may be multiple HSPs so you may need to merge the  
HSP information to get the total length aligned.  If there is a  
repeated domain or multiple high scoring suboptimal alignments this  
can cause things to get a little tricky.

There are two methods provided in the HitI interface called
frac_aligned_query() and frac_aligned_hit() do try and take all of  
this into account for you, but I admit this is less well tested  
code.  But do give them a try:
  $fracqaligned = $hit->frac_aligned_query();
  $frachaligned = $hit->frac_aligned_hit();


If you are using WU-BLASTP add the -postsw option to get a refined  
alignment which will merge HSPs where appropriate so you should use  
that.

You can also use the -links option to get WU-BLAST to get the logical  
ordering and a consistent path through the HSPs.


On Dec 4, 2005, at 8:32 PM, Angshu Kar wrote:

> Hi,
>
> To begin with, I'm new to Bioperl.
> Now, I've written the following simple piece of code to parse a WU- 
> Blast
> output which filters data *for a given e-value and >50% overlap*.
>
> I'm writing the main algorithm here:
>
> my $blast_report = $ARG[1];
> my $threshold_evalue = $ARG[2];
>
> my $in = new Bio::SearchIO(-format => 'blast', -file =>  
> $blast_report);
>
> while (my $result = $in -> next_result)
>    {
>       while(my $hit = $result->next_hit)
>          {
>             if(($line{$hit->name} == $line{$result->query_accession}))
>                {
>                   next;
>                }
>             if($hit->hsp->evalue <= $threshold_evalue)
>                {
>                   if($hit->hsp->frac_indentical>=0.5)
>                      {
>                         print $line{$result->query_accession} . "\t" .
> $line{$hit->name} . "\t" . $hit->hsp-evalue . "\n";
>                     }
>               }
>       }
> }
>
> My questions are:
>
> 1. does the frac_identical gives the measure of % overlap? Or, are  
> there any
> other methods?
> 2. now, i don't have any blast data sets to test my code upon.could  
> any of
> the experienced users let me know whether the algorithm is fine?any
> tip-offs on any point (from optimization to syntactical errors) are  
> heartily
> welcome.
> 3. could any one please let me know if i can find sample wu-blast  
> outputs to
> test my script upon?

http://fungal.genome.duke.edu/~jes12/BGT203.2005/sample_reports/

Also checkout the biodata repository from bioperl and look in the  
DB_Searching directory, we had started a  project cataloging example  
reports in all the different formats.  This sort of fizzled out, but  
could still use some volunteers to better organize things and  
incorporate more examples.

http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/biodata/ 
DB_Searching/


> Appreciate your guidance.
>
> Thanks,
> Angshu
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12


From osborne1 at optonline.net  Mon Dec  5 09:46:06 2005
From: osborne1 at optonline.net (Brian Osborne)
Date: Mon Dec  5 09:50:22 2005
Subject: [Bioperl-l] parsing a BLAST output
In-Reply-To: <df8328740512041732g9b22143y42f01182357e2e96@mail.gmail.com>
Message-ID: <BFB9BCDE.6583%osborne1@optonline.net>

Angshu,

It looks like there's WU Blast output used in various tests:

t/data/dnaEbsub_ecoli.wublastx
t/data/ecolitst.wublastp
t/data/ecolitst.noseqs.wublastp


Brian O.


On 12/4/05 8:32 PM, "Angshu Kar" <angshu96@gmail.com> wrote:

> Hi,
> 
> To begin with, I'm new to Bioperl.
> Now, I've written the following simple piece of code to parse a WU-Blast
> output which filters data *for a given e-value and >50% overlap*.
> 
> I'm writing the main algorithm here:
> 
> my $blast_report = $ARG[1];
> my $threshold_evalue = $ARG[2];
> 
> my $in = new Bio::SearchIO(-format => 'blast', -file => $blast_report);
> 
> while (my $result = $in -> next_result)
>    {
>       while(my $hit = $result->next_hit)
>          {
>             if(($line{$hit->name} == $line{$result->query_accession}))
>                {
>                   next;
>                }
>             if($hit->hsp->evalue <= $threshold_evalue)
>                {
>                   if($hit->hsp->frac_indentical>=0.5)
>                      {
>                         print $line{$result->query_accession} . "\t" .
> $line{$hit->name} . "\t" . $hit->hsp-evalue . "\n";
>                     }
>               }
>       }
> }
> 
> My questions are:
> 
> 1. does the frac_identical gives the measure of % overlap? Or, are there any
> other methods?
> 2. now, i don't have any blast data sets to test my code upon.could any of
> the experienced users let me know whether the algorithm is fine?any
> tip-offs on any point (from optimization to syntactical errors) are heartily
> welcome.
> 3. could any one please let me know if i can find sample wu-blast outputs to
> test my script upon?
> 
> Appreciate your guidance.
> 
> Thanks,
> Angshu
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From rsultana at jimmy.harvard.edu  Mon Dec  5 13:27:13 2005
From: rsultana at jimmy.harvard.edu (Razvan Sultana)
Date: Mon Dec  5 13:45:50 2005
Subject: [Bioperl-l] remote location support in BioSQL (bioperl-db) /Oracle
Message-ID: <43948681.1050606@jimmy.harvard.edu>

Hi !
I have a question regarding the bioperl-db implementation in Oracle.
I have created a BioSQL schema in Oracle and populated with the latest 
version of Genbank.
I used the "bleeding edge" version of bioperl, bioperl-db and 
bioperl-schema from the CVS repository.

When I try to extract the spliced sequences of the CDS features of 
entries that have remote locations (e.g., for AF327267: 
join(4..190,AF327268.1:89..275,AF327268.1:780..930,
                     AF327268.1:1049..1196,AF327269.1:63..229,
                     AF327269.1:522..659,AF327269.1:784..917,
                     AF327269.1:1461..1582,AF327270.1:100..173,
                     AF327270.1:349..417)
the appended  code complains that it
Can't locate object method "get_Seq_by_acc" via package 
"Bio::DB::BioSQL::DBAdaptor"
and rightly so, because the above object doesn't implement the 
Bio::DB::RandomAccessI interface.
If I omit $db from the spliced_seq() method call, I obviously get the 
message:
MSG: cannot get remote location for AF327268.1 without a valid 
Bio::DB::RandomAccessI database handle (like Bio::DB::GenBank)

My question is: is there an object to the BioSQL schema that implements 
Bio::DB::RandomAccessI ?
If there is, how do I get a handle to it?
If there isn't, I would be willing to help implementing it.

Thank you,
Razvan Sultana

#!/usr/local/bin/perl
use strict;
use Bio::DB::BioDB;
use Bio::Seq::RichSeq;
use Bio::DB::Query::BioQuery;
use Getopt::Long;

my $host = 'kevin';
my $dbuser = 'biosql';
my $dbpass;
my $dbname = 'biocompd';
my $driver = 'Oracle';
my $acc;
my $biodbname = 'genbank';

&GetOptions( 'host=s' => \$host,
             'driver=s' => \$driver,
         'dbuser=s' => \$dbuser,
         'dbpass=s' => \$dbpass,
         'dbname=s' => \$dbname,
         'accession=s' => \$acc);
$acc = 'AF327270' unless $acc;

my $db = Bio::DB::BioDB->new(-database => "biosql",
                 -host     => $host,
                 -dbname   => $dbname,
                 -driver   => $driver,
                 -user     => $dbuser,
                 -pass     => $dbpass,
                 );

my $seqadaptor = $db->get_object_adaptor('Bio::SeqI');
my $query = Bio::DB::Query::BioQuery->new(-datacollections => 
['Bio::PrimarySeqI e',
                                                               
'BioNamespace=>Bio::PrimarySeqI db'],
                                          -where => ["e.accession_number 
= '$acc'",
                                                     "db.namespace= 
'$biodbname'"]);
my $seq_object = Bio::Seq::RichSeq->new();
my $query_result = $seqadaptor->find_by_query($query);

while ($seq_object = $query_result->next_object()) {
  for my $feature ($seq_object->get_SeqFeatures()) {
    my $full_sequence = $seq_object->seq();
    my $cds_seq = $feature->spliced_seq($db)->seq() if 
($feature->primary_tag() eq 'CDS');
  }
}
From dyhyun at rda.go.kr  Mon Dec  5 09:26:21 2005
From: dyhyun at rda.go.kr (=?ks_c_5601-1987?B?x/a1tcCx?=)
Date: Mon Dec  5 18:52:07 2005
Subject: [Bioperl-l] trouble to retrieve sequence.. I'm a BEGINNER...
Message-ID: <000a01c5f9a7$dd9a2a90$28661e0a@NIAB102040>

Hi,

I'm a bioperl beginner and studying bioperl code according to Beginners HOWTO.
I have a trouble in section 9. Retrievin a sequence from a database.
How can I solve this promblem? Please, help me~~

1. ver. of Bioperl : 1.4

2. OS : linux

3. I am trying to retrieve seq. from GenBank.

4. code
#!/usr/bin/perl -w

use Bio::DB::GenBank;
use Bio::DB::Query::GenBank;

$query = "Arabidopsis[ORGN] AND topoisomerase[TITL] an 0:3000[SLEN]";
$query_obj = Bio::DB::Query::GenBank->new(-db => 'nucleotide',
                                -query => $query);

$gb_obj = Bio::DB::GenBank->new;

$stream_obj = $gb_obj->get_Stream_by_query($query_obj);

while ($seq_obj = $stream_obj->next_seq){
        #do something with the sequence object
        print $seq_obj->display_id,"\t", $seq_obj->length, "\n";
}

5. error messages

Can't locate IO/String.pm in @INC (@INC contains: /usr/lib/perl5/5.6.0/i386-linux /usr/lib/perl5/5.6.0 /usr/lib/perl5/site_perl/5.6.0/i386-linux /usr/lib/perl5/site_perl/5.6.0 /usr/lib/perl5/site_perl .) at /usr/lib/perl5/site_perl/5.6.0/Bio/DB/WebDBSeqI.pm line 90.
BEGIN failed--compilation aborted at /usr/lib/perl5/site_perl/5.6.0/Bio/DB/WebDBSeqI.pm line 90.
Compilation failed in require at /usr/lib/perl5/site_perl/5.6.0/Bio/DB/NCBIHelper.pm line 82.
BEGIN failed--compilation aborted at /usr/lib/perl5/site_perl/5.6.0/Bio/DB/NCBIHelper.pm line 82.
Compilation failed in require at /usr/lib/perl5/site_perl/5.6.0/Bio/DB/GenBank.pm line 124.
BEGIN failed--compilation aborted at /usr/lib/perl5/site_perl/5.6.0/Bio/DB/GenBank.pm line 124.
Compilation failed in require at query.pl line 3.
BEGIN failed--compilation aborted at query.pl line 3.

ps. I read the FAQ pages. I found this answer. 
"NCBI changed the web CGI script that provided this access. You must be using bioperl <= 0.7.2. The developer release 0.9.3 contains this fix as does the 1.0 release." 
I cant't understand what it means....

From torsten.seemann at infotech.monash.edu.au  Mon Dec  5 19:56:33 2005
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Mon Dec  5 20:12:57 2005
Subject: [Bioperl-l] remoteblast doesn't save the Output File
In-Reply-To: <438F7DF1.5060000@gmx.at>
References: <438F7DF1.5060000@gmx.at>
Message-ID: <1133830593.20822.13.camel@chauvel.csse.monash.edu.au>

Hubert,

> I'm quite desperated, because since two days I'm trying to save my 
> remoteblast Output and it doesn't work
> here we go....

I tried your script and it works for me.
Here is the output:

% ./hubert.pl

Name "Bio::Tools::Run::RemoteBlast::OUT" used only once: possible typo
at
p\uffff   \uffff\uffff      \uffff\uffffJ line 613.
entering blast....Blast entered successfully
submit Sequence...just do it....
MMVVVVVVVVVVVVVVVVVVVVGGGGGRGYHTHHGHHPLQWWWW
entering while loop for saving Output....
retrieved Results successfully
retrieved Results successfully
retrieved Results successfully
1133830353-27473-43968273674.BLASTQ4
File saved successfully

% ls

40 1 .out   4 hubert.pl*   4 Perm.txt

% head 1\ .out

BLASTP 2.2.12 [Aug-07-2005]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A.
Sch\uffffffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman
(1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.

RID: 1133830353-27473-43968273674.BLASTQ4

Database: Non-redundant SwissProt sequences



-- 
Torsten Seemann <torsten.seemann@infotech.monash.edu.au>
Victorian Bioinformatics Consortium

From jason.stajich at duke.edu  Mon Dec  5 19:02:41 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Mon Dec  5 20:14:09 2005
Subject: [Bioperl-l] trouble to retrieve sequence.. I'm a BEGINNER...
In-Reply-To: <000a01c5f9a7$dd9a2a90$28661e0a@NIAB102040>
References: <000a01c5f9a7$dd9a2a90$28661e0a@NIAB102040>
Message-ID: <124F8CE0-A0D0-40DD-9772-2C337801D53C@duke.edu>

You need
IO::String and LWP::UserAgent perl modules installed to access  
GenBank remote database.  The FAQ answer you are referring to only  
has to do with bioperl versions before 0.7 - more than 3 years ago so  
it isn't relevant anymore.

-jason
On Dec 5, 2005, at 9:26 AM, ??? wrote:

> Hi,
>
> I'm a bioperl beginner and studying bioperl code according to  
> Beginners HOWTO.
> I have a trouble in section 9. Retrievin a sequence from a database.
> How can I solve this promblem? Please, help me~~
>
> 1. ver. of Bioperl : 1.4
>
> 2. OS : linux
>
> 3. I am trying to retrieve seq. from GenBank.
>
> 4. code
> #!/usr/bin/perl -w
>
> use Bio::DB::GenBank;
> use Bio::DB::Query::GenBank;
>
> $query = "Arabidopsis[ORGN] AND topoisomerase[TITL] an 0:3000[SLEN]";
> $query_obj = Bio::DB::Query::GenBank->new(-db => 'nucleotide',
>                                 -query => $query);
>
> $gb_obj = Bio::DB::GenBank->new;
>
> $stream_obj = $gb_obj->get_Stream_by_query($query_obj);
>
> while ($seq_obj = $stream_obj->next_seq){
>         #do something with the sequence object
>         print $seq_obj->display_id,"\t", $seq_obj->length, "\n";
> }
>
> 5. error messages
>
> Can't locate IO/String.pm in @INC (@INC contains: /usr/lib/ 
> perl5/5.6.0/i386-linux /usr/lib/perl5/5.6.0 /usr/lib/perl5/ 
> site_perl/5.6.0/i386-linux /usr/lib/perl5/site_perl/5.6.0 /usr/lib/ 
> perl5/site_perl .) at /usr/lib/perl5/site_perl/5.6.0/Bio/DB/ 
> WebDBSeqI.pm line 90.
> BEGIN failed--compilation aborted at /usr/lib/perl5/site_perl/5.6.0/ 
> Bio/DB/WebDBSeqI.pm line 90.
> Compilation failed in require at /usr/lib/perl5/site_perl/5.6.0/Bio/ 
> DB/NCBIHelper.pm line 82.
> BEGIN failed--compilation aborted at /usr/lib/perl5/site_perl/5.6.0/ 
> Bio/DB/NCBIHelper.pm line 82.
> Compilation failed in require at /usr/lib/perl5/site_perl/5.6.0/Bio/ 
> DB/GenBank.pm line 124.
> BEGIN failed--compilation aborted at /usr/lib/perl5/site_perl/5.6.0/ 
> Bio/DB/GenBank.pm line 124.
> Compilation failed in require at query.pl line 3.
> BEGIN failed--compilation aborted at query.pl line 3.
>
> ps. I read the FAQ pages. I found this answer.
> "NCBI changed the web CGI script that provided this access. You  
> must be using bioperl <= 0.7.2. The developer release 0.9.3  
> contains this fix as does the 1.0 release."
> I cant't understand what it means....
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12



From torsten.seemann at infotech.monash.edu.au  Mon Dec  5 22:05:53 2005
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Mon Dec  5 22:04:53 2005
Subject: [Bioperl-l] remoteblast doesn't save the Output File
In-Reply-To: <4394DC21.90401@gmx.at>
References: <438F7DF1.5060000@gmx.at>
	<1133830593.20822.13.camel@chauvel.csse.monash.edu.au>
	<4394DC21.90401@gmx.at>
Message-ID: <1133838353.20822.32.camel@chauvel.csse.monash.edu.au>

On Mon, 2005-12-05 at 18:32 -0600, Hubert Prielinger wrote:
> Hello Torsten,
> thanks for your Response, I have already managed to run the program, 
> thank you very much.
> but I still have the Problem, that I don't know how set the Gap 
> Parameters, because I want to use PAM30, but
> it doesn't work with the Default Parameters......
> If you know how to change them, I would really appreciate telling me. I 
> have tried "gap" and "ext", but it doesn't work.
> and I can't find anything online...

If you read the module manual page 
ie. perldoc Bio::Tools::Run::RemoteBlast
there is an example - just set:

$Bio::Tools::Run::RemoteBlast::HEADER{'MATRIX_NAME'} = 'PAM30';

'MATRIX_NAME' is just one possibility, the perldoc
refers to this http://www.ncbi.nlm.nih.gov/BLAST/Doc/urlapi.html
which has the 'GAP_COSTS' you are looking for:
http://www.ncbi.nlm.nih.gov/BLAST/Doc/node28.html

-- 
Torsten Seemann <torsten.seemann@infotech.monash.edu.au>
Victorian Bioinformatics Consortium

From torsten.seemann at infotech.monash.edu.au  Mon Dec  5 19:49:17 2005
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Tue Dec  6 00:26:46 2005
Subject: [Bioperl-l] trouble to retrieve sequence.. I'm a BEGINNER...
In-Reply-To: <000a01c5f9a7$dd9a2a90$28661e0a@NIAB102040>
References: <000a01c5f9a7$dd9a2a90$28661e0a@NIAB102040>
Message-ID: <1133830157.20822.9.camel@chauvel.csse.monash.edu.au>

> I'm a bioperl beginner and studying bioperl code according to Beginners HOWTO.
> I have a trouble in section 9. Retrievin a sequence from a database.
> How can I solve this promblem? Please, help me~~
> 1. ver. of Bioperl : 1.4
> 2. OS : linux
> 3. I am trying to retrieve seq. from GenBank.
> 4. code
> 5. error messages
> Can't locate IO/String.pm in @INC (@INC contains: /usr/lib/perl5/5.6.0/i386-linux /usr/lib/perl5/5.6.0 /usr/lib/perl5/site_perl/5.6.0/i386-linux /usr/lib/perl5/site_perl/5.6.0 /usr/lib/perl5/site_perl .) at /usr/lib/perl5/site_perl/5.6.0/Bio/DB/WebDBSeqI.pm line 90.

When you get a lot of error messages, you should look at the first one
and try and solve that first.

It says it is trying to load the Perl IO::String module (via @INC search
path) but can't locate it. You need to install the IO::String module.

How to install Perl modules:
http://perl.about.com/od/perlmodule1/l/aa030500a.htm

IO::String source code:
http://search.cpan.org/CPAN/authors/id/G/GA/GAAS/IO-String-1.07.tar.gz

Then try your script again. You may find there are other modules which
need to be installed too.

-- 
Torsten Seemann <torsten.seemann@infotech.monash.edu.au>
Victorian Bioinformatics Consortium

From torsten.seemann at infotech.monash.edu.au  Tue Dec  6 01:28:00 2005
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Tue Dec  6 02:59:18 2005
Subject: [Bioperl-l] trouble to retrieve sequence.. I'm a BEGINNER...
In-Reply-To: <001601c5fa26$277816d0$28661e0a@NIAB102040>
References: <000a01c5f9a7$dd9a2a90$28661e0a@NIAB102040>
	<1133830157.20822.9.camel@chauvel.csse.monash.edu.au>
	<001601c5fa26$277816d0$28661e0a@NIAB102040>
Message-ID: <1133850480.20822.58.camel@chauvel.csse.monash.edu.au>

Hyun,

> Thank you for your help.
> I solved the problem by installing IO:String module...but
> there are another problems like this;
> ------------- EXCEPTION  -------------
> MSG: Error from Genbank: Your query produced warning/error messages - check flagged link below.
> STACK Bio::DB::Query::GenBank::_parse_response /usr/lib/perl5/site_perl/5.6.0/Bio/DB/Query/GenBank.pm:267
> STACK Bio::DB::Query::WebQuery::_run_query /usr/lib/perl5/site_perl/5.6.0/Bio/DB/Query/WebQuery.pm:268
> STACK Bio::DB::Query::GenBank::cookie /usr/lib/perl5/site_perl/5.6.0/Bio/DB/Query/GenBank.pm:177
> STACK Bio::DB::NCBIHelper::get_request /usr/lib/perl5/site_perl/5.6.0/Bio/DB/NCBIHelper.pm:187
> STACK Bio::DB::WebDBSeqI::get_seq_stream /usr/lib/perl5/site_perl/5.6.0/Bio/DB/WebDBSeqI.pm:438
> STACK Bio::DB::NCBIHelper::get_Stream_by_query /usr/lib/perl5/site_perl/5.6.0/Bio/DB/NCBIHelper.pm:248
> STACK toplevel query.pl:12
> Could you help me one more time, please?

It seems the MSG: line says that your Genbank query was invalid.

Your original query was:
$query = "Arabidopsis[ORGN] AND topoisomerase[TITL] an 0:3000[SLEN]";

Should that be " AND 0:3000[SLEN]" ?

-- 
Torsten Seemann <torsten.seemann@infotech.monash.edu.au>
Victorian Bioinformatics Consortium

From hlapp at gmx.net  Tue Dec  6 11:44:41 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Tue Dec  6 11:49:08 2005
Subject: [Bioperl-l] remote location support in BioSQL (bioperl-db) /Oracle
In-Reply-To: <43948681.1050606@jimmy.harvard.edu>
References: <43948681.1050606@jimmy.harvard.edu>
Message-ID: <c2db15f18bfdc56d3e7f6536ffeff537@gmx.net>

Good point. No there is no such module, i.e., one that would implement 
RandomAccessI for BioSQL. Shouldn't be hard to write though; would you 
be inclined to volunteer?

	-hilmar

On Dec 5, 2005, at 10:27 AM, Razvan Sultana wrote:

> Hi !
> I have a question regarding the bioperl-db implementation in Oracle.
> I have created a BioSQL schema in Oracle and populated with the latest 
> version of Genbank.
> I used the "bleeding edge" version of bioperl, bioperl-db and 
> bioperl-schema from the CVS repository.
>
> When I try to extract the spliced sequences of the CDS features of 
> entries that have remote locations (e.g., for AF327267: 
> join(4..190,AF327268.1:89..275,AF327268.1:780..930,
>                     AF327268.1:1049..1196,AF327269.1:63..229,
>                     AF327269.1:522..659,AF327269.1:784..917,
>                     AF327269.1:1461..1582,AF327270.1:100..173,
>                     AF327270.1:349..417)
> the appended  code complains that it
> Can't locate object method "get_Seq_by_acc" via package 
> "Bio::DB::BioSQL::DBAdaptor"
> and rightly so, because the above object doesn't implement the 
> Bio::DB::RandomAccessI interface.
> If I omit $db from the spliced_seq() method call, I obviously get the 
> message:
> MSG: cannot get remote location for AF327268.1 without a valid 
> Bio::DB::RandomAccessI database handle (like Bio::DB::GenBank)
>
> My question is: is there an object to the BioSQL schema that 
> implements Bio::DB::RandomAccessI ?
> If there is, how do I get a handle to it?
> If there isn't, I would be willing to help implementing it.
>
> Thank you,
> Razvan Sultana
>
> #!/usr/local/bin/perl
> use strict;
> use Bio::DB::BioDB;
> use Bio::Seq::RichSeq;
> use Bio::DB::Query::BioQuery;
> use Getopt::Long;
>
> my $host = 'kevin';
> my $dbuser = 'biosql';
> my $dbpass;
> my $dbname = 'biocompd';
> my $driver = 'Oracle';
> my $acc;
> my $biodbname = 'genbank';
>
> &GetOptions( 'host=s' => \$host,
>             'driver=s' => \$driver,
>         'dbuser=s' => \$dbuser,
>         'dbpass=s' => \$dbpass,
>         'dbname=s' => \$dbname,
>         'accession=s' => \$acc);
> $acc = 'AF327270' unless $acc;
>
> my $db = Bio::DB::BioDB->new(-database => "biosql",
>                 -host     => $host,
>                 -dbname   => $dbname,
>                 -driver   => $driver,
>                 -user     => $dbuser,
>                 -pass     => $dbpass,
>                 );
>
> my $seqadaptor = $db->get_object_adaptor('Bio::SeqI');
> my $query = Bio::DB::Query::BioQuery->new(-datacollections => 
> ['Bio::PrimarySeqI e',
>                                                               
> 'BioNamespace=>Bio::PrimarySeqI db'],
>                                          -where => 
> ["e.accession_number = '$acc'",
>                                                     "db.namespace= 
> '$biodbname'"]);
> my $seq_object = Bio::Seq::RichSeq->new();
> my $query_result = $seqadaptor->find_by_query($query);
>
> while ($seq_object = $query_result->next_object()) {
>  for my $feature ($seq_object->get_SeqFeatures()) {
>    my $full_sequence = $seq_object->seq();
>    my $cds_seq = $feature->spliced_seq($db)->seq() if 
> ($feature->primary_tag() eq 'CDS');
>  }
> }
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From olenka.m at gmail.com  Tue Dec  6 12:13:53 2005
From: olenka.m at gmail.com (Olena Morozova)
Date: Tue Dec  6 12:11:35 2005
Subject: [Bioperl-l] (no subject)
Message-ID: <259a224c0512060913m71f41da7q5791a4b9bd6270c7@mail.gmail.com>

Hi,

I am trying to extract sequences from a fasta file using the script
below (the fasta file has been indexed). I keep getting the message:
failure to provide a valid PrimarySeqI object. Why is this?

Thanks a lot for all your help!!
Olena


#! /usr/bin/perl -w

    use Bio::Index::Fasta;
    use strict;

    my $Index_File_Name = "c:/perl/known.fa";
    my $inx = Bio::Index::Fasta->new('-filename' => $Index_File_Name);
    my $out = Bio::SeqIO->new('-format' => 'Fasta','-fh' => \*STDOUT);

    foreach my $id ('puffer_tf_id1.txt') {
        my $seq = $inx->fetch($id); # Returns Bio::Seq object
	$out->write_seq($seq);
    }
On 12/6/05, Hilmar Lapp <hlapp@gmx.net> wrote:
> Good point. No there is no such module, i.e., one that would implement
> RandomAccessI for BioSQL. Shouldn't be hard to write though; would you
> be inclined to volunteer?
>
> 	-hilmar
>
> On Dec 5, 2005, at 10:27 AM, Razvan Sultana wrote:
>
> > Hi !
> > I have a question regarding the bioperl-db implementation in Oracle.
> > I have created a BioSQL schema in Oracle and populated with the latest
> > version of Genbank.
> > I used the "bleeding edge" version of bioperl, bioperl-db and
> > bioperl-schema from the CVS repository.
> >
> > When I try to extract the spliced sequences of the CDS features of
> > entries that have remote locations (e.g., for AF327267:
> > join(4..190,AF327268.1:89..275,AF327268.1:780..930,
> >                     AF327268.1:1049..1196,AF327269.1:63..229,
> >                     AF327269.1:522..659,AF327269.1:784..917,
> >                     AF327269.1:1461..1582,AF327270.1:100..173,
> >                     AF327270.1:349..417)
> > the appended  code complains that it
> > Can't locate object method "get_Seq_by_acc" via package
> > "Bio::DB::BioSQL::DBAdaptor"
> > and rightly so, because the above object doesn't implement the
> > Bio::DB::RandomAccessI interface.
> > If I omit $db from the spliced_seq() method call, I obviously get the
> > message:
> > MSG: cannot get remote location for AF327268.1 without a valid
> > Bio::DB::RandomAccessI database handle (like Bio::DB::GenBank)
> >
> > My question is: is there an object to the BioSQL schema that
> > implements Bio::DB::RandomAccessI ?
> > If there is, how do I get a handle to it?
> > If there isn't, I would be willing to help implementing it.
> >
> > Thank you,
> > Razvan Sultana
> >
> > #!/usr/local/bin/perl
> > use strict;
> > use Bio::DB::BioDB;
> > use Bio::Seq::RichSeq;
> > use Bio::DB::Query::BioQuery;
> > use Getopt::Long;
> >
> > my $host = 'kevin';
> > my $dbuser = 'biosql';
> > my $dbpass;
> > my $dbname = 'biocompd';
> > my $driver = 'Oracle';
> > my $acc;
> > my $biodbname = 'genbank';
> >
> > &GetOptions( 'host=s' => \$host,
> >             'driver=s' => \$driver,
> >         'dbuser=s' => \$dbuser,
> >         'dbpass=s' => \$dbpass,
> >         'dbname=s' => \$dbname,
> >         'accession=s' => \$acc);
> > $acc = 'AF327270' unless $acc;
> >
> > my $db = Bio::DB::BioDB->new(-database => "biosql",
> >                 -host     => $host,
> >                 -dbname   => $dbname,
> >                 -driver   => $driver,
> >                 -user     => $dbuser,
> >                 -pass     => $dbpass,
> >                 );
> >
> > my $seqadaptor = $db->get_object_adaptor('Bio::SeqI');
> > my $query = Bio::DB::Query::BioQuery->new(-datacollections =>
> > ['Bio::PrimarySeqI e',
> >
> > 'BioNamespace=>Bio::PrimarySeqI db'],
> >                                          -where =>
> > ["e.accession_number = '$acc'",
> >                                                     "db.namespace=
> > '$biodbname'"]);
> > my $seq_object = Bio::Seq::RichSeq->new();
> > my $query_result = $seqadaptor->find_by_query($query);
> >
> > while ($seq_object = $query_result->next_object()) {
> >  for my $feature ($seq_object->get_SeqFeatures()) {
> >    my $full_sequence = $seq_object->seq();
> >    my $cds_seq = $feature->spliced_seq($db)->seq() if
> > ($feature->primary_tag() eq 'CDS');
> >  }
> > }
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

From osborne1 at optonline.net  Tue Dec  6 12:28:50 2005
From: osborne1 at optonline.net (Brian Osborne)
Date: Tue Dec  6 12:33:06 2005
Subject: [Bioperl-l] (no subject)
In-Reply-To: <259a224c0512060913m71f41da7q5791a4b9bd6270c7@mail.gmail.com>
Message-ID: <BFBB3482.65D1%osborne1@optonline.net>

Olena,

This is _probably_ the problem described in the FAQ:

http://bioperl.org/Core/Latest/faq.html#Q2.5


Brian O.


On 12/6/05 12:13 PM, "Olena Morozova" <olenka.m@gmail.com> wrote:

> Hi,
> 
> I am trying to extract sequences from a fasta file using the script
> below (the fasta file has been indexed). I keep getting the message:
> failure to provide a valid PrimarySeqI object. Why is this?
> 
> Thanks a lot for all your help!!
> Olena
> 
> 
> #! /usr/bin/perl -w
> 
>     use Bio::Index::Fasta;
>     use strict;
> 
>     my $Index_File_Name = "c:/perl/known.fa";
>     my $inx = Bio::Index::Fasta->new('-filename' => $Index_File_Name);
>     my $out = Bio::SeqIO->new('-format' => 'Fasta','-fh' => \*STDOUT);
> 
>     foreach my $id ('puffer_tf_id1.txt') {
>         my $seq = $inx->fetch($id); # Returns Bio::Seq object
> $out->write_seq($seq);
>     }
> On 12/6/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>> Good point. No there is no such module, i.e., one that would implement
>> RandomAccessI for BioSQL. Shouldn't be hard to write though; would you
>> be inclined to volunteer?
>> 
>> -hilmar
>> 
>> On Dec 5, 2005, at 10:27 AM, Razvan Sultana wrote:
>> 
>>> Hi !
>>> I have a question regarding the bioperl-db implementation in Oracle.
>>> I have created a BioSQL schema in Oracle and populated with the latest
>>> version of Genbank.
>>> I used the "bleeding edge" version of bioperl, bioperl-db and
>>> bioperl-schema from the CVS repository.
>>> 
>>> When I try to extract the spliced sequences of the CDS features of
>>> entries that have remote locations (e.g., for AF327267:
>>> join(4..190,AF327268.1:89..275,AF327268.1:780..930,
>>>                     AF327268.1:1049..1196,AF327269.1:63..229,
>>>                     AF327269.1:522..659,AF327269.1:784..917,
>>>                     AF327269.1:1461..1582,AF327270.1:100..173,
>>>                     AF327270.1:349..417)
>>> the appended  code complains that it
>>> Can't locate object method "get_Seq_by_acc" via package
>>> "Bio::DB::BioSQL::DBAdaptor"
>>> and rightly so, because the above object doesn't implement the
>>> Bio::DB::RandomAccessI interface.
>>> If I omit $db from the spliced_seq() method call, I obviously get the
>>> message:
>>> MSG: cannot get remote location for AF327268.1 without a valid
>>> Bio::DB::RandomAccessI database handle (like Bio::DB::GenBank)
>>> 
>>> My question is: is there an object to the BioSQL schema that
>>> implements Bio::DB::RandomAccessI ?
>>> If there is, how do I get a handle to it?
>>> If there isn't, I would be willing to help implementing it.
>>> 
>>> Thank you,
>>> Razvan Sultana
>>> 
>>> #!/usr/local/bin/perl
>>> use strict;
>>> use Bio::DB::BioDB;
>>> use Bio::Seq::RichSeq;
>>> use Bio::DB::Query::BioQuery;
>>> use Getopt::Long;
>>> 
>>> my $host = 'kevin';
>>> my $dbuser = 'biosql';
>>> my $dbpass;
>>> my $dbname = 'biocompd';
>>> my $driver = 'Oracle';
>>> my $acc;
>>> my $biodbname = 'genbank';
>>> 
>>> &GetOptions( 'host=s' => \$host,
>>>             'driver=s' => \$driver,
>>>         'dbuser=s' => \$dbuser,
>>>         'dbpass=s' => \$dbpass,
>>>         'dbname=s' => \$dbname,
>>>         'accession=s' => \$acc);
>>> $acc = 'AF327270' unless $acc;
>>> 
>>> my $db = Bio::DB::BioDB->new(-database => "biosql",
>>>                 -host     => $host,
>>>                 -dbname   => $dbname,
>>>                 -driver   => $driver,
>>>                 -user     => $dbuser,
>>>                 -pass     => $dbpass,
>>>                 );
>>> 
>>> my $seqadaptor = $db->get_object_adaptor('Bio::SeqI');
>>> my $query = Bio::DB::Query::BioQuery->new(-datacollections =>
>>> ['Bio::PrimarySeqI e',
>>> 
>>> 'BioNamespace=>Bio::PrimarySeqI db'],
>>>                                          -where =>
>>> ["e.accession_number = '$acc'",
>>>                                                     "db.namespace=
>>> '$biodbname'"]);
>>> my $seq_object = Bio::Seq::RichSeq->new();
>>> my $query_result = $seqadaptor->find_by_query($query);
>>> 
>>> while ($seq_object = $query_result->next_object()) {
>>>  for my $feature ($seq_object->get_SeqFeatures()) {
>>>    my $full_sequence = $seq_object->seq();
>>>    my $cds_seq = $feature->spliced_seq($db)->seq() if
>>> ($feature->primary_tag() eq 'CDS');
>>>  }
>>> }
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l@portal.open-bio.org
>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>> 
>>> 
>> --
>> -------------------------------------------------------------
>> Hilmar Lapp                            email: lapp at gnf.org
>> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
>> -------------------------------------------------------------
>> 
>> 
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l@portal.open-bio.org
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From olenka.m at gmail.com  Tue Dec  6 11:57:31 2005
From: olenka.m at gmail.com (Olena Morozova)
Date: Tue Dec  6 12:51:56 2005
Subject: [Bioperl-l] Reciprocal best blast
Message-ID: <259a224c0512060857r519a897fpa4ab2f33287a0f44@mail.gmail.com>

Hello everyone,

Does anyone know where I can quickly get a perl script to identify
reciprocal best blast matches for two fasta files?

Thanks a lot for your help,
Olena

From olenka.m at gmail.com  Tue Dec  6 12:34:21 2005
From: olenka.m at gmail.com (Olena Morozova)
Date: Tue Dec  6 13:37:07 2005
Subject: [Bioperl-l] Re: (no subject)
In-Reply-To: <BFBB3482.65D1%osborne1@optonline.net>
References: <259a224c0512060913m71f41da7q5791a4b9bd6270c7@mail.gmail.com>
	<BFBB3482.65D1%osborne1@optonline.net>
Message-ID: <259a224c0512060934k3c27d88fw3b035bd2b4c7371a@mail.gmail.com>

Thank you very much for your reply, Brian.

The script works when I write out the actual ID like this:
my $seq = $inx->fetch('GSTENP00038948001')
However, it does not work when I try to fetch the sequence by the same
ID written in a file (I tried just putting this one ID in the file)...



On 12/6/05, Brian Osborne <osborne1@optonline.net> wrote:
> Olena,
>
> This is _probably_ the problem described in the FAQ:
>
> http://bioperl.org/Core/Latest/faq.html#Q2.5
>
>
> Brian O.
>
>
> On 12/6/05 12:13 PM, "Olena Morozova" <olenka.m@gmail.com> wrote:
>
> > Hi,
> >
> > I am trying to extract sequences from a fasta file using the script
> > below (the fasta file has been indexed). I keep getting the message:
> > failure to provide a valid PrimarySeqI object. Why is this?
> >
> > Thanks a lot for all your help!!
> > Olena
> >
> >
> > #! /usr/bin/perl -w
> >
> >     use Bio::Index::Fasta;
> >     use strict;
> >
> >     my $Index_File_Name = "c:/perl/known.fa";
> >     my $inx = Bio::Index::Fasta->new('-filename' => $Index_File_Name);
> >     my $out = Bio::SeqIO->new('-format' => 'Fasta','-fh' => \*STDOUT);
> >
> >     foreach my $id ('puffer_tf_id1.txt') {
> >         my $seq = $inx->fetch($id); # Returns Bio::Seq object
> > $out->write_seq($seq);
> >     }
> > On 12/6/05, Hilmar Lapp <hlapp@gmx.net> wrote:
> >> Good point. No there is no such module, i.e., one that would implement
> >> RandomAccessI for BioSQL. Shouldn't be hard to write though; would you
> >> be inclined to volunteer?
> >>
> >> -hilmar
> >>
> >> On Dec 5, 2005, at 10:27 AM, Razvan Sultana wrote:
> >>
> >>> Hi !
> >>> I have a question regarding the bioperl-db implementation in Oracle.
> >>> I have created a BioSQL schema in Oracle and populated with the latest
> >>> version of Genbank.
> >>> I used the "bleeding edge" version of bioperl, bioperl-db and
> >>> bioperl-schema from the CVS repository.
> >>>
> >>> When I try to extract the spliced sequences of the CDS features of
> >>> entries that have remote locations (e.g., for AF327267:
> >>> join(4..190,AF327268.1:89..275,AF327268.1:780..930,
> >>>                     AF327268.1:1049..1196,AF327269.1:63..229,
> >>>                     AF327269.1:522..659,AF327269.1:784..917,
> >>>                     AF327269.1:1461..1582,AF327270.1:100..173,
> >>>                     AF327270.1:349..417)
> >>> the appended  code complains that it
> >>> Can't locate object method "get_Seq_by_acc" via package
> >>> "Bio::DB::BioSQL::DBAdaptor"
> >>> and rightly so, because the above object doesn't implement the
> >>> Bio::DB::RandomAccessI interface.
> >>> If I omit $db from the spliced_seq() method call, I obviously get the
> >>> message:
> >>> MSG: cannot get remote location for AF327268.1 without a valid
> >>> Bio::DB::RandomAccessI database handle (like Bio::DB::GenBank)
> >>>
> >>> My question is: is there an object to the BioSQL schema that
> >>> implements Bio::DB::RandomAccessI ?
> >>> If there is, how do I get a handle to it?
> >>> If there isn't, I would be willing to help implementing it.
> >>>
> >>> Thank you,
> >>> Razvan Sultana
> >>>
> >>> #!/usr/local/bin/perl
> >>> use strict;
> >>> use Bio::DB::BioDB;
> >>> use Bio::Seq::RichSeq;
> >>> use Bio::DB::Query::BioQuery;
> >>> use Getopt::Long;
> >>>
> >>> my $host = 'kevin';
> >>> my $dbuser = 'biosql';
> >>> my $dbpass;
> >>> my $dbname = 'biocompd';
> >>> my $driver = 'Oracle';
> >>> my $acc;
> >>> my $biodbname = 'genbank';
> >>>
> >>> &GetOptions( 'host=s' => \$host,
> >>>             'driver=s' => \$driver,
> >>>         'dbuser=s' => \$dbuser,
> >>>         'dbpass=s' => \$dbpass,
> >>>         'dbname=s' => \$dbname,
> >>>         'accession=s' => \$acc);
> >>> $acc = 'AF327270' unless $acc;
> >>>
> >>> my $db = Bio::DB::BioDB->new(-database => "biosql",
> >>>                 -host     => $host,
> >>>                 -dbname   => $dbname,
> >>>                 -driver   => $driver,
> >>>                 -user     => $dbuser,
> >>>                 -pass     => $dbpass,
> >>>                 );
> >>>
> >>> my $seqadaptor = $db->get_object_adaptor('Bio::SeqI');
> >>> my $query = Bio::DB::Query::BioQuery->new(-datacollections =>
> >>> ['Bio::PrimarySeqI e',
> >>>
> >>> 'BioNamespace=>Bio::PrimarySeqI db'],
> >>>                                          -where =>
> >>> ["e.accession_number = '$acc'",
> >>>                                                     "db.namespace=
> >>> '$biodbname'"]);
> >>> my $seq_object = Bio::Seq::RichSeq->new();
> >>> my $query_result = $seqadaptor->find_by_query($query);
> >>>
> >>> while ($seq_object = $query_result->next_object()) {
> >>>  for my $feature ($seq_object->get_SeqFeatures()) {
> >>>    my $full_sequence = $seq_object->seq();
> >>>    my $cds_seq = $feature->spliced_seq($db)->seq() if
> >>> ($feature->primary_tag() eq 'CDS');
> >>>  }
> >>> }
> >>> _______________________________________________
> >>> Bioperl-l mailing list
> >>> Bioperl-l@portal.open-bio.org
> >>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >>>
> >>>
> >> --
> >> -------------------------------------------------------------
> >> Hilmar Lapp                            email: lapp at gnf.org
> >> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> >> -------------------------------------------------------------
> >>
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l@portal.open-bio.org
> >> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >>
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
>

From akholloway at ucdavis.edu  Tue Dec  6 16:24:34 2005
From: akholloway at ucdavis.edu (Alisha Holloway)
Date: Tue Dec  6 17:15:01 2005
Subject: [Bioperl-l] what am I doing wrong with $alignio->next_aln
Message-ID: <a06230903bfbbb0098475@[10.0.1.3]>

An HTML attachment was scrubbed...
URL: http://portal.open-bio.org/pipermail/bioperl-l/attachments/20051206/57fef8b3/attachment.htm
From jbmatthewgeisler at yahoo.ca  Tue Dec  6 09:40:57 2005
From: jbmatthewgeisler at yahoo.ca (matt geisler)
Date: Tue Dec  6 17:15:25 2005
Subject: [Bioperl-l] help with HOWTO script example
Message-ID: <20051206144057.83846.qmail@web32911.mail.mud.yahoo.com>

Hello, I am learning perl and bioperl (I am a mol biologist turning bioinformatics). I tried the example script in the beginners HOWTO tutorial and encountered errors.
   
  System Windows XP with Activeperl 5.8.7
  Writing the following script in notepad
   
  #!C:\perl\bin\perl.exe -w
use Bio::Seq;
$seq_obj = Bio::Seq->new(-seq =>"aaaatttggggggggcccccgtt" -alphabet => 'dna');
print $seq_obj->desc();
   
  error: arguement isn't numeric in subtraction line 3
   
  If I remove the -alphabet =>'dna' it works.
   
  I assume that it thinks I am trying to do a subtraction with the '-' symbol.
   
  The example text in beginners HOWTO insists that multiple properties of the object ($seq_obj) are assigned with dashes. 
   
  Is this true?
   
  If so, why is it thinking I am trying to subtract?

		
---------------------------------
Find your next car at Yahoo! Canada Autos
From jbmatthewgeisler at yahoo.ca  Tue Dec  6 10:28:18 2005
From: jbmatthewgeisler at yahoo.ca (matt geisler)
Date: Tue Dec  6 17:15:26 2005
Subject: [Bioperl-l] re: help with HOWTO script example
Message-ID: <20051206152818.2049.qmail@web32904.mail.mud.yahoo.com>

  I found an error in the manual "beginners HOWTO'
   
  page 5
   
  The second script is missing a comma between the sequence and -alphabet. This caused the error reported earlier by me.


		
---------------------------------
Find your next car at Yahoo! Canada Autos
From osborne1 at optonline.net  Tue Dec  6 17:41:18 2005
From: osborne1 at optonline.net (Brian Osborne)
Date: Tue Dec  6 17:44:10 2005
Subject: [Bioperl-l] re: help with HOWTO script example
In-Reply-To: <20051206152818.2049.qmail@web32904.mail.mud.yahoo.com>
Message-ID: <BFBB7DBE.65E0%osborne1@optonline.net>

Matt,

Thanks for pointing that out, I'll correct it.

Brian O.


On 12/6/05 10:28 AM, "matt geisler" <jbmatthewgeisler@yahoo.ca> wrote:

>   I found an error in the manual "beginners HOWTO'
>    
>   page 5
>    
>   The second script is missing a comma between the sequence and -alphabet.
> This caused the error reported earlier by me.
> 
> 
> 
> ---------------------------------
> Find your next car at Yahoo! Canada Autos
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From torsten.seemann at infotech.monash.edu.au  Tue Dec  6 19:08:47 2005
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Tue Dec  6 19:09:25 2005
Subject: [Bioperl-l] remoteblast doesn't save the Output File
In-Reply-To: <439614FE.60104@gmx.at>
References: <438F7DF1.5060000@gmx.at>
	<1133830593.20822.13.camel@chauvel.csse.monash.edu.au>
	<4394DC21.90401@gmx.at>
	<1133838353.20822.32.camel@chauvel.csse.monash.edu.au>
	<4395D85D.20501@gmx.at>
	<1133909153.25750.14.camel@chauvel.csse.monash.edu.au>
	<439614FE.60104@gmx.at>
Message-ID: <1133914128.25750.24.camel@chauvel.csse.monash.edu.au>

> >The error is clear:
> >'9 1' fails because it does not match the regular expression 
> >/-?\d+(\.\d+)\s+i-?\d+(\.\d+)/
> >The $NUM='-?\d+(\.\d+)' parts are trying to match a floating point
> >number or integer, eg. "3.41" or "6" or "-78.1", which simplifies to
> >/$NUM\s+i$NUM/x which suggests it wants it in the form:
> >'GAPCOSTS' = '9 i1'
> >which looks unusual but would match the pattern?

> Thanks, I have tried your Example:
> 'GAPCOSTS' = '9 i1'    ...... it wasn't working, but if you took float 
> instead of integer the gap existence will work but not the Gap extend, 
> like 'GAPCOSTS' = '9.0 i1.0'
> It never minds, if I take 'GAPCOSTS' = '9.0 i1.0' or 'GAPCOSTS' = '9.0 
> i-1.0' or instead of 1.0 any other float value, I always get the same 
> Message:
> Gap existence and extension values of 10 and 0 not supported for BLOSUM80
> it always sets the extension Value to 0.

If I was awake when I wrote this I would have realised that it
was $NUM='-?\d+(\.\d+)' which means you MUST have the number with
a decimal point and a zero after it. i.e. integers are NOT accepted.
They would be accepted if it was $NUM='-?\d+(\.\d+)?' - the fact that
they have bracketed it suggests they forgot to put the ? after it, other
wise their isn't much point to bracketing it.

So you are right that "9.0 i1.0" matches the expression.

-- 
Torsten Seemann <torsten.seemann@infotech.monash.edu.au>
Victorian Bioinformatics Consortium

From torsten.seemann at infotech.monash.edu.au  Tue Dec  6 17:45:53 2005
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Tue Dec  6 19:10:54 2005
Subject: [Bioperl-l] remoteblast doesn't save the Output File
In-Reply-To: <4395D85D.20501@gmx.at>
References: <438F7DF1.5060000@gmx.at>
	<1133830593.20822.13.camel@chauvel.csse.monash.edu.au>
	<4394DC21.90401@gmx.at>
	<1133838353.20822.32.camel@chauvel.csse.monash.edu.au>
	<4395D85D.20501@gmx.at>
Message-ID: <1133909153.25750.14.camel@chauvel.csse.monash.edu.au>

(Hubert - please send your emails to bioperl-l@bioperl.org so others
can help too)

> Sorry for the Misunderstanding, it was my fault. I have already read the 
> Module, and the Matrix is working well. But if I want to change the 
> Gapcost Parameter, I don't know
> how to format, because if I do it like that 'GAPCOSTS' = '9 1';  I will 
> get the following Message:
>
> MSG: Value 9 1 for PUT parameter GAPCOSTS does not match expression 
> -?\d+(\.\d+)\s+i-?\d+(\.\d+). Rejecting.
>
> if I do it like 'GAPCOSTS' = '9';  I will get the same Message like above.
> I have tried it with "" too, but there was no Impact on it, i got the 
> same Message:

The error is clear:
'9 1' fails because it does not match the regular expression 
/-?\d+(\.\d+)\s+i-?\d+(\.\d+)/

The $NUM='-?\d+(\.\d+)' parts are trying to match a floating point
number or integer, eg. "3.41" or "6" or "-78.1", which simplifies to
/$NUM\s+i$NUM/x which suggests it wants it in the form:

'GAPCOSTS' = '9 i1'

which looks unusual but would match the pattern?

The documentation says '9 1' should work?
http://www.ncbi.nlm.nih.gov/BLAST/Doc/node28.html

Perhaps a bug in NCBI's code, the 'i' might be a typo?

-- 
Torsten Seemann <torsten.seemann@infotech.monash.edu.au>
Victorian Bioinformatics Consortium

From chen_li3 at yahoo.com  Wed Dec  7 01:28:23 2005
From: chen_li3 at yahoo.com (chen li)
Date: Wed Dec  7 01:32:37 2005
Subject: [Bioperl-l] Bioperl and Mysql
In-Reply-To: <1f0b7c7937e41d7f285fcccabb612c2a@gnf.org>
Message-ID: <20051207062823.52871.qmail@web36805.mail.mud.yahoo.com>

Hi Hilmar,

 I download a small fasta-format sequence file from
NCBI and populate the database. But I can't retrieve
them within mysql as a root user. The biosql database
is empty. What is going on?

Thanks,

Li



[alex@cpe-65-189-147-4 biosql]$ perl
load_seqdatabase.pl --host localhost --dbname biosql
/home/alex/DB/RNA.fasta
Loading /home/alex/DB/RNA.fasta ...

A small part of my file:
>gi|21237774|ref|NM_139124.1| Homo sapiens
mitogen-activated protein kinase 8 interacting protein
2 (MAPK8IP2), transcript variant 3, mRNA
CGCGGGGCGGACGCCGCAGGGCGTGTCACGAGGTGAGCGGGGCGGGCCGAGCGCCGGCGCGGGGCGCGGCGAGGCTCCCG
...........................






		
__________________________________________ 
Yahoo! DSL ? Something to write home about. 
Just $16.99/mo. or less. 
dsl.yahoo.com 

From avilella at ub.edu  Wed Dec  7 01:46:12 2005
From: avilella at ub.edu (Albert Vilella)
Date: Wed Dec  7 04:03:04 2005
Subject: [Bioperl-l] what am I doing wrong with $alignio->next_aln
In-Reply-To: <a06230903bfbbb0098475@[10.0.1.3]>
References: <a06230903bfbbb0098475@[10.0.1.3]>
Message-ID: <1133937972.9277.4.camel@localhost.localdomain>

Quick guess, can you try changing:

>   my $alignio = new Bio::AlignIO('-format' => 'fasta',
>                               -interleaved => 0,
>                               -file   => $tempfile); 
> 

to:

>   my $alignio = new Bio::AlignIO('-format' => 'fasta',
>                               -file   => $tempfile); 
> 

the "interleaved" bit is for phylip file format... not sure if that is
really the problem here.

if you don't get a proper $aln object after:

my $aln = $alignio->next_aln;

then you should double-check the place where you are getting the
alignment files from.

To be sure it is not a bioperl-run/PAML problem, you can run the test:

cd /where/bioperl/and/bioperl-run/are/placed/
perl t/PAML.t

should give you 18 ok's,

    Albert.

El dt 06 de 12 del 2005 a les 13:24 -0800, en/na Alisha Holloway va
escriure:
> I'm trying to run PAML through BioPerl.  I get this error message
> 
> 
> -------------------- WARNING ---------------------
> MSG: must have supplied a valid alignment file in order to run codeml
> ---------------------------------------------------
> 
> because I'm not getting a return value from "my $aln =
> $alignio->next_aln".  I just can't quite figure out why.  Here's the
> code bit.  Any help would be greatly appreciated.  I have a feeling
> this has to do with the input file, but the format of the file is
> fine.  Is there something about the path that I'm missing?
> 
> 
> 
> 
> if($sepfiles[$x] =~ /.fa$/){
>     my $tempfile = './tempfiles/'.$sepfiles[$x];
>     print "Datafile is - $allfiles[$a], $tempfile\n";
>        ##my $tempfile= shift @ARGV; ## to load infile on command line
>   my $alignio = new Bio::AlignIO('-format' => 'fasta',
>                               -interleaved => 0,
>                               -file   => $tempfile); 
>                                     
>         my $aln = $alignio->next_aln;
>    my $codeml = new Bio::Tools::Run::Phylo::PAML::Codeml();
>        #$codeml->no_param_checks(1);  
>        $codeml->set_parameter('runmode',0);
>    $codeml->set_parameter('seqtype',1);
>    $codeml->set_parameter('CodonFreq',2);
>        $codeml->set_parameter('model', 1);
>        $codeml->set_parameter('NSsites', 0);
>        $codeml->set_parameter('fix_omega', 0);
> $codeml->set_parameter('omega',0.4);
>    $codeml->set_parameter('fix_kappa', 0);
> $codeml->set_parameter('kappa',2);
>      $codeml->set_parameter('cleandata',1);
>   
>         print $codeml->executable(), " is codeml\n";
> 
>        $codeml->alignment($aln);  ## it gets to here and tries to use
> $aln and gives the warning
> 
> 
> Thanks,
> 
> 
> Alisha
> 
> 
> 
> 
> -- 
> Alisha Holloway
> 
> Postdoctoral Fellow
> Section of Evolution & Ecology
> 3347 Storer Hall
> University of California
> Davis, CA  95616
> 
> 530-754-9551 Office
> 512-297-3958 Cell
> 530-752-1449 Fax
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
From andrej.kastrin at siol.net  Wed Dec  7 07:42:32 2005
From: andrej.kastrin at siol.net (Andrej Kastrin)
Date: Wed Dec  7 07:57:34 2005
Subject: [Bioperl-l] Extract fields from Medline
Message-ID: <4396D8B8.3040706@siol.net>

Hello all,

big problem for me, small for you (while I'm noob in perl). I have a 
list of terms (i.e. genes, gene products) in row data format. Now I have 
to parse Medline (standard Medline format) and extract PMID, TI and AB 
(ID number, Title and Abstract) fields which involve any term in my term 
list. I already transform Medline "multiline" format to "single" line, 
so there is only one line per each field.

How to start? Thanks for any suggesstion.
Best, Andrej

From andrej.kastrin at siol.net  Wed Dec  7 07:40:05 2005
From: andrej.kastrin at siol.net (Andrej Kastrin)
Date: Wed Dec  7 07:57:36 2005
Subject: [Bioperl-l] Extract field from Medline
Message-ID: <4396D825.5050901@siol.net>

Hello all,

big problem for me, small for you (while I'm noob in perl). I have a 
list of terms (i.e. genes, gene products) in row data format. Now I have 
to parse Medline (standard Medline format) and extract PMID, TI and AB 
(ID number, Title and Abstract) fields which involve any term in my term 
list. I already transform Medline "multiline" format to "single" line, 
so there is only one line per each field.

How to start? Thanks for any suggesstion.
Best, Andrej

From amackey at pcbi.upenn.edu  Wed Dec  7 08:13:05 2005
From: amackey at pcbi.upenn.edu (Aaron J. Mackey)
Date: Wed Dec  7 08:50:09 2005
Subject: [Bioperl-l] Kyte Doolittle hydropathy plot:
	Bio::Graphics::Glyph::protein
Message-ID: <580CCD33-D413-4038-9C62-B57B236C71B1@pcbi.upenn.edu>


I've just checked in to BioPerl the above mentioned glyph, which  
(like Glyph::dna) is a "global feature" glyph that  at high  
magnification shows raw protein sequence, but at lower magnification  
provides the standard Kyte-Doolittle hydropathy plot (adding an  
option to use Hopp-Woods scale is left as an exercise to the reader).

You can see an example of using this glyph at:

   http://v5-0.plasmodb.org/cgi-bin/gbrowse_img/plasmodbaa/?q=PF10_0238

Enjoy,

-Aaron

--
Aaron J. Mackey, Ph.D.
Project Manager, ApiDB Bioinformatics Resource Center
Penn Genomics Institute, University of Pennsylvania
email:  amackey@pcbi.upenn.edu
office: 215-898-1205 (Biology, 212 Goddard Labs)
         215-746-7018 (PCBI, 1428 Blockley Hall)
fax:    215-746-6697 (Penn Genomics Institute)
postal: Penn Genomics Institute
         Goddard Labs 212
         415 S. University Avenue
         Philadelphia, PA  19104-6017


From osborne1 at optonline.net  Wed Dec  7 09:06:09 2005
From: osborne1 at optonline.net (Brian Osborne)
Date: Wed Dec  7 09:08:42 2005
Subject: [Bioperl-l] Extract fields from Medline
In-Reply-To: <4396D8B8.3040706@siol.net>
Message-ID: <BFBC5681.65F4%osborne1@optonline.net>

Andrej,

For a start take a look at the scripts in examples/biblio, these scripts
show how one can access an OpenBQS service ("soap") or PubMed ("eutils")
using Bio::Biblio.

Brian O.


On 12/7/05 7:42 AM, "Andrej Kastrin" <andrej.kastrin@siol.net> wrote:

> Hello all,
> 
> big problem for me, small for you (while I'm noob in perl). I have a
> list of terms (i.e. genes, gene products) in row data format. Now I have
> to parse Medline (standard Medline format) and extract PMID, TI and AB
> (ID number, Title and Abstract) fields which involve any term in my term
> list. I already transform Medline "multiline" format to "single" line,
> so there is only one line per each field.
> 
> How to start? Thanks for any suggesstion.
> Best, Andrej
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From bmoore at genetics.utah.edu  Wed Dec  7 09:13:15 2005
From: bmoore at genetics.utah.edu (Barry Moore)
Date: Wed Dec  7 09:10:10 2005
Subject: [Bioperl-l] Extract field from Medline
Message-ID: <CFE1DF3BA20F424689DA0881A14055BECF2EFF@m.hg.genetics.utah.edu>

Andrej-

Doesn't really sound like you need Bioperl for this one - just some
loops and regular expressions.  Can't offer too much help without seeing
your file formats, but a boiler plate might look like this:

#!/usr/bin/perl

use strict;
use warnings;

my $file_terms = shift;
my $file_medline = shift;
open (TERM, $file_term) or die "Can't open TERM";
open (MEDL, $file_medline) or die "Can't open MEDL";

my @terms = <TERM>;

while (my ($pmid, $ti, $ab) = split <MEDL>) {
	for my $term (@terms) {
		if (/$term/ for ($pmid, $ti, $ab)) {
			print "$pmid\t$ti\t$ab";
		}
	}
}	

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Andrej
Kastrin
Sent: Wednesday, December 07, 2005 5:40 AM
To: bioperl-l@portal.open-bio.org
Subject: [Bioperl-l] Extract field from Medline

Hello all,

big problem for me, small for you (while I'm noob in perl). I have a 
list of terms (i.e. genes, gene products) in row data format. Now I have

to parse Medline (standard Medline format) and extract PMID, TI and AB 
(ID number, Title and Abstract) fields which involve any term in my term

list. I already transform Medline "multiline" format to "single" line, 
so there is only one line per each field.

How to start? Thanks for any suggesstion.
Best, Andrej

_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l

From Richard.Adams at ed.ac.uk  Wed Dec  7 09:01:49 2005
From: Richard.Adams at ed.ac.uk (Richard Adams)
Date: Wed Dec  7 09:31:28 2005
Subject: [Bioperl-l] need info
Message-ID: <4396EB4D.30109@ed.ac.uk>

Hi Heikki,
Regarding looking for untested modules/tests,
how about parsing the *.t files,  parsing out the lines such as

ok $myvar->method1

and getting the class of the variable and making a hash of which public 
methods in each class are tested.
In this way the class of IO type instances will be the correct subclass 
and you can get this info independent of parsing the 'use module' statements
If a method is not in that class (ie is in a   superclass) then the 
inheritance hierarchy can be searched until the method is found and that 
method in the superclass ticked as 'tested'

If you like I could work up some pseudocode for it  for any comments,

Richard

-- 
Dr Richard Adams
Psychiatric Genetics Group,
Medical Genetics,
Molecular Medicine Centre,
Western General Hospital,
Crewe Rd West,
Edinburgh UK
EH4 2XU

Tel: 44 131 651 1084
richard.adams@ed.ac.uk


From andrej.kastrin at siol.net  Wed Dec  7 09:57:26 2005
From: andrej.kastrin at siol.net (Andrej Kastrin)
Date: Wed Dec  7 09:54:39 2005
Subject: [Bioperl-l] Extract field from Medline
In-Reply-To: <CFE1DF3BA20F424689DA0881A14055BECF2EFF@m.hg.genetics.utah.edu>
References: <CFE1DF3BA20F424689DA0881A14055BECF2EFF@m.hg.genetics.utah.edu>
Message-ID: <4396F856.3020303@siol.net>

Barry Moore wrote:

>Andrej-
>
>Doesn't really sound like you need Bioperl for this one - just some
>loops and regular expressions.  Can't offer too much help without seeing
>your file formats, but a boiler plate might look like this:
>
>#!/usr/bin/perl
>
>use strict;
>use warnings;
>
>my $file_terms = shift;
>my $file_medline = shift;
>open (TERM, $file_term) or die "Can't open TERM";
>open (MEDL, $file_medline) or die "Can't open MEDL";
>
>my @terms = <TERM>;
>
>while (my ($pmid, $ti, $ab) = split <MEDL>) {
>	for my $term (@terms) {
>		if (/$term/ for ($pmid, $ti, $ab)) {
>			print "$pmid\t$ti\t$ab";
>		}
>	}
>}	
>
>-----Original Message-----
>From: bioperl-l-bounces@portal.open-bio.org
>[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Andrej
>Kastrin
>Sent: Wednesday, December 07, 2005 5:40 AM
>To: bioperl-l@portal.open-bio.org
>Subject: [Bioperl-l] Extract field from Medline
>
>Hello all,
>
>big problem for me, small for you (while I'm noob in perl). I have a 
>list of terms (i.e. genes, gene products) in row data format. Now I have
>
>to parse Medline (standard Medline format) and extract PMID, TI and AB 
>(ID number, Title and Abstract) fields which involve any term in my term
>
>list. I already transform Medline "multiline" format to "single" line, 
>so there is only one line per each field.
>
>How to start? Thanks for any suggesstion.
>Best, Andrej
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
>  
>
Hi,
I try this but something wrong, due to compilation problem (lines 15  
and 19); and also, how to include input files?

From hubert.prielinger at gmx.at  Tue Dec  6 17:47:18 2005
From: hubert.prielinger at gmx.at (Hubert Prielinger)
Date: Wed Dec  7 13:07:29 2005
Subject: [Bioperl-l] the Parameter GAPCOSTS for the remoteblast Modul
	doesn't work
Message-ID: <439614F6.3080500@gmx.at>

Hi,
I have tried to set the GAPCOSTS Parameter:
'GAPCOSTS' = '9 i1'    ...... it wasn't working, but if I took float 
instead of integer the gap existence will work but not the Gap extend, 
like 'GAPCOSTS' = '9.0 i1.0'
It never minds, if I take 'GAPCOSTS' = '9.0 i1.0' or 'GAPCOSTS' = '9.0 
i-1.0' or instead of 1.0 any other float value, I always get the same 
Message:

Gap existence and extension values of 10 and 0 not supported for 
BLOSUM80 (for example)

it always sets the extension Value to 0.

regards
Hubert
From hlapp at gnf.org  Wed Dec  7 12:37:16 2005
From: hlapp at gnf.org (Hilmar Lapp)
Date: Wed Dec  7 15:42:55 2005
Subject: [Bioperl-l] Bioperl and Mysql
In-Reply-To: <20051207062823.52871.qmail@web36805.mail.mud.yahoo.com>
References: <20051207062823.52871.qmail@web36805.mail.mud.yahoo.com>
Message-ID: <428b7198c15ed6fb961cdba547db83ba@gnf.org>

You probably got a lot of errors when you uploaded the file didn't you?  
Always post error messages.

The problem with fasta files is that the Bioperl SeqIO parser (for  
legitimate reasons) doesn't parse out an accession number, which,  
however, is part of the unique key constraint. So you probably you do  
have one sequence in the database; the only way you can get an empty  
database after running a non-empty file is by failure to connect,  
failure to load (find) the bioperl/bioperl-db modules, or by providing  
--testonly to the load_seqdatabase.pl script. Only the latter will be  
silent.

See http://bioperl.org/pipermail/bioperl-l/2005-August/019579.html for  
what you need to do in order to load fasta-formatted files into biosql.

If none of this can be the problem, run the bioperl-db tests and report  
the outcome.

	-hilmar

On Dec 6, 2005, at 10:28 PM, chen li wrote:

> Hi Hilmar,
>
>  I download a small fasta-format sequence file from
> NCBI and populate the database. But I can't retrieve
> them within mysql as a root user. The biosql database
> is empty. What is going on?
>
> Thanks,
>
> Li
>
>
>
> [alex@cpe-65-189-147-4 biosql]$ perl
> load_seqdatabase.pl --host localhost --dbname biosql
> /home/alex/DB/RNA.fasta
> Loading /home/alex/DB/RNA.fasta ...
>
> A small part of my file:
>> gi|21237774|ref|NM_139124.1| Homo sapiens
> mitogen-activated protein kinase 8 interacting protein
> 2 (MAPK8IP2), transcript variant 3, mRNA
> CGCGGGGCGGACGCCGCAGGGCGTGTCACGAGGTGAGCGGGGCGGGCCGAGCGCCGGCGCGGGGCGCGGCG 
> AGGCTCCCG
> ...........................
>
>
>
>
>
>
> 		
> __________________________________________
> Yahoo! DSL ? Something to write home about.
> Just $16.99/mo. or less.
> dsl.yahoo.com
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------



From bmoore at genetics.utah.edu  Wed Dec  7 17:44:07 2005
From: bmoore at genetics.utah.edu (Barry Moore)
Date: Wed Dec  7 17:40:42 2005
Subject: [Bioperl-l] Extract field from Medline
Message-ID: <CFE1DF3BA20F424689DA0881A14055BECF2F00@m.hg.genetics.utah.edu>

Andrej-

I didn't run that script, it was just meant to give you a start.  I've
cleaned it up and it works for me - without knowing your file formats
that's about all I can do to help you.  You'll need to debug it and
adapt it to your needs.  If you are very new to perl and unfamiliar with
debugging scripts, then you will certainly want to consult one of the
many fine texts on the subject such as "Learning Perl" from O'Reilly.
You can use the script below as a starting point.

Barry


#!/usr/bin/perl


use strict;
use warnings;

my $file_terms = shift;
my $file_medline = shift;
open (TERM, $file_terms) or die "Can't open TERM";
open (MEDL, $file_medline) or die "Can't open MEDL";

my @terms = <TERM>;
my @lines = <MEDL>;

for my $line (@lines) {
    my ($pmid, $ti, $ab) = split /\t/, $line;
    for  my $term (@terms) {
        chomp $term;
        for ($pmid, $ti, $ab) {
            if (/$term/) {
                print "$pmid\t$ti\t$ab";
            }
        }
    }
}


> -----Original Message-----
> From: Andrej Kastrin [mailto:andrej.kastrin@siol.net]
> Sent: Wednesday, December 07, 2005 7:57 AM
> To: Barry Moore
> Cc: bioperl-l@portal.open-bio.org
> Subject: Re: [Bioperl-l] Extract field from Medline
> 
> Barry Moore wrote:
> 
> >Andrej-
> >
> >Doesn't really sound like you need Bioperl for this one - just some
> >loops and regular expressions.  Can't offer too much help without
seeing
> >your file formats, but a boiler plate might look like this:
> >
> >#!/usr/bin/perl
> >
> >use strict;
> >use warnings;
> >
> >my $file_terms = shift;
> >my $file_medline = shift;
> >open (TERM, $file_term) or die "Can't open TERM";
> >open (MEDL, $file_medline) or die "Can't open MEDL";
> >
> >my @terms = <TERM>;
> >
> >while (my ($pmid, $ti, $ab) = split <MEDL>) {
> >	for my $term (@terms) {
> >		if (/$term/ for ($pmid, $ti, $ab)) {
> >			print "$pmid\t$ti\t$ab";
> >		}
> >	}
> >}
> >
> >-----Original Message-----
> >From: bioperl-l-bounces@portal.open-bio.org
> >[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Andrej
> >Kastrin
> >Sent: Wednesday, December 07, 2005 5:40 AM
> >To: bioperl-l@portal.open-bio.org
> >Subject: [Bioperl-l] Extract field from Medline
> >
> >Hello all,
> >
> >big problem for me, small for you (while I'm noob in perl). I have a
> >list of terms (i.e. genes, gene products) in row data format. Now I
have
> >
> >to parse Medline (standard Medline format) and extract PMID, TI and
AB
> >(ID number, Title and Abstract) fields which involve any term in my
term
> >
> >list. I already transform Medline "multiline" format to "single"
line,
> >so there is only one line per each field.
> >
> >How to start? Thanks for any suggesstion.
> >Best, Andrej
> >
> >_______________________________________________
> >Bioperl-l mailing list
> >Bioperl-l@portal.open-bio.org
> >http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> >_______________________________________________
> >Bioperl-l mailing list
> >Bioperl-l@portal.open-bio.org
> >http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> >
> >
> Hi,
> I try this but something wrong, due to compilation problem (lines 15
> and 19); and also, how to include input files?


From angshu96 at gmail.com  Wed Dec  7 21:12:36 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Wed Dec  7 21:38:48 2005
Subject: [Bioperl-l] loading data to biosql tables
Message-ID: <df8328740512071812n7a5507aap71d273f0d8d781fe@mail.gmail.com>

Hi,

I've created 5 tables (taxon, taxon name, bioentry, biosequence,
biodatabase) in my postgresql database (linux box) using the biosql schema
ddl from
http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/biosql-schema/sql/biosqldb-pg.sql?rev=1.29&cvsroot=biosql&content-type=text/vnd.viewcvs-markup
 .
Now I want to load the tables with arabidopsis data. Could you please let me
know where can I find such scripts for pgsql? And also I find at
http://bio.perl.org/Core/Latest/index.shtml that the DB module has not been
updated since 2001. Do I need to install that? Or are there some new
releases?

I'll be obliged if you can guide.

Thanks,
Angshu

From hlapp at gmx.net  Thu Dec  8 11:55:21 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu Dec  8 11:59:34 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <df8328740512071812n7a5507aap71d273f0d8d781fe@mail.gmail.com>
References: <df8328740512071812n7a5507aap71d273f0d8d781fe@mail.gmail.com>
Message-ID: <3e86c394e54677a898eab8de11d8e002@gmx.net>

Any reason you didn't instantiate the rest of the schema? Any scripts  
and software that have been written against BioSQL will certainly  
expect the rest of the schema be present ...

Bioperl-db is the BioSQL language binding for Bioperl, so that's what  
you will want to use. It comes with a script load_seqdatabase.pl to  
load any format supported by Bioperl.

However, bioperl-db does expect all of Biosql to be present ...

	-hilmar

On Dec 7, 2005, at 6:12 PM, Angshu Kar wrote:

> Hi,
>
> I've created 5 tables (taxon, taxon name, bioentry, biosequence,
> biodatabase) in my postgresql database (linux box) using the biosql  
> schema
> ddl from
> http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/biosql-schema/sql/ 
> biosqldb-pg.sql?rev=1.29&cvsroot=biosql&content-type=text/vnd.viewcvs- 
> markup
>  .
> Now I want to load the tables with arabidopsis data. Could you please  
> let me
> know where can I find such scripts for pgsql? And also I find at
> http://bio.perl.org/Core/Latest/index.shtml that the DB module has not  
> been
> updated since 2001. Do I need to install that? Or are there some new
> releases?
>
> I'll be obliged if you can guide.
>
> Thanks,
> Angshu
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From kevin.mcmahon at ttuhsc.edu  Thu Dec  8 12:36:57 2005
From: kevin.mcmahon at ttuhsc.edu (kevin.mcmahon@ttuhsc.edu)
Date: Thu Dec  8 12:49:30 2005
Subject: [Bioperl-l] PrimarySeq object question
Message-ID: <8CA078F2E9F09043B48141DD6195E99D08A752C0@marfa.ttuhsc.edu>

Everyone,
 
I'm new to this, so please bear with me.
 
I'm having some trouble with a scf to fasta converting program I'm writing.
 
  my $in  = Bio::SeqIO->new(-file => $infile , '-format' => 'scf', -alphabet
=> 'dna');
 
    my $seq = $in->next_seq();
    print "My sequence is:  " . $seq->seq() . "\n";
 
Above is the code in discussion.  The $in object contains information from a
file ($infile) in scf format.  
 
Here's my problem.  When we get to $in->next_seq(), if the file is empty,
the program dies and returns:
 
"MSG: If you want me to create a PrimarySeq object for your empty sequence
<boggle> you must specify a -alphabet to satisfy the constructor
requirements for a Bio::PrimarySeq object with no sequence.  Read the POD
for it, luke."
 
I guess what I need to know is: if this $in->next_seq() doesn't work, how
can I test for this before I get this reply.
 
Thanks in advance,
 
Wyatt
 
From angshu96 at gmail.com  Thu Dec  8 13:09:15 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Thu Dec  8 13:06:46 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <3e86c394e54677a898eab8de11d8e002@gmx.net>
References: <df8328740512071812n7a5507aap71d273f0d8d781fe@mail.gmail.com>
	<3e86c394e54677a898eab8de11d8e002@gmx.net>
Message-ID: <df8328740512081009o3e2cf31an4a896a31078af0c9@mail.gmail.com>

Thank you Hilmar. Actually we want only those tables for our tests!
Also at first, do I need to install the Bioperl-db module ( But is it the
one that was updated 4 years back or are there any new releases)? And then
run the script suggested by you in the box? Can't we just edit the script
and keep those parts that correspond to only the tables that I've created?

Thanks,
Angshu


On 12/8/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
> Any reason you didn't instantiate the rest of the schema? Any scripts
> and software that have been written against BioSQL will certainly
> expect the rest of the schema be present ...
>
> Bioperl-db is the BioSQL language binding for Bioperl, so that's what
> you will want to use. It comes with a script load_seqdatabase.pl to
> load any format supported by Bioperl.
>
> However, bioperl-db does expect all of Biosql to be present ...
>
>        -hilmar
>
> On Dec 7, 2005, at 6:12 PM, Angshu Kar wrote:
>
> > Hi,
> >
> > I've created 5 tables (taxon, taxon name, bioentry, biosequence,
> > biodatabase) in my postgresql database (linux box) using the biosql
> > schema
> > ddl from
> > http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/biosql-schema/sql/
> > biosqldb-pg.sql?rev=1.29&cvsroot=biosql&content-type=text/vnd.viewcvs-
> > markup
> >  .
> > Now I want to load the tables with arabidopsis data. Could you please
> > let me
> > know where can I find such scripts for pgsql? And also I find at
> > http://bio.perl.org/Core/Latest/index.shtml that the DB module has not
> > been
> > updated since 2001. Do I need to install that? Or are there some new
> > releases?
> >
> > I'll be obliged if you can guide.
> >
> > Thanks,
> > Angshu
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From saldroubi at yahoo.com  Thu Dec  8 14:51:09 2005
From: saldroubi at yahoo.com (Sam Al-Droubi)
Date: Thu Dec  8 14:48:39 2005
Subject: [Bioperl-l] PrimarySeq object question
In-Reply-To: <8CA078F2E9F09043B48141DD6195E99D08A752C0@marfa.ttuhsc.edu>
Message-ID: <20051208195109.18775.qmail@web34305.mail.mud.yahoo.com>

Kevin,
 
 I am fairly new to bioperl as well.  But I have written a program that reads fasta format files. 
 I gave my program an empty file and it worked.  The difference I see is that you are reading a different format.  I am wondering if you found a bug.  Did you try a differnt format, like fasta?
 If you did find a bug may be you can call "ls" from Perl and check the file size before you try to open it.  I am assuming you are running this on UNIX/Linux.
 
 
 
 Snippet of my code is below
 
 
     $seqio_obj = Bio::SeqIO->new(-file => $fname,-format => "fasta" );
         while ($seq_obj = $seqio_obj->next_seq){
 ....
 
           }

kevin.mcmahon@ttuhsc.edu wrote: Everyone,
 
I'm new to this, so please bear with me.
 
I'm having some trouble with a scf to fasta converting program I'm writing.
 
  my $in  = Bio::SeqIO->new(-file => $infile , '-format' => 'scf', -alphabet
=> 'dna');
 
    my $seq = $in->next_seq();
    print "My sequence is:  " . $seq->seq() . "\n";
 
Above is the code in discussion.  The $in object contains information from a
file ($infile) in scf format.  
 
Here's my problem.  When we get to $in->next_seq(), if the file is empty,
the program dies and returns:
 
"MSG: If you want me to create a PrimarySeq object for your empty sequence
 you must specify a -alphabet to satisfy the constructor
requirements for a Bio::PrimarySeq object with no sequence.  Read the POD
for it, luke."
 
I guess what I need to know is: if this $in->next_seq() doesn't work, how
can I test for this before I get this reply.
 
Thanks in advance,
 
Wyatt
 
_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l




Sincerely, 
Sam Al-Droubi, M.S.
saldroubi@yahoo.com
From angshu96 at gmail.com  Thu Dec  8 18:55:00 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Thu Dec  8 19:00:28 2005
Subject: [Bioperl-l] parsing a BLAST output
In-Reply-To: <82B9FC7C-BE37-4961-85BB-6014CEADE8E7@duke.edu>
References: <df8328740512041732g9b22143y42f01182357e2e96@mail.gmail.com>
	<82B9FC7C-BE37-4961-85BB-6014CEADE8E7@duke.edu>
Message-ID: <df8328740512081555n59340d06j7b5e58e119266075@mail.gmail.com>

Thanks Jason...So, if I get you right, if I use the  -postsw option I can
use any of the

$fracqaligned = $hsp->query->length / $result->query_length;
$frachaligned = $hsp->hit->length / $hit->length;

formulae and merge the result for all HSPs to get the % overlap.?

I mean then do I have to worry about repeated domain or multiple high
scoring suboptimal alignments ?

Appreciate your guidance.

Thanks,
Angshu



On 12/4/05, Jason Stajich <jason.stajich@duke.edu> wrote:
>
> frac_identical gives the fraction of bases in the HSP that are
> identical.
>
> overlap would be calculated from (length of the query aligned) /
> (length of query) or (length of hit aligned) / (length of hit).
>
> So for an HSP you can calculate this
> $fracqaligned = $hsp->query->length / $result->query_length;
> $frachaligned = $hsp->hit->length / $hit->length;
>
> But remember there may be multiple HSPs so you may need to merge the
> HSP information to get the total length aligned.  If there is a
> repeated domain or multiple high scoring suboptimal alignments this
> can cause things to get a little tricky.
>
> There are two methods provided in the HitI interface called
> frac_aligned_query() and frac_aligned_hit() do try and take all of
> this into account for you, but I admit this is less well tested
> code.  But do give them a try:
> $fracqaligned = $hit->frac_aligned_query();
> $frachaligned = $hit->frac_aligned_hit();
>
>
> If you are using WU-BLASTP add the -postsw option to get a refined
> alignment which will merge HSPs where appropriate so you should use
> that.
>
> You can also use the -links option to get WU-BLAST to get the logical
> ordering and a consistent path through the HSPs.
>
>
> On Dec 4, 2005, at 8:32 PM, Angshu Kar wrote:
>
> > Hi,
> >
> > To begin with, I'm new to Bioperl.
> > Now, I've written the following simple piece of code to parse a WU-
> > Blast
> > output which filters data *for a given e-value and >50% overlap*.
> >
> > I'm writing the main algorithm here:
> >
> > my $blast_report = $ARG[1];
> > my $threshold_evalue = $ARG[2];
> >
> > my $in = new Bio::SearchIO(-format => 'blast', -file =>
> > $blast_report);
> >
> > while (my $result = $in -> next_result)
> >    {
> >       while(my $hit = $result->next_hit)
> >          {
> >             if(($line{$hit->name} == $line{$result->query_accession}))
> >                {
> >                   next;
> >                }
> >             if($hit->hsp->evalue <= $threshold_evalue)
> >                {
> >                   if($hit->hsp->frac_indentical>=0.5)
> >                      {
> >                         print $line{$result->query_accession} . "\t" .
> > $line{$hit->name} . "\t" . $hit->hsp-evalue . "\n";
> >                     }
> >               }
> >       }
> > }
> >
> > My questions are:
> >
> > 1. does the frac_identical gives the measure of % overlap? Or, are
> > there any
> > other methods?
> > 2. now, i don't have any blast data sets to test my code upon.could
> > any of
> > the experienced users let me know whether the algorithm is fine?any
> > tip-offs on any point (from optimization to syntactical errors) are
> > heartily
> > welcome.
> > 3. could any one please let me know if i can find sample wu-blast
> > outputs to
> > test my script upon?
>
> http://fungal.genome.duke.edu/~jes12/BGT203.2005/sample_reports/
>
> Also checkout the biodata repository from bioperl and look in the
> DB_Searching directory, we had started a  project cataloging example
> reports in all the different formats.  This sort of fizzled out, but
> could still use some volunteers to better organize things and
> incorporate more examples.
>
> http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/biodata/
> DB_Searching/
>
>
> > Appreciate your guidance.
> >
> > Thanks,
> > Angshu
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
> --
> Jason Stajich
> Duke University
> http://www.duke.edu/~jes12
>
>
>

From angshu96 at gmail.com  Thu Dec  8 18:59:12 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Thu Dec  8 20:01:28 2005
Subject: [Bioperl-l] parsing a BLAST output
In-Reply-To: <CFE1DF3BA20F424689DA0881A14055BECF2EF1@m.hg.genetics.utah.edu>
References: <CFE1DF3BA20F424689DA0881A14055BECF2EF1@m.hg.genetics.utah.edu>
Message-ID: <df8328740512081559h4daf3c15uf1a0c4e612f5b61e@mail.gmail.com>

Thanks for the url. I'll go through it and let you know if I face any
problem.
And have you had any code pieces using those functions to calculate %
overlap? It will be great if you can provide them to me.

Thank you so much,
Angshu


On 12/4/05, Barry Moore <bmoore@genetics.utah.edu> wrote:
>
> Angshu-
>
> 1) No.  From the docs (online at
> http://doc.bioperl.org/releases/bioperl-1.4/Bio/Search/HSP/BlastHSP.html
> ):
>
> Different versions of Blast report different values for the total length
> of the alignment. This is the number reported in the denominators in the
> stats section: "Identical = 34/120 Positives = 67/120". NCBI-BLAST uses
> the total length of the alignment (with gaps) WU-BLAST uses the length
> of the query sequence (without gaps). Therefore, when called without an
> argument or an argument of 'total', this method will report different
> values depending on the version of BLAST used.
>
> To get the fraction identical among only the aligned residues, ignoring
> the gaps, call this method with an argument of 'query' or 'sbjct'
> ('sbjct' is synonymous with 'hit').
>
> 2) If I understand your question correctly I think you are looking for
> frac_aligned_hit and/or frac_aligned_query called on you hit object.
> See
> (http://doc.bioperl.org/releases/bioperl-1.4/Bio/Search/Hit/GenericHit.h
> tml) for discussion.
>
> 3) Try the files in the bioperl test/data directory for lots of program
> output samples.  For wu-blast have a look at:
>
> bioperl-live/t/data/brassica_ATH.WUBLASTN
>
> which can be found on the web at:
>
> http://cvs.bioperl.org/cgi-bin/viewcvs/viewcvs.cgi/*checkout*/bioperl-li
> ve/t/data/brassica_ATH.WUBLASTN?rev=HEAD&cvsroot=bioperl&content-type=te
> xt/plain.
>
> Barry
>
> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org
> [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Angshu Kar
> Sent: Sunday, December 04, 2005 6:32 PM
> To: bioperl-l@bioperl.org
> Subject: [Bioperl-l] parsing a BLAST output
>
> Hi,
>
> To begin with, I'm new to Bioperl.
> Now, I've written the following simple piece of code to parse a WU-Blast
> output which filters data *for a given e-value and >50% overlap*.
>
> I'm writing the main algorithm here:
>
> my $blast_report = $ARG[1];
> my $threshold_evalue = $ARG[2];
>
> my $in = new Bio::SearchIO(-format => 'blast', -file => $blast_report);
>
> while (my $result = $in -> next_result)
>   {
>      while(my $hit = $result->next_hit)
>         {
>            if(($line{$hit->name} == $line{$result->query_accession}))
>               {
>                  next;
>               }
>            if($hit->hsp->evalue <= $threshold_evalue)
>               {
>                  if($hit->hsp->frac_indentical>=0.5)
>                     {
>                        print $line{$result->query_accession} . "\t" .
> $line{$hit->name} . "\t" . $hit->hsp-evalue . "\n";
>                    }
>              }
>      }
> }
>
> My questions are:
>
> 1. does the frac_identical gives the measure of % overlap? Or, are there
> any
> other methods?
> 2. now, i don't have any blast data sets to test my code upon.could any
> of
> the experienced users let me know whether the algorithm is fine?any
> tip-offs on any point (from optimization to syntactical errors) are
> heartily
> welcome.
> 3. could any one please let me know if i can find sample wu-blast
> outputs to
> test my script upon?
>
> Appreciate your guidance.
>
> Thanks,
> Angshu
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

From angshu96 at gmail.com  Thu Dec  8 18:55:32 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Thu Dec  8 20:35:51 2005
Subject: [Bioperl-l] parsing a BLAST output
In-Reply-To: <BFB9BCDE.6583%osborne1@optonline.net>
References: <df8328740512041732g9b22143y42f01182357e2e96@mail.gmail.com>
	<BFB9BCDE.6583%osborne1@optonline.net>
Message-ID: <df8328740512081555r76b7a817yabd1065c6dc9ab8f@mail.gmail.com>

Thanks Brian.


On 12/5/05, Brian Osborne <osborne1@optonline.net> wrote:
>
> Angshu,
>
> It looks like there's WU Blast output used in various tests:
>
> t/data/dnaEbsub_ecoli.wublastx
> t/data/ecolitst.wublastp
> t/data/ecolitst.noseqs.wublastp
>
>
> Brian O.
>
>
> On 12/4/05 8:32 PM, "Angshu Kar" <angshu96@gmail.com> wrote:
>
> > Hi,
> >
> > To begin with, I'm new to Bioperl.
> > Now, I've written the following simple piece of code to parse a WU-Blast
> > output which filters data *for a given e-value and >50% overlap*.
> >
> > I'm writing the main algorithm here:
> >
> > my $blast_report = $ARG[1];
> > my $threshold_evalue = $ARG[2];
> >
> > my $in = new Bio::SearchIO(-format => 'blast', -file => $blast_report);
> >
> > while (my $result = $in -> next_result)
> >    {
> >       while(my $hit = $result->next_hit)
> >          {
> >             if(($line{$hit->name} == $line{$result->query_accession}))
> >                {
> >                   next;
> >                }
> >             if($hit->hsp->evalue <= $threshold_evalue)
> >                {
> >                   if($hit->hsp->frac_indentical>=0.5)
> >                      {
> >                         print $line{$result->query_accession} . "\t" .
> > $line{$hit->name} . "\t" . $hit->hsp-evalue . "\n";
> >                     }
> >               }
> >       }
> > }
> >
> > My questions are:
> >
> > 1. does the frac_identical gives the measure of % overlap? Or, are there
> any
> > other methods?
> > 2. now, i don't have any blast data sets to test my code upon.could any
> of
> > the experienced users let me know whether the algorithm is fine?any
> > tip-offs on any point (from optimization to syntactical errors) are
> heartily
> > welcome.
> > 3. could any one please let me know if i can find sample wu-blast
> outputs to
> > test my script upon?
> >
> > Appreciate your guidance.
> >
> > Thanks,
> > Angshu
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
>

From angshu96 at gmail.com  Thu Dec  8 21:00:35 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Thu Dec  8 21:04:09 2005
Subject: [Bioperl-l] Urgent: DB module installation
Message-ID: <df8328740512081800s60f49341j2d22042ea66862cd@mail.gmail.com>

Hi,

Could anyone please let me know how to install Bioperl-db in WindowsXP as
well as a linux machine?

Thanks,
Angshu

From bmoore at genetics.utah.edu  Thu Dec  8 23:02:55 2005
From: bmoore at genetics.utah.edu (Barry Moore)
Date: Thu Dec  8 23:06:44 2005
Subject: [Bioperl-l] Urgent: DB module installation
Message-ID: <CFE1DF3BA20F424689DA0881A14055BECF2F0C@m.hg.genetics.utah.edu>

Angshu-

The package you downloaded should have come with a file named INSTALL.
Did you have specific problems following the instructions in that file?

Barry

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Angshu Kar
Sent: Thursday, December 08, 2005 7:01 PM
To: bioperl-l
Subject: [Bioperl-l] Urgent: DB module installation

Hi,

Could anyone please let me know how to install Bioperl-db in WindowsXP
as
well as a linux machine?

Thanks,
Angshu

_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l

From bmoore at genetics.utah.edu  Thu Dec  8 22:58:07 2005
From: bmoore at genetics.utah.edu (Barry Moore)
Date: Thu Dec  8 23:06:46 2005
Subject: [Bioperl-l] parsing a BLAST output
Message-ID: <CFE1DF3BA20F424689DA0881A14055BECF2F0B@m.hg.genetics.utah.edu>

Angshu-

 

I have not used those functions in any of my code, you might grep
through some of the test scripts to look for examples.

 

Barry

 

-----Original Message-----
From: Angshu Kar [mailto:angshu96@gmail.com] 
Sent: Thursday, December 08, 2005 4:59 PM
To: Barry Moore
Cc: bioperl-l@bioperl.org
Subject: Re: [Bioperl-l] parsing a BLAST output

 

Thanks for the url. I'll go through it and let you know if I face any
problem.

And have you had any code pieces using those functions to calculate %
overlap? It will be great if you can provide them to me.

 

Thank you so much,

Angshu

 

On 12/4/05, Barry Moore <bmoore@genetics.utah.edu> wrote: 

Angshu-

1) No.  From the docs (online at
http://doc.bioperl.org/releases/bioperl-1.4/Bio/Search/HSP/BlastHSP.html
):

Different versions of Blast report different values for the total length
of the alignment. This is the number reported in the denominators in the

stats section: "Identical = 34/120 Positives = 67/120". NCBI-BLAST uses
the total length of the alignment (with gaps) WU-BLAST uses the length
of the query sequence (without gaps). Therefore, when called without an 
argument or an argument of 'total', this method will report different
values depending on the version of BLAST used.

To get the fraction identical among only the aligned residues, ignoring
the gaps, call this method with an argument of 'query' or 'sbjct' 
('sbjct' is synonymous with 'hit').

2) If I understand your question correctly I think you are looking for
frac_aligned_hit and/or frac_aligned_query called on you hit object.
See
(
http://doc.bioperl.org/releases/bioperl-1.4/Bio/Search/Hit/GenericHit.h
<http://doc.bioperl.org/releases/bioperl-1.4/Bio/Search/Hit/GenericHit.h
> 
tml) for discussion.

3) Try the files in the bioperl test/data directory for lots of program
output samples.  For wu-blast have a look at: 

bioperl-live/t/data/brassica_ATH.WUBLASTN

which can be found on the web at:

http://cvs.bioperl.org/cgi-bin/viewcvs/viewcvs.cgi/*checkout*/bioperl-li

ve/t/data/brassica_ATH.WUBLASTN?rev=HEAD&cvsroot=bioperl&content-type=te
xt/plain.

Barry

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org 
[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Angshu Kar
Sent: Sunday, December 04, 2005 6:32 PM
To: bioperl-l@bioperl.org
Subject: [Bioperl-l] parsing a BLAST output

Hi,

To begin with, I'm new to Bioperl.
Now, I've written the following simple piece of code to parse a WU-Blast
output which filters data *for a given e-value and >50% overlap*. 

I'm writing the main algorithm here:

my $blast_report = $ARG[1];
my $threshold_evalue = $ARG[2];

my $in = new Bio::SearchIO(-format => 'blast', -file => $blast_report);

while (my $result = $in -> next_result) 
  {
     while(my $hit = $result->next_hit)
        {
           if(($line{$hit->name} == $line{$result->query_accession}))
              {
                 next;
              }
           if($hit->hsp->evalue <= $threshold_evalue) 
              {
                 if($hit->hsp->frac_indentical>=0.5)
                    {
                       print $line{$result->query_accession} . "\t" .
$line{$hit->name} . "\t" . $hit->hsp-evalue . "\n"; 
                   }
             }
     }
}

My questions are:

1. does the frac_identical gives the measure of % overlap? Or, are there
any
other methods?
2. now, i don't have any blast data sets to test my code upon.could any
of
the experienced users let me know whether the algorithm is fine?any
tip-offs on any point (from optimization to syntactical errors) are
heartily
welcome.
3. could any one please let me know if i can find sample wu-blast 
outputs to
test my script upon?

Appreciate your guidance.

Thanks,
Angshu

_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l

 


From angshu96 at gmail.com  Thu Dec  8 23:10:19 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Thu Dec  8 23:07:46 2005
Subject: [Bioperl-l] Urgent: DB module installation
In-Reply-To: <CFE1DF3BA20F424689DA0881A14055BECF2F0C@m.hg.genetics.utah.edu>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F0C@m.hg.genetics.utah.edu>
Message-ID: <df8328740512082010m2a34c64em7488527b1846ad5a@mail.gmail.com>

I'm away from my lab now. I'll surely send you the error messages. I got 16
errors when i ran the make test command and all in the .t files. Also could
you please let me know if I can test whether the db module has been properly
installed using some command?

Thanks,
Angshu


On 12/8/05, Barry Moore <bmoore@genetics.utah.edu> wrote:
>
> Angshu-
>
> The package you downloaded should have come with a file named INSTALL.
> Did you have specific problems following the instructions in that file?
>
> Barry
>
> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org
> [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Angshu Kar
> Sent: Thursday, December 08, 2005 7:01 PM
> To: bioperl-l
> Subject: [Bioperl-l] Urgent: DB module installation
>
> Hi,
>
> Could anyone please let me know how to install Bioperl-db in WindowsXP
> as
> well as a linux machine?
>
> Thanks,
> Angshu
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

From MEC at stowers-institute.org  Fri Dec  9 00:25:57 2005
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Fri Dec  9 00:38:51 2005
Subject: [Bioperl-l] patch to Bio::Location::Split - split locations whose
	strand is -1 don't print with complement when only one
	sublocation present
Message-ID: <CED81D34E37D5043A1211565277A51E5045CEAD5@exchkc02.stowers-institute.org>

Jason,

When a "split location" really isn't, and has only one sublocation, the 'complement' was missing from the string produced by to_FTstring. 

So,  I moved the code that wraps the FTstring in 'complement' outside of the test for number for sublocations and it works, at least better for me in my hands.

Fix is below.

I'm tracking the head.

sub to_FTstring {
    my ($self) = @_;
    my @strs;
    my $strand;
    if( ($strand = ($self->strand || 0)) < 0 ) {
	$self->flip_strand; # this will recursively set the strand
	                    # to +1 for all the sub locations
    }
    foreach my $loc ( $self->sub_Location()  ) {		
	my $str = $loc->to_FTstring();
	# we only append the remote seq_id if it hasn't been done already
	# by the sub-location (which it should if it knows it's remote)
	# (and of course only if it's necessary)
	if( (! $loc->is_remote) &&
	    defined($self->seq_id) && defined($loc->seq_id) &&
	    ($loc->seq_id ne $self->seq_id) ) {
	    $str = sprintf("%s:%s", $loc->seq_id, $str);
	} 
	push @strs, $str;
    }
    $self->flip_strand if $strand < 0;
    my $str;
    if( @strs == 1 ) {
	($str) = @strs;
    } elsif( @strs == 0 ) {
	$self->warn("no Sublocations for this splitloc, so not returning anything\n");

    } else { 
	$str = sprintf("%s(%s)",lc $self->splittype, join(",", @strs));
    }

    if( $strand < 0 ) {  # wrap this in a complement if it was unrolled
      $str = sprintf("%s(%s)",'complement',$str);
    }				# mec fixed: had erroneously not occured previously when @srs == 0 !!! !

    return $str;
}



Also, while we're here, what do you understand the semantics of strand in split sublocations to be?  Your logic of termporarily flipping the sublocations strand seems to suggest that you expect that the strand of the sublocation should in practice agree with that of the superiour split location.  I'm building split locations 'by hand' and seem forced to set the strand in both the parent and all subs.  Is this what you expect?  thanks.

As an aside but related issue, I've got a the bioperl source head cvs checked out as anonymous with a bunch of edits (such as this) that I'd like now to commit given that I now have privs (I'm user mcook).  Do you now a way to edit my source tree to change them to be checked out by mcook instead of anonymous.  Or do I have to recheck out a fresh source tree and make my edits there for commit?  Thanks

Cheers,

Malcolm Cook - mec@stowers-institute.org - 816-926-4449
Database Applications Manager - Bioinformatics
Stowers Institute for Medical Research - Kansas City, MO  USA 






From heikki at sanbi.ac.za  Fri Dec  9 01:52:48 2005
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Fri Dec  9 02:32:39 2005
Subject: [Bioperl-l] PrimarySeq object question
In-Reply-To: <8CA078F2E9F09043B48141DD6195E99D08A752C0@marfa.ttuhsc.edu>
References: <8CA078F2E9F09043B48141DD6195E99D08A752C0@marfa.ttuhsc.edu>
Message-ID: <200512090852.48878.heikki@sanbi.ac.za>

Kevin,

The message you get comes from Bio::Seq::SeqWithQuality module. It could be 
argued that it is overzealous to throw an exception if it can not find a 
sequence. Also, the message comes after it has come to the conclusion that 
you have not set the alphabet that, according to your code snippet, you have. 
Report this as a bug to bugzilla.bioperl.org and make sure you attach an 
example scf file.

Meanwhile, you can always avoid exiting from you code by wrapping the code 
within the eval statement.

eval { 
  # your code   
}; # note the ';'
if ($@) {
  # do something else
}

Yours,
       -Heikki

On Thursday 08 December 2005 19:36, kevin.mcmahon@ttuhsc.edu wrote:
> Everyone,
>
> I'm new to this, so please bear with me.
>
> I'm having some trouble with a scf to fasta converting program I'm writing.
>
>   my $in  = Bio::SeqIO->new(-file => $infile , '-format' => 'scf',
> -alphabet => 'dna');
>
>     my $seq = $in->next_seq();
>     print "My sequence is:  " . $seq->seq() . "\n";
>
> Above is the code in discussion.  The $in object contains information from
> a file ($infile) in scf format.
>
> Here's my problem.  When we get to $in->next_seq(), if the file is empty,
> the program dies and returns:
>
> "MSG: If you want me to create a PrimarySeq object for your empty sequence
> <boggle> you must specify a -alphabet to satisfy the constructor
> requirements for a Bio::PrimarySeq object with no sequence.  Read the POD
> for it, luke."
>
> I guess what I need to know is: if this $in->next_seq() doesn't work, how
> can I test for this before I get this reply.
>
> Thanks in advance,
>
> Wyatt
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of the Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________
From heikki at sanbi.ac.za  Fri Dec  9 04:36:32 2005
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Fri Dec  9 04:34:20 2005
Subject: [Bioperl-l] need info
In-Reply-To: <4396EB4D.30109@ed.ac.uk>
References: <4396EB4D.30109@ed.ac.uk>
Message-ID: <200512091136.33101.heikki@sanbi.ac.za>

Richard,


The modules.pl really could check for public methods and it could try to find 
from t files which have been tested. That would be quite useful, but only 
after we can clean up the module level testing output sufficiently. 

I've been thinking extending the current code in modules.pl to recursively 
tick tested all modules that are used or inherited from, but have not written 
any code, yet.

Please go ahead and try to get something together along the lines you've been 
thinking.

	-Heikki

On Wednesday 07 December 2005 16:01, Richard Adams wrote:
 > Hi Heikki,
> Regarding looking for untested modules/tests,
> how about parsing the *.t files,  parsing out the lines such as
>
> ok $myvar->method1
>
> and getting the class of the variable and making a hash of which public
> methods in each class are tested.
> In this way the class of IO type instances will be the correct subclass
> and you can get this info independent of parsing the 'use module'
> statements If a method is not in that class (ie is in a   superclass) then
> the inheritance hierarchy can be searched until the method is found and
> that method in the superclass ticked as 'tested'
>
> If you like I could work up some pseudocode for it  for any comments,
>
> Richard

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of the Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________
From ron at ron.dk  Fri Dec  9 04:36:47 2005
From: ron at ron.dk (Rasmus Ory Nielsen)
Date: Fri Dec  9 05:31:45 2005
Subject: [Bioperl-l] Missing parameters in Bio::Tools::Run::Primer3
Message-ID: <1134121007.14008.28.camel@gbi-pc-128036.djf.agrsci.dk>

Hi list

I wish to use the Bio::Tools::Run::Primer3 module (branch 1-5-1). I
found that the PRIMER_LIB_AMBIGUITY_CODES_CONSENSUS parameter is missing
from the module. This is the warning I get:

MSG: Parameter PRIMER_LIB_AMBIGUITY_CODES_CONSENSUS is not a valid
Primer3 parameter

I then searched the module for more missing parameters. Below is a list
of what I found.

PRIMER_DEFAULT_PRODUCT
PRIMER_DEFAULT_SIZE
PRIMER_INSIDE_PENALTY
PRIMER_INTERNAL_OLIGO_MAX_TEMPLATE_MISHYB
PRIMER_LIB_AMBIGUITY_CODES_CONSENSUS
PRIMER_MAX_TEMPLATE_MISPRIMING
PRIMER_OUTSIDE_PENALTY
PRIMER_PAIR_MAX_TEMPLATE_MISPRIMING
PRIMER_PAIR_WT_TEMPLATE_MISPRIMING
PRIMER_WT_TEMPLATE_MISPRIMING

Best regards
Rasmus Ory Nielsen
From heikki at sanbi.ac.za  Fri Dec  9 07:26:56 2005
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Fri Dec  9 07:24:45 2005
Subject: [Bioperl-l] throw, not die
Message-ID: <200512091426.57161.heikki@sanbi.ac.za>

Brian,

I picked up the idea from your recent commits, did a search for 'die' commands 
in bioperl cvs head and fixed quite a few. I did not touch the Bio::Graphics 
name space as those do not inherit from Bio::Root::Root.

I hope I was not overly zealous. At least all tests pass.

	-Heikki

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of the Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________
From angshu96 at gmail.com  Fri Dec  9 10:10:12 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec  9 10:08:42 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <3e86c394e54677a898eab8de11d8e002@gmx.net>
References: <df8328740512071812n7a5507aap71d273f0d8d781fe@mail.gmail.com>
	<3e86c394e54677a898eab8de11d8e002@gmx.net>
Message-ID: <df8328740512090710n3c47c517x45e378908c81d8cb@mail.gmail.com>

Hi Hilmar,

In the load_seqdatabase.pl script could you please tell me where you are
inserting the data into the db tables, so that I can try and modify that
part to insert data only to the tables that I need ?

Thanks,
Angshu


On 12/8/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
> Any reason you didn't instantiate the rest of the schema? Any scripts
> and software that have been written against BioSQL will certainly
> expect the rest of the schema be present ...
>
> Bioperl-db is the BioSQL language binding for Bioperl, so that's what
> you will want to use. It comes with a script load_seqdatabase.pl to
> load any format supported by Bioperl.
>
> However, bioperl-db does expect all of Biosql to be present ...
>
>        -hilmar
>
> On Dec 7, 2005, at 6:12 PM, Angshu Kar wrote:
>
> > Hi,
> >
> > I've created 5 tables (taxon, taxon name, bioentry, biosequence,
> > biodatabase) in my postgresql database (linux box) using the biosql
> > schema
> > ddl from
> > http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/biosql-schema/sql/
> > biosqldb-pg.sql?rev=1.29&cvsroot=biosql&content-type=text/vnd.viewcvs-
> > markup
> >  .
> > Now I want to load the tables with arabidopsis data. Could you please
> > let me
> > know where can I find such scripts for pgsql? And also I find at
> > http://bio.perl.org/Core/Latest/index.shtml that the DB module has not
> > been
> > updated since 2001. Do I need to install that? Or are there some new
> > releases?
> >
> > I'll be obliged if you can guide.
> >
> > Thanks,
> > Angshu
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From sdavis2 at mail.nih.gov  Fri Dec  9 10:56:14 2005
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Fri Dec  9 10:59:48 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <df8328740512090710n3c47c517x45e378908c81d8cb@mail.gmail.com>
Message-ID: <BFBF134E.1407%sdavis2@mail.nih.gov>




On 12/9/05 10:10 AM, "Angshu Kar" <angshu96@gmail.com> wrote:

> Hi Hilmar,
> 
> In the load_seqdatabase.pl script could you please tell me where you are
> inserting the data into the db tables, so that I can try and modify that
> part to insert data only to the tables that I need ?

Angshu,

In general, that isn't going to be a fruitful exercise, as the code probably
isn't divided nicely into an "insert" (but Hilmar can comment directly).  I
would do as Hilmar suggests and instantiate the entire schema.  Only then
can you expect the tools for loading and querying the database to be useful.

If you want to do something differently, you are probably better off
starting with your own schema (or using BioSQL) and then writing your own
tools to load and query it.  However, doing so can be EXTREMELY challenging
for genomics data. 

Sean


From osborne1 at optonline.net  Fri Dec  9 11:36:23 2005
From: osborne1 at optonline.net (Brian Osborne)
Date: Fri Dec  9 11:38:51 2005
Subject: [Bioperl-l] Missing parameters in Bio::Tools::Run::Primer3
In-Reply-To: <1134121007.14008.28.camel@gbi-pc-128036.djf.agrsci.dk>
Message-ID: <BFBF1CB7.6673%osborne1@optonline.net>

Rasmus,

Thanks for pointing this out. Please record this in Bugzilla
(http://bugzilla.bioperl.org) as an "Enhancement", this way your suggestion
won't get lost.

Brian O.


On 12/9/05 4:36 AM, "Rasmus Ory Nielsen" <ron@ron.dk> wrote:

> Hi list
> 
> I wish to use the Bio::Tools::Run::Primer3 module (branch 1-5-1). I
> found that the PRIMER_LIB_AMBIGUITY_CODES_CONSENSUS parameter is missing
> from the module. This is the warning I get:
> 
> MSG: Parameter PRIMER_LIB_AMBIGUITY_CODES_CONSENSUS is not a valid
> Primer3 parameter
> 
> I then searched the module for more missing parameters. Below is a list
> of what I found.
> 
> PRIMER_DEFAULT_PRODUCT
> PRIMER_DEFAULT_SIZE
> PRIMER_INSIDE_PENALTY
> PRIMER_INTERNAL_OLIGO_MAX_TEMPLATE_MISHYB
> PRIMER_LIB_AMBIGUITY_CODES_CONSENSUS
> PRIMER_MAX_TEMPLATE_MISPRIMING
> PRIMER_OUTSIDE_PENALTY
> PRIMER_PAIR_MAX_TEMPLATE_MISPRIMING
> PRIMER_PAIR_WT_TEMPLATE_MISPRIMING
> PRIMER_WT_TEMPLATE_MISPRIMING
> 
> Best regards
> Rasmus Ory Nielsen
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From hlapp at gmx.net  Fri Dec  9 12:22:51 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri Dec  9 12:27:01 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <df8328740512081009o3e2cf31an4a896a31078af0c9@mail.gmail.com>
References: <df8328740512071812n7a5507aap71d273f0d8d781fe@mail.gmail.com>
	<3e86c394e54677a898eab8de11d8e002@gmx.net>
	<df8328740512081009o3e2cf31an4a896a31078af0c9@mail.gmail.com>
Message-ID: <25db4b5c66443458715cf08b488f538f@gmx.net>

You need to install bioperl-db from CVS. There's is no good way to  
remove code that addresses those tables you don't want to instantiate,  
and frankly I don't understand why you want to spend any time on  
accommodating a truncated Biosql schema (i.e., I don't understand why  
there would be a price to instantiating the rest of the schema too).

	-hilmar


On Dec 8, 2005, at 10:09 AM, Angshu Kar wrote:

> Thank you Hilmar. Actually we want only those tables for our tests!
> Also at first, do I need to install the Bioperl-db module ( But is it  
> the
> one that was updated 4 years back or are there any new releases)? And  
> then
> run the script suggested by you in the box? Can't we just edit the  
> script
> and keep those parts that correspond to only the tables that I've  
> created?
>
> Thanks,
> Angshu
>
>
> On 12/8/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>>
>> Any reason you didn't instantiate the rest of the schema? Any scripts
>> and software that have been written against BioSQL will certainly
>> expect the rest of the schema be present ...
>>
>> Bioperl-db is the BioSQL language binding for Bioperl, so that's what
>> you will want to use. It comes with a script load_seqdatabase.pl to
>> load any format supported by Bioperl.
>>
>> However, bioperl-db does expect all of Biosql to be present ...
>>
>>        -hilmar
>>
>> On Dec 7, 2005, at 6:12 PM, Angshu Kar wrote:
>>
>>> Hi,
>>>
>>> I've created 5 tables (taxon, taxon name, bioentry, biosequence,
>>> biodatabase) in my postgresql database (linux box) using the biosql
>>> schema
>>> ddl from
>>> http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/biosql-schema/ 
>>> sql/
>>> biosqldb-pg.sql?rev=1.29&cvsroot=biosql&content-type=text/ 
>>> vnd.viewcvs-
>>> markup
>>>  .
>>> Now I want to load the tables with arabidopsis data. Could you please
>>> let me
>>> know where can I find such scripts for pgsql? And also I find at
>>> http://bio.perl.org/Core/Latest/index.shtml that the DB module has  
>>> not
>>> been
>>> updated since 2001. Do I need to install that? Or are there some new
>>> releases?
>>>
>>> I'll be obliged if you can guide.
>>>
>>> Thanks,
>>> Angshu
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l@portal.open-bio.org
>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>
>> --
>> -------------------------------------------------------------
>> Hilmar Lapp                            email: lapp at gnf.org
>> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
>> -------------------------------------------------------------
>>
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From hlapp at gmx.net  Fri Dec  9 12:45:02 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri Dec  9 12:42:27 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <df8328740512090710n3c47c517x45e378908c81d8cb@mail.gmail.com>
References: <df8328740512071812n7a5507aap71d273f0d8d781fe@mail.gmail.com>
	<3e86c394e54677a898eab8de11d8e002@gmx.net>
	<df8328740512090710n3c47c517x45e378908c81d8cb@mail.gmail.com>
Message-ID: <2725905b99cf48d0d0740376a1156082@gmx.net>

Angshu, load_seqdatabase.pl is a script that utilizes the language  
binding library bioperl-db to load sequences and annotation into  
Biosql. The object-relational mapping code is all over bioperl-db.

I'm sorry, but if you believe it is worth fiddling with that  
object-relational code to 'save' instantiating a few more tables then  
you're welcome to do so but you're essentially on your own.

Also, if you'd like to work with a schema the language binding of which  
allows to arbitrarily drop tables from the schema and still work then  
Biosql/bioperl-db may not be for you.

	-hilmar

On Dec 9, 2005, at 7:10 AM, Angshu Kar wrote:

> Hi Hilmar,
> ?
> In the load_seqdatabase.pl script could you please tell me where you  
> are inserting the data into the db tables, so that I can try and  
> modify that part to insert data only to the tables that I need ?
> ?
> Thanks,
> Angshu
>
> ?
> On 12/8/05, Hilmar Lapp <hlapp@gmx.net> wrote: Any reason you didn't  
> instantiate the rest of the schema? Any scripts
>> and software that have been written against BioSQL will certainly
>> expect the rest of the schema be present ...
>>
>> Bioperl-db is the BioSQL language binding for Bioperl, so that's what
>> you will want to use. It comes with a script load_seqdatabase.pl to
>> load any format supported by Bioperl.
>>
>> However, bioperl-db does expect all of Biosql to be present ...
>>
>> ?????? -hilmar
>>
>> On Dec 7, 2005, at 6:12 PM, Angshu Kar wrote:
>>
>> > Hi,
>> >
>> > I've created 5 tables (taxon, taxon name, bioentry, biosequence,
>> > biodatabase) in my postgresql database (linux box) using the biosql
>> > schema
>> > ddl from
>> >  
>> http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/biosql-schema/ 
>> sql/
>> >  
>> biosqldb-pg.sql?rev=1.29&cvsroot=biosql&content-type=text/ 
>> vnd.viewcvs-
>> > markup
>> >??.
>> > Now I want to load the tables with arabidopsis data. Could you  
>> please
>> > let me
>> > know where can I find such scripts for pgsql? And also I find at
>> > http://bio.perl.org/Core/Latest/index.shtml that the DB module has  
>> not
>> > been
>> > updated since 2001. Do I need to install that? Or are there some new
>> > releases?
>> >
>> > I'll be obliged if you can guide.
>> >
>> > Thanks,
>> > Angshu
>> >
>> > _______________________________________________
>> > Bioperl-l mailing list
>> > Bioperl-l@portal.open-bio.org
>> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>> >
>> >
>> --
>> -------------------------------------------------------------
>> Hilmar Lapp????????????????????????????email: lapp at gnf.org
>> GNF, San Diego, Ca. 92121??????????????phone: +1-858-812-1757
>> -------------------------------------------------------------
>>
>>
>>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------



From kevin.mcmahon at ttuhsc.edu  Fri Dec  9 12:56:29 2005
From: kevin.mcmahon at ttuhsc.edu (kevin.mcmahon@ttuhsc.edu)
Date: Fri Dec  9 12:54:05 2005
Subject: [Bioperl-l] PrimarySeq object question
Message-ID: <6846AE140C394A4E9F91E177190F875204874564@alamo.ttuhsc.edu>

Wow, what a great response!  I'm very thankful for what everyone has done
for me.  

First, to answer some questions:

Thanks to Matt and Sam (my fellow beginners) for the help.  The file
converter you showed me works great, but (as mentioned below in Heikki's
response) this bug is in the Bio::Seq::SeqWithQuality module.  It only
throws this exception when you're working with these objects.  So while your
codes work great for someone converting Genbank to Fasta, it won't help me
read an empty scf file.  Instead, this exception will be thrown and the
program will stop.  

Now, on to Heikki and Brian.  Thanks a ton guys.  Here's what I eventually
did:

   if (eval {$in->next_seq()}){

	[Do some really cool stuff]
  }else{
    next;
  }

And now it works.  If there is still problems with this code, let us all
know for future reference and general education purposes.

As Heikki said, 
" It could be 
argued that it is overzealous to throw an exception if it can not find a 
sequence."

But, if you know the eval trick (which I should have been using all along)
you can get around this.

Thanks to everyone for helping.  I'll submit the Bugzilla report after
lunch.

Thanks a ton,

Wyatt

-----Original Message-----
From: Heikki Lehvaslaiho [mailto:heikki@sanbi.ac.za] 
Sent: Friday, December 09, 2005 12:53 AM
To: bioperl-l@portal.open-bio.org
Cc: McMahon, Kevin
Subject: Re: [Bioperl-l] PrimarySeq object question

Kevin,

The message you get comes from Bio::Seq::SeqWithQuality module. It could be 
argued that it is overzealous to throw an exception if it can not find a 
sequence. Also, the message comes after it has come to the conclusion that 
you have not set the alphabet that, according to your code snippet, you
have. 
Report this as a bug to bugzilla.bioperl.org and make sure you attach an 
example scf file.

Meanwhile, you can always avoid exiting from you code by wrapping the code 
within the eval statement.

eval { 
  # your code   
}; # note the ';'
if ($@) {
  # do something else
}

Yours,
       -Heikki

On Thursday 08 December 2005 19:36, kevin.mcmahon@ttuhsc.edu wrote:
> Everyone,
>
> I'm new to this, so please bear with me.
>
> I'm having some trouble with a scf to fasta converting program I'm
writing.
>
>   my $in  = Bio::SeqIO->new(-file => $infile , '-format' => 'scf',
> -alphabet => 'dna');
>
>     my $seq = $in->next_seq();
>     print "My sequence is:  " . $seq->seq() . "\n";
>
> Above is the code in discussion.  The $in object contains information from
> a file ($infile) in scf format.
>
> Here's my problem.  When we get to $in->next_seq(), if the file is empty,
> the program dies and returns:
>
> "MSG: If you want me to create a PrimarySeq object for your empty sequence
> <boggle> you must specify a -alphabet to satisfy the constructor
> requirements for a Bio::PrimarySeq object with no sequence.  Read the POD
> for it, luke."
>
> I guess what I need to know is: if this $in->next_seq() doesn't work, how
> can I test for this before I get this reply.
>
> Thanks in advance,
>
> Wyatt
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of the Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________
From hlapp at gmx.net  Fri Dec  9 13:00:14 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri Dec  9 12:57:44 2005
Subject: [Bioperl-l] Urgent: DB module installation
In-Reply-To: <df8328740512082010m2a34c64em7488527b1846ad5a@mail.gmail.com>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F0C@m.hg.genetics.utah.edu>
	<df8328740512082010m2a34c64em7488527b1846ad5a@mail.gmail.com>
Message-ID: <d88b84c35d58336f28b9ade2bcd4e83d@gmx.net>

If you ran the tests against your 5-table version of Biosql then for 
sure they are going to fail.

On Dec 8, 2005, at 8:10 PM, Angshu Kar wrote:

> I'm away from my lab now. I'll surely send you the error messages. I 
> got 16
> errors when i ran the make test command and all in the .t files. Also 
> could
> you please let me know if I can test whether the db module has been 
> properly
> installed using some command?
>
> Thanks,
> Angshu
>
>
> On 12/8/05, Barry Moore <bmoore@genetics.utah.edu> wrote:
>>
>> Angshu-
>>
>> The package you downloaded should have come with a file named INSTALL.
>> Did you have specific problems following the instructions in that 
>> file?
>>
>> Barry
>>
>> -----Original Message-----
>> From: bioperl-l-bounces@portal.open-bio.org
>> [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Angshu Kar
>> Sent: Thursday, December 08, 2005 7:01 PM
>> To: bioperl-l
>> Subject: [Bioperl-l] Urgent: DB module installation
>>
>> Hi,
>>
>> Could anyone please let me know how to install Bioperl-db in WindowsXP
>> as
>> well as a linux machine?
>>
>> Thanks,
>> Angshu
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l@portal.open-bio.org
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From angshu96 at gmail.com  Fri Dec  9 13:06:33 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec  9 13:04:04 2005
Subject: [Bioperl-l] Urgent: DB module installation
In-Reply-To: <d88b84c35d58336f28b9ade2bcd4e83d@gmx.net>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F0C@m.hg.genetics.utah.edu>
	<df8328740512082010m2a34c64em7488527b1846ad5a@mail.gmail.com>
	<d88b84c35d58336f28b9ade2bcd4e83d@gmx.net>
Message-ID: <df8328740512091006t20d45cf4nb4e49955a358b5dc@mail.gmail.com>

Hi Hilmar,

But this was while I was trying to install the Bioperl-db module. Has it got
anything to do with my existing schema ? I'll be obliged if you could
explain.

Thanks,
Angshu


On 12/9/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
> If you ran the tests against your 5-table version of Biosql then for
> sure they are going to fail.
>
> On Dec 8, 2005, at 8:10 PM, Angshu Kar wrote:
>
> > I'm away from my lab now. I'll surely send you the error messages. I
> > got 16
> > errors when i ran the make test command and all in the .t files. Also
> > could
> > you please let me know if I can test whether the db module has been
> > properly
> > installed using some command?
> >
> > Thanks,
> > Angshu
> >
> >
> > On 12/8/05, Barry Moore <bmoore@genetics.utah.edu> wrote:
> >>
> >> Angshu-
> >>
> >> The package you downloaded should have come with a file named INSTALL.
> >> Did you have specific problems following the instructions in that
> >> file?
> >>
> >> Barry
> >>
> >> -----Original Message-----
> >> From: bioperl-l-bounces@portal.open-bio.org
> >> [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Angshu Kar
> >> Sent: Thursday, December 08, 2005 7:01 PM
> >> To: bioperl-l
> >> Subject: [Bioperl-l] Urgent: DB module installation
> >>
> >> Hi,
> >>
> >> Could anyone please let me know how to install Bioperl-db in WindowsXP
> >> as
> >> well as a linux machine?
> >>
> >> Thanks,
> >> Angshu
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l@portal.open-bio.org
> >> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >>
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From hlapp at gmx.net  Fri Dec  9 13:09:54 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri Dec  9 13:07:21 2005
Subject: [Bioperl-l] Urgent: DB module installation
In-Reply-To: <df8328740512091006t20d45cf4nb4e49955a358b5dc@mail.gmail.com>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F0C@m.hg.genetics.utah.edu>
	<df8328740512082010m2a34c64em7488527b1846ad5a@mail.gmail.com>
	<d88b84c35d58336f28b9ade2bcd4e83d@gmx.net>
	<df8328740512091006t20d45cf4nb4e49955a358b5dc@mail.gmail.com>
Message-ID: <c661ae1d1a43b9b2cdce742fd8409cce@gmx.net>

The tests need a Biosql schema (otherwise testing bioperl-db is 
meaningless). If you didn't configure one in t/DBHarness.biosql.conf 
then they'll also fail ..

On Dec 9, 2005, at 10:06 AM, Angshu Kar wrote:

> Hi Hilmar,
> ?
> But this was while I was trying to install the Bioperl-db module. Has 
> it got anything to do with my existing schema ? I'll be obliged if you 
> could explain.
> ?
> Thanks,
> Angshu
>
> ?
> On 12/9/05, Hilmar Lapp <hlapp@gmx.net> wrote: If you ran the tests 
> against your 5-table version of Biosql then for
>> sure they are going to fail.
>>
>>  On Dec 8, 2005, at 8:10 PM, Angshu Kar wrote:
>>
>> > I'm away from my lab now. I'll surely send you the error messages. I
>> > got 16
>> > errors when i ran the make test command and all in the .t files. 
>> Also
>>  > could
>> > you please let me know if I can test whether the db module has been
>> > properly
>> > installed using some command?
>> >
>> > Thanks,
>> > Angshu
>> >
>> >
>> > On 12/8/05, Barry Moore < bmoore@genetics.utah.edu> wrote:
>> >>
>> >> Angshu-
>> >>
>> >> The package you downloaded should have come with a file named 
>> INSTALL.
>> >> Did you have specific problems following the instructions in that
>> >> file?
>> >>
>> >> Barry
>> >>
>> >> -----Original Message-----
>> >> From: bioperl-l-bounces@portal.open-bio.org
>> >> [mailto: bioperl-l-bounces@portal.open-bio.org] On Behalf Of 
>> Angshu Kar
>> >> Sent: Thursday, December 08, 2005 7:01 PM
>> >> To: bioperl-l
>> >> Subject: [Bioperl-l] Urgent: DB module installation
>> >>
>> >> Hi,
>> >>
>> >> Could anyone please let me know how to install Bioperl-db in 
>> WindowsXP
>> >> as
>> >> well as a linux machine?
>> >>
>> >> Thanks,
>> >> Angshu
>> >>
>> >> _______________________________________________
>> >> Bioperl-l mailing list
>> >> Bioperl-l@portal.open-bio.org
>> >> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>> >>
>> >
>> > _______________________________________________
>> > Bioperl-l mailing list
>> > Bioperl-l@portal.open-bio.org
>> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>> >
>> >
>> --
>> -------------------------------------------------------------
>> Hilmar Lapp????????????????????????????email: lapp at gnf.org
>> GNF, San Diego, Ca. 92121??????????????phone: +1-858-812-1757
>> -------------------------------------------------------------
>>
>>
>>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------



From hlapp at gmx.net  Fri Dec  9 13:22:41 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri Dec  9 13:20:07 2005
Subject: [Bioperl-l] patch to Bio::Location::Split - split locations whose
	strand is -1 don't print with complement when only one
	sublocation present
In-Reply-To: <CED81D34E37D5043A1211565277A51E5045CEAD5@exchkc02.stowers-institute.org>
References: <CED81D34E37D5043A1211565277A51E5045CEAD5@exchkc02.stowers-institute.org>
Message-ID: <f9ae72eaca311931bf088ea37ed052e5@gmx.net>


On Dec 8, 2005, at 9:25 PM, Cook, Malcolm wrote:

> Also, while we're here, what do you understand the semantics of strand 
> in split sublocations to be?  Your logic of termporarily flipping the 
> sublocations strand seems to suggest that you expect that the strand 
> of the sublocation should in practice agree with that of the superiour 
> split location.  I'm building split locations 'by hand' and seem 
> forced to set the strand in both the parent and all subs.  Is this 
> what you expect?  thanks.

Setting the strand on the container location should propagate to all 
its sub-locations. I.e., you should only have to set a single strand, 
unless you want sub-locations on different strands. In that case, any 
manipulation of the container strand will override the manually set 
sub-location strands.

At least that's how it should be (i.e., was meant to be).

>
> As an aside but related issue, I've got a the bioperl source head cvs 
> checked out as anonymous with a bunch of edits (such as this) that I'd 
> like now to commit given that I now have privs (I'm user mcook).  Do 
> you now a way to edit my source tree to change them to be checked out 
> by mcook instead of anonymous.  Or do I have to recheck out a fresh 
> source tree and make my edits there for commit?  Thanks

It might be easiest to get a fresh checkout and then copy over your 
changed sources (just be careful to only copy .pm files, so as not to 
copy the CVS/* files used by cvs ...).

Actually, I'm going to retract this somewhat - it is really only a good 
idea if you're very sure that the repository wasn't updated from the 
time you made your changes. You can convince yourself whether a module 
was updated in the repository or not by comparing the revision IDs. If 
you have a series of modules you could skip that step, take a diff of 
your changed modules to the repository ('cvs diff') and apply the 
resulting patch(es) to your new checkout.

	-hilmar

>
> Cheers,
>
> Malcolm Cook - mec@stowers-institute.org - 816-926-4449
> Database Applications Manager - Bioinformatics
> Stowers Institute for Medical Research - Kansas City, MO  USA
>
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From hlapp at gmx.net  Fri Dec  9 13:26:19 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri Dec  9 13:23:44 2005
Subject: [Bioperl-l] Urgent: DB module installation
In-Reply-To: <df8328740512091013na4b1438t3a97abea28461ec9@mail.gmail.com>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F0C@m.hg.genetics.utah.edu>
	<df8328740512082010m2a34c64em7488527b1846ad5a@mail.gmail.com>
	<d88b84c35d58336f28b9ade2bcd4e83d@gmx.net>
	<df8328740512091006t20d45cf4nb4e49955a358b5dc@mail.gmail.com>
	<c661ae1d1a43b9b2cdce742fd8409cce@gmx.net>
	<df8328740512091013na4b1438t3a97abea28461ec9@mail.gmail.com>
Message-ID: <2cc8cd28502f68811af5e8870b1a0e4e@gmx.net>

Read t/DBHarness.conf.example and follow the instructions. Also, this 
is explained in the INSTALL file.

Let me know if you have questions not addressed there.

	-hilmar

On Dec 9, 2005, at 10:13 AM, Angshu Kar wrote:

> Thank you so much Hilmar...and could you please explain this .conf 
> part (how/what to do)?
> ?
> Gratefully,
> Angshu
>
> ?
> On 12/9/05, Hilmar Lapp <hlapp@gmx.net> wrote: The tests need a Biosql 
> schema (otherwise testing bioperl-db is
>> meaningless). If you didn't configure one in t/DBHarness.biosql.conf
>> then they'll also fail ..
>>
>> On Dec 9, 2005, at 10:06 AM, Angshu Kar wrote:
>>
>> > Hi Hilmar,
>> >
>> > But this was while I was trying to install the Bioperl-db module. 
>> Has
>> > it got anything to do with my existing schema ? I'll be obliged if 
>> you
>> > could explain.
>> >
>> > Thanks,
>> > Angshu
>> >
>> >
>> > On 12/9/05, Hilmar Lapp <hlapp@gmx.net> wrote: If you ran the tests
>> > against your 5-table version of Biosql then for
>> >> sure they are going to fail.
>> >>
>> >>??On Dec 8, 2005, at 8:10 PM, Angshu Kar wrote:
>> >>
>> >> > I'm away from my lab now. I'll surely send you the error 
>> messages. I
>> >> > got 16
>> >> > errors when i ran the make test command and all in the .t files.
>> >> Also
>> >>??> could
>> >> > you please let me know if I can test whether the db module has 
>> been
>> >> > properly
>> >> > installed using some command?
>> >> >
>> >> > Thanks,
>> >> > Angshu
>> >> >
>> >> >
>> >> > On 12/8/05, Barry Moore < bmoore@genetics.utah.edu> wrote:
>> >> >>
>> >> >> Angshu-
>> >> >>
>> >> >> The package you downloaded should have come with a file named
>> >> INSTALL.
>> >> >> Did you have specific problems following the instructions in 
>> that
>> >> >> file?
>> >> >>
>> >> >> Barry
>> >> >>
>> >> >> -----Original Message-----
>> >> >> From: bioperl-l-bounces@portal.open-bio.org
>> >> >> [mailto: bioperl-l-bounces@portal.open-bio.org] On Behalf Of
>> >> Angshu Kar
>> >> >> Sent: Thursday, December 08, 2005 7:01 PM
>> >> >> To: bioperl-l
>> >> >> Subject: [Bioperl-l] Urgent: DB module installation
>> >> >>
>> >> >> Hi,
>> >> >>
>> >> >> Could anyone please let me know how to install Bioperl-db in
>> >> WindowsXP
>> >> >> as
>> >> >> well as a linux machine?
>> >> >>
>> >> >> Thanks,
>> >> >> Angshu
>> >> >>
>> >> >> _______________________________________________
>> >> >> Bioperl-l mailing list
>> >> >> Bioperl-l@portal.open-bio.org
>> >> >> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>> >> >>
>> >> >
>> >> > _______________________________________________
>> >> > Bioperl-l mailing list
>> >> > Bioperl-l@portal.open-bio.org
>> >> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>> >> >
>> >> >
>> >> --
>> >> -------------------------------------------------------------
>> >> Hilmar Lappemail: lapp at gnf.org
>> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> -------------------------------------------------------------
>> >>
>> >>
>> >>
>> --
>> -------------------------------------------------------------
>> Hilmar Lapp????????????????????????????email: lapp at gnf.org
>> GNF, San Diego, Ca. 92121??????????????phone: +1-858-812-1757
>> -------------------------------------------------------------
>>
>>
>>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------



From angshu96 at gmail.com  Fri Dec  9 13:13:40 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec  9 13:42:06 2005
Subject: [Bioperl-l] Urgent: DB module installation
In-Reply-To: <c661ae1d1a43b9b2cdce742fd8409cce@gmx.net>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F0C@m.hg.genetics.utah.edu>
	<df8328740512082010m2a34c64em7488527b1846ad5a@mail.gmail.com>
	<d88b84c35d58336f28b9ade2bcd4e83d@gmx.net>
	<df8328740512091006t20d45cf4nb4e49955a358b5dc@mail.gmail.com>
	<c661ae1d1a43b9b2cdce742fd8409cce@gmx.net>
Message-ID: <df8328740512091013na4b1438t3a97abea28461ec9@mail.gmail.com>

Thank you so much Hilmar...and could you please explain this .conf part
(how/what to do)?

Gratefully,
Angshu


On 12/9/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
> The tests need a Biosql schema (otherwise testing bioperl-db is
> meaningless). If you didn't configure one in t/DBHarness.biosql.conf
> then they'll also fail ..
>
> On Dec 9, 2005, at 10:06 AM, Angshu Kar wrote:
>
> > Hi Hilmar,
> >
> > But this was while I was trying to install the Bioperl-db module. Has
> > it got anything to do with my existing schema ? I'll be obliged if you
> > could explain.
> >
> > Thanks,
> > Angshu
> >
> >
> > On 12/9/05, Hilmar Lapp <hlapp@gmx.net> wrote: If you ran the tests
> > against your 5-table version of Biosql then for
> >> sure they are going to fail.
> >>
> >>  On Dec 8, 2005, at 8:10 PM, Angshu Kar wrote:
> >>
> >> > I'm away from my lab now. I'll surely send you the error messages. I
> >> > got 16
> >> > errors when i ran the make test command and all in the .t files.
> >> Also
> >>  > could
> >> > you please let me know if I can test whether the db module has been
> >> > properly
> >> > installed using some command?
> >> >
> >> > Thanks,
> >> > Angshu
> >> >
> >> >
> >> > On 12/8/05, Barry Moore < bmoore@genetics.utah.edu> wrote:
> >> >>
> >> >> Angshu-
> >> >>
> >> >> The package you downloaded should have come with a file named
> >> INSTALL.
> >> >> Did you have specific problems following the instructions in that
> >> >> file?
> >> >>
> >> >> Barry
> >> >>
> >> >> -----Original Message-----
> >> >> From: bioperl-l-bounces@portal.open-bio.org
> >> >> [mailto: bioperl-l-bounces@portal.open-bio.org] On Behalf Of
> >> Angshu Kar
> >> >> Sent: Thursday, December 08, 2005 7:01 PM
> >> >> To: bioperl-l
> >> >> Subject: [Bioperl-l] Urgent: DB module installation
> >> >>
> >> >> Hi,
> >> >>
> >> >> Could anyone please let me know how to install Bioperl-db in
> >> WindowsXP
> >> >> as
> >> >> well as a linux machine?
> >> >>
> >> >> Thanks,
> >> >> Angshu
> >> >>
> >> >> _______________________________________________
> >> >> Bioperl-l mailing list
> >> >> Bioperl-l@portal.open-bio.org
> >> >> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >> >>
> >> >
> >> > _______________________________________________
> >> > Bioperl-l mailing list
> >> > Bioperl-l@portal.open-bio.org
> >> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >> >
> >> >
> >> --
> >> -------------------------------------------------------------
> >> Hilmar Lappemail: lapp at gnf.org
> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> -------------------------------------------------------------
> >>
> >>
> >>
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From osborne1 at optonline.net  Fri Dec  9 15:36:22 2005
From: osborne1 at optonline.net (Brian Osborne)
Date: Fri Dec  9 15:38:54 2005
Subject: [Bioperl-l] throw, not die
In-Reply-To: <200512091426.57161.heikki@sanbi.ac.za>
Message-ID: <BFBF54F6.668C%osborne1@optonline.net>

Heikki,

Torsten's idea!

Brian O.


On 12/9/05 7:26 AM, "Heikki Lehvaslaiho" <heikki@sanbi.ac.za> wrote:

> Brian,
> 
> I picked up the idea from your recent commits, did a search for 'die' commands
> in bioperl cvs head and fixed quite a few. I did not touch the Bio::Graphics
> name space as those do not inherit from Bio::Root::Root.
> 
> I hope I was not overly zealous. At least all tests pass.
> 
> -Heikki


From angshu96 at gmail.com  Fri Dec  9 16:58:42 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec  9 17:22:20 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <2725905b99cf48d0d0740376a1156082@gmx.net>
References: <df8328740512071812n7a5507aap71d273f0d8d781fe@mail.gmail.com>
	<3e86c394e54677a898eab8de11d8e002@gmx.net>
	<df8328740512090710n3c47c517x45e378908c81d8cb@mail.gmail.com>
	<2725905b99cf48d0d0740376a1156082@gmx.net>
Message-ID: <df8328740512091358i7fe0e477rc8f3a135adc1e470@mail.gmail.com>

Hi Hilmar,

I'm obliged that you showed me the light. I reanalyzed the schema and found
that its no use working with a truncated version of biosql-schema and now
I'm planning to install the entire schema. Could you please let me know
where can I find the script for that for a Pg db?

Thank you so much. Else I would have to face a lots of problem in the later
half of my project.

Gratefully,
Angshu

On 12/9/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
> Angshu, load_seqdatabase.pl is a script that utilizes the language
> binding library bioperl-db to load sequences and annotation into
> Biosql. The object-relational mapping code is all over bioperl-db.
>
> I'm sorry, but if you believe it is worth fiddling with that
> object-relational code to 'save' instantiating a few more tables then
> you're welcome to do so but you're essentially on your own.
>
> Also, if you'd like to work with a schema the language binding of which
> allows to arbitrarily drop tables from the schema and still work then
> Biosql/bioperl-db may not be for you.
>
>         -hilmar
>
> On Dec 9, 2005, at 7:10 AM, Angshu Kar wrote:
>
> > Hi Hilmar,
> >
> > In the load_seqdatabase.pl script could you please tell me where you
> > are inserting the data into the db tables, so that I can try and
> > modify that part to insert data only to the tables that I need ?
> >
> > Thanks,
> > Angshu
> >
> >
> > On 12/8/05, Hilmar Lapp <hlapp@gmx.net> wrote: Any reason you didn't
> > instantiate the rest of the schema? Any scripts
> >> and software that have been written against BioSQL will certainly
> >> expect the rest of the schema be present ...
> >>
> >> Bioperl-db is the BioSQL language binding for Bioperl, so that's what
> >> you will want to use. It comes with a script load_seqdatabase.pl to
> >> load any format supported by Bioperl.
> >>
> >> However, bioperl-db does expect all of Biosql to be present ...
> >>
> >> -hilmar
> >>
> >> On Dec 7, 2005, at 6:12 PM, Angshu Kar wrote:
> >>
> >> > Hi,
> >> >
> >> > I've created 5 tables (taxon, taxon name, bioentry, biosequence,
> >> > biodatabase) in my postgresql database (linux box) using the biosql
> >> > schema
> >> > ddl from
> >> >
> >> http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/biosql-schema/
> >> sql/
> >> >
> >> biosqldb-pg.sql?rev=1.29&cvsroot=biosql&content-type=text/
> >> vnd.viewcvs-
> >> > markup
> >> >.
> >> > Now I want to load the tables with arabidopsis data. Could you
> >> please
> >> > let me
> >> > know where can I find such scripts for pgsql? And also I find at
> >> > http://bio.perl.org/Core/Latest/index.shtml that the DB module has
> >> not
> >> > been
> >> > updated since 2001. Do I need to install that? Or are there some new
> >> > releases?
> >> >
> >> > I'll be obliged if you can guide.
> >> >
> >> > Thanks,
> >> > Angshu
> >> >
> >> > _______________________________________________
> >> > Bioperl-l mailing list
> >> > Bioperl-l@portal.open-bio.org
> >> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >> >
> >> >
> >> --
> >> -------------------------------------------------------------
> >> Hilmar Lappemail: lapp at gnf.org
> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> -------------------------------------------------------------
> >>
> >>
> >>
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From sdavis2 at mail.nih.gov  Fri Dec  9 18:07:36 2005
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Fri Dec  9 18:05:08 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <df8328740512091358i7fe0e477rc8f3a135adc1e470@mail.gmail.com>
Message-ID: <BFBF7868.149E%sdavis2@mail.nih.gov>




On 12/9/05 4:58 PM, "Angshu Kar" <angshu96@gmail.com> wrote:

> Hi Hilmar,
> 
> I'm obliged that you showed me the light. I reanalyzed the schema and found
> that its no use working with a truncated version of biosql-schema and now
> I'm planning to install the entire schema. Could you please let me know
> where can I find the script for that for a Pg db?
> 
> Thank you so much. Else I would have to face a lots of problem in the later
> half of my project.
> 
> Gratefully,
> Angshu

Angshu,

Unfortunately (I hate to read documentation, also), you need to read the
documentation and installation instructions with things that you download.
If you got the biosql-schema, there is an INSTALL file in it that gives
details.  Hilmar and others have pointed out the INSTALL files on several
occasions as a source of answers to most installation questions.

I would suggest going through the INSTALL file located here:

http://cvs.bioperl.org/cgi-bin/viewcvs/viewcvs.cgi/*checkout*/biosql-schema/
INSTALL?rev=HEAD&cvsroot=bioperl&content-type=text/plain

If you have a problem, then you need to provide the exact commands that you
executed prior to getting that problem, the exact error message you see, and
the operating system and version numbers for any relevant software.  That
will save you much time and grief when asking for help.

Sean


From angshu96 at gmail.com  Fri Dec  9 18:14:03 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec  9 18:39:09 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <BFBF7868.149E%sdavis2@mail.nih.gov>
References: <df8328740512091358i7fe0e477rc8f3a135adc1e470@mail.gmail.com>
	<BFBF7868.149E%sdavis2@mail.nih.gov>
Message-ID: <df8328740512091514r1368610ct31ac6be653af5ca5@mail.gmail.com>

Thanks Sean. I've found all documents needed. I've also installed the biosql
schema (by the way are there 28 tables? to confirm if I've missed
something). My taxon loading script has also run successfully, Now I'll be
running the load_seq script. Thank you so much for helping this novice out.

Thanks,
Angshu

On 12/9/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
>
>
>
>
> On 12/9/05 4:58 PM, "Angshu Kar" <angshu96@gmail.com> wrote:
>
> > Hi Hilmar,
> >
> > I'm obliged that you showed me the light. I reanalyzed the schema and
> found
> > that its no use working with a truncated version of biosql-schema and
> now
> > I'm planning to install the entire schema. Could you please let me know
> > where can I find the script for that for a Pg db?
> >
> > Thank you so much. Else I would have to face a lots of problem in the
> later
> > half of my project.
> >
> > Gratefully,
> > Angshu
>
> Angshu,
>
> Unfortunately (I hate to read documentation, also), you need to read the
> documentation and installation instructions with things that you download.
> If you got the biosql-schema, there is an INSTALL file in it that gives
> details.  Hilmar and others have pointed out the INSTALL files on several
> occasions as a source of answers to most installation questions.
>
> I would suggest going through the INSTALL file located here:
>
>
> http://cvs.bioperl.org/cgi-bin/viewcvs/viewcvs.cgi/*checkout*/biosql-schema/
> INSTALL?rev=HEAD&cvsroot=bioperl&content-type=text/plain
>
> If you have a problem, then you need to provide the exact commands that
> you
> executed prior to getting that problem, the exact error message you see,
> and
> the operating system and version numbers for any relevant software.  That
> will save you much time and grief when asking for help.
>
> Sean
>
>
>

From angshu96 at gmail.com  Fri Dec  9 19:21:49 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec  9 19:19:13 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <BFBF7B1D.14A6%sdavis2@mail.nih.gov>
References: <df8328740512091514r1368610ct31ac6be653af5ca5@mail.gmail.com>
	<BFBF7B1D.14A6%sdavis2@mail.nih.gov>
Message-ID: <df8328740512091621td5bf053l26d42535a67679f@mail.gmail.com>

Hi Sean,

A small help I need before I run the load_seqdatabase.pl. I've downloaded my
datafile which is ATH1_cds_cm_20040228 from TAIR. What's the namespace and
format for this?

Thanks,
Angshu

From bmoore at genetics.utah.edu  Fri Dec  9 19:35:34 2005
From: bmoore at genetics.utah.edu (Barry Moore)
Date: Fri Dec  9 19:32:00 2005
Subject: [Bioperl-l] loading data to biosql tables
Message-ID: <CFE1DF3BA20F424689DA0881A14055BECF2F14@m.hg.genetics.utah.edu>

Angshu-

Make the namespace whatever you want it to be.  This is useful if you
want to load sequence from different sources into the same database.  As
for the format - you tell us what format is the file in?  You could just
let bioperl guess, but looking at the file and deciding yourself would
be your best bet.

Barry

> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-
> bounces@portal.open-bio.org] On Behalf Of Angshu Kar
> Sent: Friday, December 09, 2005 5:22 PM
> To: Sean Davis
> Cc: bioperl-l
> Subject: Re: [Bioperl-l] loading data to biosql tables
> 
> Hi Sean,
> 
> A small help I need before I run the load_seqdatabase.pl. I've
downloaded
> my
> datafile which is ATH1_cds_cm_20040228 from TAIR. What's the namespace
and
> format for this?
> 
> Thanks,
> Angshu
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

From angshu96 at gmail.com  Fri Dec  9 19:45:41 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec  9 19:43:07 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <CFE1DF3BA20F424689DA0881A14055BECF2F14@m.hg.genetics.utah.edu>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F14@m.hg.genetics.utah.edu>
Message-ID: <df8328740512091645g1b1d20f1rb909a28fc65c0536@mail.gmail.com>

Thanks a lot Barry.

Now I'm getting this error while tryin to run the load_seqdatabase.pl in a
linux box (I used :
perl load_seqdatabase.pl /akar/seq/ATH1_cds_cm_20040228)


Can't locate Bio/Root/Root.pm in @INC (@INC contains:
/usr/lib/perl5/5.8.5/i386-linux-thread-multi /usr/lib/perl5/5.8.5
/usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4
/usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
/usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
/usr/lib/perl5/site_perl
/usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4
/usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
/usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
/usr/lib/perl5/vendor_perl .) at load_seqdatabase.pl line 7.
BEGIN failed--compilation aborted at load_seqdatabase.pl line 7.

Please guide.

Thanks,
Angshu

On 12/9/05, Barry Moore <bmoore@genetics.utah.edu> wrote:
>
> Angshu-
>
> Make the namespace whatever you want it to be.  This is useful if you
> want to load sequence from different sources into the same database.  As
> for the format - you tell us what format is the file in?  You could just
> let bioperl guess, but looking at the file and deciding yourself would
> be your best bet.
>
> Barry
>
> > -----Original Message-----
> > From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-
> > bounces@portal.open-bio.org] On Behalf Of Angshu Kar
> > Sent: Friday, December 09, 2005 5:22 PM
> > To: Sean Davis
> > Cc: bioperl-l
> > Subject: Re: [Bioperl-l] loading data to biosql tables
> >
> > Hi Sean,
> >
> > A small help I need before I run the load_seqdatabase.pl. I've
> downloaded
> > my
> > datafile which is ATH1_cds_cm_20040228 from TAIR. What's the namespace
> and
> > format for this?
> >
> > Thanks,
> > Angshu
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

From angshu96 at gmail.com  Fri Dec  9 19:54:59 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec  9 19:52:26 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <df8328740512091645g1b1d20f1rb909a28fc65c0536@mail.gmail.com>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F14@m.hg.genetics.utah.edu>
	<df8328740512091645g1b1d20f1rb909a28fc65c0536@mail.gmail.com>
Message-ID: <df8328740512091654p1e5e7b14i7e2c731f87e721c6@mail.gmail.com>

One thing I missed was that my Root.pm resides in a different path...How to
specify that?

On 12/9/05, Angshu Kar <angshu96@gmail.com> wrote:
>
> Thanks a lot Barry.
>
> Now I'm getting this error while tryin to run the load_seqdatabase.pl in a
> linux box (I used :
> perl load_seqdatabase.pl /akar/seq/ATH1_cds_cm_20040228)
>
>
> Can't locate Bio/Root/Root.pm in @INC (@INC contains:
> /usr/lib/perl5/5.8.5/i386-linux-thread-multi /usr/lib/perl5/5.8.5
> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4
> /usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
> /usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
> /usr/lib/perl5/site_perl
> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4
> /usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
> /usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
> /usr/lib/perl5/vendor_perl .) at load_seqdatabase.pl line 7.
> BEGIN failed--compilation aborted at load_seqdatabase.pl line 7.
>
> Please guide.
>
> Thanks,
> Angshu
>
> On 12/9/05, Barry Moore < bmoore@genetics.utah.edu> wrote:
> >
> > Angshu-
> >
> > Make the namespace whatever you want it to be.  This is useful if you
> > want to load sequence from different sources into the same database.  As
> > for the format - you tell us what format is the file in?  You could just
> > let bioperl guess, but looking at the file and deciding yourself would
> > be your best bet.
> >
> > Barry
> >
> > > -----Original Message-----
> > > From: bioperl-l-bounces@portal.open-bio.org [mailto: bioperl-l-
> > > bounces@portal.open-bio.org] On Behalf Of Angshu Kar
> > > Sent: Friday, December 09, 2005 5:22 PM
> > > To: Sean Davis
> > > Cc: bioperl-l
> > > Subject: Re: [Bioperl-l] loading data to biosql tables
> > >
> > > Hi Sean,
> > >
> > > A small help I need before I run the load_seqdatabase.pl. I've
> > downloaded
> > > my
> > > datafile which is ATH1_cds_cm_20040228 from TAIR. What's the namespace
> >
> > and
> > > format for this?
> > >
> > > Thanks,
> > > Angshu
> > >
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l@portal.open-bio.org
> > > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
>
>

From jason.stajich at duke.edu  Fri Dec  9 21:09:35 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Fri Dec  9 21:43:35 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <df8328740512091654p1e5e7b14i7e2c731f87e721c6@mail.gmail.com>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F14@m.hg.genetics.utah.edu>
	<df8328740512091645g1b1d20f1rb909a28fc65c0536@mail.gmail.com>
	<df8328740512091654p1e5e7b14i7e2c731f87e721c6@mail.gmail.com>
Message-ID: <3CCC9485-FF57-4C6F-81AF-3B9C9AFDF197@duke.edu>


Follow the install instructions for bioperl first, you need bioperl  
to run bioperl-db.
These include, set your PERL5LIB or install bioperl on your system or  
run the load script with -I PATH/TO/BIOPERL


On Dec 9, 2005, at 7:54 PM, Angshu Kar wrote:

> One thing I missed was that my Root.pm resides in a different  
> path...How to
> specify that?
>
> On 12/9/05, Angshu Kar <angshu96@gmail.com> wrote:
>>
>> Thanks a lot Barry.
>>
>> Now I'm getting this error while tryin to run the  
>> load_seqdatabase.pl in a
>> linux box (I used :
>> perl load_seqdatabase.pl /akar/seq/ATH1_cds_cm_20040228)
>>
>>
>> Can't locate Bio/Root/Root.pm in @INC (@INC contains:
>> /usr/lib/perl5/5.8.5/i386-linux-thread-multi /usr/lib/perl5/5.8.5
>> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4
>> /usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
>> /usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
>> /usr/lib/perl5/site_perl
>> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4
>> /usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
>> /usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
>> /usr/lib/perl5/vendor_perl .) at load_seqdatabase.pl line 7.
>> BEGIN failed--compilation aborted at load_seqdatabase.pl line 7.
>>
>> Please guide.
>>
>> Thanks,
>> Angshu
>>
>> On 12/9/05, Barry Moore < bmoore@genetics.utah.edu> wrote:
>>>
>>> Angshu-
>>>
>>> Make the namespace whatever you want it to be.  This is useful if  
>>> you
>>> want to load sequence from different sources into the same  
>>> database.  As
>>> for the format - you tell us what format is the file in?  You  
>>> could just
>>> let bioperl guess, but looking at the file and deciding yourself  
>>> would
>>> be your best bet.
>>>
>>> Barry
>>>
>>>> -----Original Message-----
>>>> From: bioperl-l-bounces@portal.open-bio.org [mailto: bioperl-l-
>>>> bounces@portal.open-bio.org] On Behalf Of Angshu Kar
>>>> Sent: Friday, December 09, 2005 5:22 PM
>>>> To: Sean Davis
>>>> Cc: bioperl-l
>>>> Subject: Re: [Bioperl-l] loading data to biosql tables
>>>>
>>>> Hi Sean,
>>>>
>>>> A small help I need before I run the load_seqdatabase.pl. I've
>>> downloaded
>>>> my
>>>> datafile which is ATH1_cds_cm_20040228 from TAIR. What's the  
>>>> namespace
>>>
>>> and
>>>> format for this?
>>>>
>>>> Thanks,
>>>> Angshu
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l@portal.open-bio.org
>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12


From angshu96 at gmail.com  Fri Dec  9 22:21:27 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec  9 22:27:12 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <3CCC9485-FF57-4C6F-81AF-3B9C9AFDF197@duke.edu>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F14@m.hg.genetics.utah.edu>
	<df8328740512091645g1b1d20f1rb909a28fc65c0536@mail.gmail.com>
	<df8328740512091654p1e5e7b14i7e2c731f87e721c6@mail.gmail.com>
	<3CCC9485-FF57-4C6F-81AF-3B9C9AFDF197@duke.edu>
Message-ID: <df8328740512091921w175f04a4iead8a34a6f0b8993@mail.gmail.com>

Thanks Jason...
I'm sorry but I didn't get you.
I've installed bioperl as well as bioperl-db module in my system...
Now what should be my next step to resolve this problem?
I'm sorry again, but as I told that I'm a novice in this domain.

Thanks,
Angshu


On 12/9/05, Jason Stajich <jason.stajich@duke.edu> wrote:
>
>
> Follow the install instructions for bioperl first, you need bioperl
> to run bioperl-db.
> These include, set your PERL5LIB or install bioperl on your system or
> run the load script with -I PATH/TO/BIOPERL
>
>
> On Dec 9, 2005, at 7:54 PM, Angshu Kar wrote:
>
> > One thing I missed was that my Root.pm resides in a different
> > path...How to
> > specify that?
> >
> > On 12/9/05, Angshu Kar <angshu96@gmail.com> wrote:
> >>
> >> Thanks a lot Barry.
> >>
> >> Now I'm getting this error while tryin to run the
> >> load_seqdatabase.pl in a
> >> linux box (I used :
> >> perl load_seqdatabase.pl /akar/seq/ATH1_cds_cm_20040228)
> >>
> >>
> >> Can't locate Bio/Root/Root.pm in @INC (@INC contains:
> >> /usr/lib/perl5/5.8.5/i386-linux-thread-multi /usr/lib/perl5/5.8.5
> >> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4
> >> /usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
> >> /usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
> >> /usr/lib/perl5/site_perl
> >> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4
> >> /usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
> >> /usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
> >> /usr/lib/perl5/vendor_perl .) at load_seqdatabase.pl line 7.
> >> BEGIN failed--compilation aborted at load_seqdatabase.pl line 7.
> >>
> >> Please guide.
> >>
> >> Thanks,
> >> Angshu
> >>
> >> On 12/9/05, Barry Moore < bmoore@genetics.utah.edu> wrote:
> >>>
> >>> Angshu-
> >>>
> >>> Make the namespace whatever you want it to be.  This is useful if
> >>> you
> >>> want to load sequence from different sources into the same
> >>> database.  As
> >>> for the format - you tell us what format is the file in?  You
> >>> could just
> >>> let bioperl guess, but looking at the file and deciding yourself
> >>> would
> >>> be your best bet.
> >>>
> >>> Barry
> >>>
> >>>> -----Original Message-----
> >>>> From: bioperl-l-bounces@portal.open-bio.org [mailto: bioperl-l-
> >>>> bounces@portal.open-bio.org] On Behalf Of Angshu Kar
> >>>> Sent: Friday, December 09, 2005 5:22 PM
> >>>> To: Sean Davis
> >>>> Cc: bioperl-l
> >>>> Subject: Re: [Bioperl-l] loading data to biosql tables
> >>>>
> >>>> Hi Sean,
> >>>>
> >>>> A small help I need before I run the load_seqdatabase.pl. I've
> >>> downloaded
> >>>> my
> >>>> datafile which is ATH1_cds_cm_20040228 from TAIR. What's the
> >>>> namespace
> >>>
> >>> and
> >>>> format for this?
> >>>>
> >>>> Thanks,
> >>>> Angshu
> >>>>
> >>>> _______________________________________________
> >>>> Bioperl-l mailing list
> >>>> Bioperl-l@portal.open-bio.org
> >>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >>>
> >>
> >>
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
> --
> Jason Stajich
> Duke University
> http://www.duke.edu/~jes12
>
>
>

From angshu96 at gmail.com  Fri Dec  9 23:46:12 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec  9 23:43:47 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <20051210044021.95719.qmail@web36809.mail.mud.yahoo.com>
References: <df8328740512091921w175f04a4iead8a34a6f0b8993@mail.gmail.com>
	<20051210044021.95719.qmail@web36809.mail.mud.yahoo.com>
Message-ID: <df8328740512092046u21c4c6e5rfba6ca4a630c4294@mail.gmail.com>

Thanks Chen. I'm running it on linux (red hat) too... but did you work with
biosql-db module and face that problem?

On 12/9/05, chen li <chen_li3@yahoo.com> wrote:
>
> Based on my personal experience Bioperl is meant to
> run much much smoothly on linux system (or Unix).
> Which operation system are you using? If it is windows
> I expect you have a lot of troubles (now and in the
> future) for a novice even you install an ActivePerl. I
> have the same probelm before. But everything is fine
> after I install a red hat linxu Fedora core 1 on my
> computer.  Now I have dual OS on my computer. I follow
> the HOWTO INSTALL coming with Biosql and everything is
> fine.
>
> Li
>
> --- Angshu Kar <angshu96@gmail.com> wrote:
>
> > Thanks Jason...
> > I'm sorry but I didn't get you.
> > I've installed bioperl as well as bioperl-db module
> > in my system...
> > Now what should be my next step to resolve this
> > problem?
> > I'm sorry again, but as I told that I'm a novice in
> > this domain.
> >
> > Thanks,
> > Angshu
> >
> >
> > On 12/9/05, Jason Stajich <jason.stajich@duke.edu>
> > wrote:
> > >
> > >
> > > Follow the install instructions for bioperl first,
> > you need bioperl
> > > to run bioperl-db.
> > > These include, set your PERL5LIB or install
> > bioperl on your system or
> > > run the load script with -I PATH/TO/BIOPERL
> > >
> > >
> > > On Dec 9, 2005, at 7:54 PM, Angshu Kar wrote:
> > >
> > > > One thing I missed was that my Root.pm resides
> > in a different
> > > > path...How to
> > > > specify that?
> > > >
> > > > On 12/9/05, Angshu Kar <angshu96@gmail.com>
> > wrote:
> > > >>
> > > >> Thanks a lot Barry.
> > > >>
> > > >> Now I'm getting this error while tryin to run
> > the
> > > >> load_seqdatabase.pl in a
> > > >> linux box (I used :
> > > >> perl load_seqdatabase.pl
> > /akar/seq/ATH1_cds_cm_20040228)
> > > >>
> > > >>
> > > >> Can't locate Bio/Root/Root.pm in @INC (@INC
> > contains:
> > > >> /usr/lib/perl5/5.8.5/i386-linux-thread-multi
> > /usr/lib/perl5/5.8.5
> > > >>
> >
> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
> > > >>
> >
> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
> > > >>
> >
> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
> > > >>
> >
> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
> > > >>
> >
> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
> > > >>
> >
> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
> > > >> /usr/lib/perl5/site_perl/5.8.5
> > /usr/lib/perl5/site_perl/5.8.4
> > > >> /usr/lib/perl5/site_perl/5.8.3
> > /usr/lib/perl5/site_perl/5.8.2
> > > >> /usr/lib/perl5/site_perl/5.8.1
> > /usr/lib/perl5/site_perl/5.8.0
> > > >> /usr/lib/perl5/site_perl
> > > >>
> >
> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
> > > >>
> >
> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
> > > >>
> >
> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
> > > >>
> >
> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
> > > >>
> >
> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
> > > >>
> >
> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
> > > >> /usr/lib/perl5/vendor_perl/5.8.5
> > /usr/lib/perl5/vendor_perl/5.8.4
> > > >> /usr/lib/perl5/vendor_perl/5.8.3
> > /usr/lib/perl5/vendor_perl/5.8.2
> > > >> /usr/lib/perl5/vendor_perl/5.8.1
> > /usr/lib/perl5/vendor_perl/5.8.0
> > > >> /usr/lib/perl5/vendor_perl .) at
> > load_seqdatabase.pl line 7.
> > > >> BEGIN failed--compilation aborted at
> > load_seqdatabase.pl line 7.
> > > >>
> > > >> Please guide.
> > > >>
> > > >> Thanks,
> > > >> Angshu
> > > >>
> > > >> On 12/9/05, Barry Moore <
> > bmoore@genetics.utah.edu> wrote:
> > > >>>
> > > >>> Angshu-
> > > >>>
> > > >>> Make the namespace whatever you want it to be.
> >  This is useful if
> > > >>> you
> > > >>> want to load sequence from different sources
> > into the same
> > > >>> database.  As
> > > >>> for the format - you tell us what format is
> > the file in?  You
> > > >>> could just
> > > >>> let bioperl guess, but looking at the file and
> > deciding yourself
> > > >>> would
> > > >>> be your best bet.
> > > >>>
> > > >>> Barry
> > > >>>
> > > >>>> -----Original Message-----
> > > >>>> From: bioperl-l-bounces@portal.open-bio.org
> > [mailto: bioperl-l-
> > > >>>> bounces@portal.open-bio.org] On Behalf Of
> > Angshu Kar
> > > >>>> Sent: Friday, December 09, 2005 5:22 PM
> > > >>>> To: Sean Davis
> > > >>>> Cc: bioperl-l
> > > >>>> Subject: Re: [Bioperl-l] loading data to
> > biosql tables
> > > >>>>
> > > >>>> Hi Sean,
> > > >>>>
> > > >>>> A small help I need before I run the
> > load_seqdatabase.pl. I've
> > > >>> downloaded
> > > >>>> my
> > > >>>> datafile which is ATH1_cds_cm_20040228 from
> > TAIR. What's the
> > > >>>> namespace
> > > >>>
> > > >>> and
> > > >>>> format for this?
> > > >>>>
> > > >>>> Thanks,
> > > >>>> Angshu
> > > >>>>
> > > >>>>
> > _______________________________________________
> > > >>>> Bioperl-l mailing list
> > > >>>> Bioperl-l@portal.open-bio.org
> > > >>>>
> >
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > > >>>
> > > >>
> > > >>
> > > >
> > > > _______________________________________________
> > > > Bioperl-l mailing list
> > > > Bioperl-l@portal.open-bio.org
> > > >
> >
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > >
> > > --
> > > Jason Stajich
> > > Duke University
> > > http://www.duke.edu/~jes12
> > >
> > >
> > >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> >
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
>
>
> __________________________________________________
> Do You Yahoo!?
> Tired of spam?  Yahoo! Mail has the best spam protection around
> http://mail.yahoo.com
>

From osborne1 at optonline.net  Sat Dec 10 00:11:21 2005
From: osborne1 at optonline.net (Brian Osborne)
Date: Sat Dec 10 00:13:50 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <df8328740512092046u21c4c6e5rfba6ca4a630c4294@mail.gmail.com>
Message-ID: <BFBFCDA9.66A2%osborne1@optonline.net>

Li,

Cygwin on Windows is a great platform for Bioperl, I used it happily for
many years. When I was using Windows and Cygwin I recall getting bioperl-db
and Biosql up and running in 10 minutes using the postgres package from
Cygwin, and this was the first time I tried to install bioperl-db and Biosql
with postgres. Since Cygwin is a Unix emulator all the INSTALL instructions
work perfectly without any amendments.

Brian O.


On 12/9/05 11:46 PM, "Angshu Kar" <angshu96@gmail.com> wrote:

> Thanks Chen. I'm running it on linux (red hat) too... but did you work with
> biosql-db module and face that problem?
> 
> On 12/9/05, chen li <chen_li3@yahoo.com> wrote:
>> 
>> Based on my personal experience Bioperl is meant to
>> run much much smoothly on linux system (or Unix).
>> Which operation system are you using? If it is windows
>> I expect you have a lot of troubles (now and in the
>> future) for a novice even you install an ActivePerl. I
>> have the same probelm before. But everything is fine
>> after I install a red hat linxu Fedora core 1 on my
>> computer.  Now I have dual OS on my computer. I follow
>> the HOWTO INSTALL coming with Biosql and everything is
>> fine.
>> 
>> Li
>> 
>> --- Angshu Kar <angshu96@gmail.com> wrote:
>> 
>>> Thanks Jason...
>>> I'm sorry but I didn't get you.
>>> I've installed bioperl as well as bioperl-db module
>>> in my system...
>>> Now what should be my next step to resolve this
>>> problem?
>>> I'm sorry again, but as I told that I'm a novice in
>>> this domain.
>>> 
>>> Thanks,
>>> Angshu
>>> 
>>> 
>>> On 12/9/05, Jason Stajich <jason.stajich@duke.edu>
>>> wrote:
>>>> 
>>>> 
>>>> Follow the install instructions for bioperl first,
>>> you need bioperl
>>>> to run bioperl-db.
>>>> These include, set your PERL5LIB or install
>>> bioperl on your system or
>>>> run the load script with -I PATH/TO/BIOPERL
>>>> 
>>>> 
>>>> On Dec 9, 2005, at 7:54 PM, Angshu Kar wrote:
>>>> 
>>>>> One thing I missed was that my Root.pm resides
>>> in a different
>>>>> path...How to
>>>>> specify that?
>>>>> 
>>>>> On 12/9/05, Angshu Kar <angshu96@gmail.com>
>>> wrote:
>>>>>> 
>>>>>> Thanks a lot Barry.
>>>>>> 
>>>>>> Now I'm getting this error while tryin to run
>>> the
>>>>>> load_seqdatabase.pl in a
>>>>>> linux box (I used :
>>>>>> perl load_seqdatabase.pl
>>> /akar/seq/ATH1_cds_cm_20040228)
>>>>>> 
>>>>>> 
>>>>>> Can't locate Bio/Root/Root.pm in @INC (@INC
>>> contains:
>>>>>> /usr/lib/perl5/5.8.5/i386-linux-thread-multi
>>> /usr/lib/perl5/5.8.5
>>>>>> 
>>> 
>> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
>>>>>> 
>>> 
>> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
>>>>>> 
>>> 
>> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
>>>>>> 
>>> 
>> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
>>>>>> 
>>> 
>> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
>>>>>> 
>>> 
>> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
>>>>>> /usr/lib/perl5/site_perl/5.8.5
>>> /usr/lib/perl5/site_perl/5.8.4
>>>>>> /usr/lib/perl5/site_perl/5.8.3
>>> /usr/lib/perl5/site_perl/5.8.2
>>>>>> /usr/lib/perl5/site_perl/5.8.1
>>> /usr/lib/perl5/site_perl/5.8.0
>>>>>> /usr/lib/perl5/site_perl
>>>>>> 
>>> 
>> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
>>>>>> 
>>> 
>> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
>>>>>> 
>>> 
>> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
>>>>>> 
>>> 
>> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
>>>>>> 
>>> 
>> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
>>>>>> 
>>> 
>> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
>>>>>> /usr/lib/perl5/vendor_perl/5.8.5
>>> /usr/lib/perl5/vendor_perl/5.8.4
>>>>>> /usr/lib/perl5/vendor_perl/5.8.3
>>> /usr/lib/perl5/vendor_perl/5.8.2
>>>>>> /usr/lib/perl5/vendor_perl/5.8.1
>>> /usr/lib/perl5/vendor_perl/5.8.0
>>>>>> /usr/lib/perl5/vendor_perl .) at
>>> load_seqdatabase.pl line 7.
>>>>>> BEGIN failed--compilation aborted at
>>> load_seqdatabase.pl line 7.
>>>>>> 
>>>>>> Please guide.
>>>>>> 
>>>>>> Thanks,
>>>>>> Angshu
>>>>>> 
>>>>>> On 12/9/05, Barry Moore <
>>> bmoore@genetics.utah.edu> wrote:
>>>>>>> 
>>>>>>> Angshu-
>>>>>>> 
>>>>>>> Make the namespace whatever you want it to be.
>>>  This is useful if
>>>>>>> you
>>>>>>> want to load sequence from different sources
>>> into the same
>>>>>>> database.  As
>>>>>>> for the format - you tell us what format is
>>> the file in?  You
>>>>>>> could just
>>>>>>> let bioperl guess, but looking at the file and
>>> deciding yourself
>>>>>>> would
>>>>>>> be your best bet.
>>>>>>> 
>>>>>>> Barry
>>>>>>> 
>>>>>>>> -----Original Message-----
>>>>>>>> From: bioperl-l-bounces@portal.open-bio.org
>>> [mailto: bioperl-l-
>>>>>>>> bounces@portal.open-bio.org] On Behalf Of
>>> Angshu Kar
>>>>>>>> Sent: Friday, December 09, 2005 5:22 PM
>>>>>>>> To: Sean Davis
>>>>>>>> Cc: bioperl-l
>>>>>>>> Subject: Re: [Bioperl-l] loading data to
>>> biosql tables
>>>>>>>> 
>>>>>>>> Hi Sean,
>>>>>>>> 
>>>>>>>> A small help I need before I run the
>>> load_seqdatabase.pl. I've
>>>>>>> downloaded
>>>>>>>> my
>>>>>>>> datafile which is ATH1_cds_cm_20040228 from
>>> TAIR. What's the
>>>>>>>> namespace
>>>>>>> 
>>>>>>> and
>>>>>>>> format for this?
>>>>>>>> 
>>>>>>>> Thanks,
>>>>>>>> Angshu
>>>>>>>> 
>>>>>>>> 
>>> _______________________________________________
>>>>>>>> Bioperl-l mailing list
>>>>>>>> Bioperl-l@portal.open-bio.org
>>>>>>>> 
>>> 
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>> 
>>>>>> 
>>>>>> 
>>>>> 
>>>>> _______________________________________________
>>>>> Bioperl-l mailing list
>>>>> Bioperl-l@portal.open-bio.org
>>>>> 
>>> 
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>> 
>>>> --
>>>> Jason Stajich
>>>> Duke University
>>>> http://www.duke.edu/~jes12
>>>> 
>>>> 
>>>> 
>>> 
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l@portal.open-bio.org
>>> 
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>> 
>> 
>> 
>> __________________________________________________
>> Do You Yahoo!?
>> Tired of spam?  Yahoo! Mail has the best spam protection around
>> http://mail.yahoo.com
>> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From angshu96 at gmail.com  Sat Dec 10 00:17:03 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Sat Dec 10 00:14:34 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <BFBFCDA9.66A2%osborne1@optonline.net>
References: <df8328740512092046u21c4c6e5rfba6ca4a630c4294@mail.gmail.com>
	<BFBFCDA9.66A2%osborne1@optonline.net>
Message-ID: <df8328740512092117lc0ee4e9i8f76448f64295d18@mail.gmail.com>

Hi Brian,

That sounds great! But in our labs they don't have any win boxes! Could
you please let me know how to get my problem resolved in a linux box?

Thanks,
Angshu


On 12/10/05, Brian Osborne <osborne1@optonline.net> wrote:
>
> Li,
>
> Cygwin on Windows is a great platform for Bioperl, I used it happily for
> many years. When I was using Windows and Cygwin I recall getting
> bioperl-db
> and Biosql up and running in 10 minutes using the postgres package from
> Cygwin, and this was the first time I tried to install bioperl-db and
> Biosql
> with postgres. Since Cygwin is a Unix emulator all the INSTALL
> instructions
> work perfectly without any amendments.
>
> Brian O.
>
>
> On 12/9/05 11:46 PM, "Angshu Kar" <angshu96@gmail.com> wrote:
>
> > Thanks Chen. I'm running it on linux (red hat) too... but did you work
> with
> > biosql-db module and face that problem?
> >
> > On 12/9/05, chen li <chen_li3@yahoo.com> wrote:
> >>
> >> Based on my personal experience Bioperl is meant to
> >> run much much smoothly on linux system (or Unix).
> >> Which operation system are you using? If it is windows
> >> I expect you have a lot of troubles (now and in the
> >> future) for a novice even you install an ActivePerl. I
> >> have the same probelm before. But everything is fine
> >> after I install a red hat linxu Fedora core 1 on my
> >> computer.  Now I have dual OS on my computer. I follow
> >> the HOWTO INSTALL coming with Biosql and everything is
> >> fine.
> >>
> >> Li
> >>
> >> --- Angshu Kar <angshu96@gmail.com> wrote:
> >>
> >>> Thanks Jason...
> >>> I'm sorry but I didn't get you.
> >>> I've installed bioperl as well as bioperl-db module
> >>> in my system...
> >>> Now what should be my next step to resolve this
> >>> problem?
> >>> I'm sorry again, but as I told that I'm a novice in
> >>> this domain.
> >>>
> >>> Thanks,
> >>> Angshu
> >>>
> >>>
> >>> On 12/9/05, Jason Stajich <jason.stajich@duke.edu>
> >>> wrote:
> >>>>
> >>>>
> >>>> Follow the install instructions for bioperl first,
> >>> you need bioperl
> >>>> to run bioperl-db.
> >>>> These include, set your PERL5LIB or install
> >>> bioperl on your system or
> >>>> run the load script with -I PATH/TO/BIOPERL
> >>>>
> >>>>
> >>>> On Dec 9, 2005, at 7:54 PM, Angshu Kar wrote:
> >>>>
> >>>>> One thing I missed was that my Root.pm resides
> >>> in a different
> >>>>> path...How to
> >>>>> specify that?
> >>>>>
> >>>>> On 12/9/05, Angshu Kar <angshu96@gmail.com>
> >>> wrote:
> >>>>>>
> >>>>>> Thanks a lot Barry.
> >>>>>>
> >>>>>> Now I'm getting this error while tryin to run
> >>> the
> >>>>>> load_seqdatabase.pl in a
> >>>>>> linux box (I used :
> >>>>>> perl load_seqdatabase.pl
> >>> /akar/seq/ATH1_cds_cm_20040228)
> >>>>>>
> >>>>>>
> >>>>>> Can't locate Bio/Root/Root.pm in @INC (@INC
> >>> contains:
> >>>>>> /usr/lib/perl5/5.8.5/i386-linux-thread-multi
> >>> /usr/lib/perl5/5.8.5
> >>>>>>
> >>>
> >> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
> >>>>>>
> >>>
> >> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
> >>>>>>
> >>>
> >> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
> >>>>>>
> >>>
> >> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
> >>>>>>
> >>>
> >> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
> >>>>>>
> >>>
> >> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
> >>>>>> /usr/lib/perl5/site_perl/5.8.5
> >>> /usr/lib/perl5/site_perl/5.8.4
> >>>>>> /usr/lib/perl5/site_perl/5.8.3
> >>> /usr/lib/perl5/site_perl/5.8.2
> >>>>>> /usr/lib/perl5/site_perl/5.8.1
> >>> /usr/lib/perl5/site_perl/5.8.0
> >>>>>> /usr/lib/perl5/site_perl
> >>>>>>
> >>>
> >> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
> >>>>>>
> >>>
> >> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
> >>>>>>
> >>>
> >> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
> >>>>>>
> >>>
> >> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
> >>>>>>
> >>>
> >> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
> >>>>>>
> >>>
> >> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
> >>>>>> /usr/lib/perl5/vendor_perl/5.8.5
> >>> /usr/lib/perl5/vendor_perl/5.8.4
> >>>>>> /usr/lib/perl5/vendor_perl/5.8.3
> >>> /usr/lib/perl5/vendor_perl/5.8.2
> >>>>>> /usr/lib/perl5/vendor_perl/5.8.1
> >>> /usr/lib/perl5/vendor_perl/5.8.0
> >>>>>> /usr/lib/perl5/vendor_perl .) at
> >>> load_seqdatabase.pl line 7.
> >>>>>> BEGIN failed--compilation aborted at
> >>> load_seqdatabase.pl line 7.
> >>>>>>
> >>>>>> Please guide.
> >>>>>>
> >>>>>> Thanks,
> >>>>>> Angshu
> >>>>>>
> >>>>>> On 12/9/05, Barry Moore <
> >>> bmoore@genetics.utah.edu> wrote:
> >>>>>>>
> >>>>>>> Angshu-
> >>>>>>>
> >>>>>>> Make the namespace whatever you want it to be.
> >>>  This is useful if
> >>>>>>> you
> >>>>>>> want to load sequence from different sources
> >>> into the same
> >>>>>>> database.  As
> >>>>>>> for the format - you tell us what format is
> >>> the file in?  You
> >>>>>>> could just
> >>>>>>> let bioperl guess, but looking at the file and
> >>> deciding yourself
> >>>>>>> would
> >>>>>>> be your best bet.
> >>>>>>>
> >>>>>>> Barry
> >>>>>>>
> >>>>>>>> -----Original Message-----
> >>>>>>>> From: bioperl-l-bounces@portal.open-bio.org
> >>> [mailto: bioperl-l-
> >>>>>>>> bounces@portal.open-bio.org] On Behalf Of
> >>> Angshu Kar
> >>>>>>>> Sent: Friday, December 09, 2005 5:22 PM
> >>>>>>>> To: Sean Davis
> >>>>>>>> Cc: bioperl-l
> >>>>>>>> Subject: Re: [Bioperl-l] loading data to
> >>> biosql tables
> >>>>>>>>
> >>>>>>>> Hi Sean,
> >>>>>>>>
> >>>>>>>> A small help I need before I run the
> >>> load_seqdatabase.pl. I've
> >>>>>>> downloaded
> >>>>>>>> my
> >>>>>>>> datafile which is ATH1_cds_cm_20040228 from
> >>> TAIR. What's the
> >>>>>>>> namespace
> >>>>>>>
> >>>>>>> and
> >>>>>>>> format for this?
> >>>>>>>>
> >>>>>>>> Thanks,
> >>>>>>>> Angshu
> >>>>>>>>
> >>>>>>>>
> >>> _______________________________________________
> >>>>>>>> Bioperl-l mailing list
> >>>>>>>> Bioperl-l@portal.open-bio.org
> >>>>>>>>
> >>>
> >> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >>>>>>>
> >>>>>>
> >>>>>>
> >>>>>
> >>>>> _______________________________________________
> >>>>> Bioperl-l mailing list
> >>>>> Bioperl-l@portal.open-bio.org
> >>>>>
> >>>
> >> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >>>>
> >>>> --
> >>>> Jason Stajich
> >>>> Duke University
> >>>> http://www.duke.edu/~jes12
> >>>>
> >>>>
> >>>>
> >>>
> >>> _______________________________________________
> >>> Bioperl-l mailing list
> >>> Bioperl-l@portal.open-bio.org
> >>>
> >> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >>>
> >>
> >>
> >> __________________________________________________
> >> Do You Yahoo!?
> >> Tired of spam?  Yahoo! Mail has the best spam protection around
> >> http://mail.yahoo.com
> >>
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
>

From MEC at stowers-institute.org  Sat Dec 10 02:06:03 2005
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Sat Dec 10 02:20:25 2005
Subject: [Bioperl-l] HOWTO: take a slice of a split location
Message-ID: <CED81D34E37D5043A1211565277A51E5045CEB3B@exchkc02.stowers-institute.org>

Fellow Bioperlers,

I was in need of extracting the 3'-most 1000 bp of from multiple genomic CDS regions (designing 70mer u-array probes).

I looked in vain for Bio::Location->splice($from,$to);

So I wrote one which works but suffers from actually materializing the list of interger indices into the sequence for every base.

Has anyone a better approach they'd care to share?  

Malcolm Cook - mec@stowers-institute.org
Stowers Institute for Medical Research - Kansas City, MO  USA 

P.S. Here' what I wrote:

package Bio::LocationI;		# Code in the interface so it works
                                # with both ::Split and ::Simple
                                # Bio::Locations

sub _intspans {
  # Purpose: for a (presumably) monotonically increasing list of
  # integers, return list of arrays each holding min and max of
  # the list's internal contiguous spans.
  #
  # Example: 1..5,10..20,30 => ([1,5],[10,20],[30,30])
  my @i = @_;
  die "nothing passed to intspans" unless @i;
  my @s = ([$i[0],shift(@i)]);
  foreach (@i) {
    if ($_ == 1 + $s[0][1]) {
      $s[0][1] = $_;
    } else {
      unshift @s, [$_, $_]
    }}
  reverse @s;
}

sub slice {
  # Purpose: compute a slice of the Location, using perls normal slice
  # semantics, expect that it trims out of range values.
  my ($self, $from, $to) = @_;
  my @int = eval (join ',', map {$_->start . '..' . $_->end} $self->each_Location); # build perl expression using the range (..) and list (,) operators.
  @int = @int[$from..$to];
  @int = grep {$_} @int;	# Removing undefs (in case $from/$to out of bounds).
  my @intspans = _intspans(@int); 
  new  Bio::Location::Split (-strand => $self->strand,
			     -locations => [map {new Bio::Location::Simple(-start => $_->[0],
									   -end   => $_->[1],
									   -strand => $self->strand,
									  )
					       } @intspans],
			    );
}

From jason.stajich at duke.edu  Sat Dec 10 11:24:25 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Sat Dec 10 11:22:23 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <df8328740512091921w175f04a4iead8a34a6f0b8993@mail.gmail.com>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F14@m.hg.genetics.utah.edu>
	<df8328740512091645g1b1d20f1rb909a28fc65c0536@mail.gmail.com>
	<df8328740512091654p1e5e7b14i7e2c731f87e721c6@mail.gmail.com>
	<3CCC9485-FF57-4C6F-81AF-3B9C9AFDF197@duke.edu>
	<df8328740512091921w175f04a4iead8a34a6f0b8993@mail.gmail.com>
Message-ID: <2E2A564F-116D-497B-86B1-421CCF368437@duke.edu>

you have not installed it so that your perl knows to find it.  Did  
you do 'make install'?

On Dec 9, 2005, at 10:21 PM, Angshu Kar wrote:

> Thanks Jason...
> I'm sorry but I didn't get you.
> I've installed bioperl as well as bioperl-db module in my system...
> Now what should be my next step to resolve this problem?
> I'm sorry again, but as I told that I'm a novice in this domain.
>
> Thanks,
> Angshu
>
>
> On 12/9/05, Jason Stajich <jason.stajich@duke.edu> wrote:
>
> Follow the install instructions for bioperl first, you need bioperl
> to run bioperl-db.
> These include, set your PERL5LIB or install bioperl on your system or
> run the load script with -I PATH/TO/BIOPERL
>
>
> On Dec 9, 2005, at 7:54 PM, Angshu Kar wrote:
>
> > One thing I missed was that my Root.pm resides in a different
> > path...How to
> > specify that?
> >
> > On 12/9/05, Angshu Kar <angshu96@gmail.com> wrote:
> >>
> >> Thanks a lot Barry.
> >>
> >> Now I'm getting this error while tryin to run the
> >> load_seqdatabase.pl in a
> >> linux box (I used :
> >> perl load_seqdatabase.pl /akar/seq/ATH1_cds_cm_20040228)
> >>
> >>
> >> Can't locate Bio/Root/Root.pm in @INC (@INC contains:
> >> /usr/lib/perl5/5.8.5/i386-linux-thread-multi /usr/lib/perl5/5.8.5
> >> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4
> >> /usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
> >> /usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
> >> /usr/lib/perl5/site_perl
> >> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4
> >> /usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
> >> /usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
> >> /usr/lib/perl5/vendor_perl .) at load_seqdatabase.pl line 7.
> >> BEGIN failed--compilation aborted at load_seqdatabase.pl line 7.
> >>
> >> Please guide.
> >>
> >> Thanks,
> >> Angshu
> >>
> >> On 12/9/05, Barry Moore < bmoore@genetics.utah.edu> wrote:
> >>>
> >>> Angshu-
> >>>
> >>> Make the namespace whatever you want it to be.  This is useful if
> >>> you
> >>> want to load sequence from different sources into the same
> >>> database.  As
> >>> for the format - you tell us what format is the file in?  You
> >>> could just
> >>> let bioperl guess, but looking at the file and deciding yourself
> >>> would
> >>> be your best bet.
> >>>
> >>> Barry
> >>>
> >>>> -----Original Message-----
> >>>> From: bioperl-l-bounces@portal.open-bio.org [mailto: bioperl-l-
> >>>> bounces@portal.open-bio.org] On Behalf Of Angshu Kar
> >>>> Sent: Friday, December 09, 2005 5:22 PM
> >>>> To: Sean Davis
> >>>> Cc: bioperl-l
> >>>> Subject: Re: [Bioperl-l] loading data to biosql tables
> >>>>
> >>>> Hi Sean,
> >>>>
> >>>> A small help I need before I run the load_seqdatabase.pl. I've
> >>> downloaded
> >>>> my
> >>>> datafile which is ATH1_cds_cm_20040228 from TAIR. What's the
> >>>> namespace
> >>>
> >>> and
> >>>> format for this?
> >>>>
> >>>> Thanks,
> >>>> Angshu
> >>>>
> >>>> _______________________________________________
> >>>> Bioperl-l mailing list
> >>>> Bioperl-l@portal.open-bio.org
> >>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >>>
> >>
> >>
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
> --
> Jason Stajich
> Duke University
> http://www.duke.edu/~jes12
>
>
>

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12


From angshu96 at gmail.com  Sat Dec 10 11:51:19 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Sat Dec 10 11:55:33 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <2E2A564F-116D-497B-86B1-421CCF368437@duke.edu>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F14@m.hg.genetics.utah.edu>
	<df8328740512091645g1b1d20f1rb909a28fc65c0536@mail.gmail.com>
	<df8328740512091654p1e5e7b14i7e2c731f87e721c6@mail.gmail.com>
	<3CCC9485-FF57-4C6F-81AF-3B9C9AFDF197@duke.edu>
	<df8328740512091921w175f04a4iead8a34a6f0b8993@mail.gmail.com>
	<2E2A564F-116D-497B-86B1-421CCF368437@duke.edu>
Message-ID: <df8328740512100851v685b0f6bg7d1d9f6eb983674f@mail.gmail.com>

Yes Jason. But what I've done is, instead of putting the .pm and .pl files
in default locations I've used the LIB and PREFIX arguments to place them in
my local directory. This I've done for bioperl as well as bioperl-db
modules.
Now could you please help me in how to make perl find it?

Thanks,
Angshu


On 12/10/05, Jason Stajich <jason.stajich@duke.edu> wrote:
>
> you have not installed it so that your perl knows to find it.  Did you do
> 'make install'?
>  On Dec 9, 2005, at 10:21 PM, Angshu Kar wrote:
>
>  Thanks Jason...
> I'm sorry but I didn't get you.
> I've installed bioperl as well as bioperl-db module in my system...
> Now what should be my next step to resolve this problem?
> I'm sorry again, but as I told that I'm a novice in this domain.
>
> Thanks,
> Angshu
>
>
> On 12/9/05, Jason Stajich <jason.stajich@duke.edu> wrote:
> >
> >
> > Follow the install instructions for bioperl first, you need bioperl
> > to run bioperl-db.
> > These include, set your PERL5LIB or install bioperl on your system or
> > run the load script with -I PATH/TO/BIOPERL
> >
> >
> > On Dec 9, 2005, at 7:54 PM, Angshu Kar wrote:
> >
> > > One thing I missed was that my Root.pm <http://root.pm/> resides in a
> > different
> > > path...How to
> > > specify that?
> > >
> > > On 12/9/05, Angshu Kar <angshu96@gmail.com> wrote:
> > >>
> > >> Thanks a lot Barry.
> > >>
> > >> Now I'm getting this error while tryin to run the
> > >> load_seqdatabase.pl in a
> > >> linux box (I used :
> > >> perl load_seqdatabase.pl /akar/seq/ATH1_cds_cm_20040228)
> > >>
> > >>
> > >> Can't locate Bio/Root/Root.pm in @INC (@INC contains:
> > >> /usr/lib/perl5/5.8.5/i386-linux-thread-multi /usr/lib/perl5/5.8.5
> > >> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
> > >> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
> > >> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
> > >> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
> > >> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
> > >> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
> > >> /usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4
> > >> /usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
> > >> /usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
> > >> /usr/lib/perl5/site_perl
> > >> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
> > >> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
> > >> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
> > >> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
> > >> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
> > >> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
> > >> /usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4
> > >> /usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
> > >> /usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
> > >> /usr/lib/perl5/vendor_perl .) at load_seqdatabase.pl line 7.
> > >> BEGIN failed--compilation aborted at load_seqdatabase.pl line 7.
> > >>
> > >> Please guide.
> > >>
> > >> Thanks,
> > >> Angshu
> > >>
> > >> On 12/9/05, Barry Moore < bmoore@genetics.utah.edu> wrote:
> > >>>
> > >>> Angshu-
> > >>>
> > >>> Make the namespace whatever you want it to be.  This is useful if
> > >>> you
> > >>> want to load sequence from different sources into the same
> > >>> database.  As
> > >>> for the format - you tell us what format is the file in?  You
> > >>> could just
> > >>> let bioperl guess, but looking at the file and deciding yourself
> > >>> would
> > >>> be your best bet.
> > >>>
> > >>> Barry
> > >>>
> > >>>> -----Original Message-----
> > >>>> From: bioperl-l-bounces@portal.open-bio.org [mailto: bioperl-l-
> > >>>> bounces@portal.open-bio.org] On Behalf Of Angshu Kar
> > >>>> Sent: Friday, December 09, 2005 5:22 PM
> > >>>> To: Sean Davis
> > >>>> Cc: bioperl-l
> > >>>> Subject: Re: [Bioperl-l] loading data to biosql tables
> > >>>>
> > >>>> Hi Sean,
> > >>>>
> > >>>> A small help I need before I run the load_seqdatabase.pl. I've
> > >>> downloaded
> > >>>> my
> > >>>> datafile which is ATH1_cds_cm_20040228 from TAIR. What's the
> > >>>> namespace
> > >>>
> > >>> and
> > >>>> format for this?
> > >>>>
> > >>>> Thanks,
> > >>>> Angshu
> > >>>>
> > >>>> _______________________________________________
> > >>>> Bioperl-l mailing list
> > >>>> Bioperl-l@portal.open-bio.org
> > >>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > >>>
> > >>
> > >>
> > >
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l@portal.open-bio.org
> > > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> > --
> > Jason Stajich
> > Duke University
> > http://www.duke.edu/~jes12
> >
> >
> >
>
>  --
> Jason Stajich
> Duke University
> http://www.duke.edu/~jes12
>
>
>
>

From jason.stajich at duke.edu  Sat Dec 10 12:05:33 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Sat Dec 10 12:02:58 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <df8328740512100851v685b0f6bg7d1d9f6eb983674f@mail.gmail.com>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F14@m.hg.genetics.utah.edu>
	<df8328740512091645g1b1d20f1rb909a28fc65c0536@mail.gmail.com>
	<df8328740512091654p1e5e7b14i7e2c731f87e721c6@mail.gmail.com>
	<3CCC9485-FF57-4C6F-81AF-3B9C9AFDF197@duke.edu>
	<df8328740512091921w175f04a4iead8a34a6f0b8993@mail.gmail.com>
	<2E2A564F-116D-497B-86B1-421CCF368437@duke.edu>
	<df8328740512100851v685b0f6bg7d1d9f6eb983674f@mail.gmail.com>
Message-ID: <6CE9663B-2666-418C-8322-AC48A7036143@duke.edu>

 From the INSTALL document in the Bioperl distribution

    You can explicitly tell perl where to look for modules by using the
    lib module which comes standard with perl.

    Example:

        #!/usr/bin/perl

        use lib "/home/users/dag/My_Local_Perl_Modules/";
        use Bio::Seq;

        <...insert whizzy perl code here...>

    Or, you can set the environmental variable PERL5LIB:

      csh or tcsh:

        setenv PERL5LIB /home/users/dag/My_Local_Perl_Modules/

      bash or sh:

       export PERL5LIB=/home/users/dag/My_Local_Perl_Modules/


On Dec 10, 2005, at 11:51 AM, Angshu Kar wrote:

> Yes Jason. But what I've done is, instead of putting the .pm  
> and .pl files in default locations I've used the LIB and PREFIX  
> arguments to place them in my local directory. This I've done for  
> bioperl as well as bioperl-db modules.
> Now could you please help me in how to make perl find it?
>
> Thanks,
> Angshu
>
>
> On 12/10/05, Jason Stajich <jason.stajich@duke.edu> wrote:
> you have not installed it so that your perl knows to find it.  Did  
> you do 'make install'?
>
> On Dec 9, 2005, at 10:21 PM, Angshu Kar wrote:
>
>> Thanks Jason...
>> I'm sorry but I didn't get you.
>> I've installed bioperl as well as bioperl-db module in my system...
>> Now what should be my next step to resolve this problem?
>> I'm sorry again, but as I told that I'm a novice in this domain.
>>
>> Thanks,
>> Angshu
>>
>>
>> On 12/9/05, Jason Stajich <jason.stajich@duke.edu > wrote:
>>
>> Follow the install instructions for bioperl first, you need bioperl
>> to run bioperl-db.
>> These include, set your PERL5LIB or install bioperl on your system or
>> run the load script with -I PATH/TO/BIOPERL
>>
>>
>> On Dec 9, 2005, at 7:54 PM, Angshu Kar wrote:
>>
>> > One thing I missed was that my Root.pm resides in a different
>> > path...How to
>> > specify that?
>> >
>> > On 12/9/05, Angshu Kar < angshu96@gmail.com> wrote:
>> >>
>> >> Thanks a lot Barry.
>> >>
>> >> Now I'm getting this error while tryin to run the
>> >> load_seqdatabase.pl in a
>> >> linux box (I used :
>> >> perl load_seqdatabase.pl /akar/seq/ATH1_cds_cm_20040228)
>> >>
>> >>
>> >> Can't locate Bio/Root/Root.pm in @INC (@INC contains:
>> >> /usr/lib/perl5/5.8.5/i386-linux-thread-multi /usr/lib/perl5/5.8.5
>> >> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
>> >> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
>> >> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
>> >> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
>> >> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
>> >> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
>> >> /usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4
>> >> /usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
>> >> /usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
>> >> /usr/lib/perl5/site_perl
>> >> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
>> >> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
>> >> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
>> >> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
>> >> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
>> >> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
>> >> /usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4
>> >> /usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
>> >> /usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
>> >> /usr/lib/perl5/vendor_perl .) at load_seqdatabase.pl line 7.
>> >> BEGIN failed--compilation aborted at load_seqdatabase.pl line 7.
>> >>
>> >> Please guide.
>> >>
>> >> Thanks,
>> >> Angshu
>> >>
>> >> On 12/9/05, Barry Moore < bmoore@genetics.utah.edu> wrote:
>> >>>
>> >>> Angshu-
>> >>>
>> >>> Make the namespace whatever you want it to be.  This is useful if
>> >>> you
>> >>> want to load sequence from different sources into the same
>> >>> database.  As
>> >>> for the format - you tell us what format is the file in?  You
>> >>> could just
>> >>> let bioperl guess, but looking at the file and deciding yourself
>> >>> would
>> >>> be your best bet.
>> >>>
>> >>> Barry
>> >>>
>> >>>> -----Original Message-----
>> >>>> From: bioperl-l-bounces@portal.open-bio.org [mailto: bioperl-l-
>> >>>> bounces@portal.open-bio.org ] On Behalf Of Angshu Kar
>> >>>> Sent: Friday, December 09, 2005 5:22 PM
>> >>>> To: Sean Davis
>> >>>> Cc: bioperl-l
>> >>>> Subject: Re: [Bioperl-l] loading data to biosql tables
>> >>>>
>> >>>> Hi Sean,
>> >>>>
>> >>>> A small help I need before I run the load_seqdatabase.pl. I've
>> >>> downloaded
>> >>>> my
>> >>>> datafile which is ATH1_cds_cm_20040228 from TAIR. What's the
>> >>>> namespace
>> >>>
>> >>> and
>> >>>> format for this?
>> >>>>
>> >>>> Thanks,
>> >>>> Angshu
>> >>>>
>> >>>> _______________________________________________
>> >>>> Bioperl-l mailing list
>> >>>> Bioperl-l@portal.open-bio.org
>> >>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>> >>>
>> >>
>> >>
>> >
>> > _______________________________________________
>> > Bioperl-l mailing list
>> > Bioperl-l@portal.open-bio.org
>> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>
>> --
>> Jason Stajich
>> Duke University
>> http://www.duke.edu/~jes12
>>
>>
>>
>
> --
> Jason Stajich
> Duke University
> http://www.duke.edu/~jes12
>
>
>
>

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12


From angshu96 at gmail.com  Sat Dec 10 12:17:09 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Sat Dec 10 12:14:33 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <6CE9663B-2666-418C-8322-AC48A7036143@duke.edu>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F14@m.hg.genetics.utah.edu>
	<df8328740512091645g1b1d20f1rb909a28fc65c0536@mail.gmail.com>
	<df8328740512091654p1e5e7b14i7e2c731f87e721c6@mail.gmail.com>
	<3CCC9485-FF57-4C6F-81AF-3B9C9AFDF197@duke.edu>
	<df8328740512091921w175f04a4iead8a34a6f0b8993@mail.gmail.com>
	<2E2A564F-116D-497B-86B1-421CCF368437@duke.edu>
	<df8328740512100851v685b0f6bg7d1d9f6eb983674f@mail.gmail.com>
	<6CE9663B-2666-418C-8322-AC48A7036143@duke.edu>
Message-ID: <df8328740512100917t69001252vbff34b2598d64e15@mail.gmail.com>

You are marvellous Jason...Thanks a lot for using the lingo thats for a
freshie like me.
I'll apply this today to the load_seqdatabase.pl and let you know if any
problem arises.

Thanks,
Angshu


On 12/10/05, Jason Stajich <jason.stajich@duke.edu> wrote:
>
>  From the INSTALL document in the Bioperl distribution
>
>
>    You can explicitly tell perl where to look for modules by using the
>    lib module which comes standard with perl.
>
>
>    Example:
>
>
>        #!/usr/bin/perl
>
>
>        use lib "/home/users/dag/My_Local_Perl_Modules/";
>        use Bio::Seq;
>
>
>        <...insert whizzy perl code here...>
>
>
>    Or, you can set the environmental variable PERL5LIB:
>
>
>      csh or tcsh:
>
>
>        setenv PERL5LIB /home/users/dag/My_Local_Perl_Modules/
>
>      bash or sh:
>
>
>       export PERL5LIB=/home/users/dag/My_Local_Perl_Modules/
>
>
>
>  On Dec 10, 2005, at 11:51 AM, Angshu Kar wrote:
>
>  Yes Jason. But what I've done is, instead of putting the .pm and .pl
> files in default locations I've used the LIB and PREFIX arguments to
> place them in my local directory. This I've done for bioperl as well as
> bioperl-db modules.
> Now could you please help me in how to make perl find it?
>
> Thanks,
> Angshu
>
>
> On 12/10/05, Jason Stajich <jason.stajich@duke.edu> wrote:
> >
> > you have not installed it so that your perl knows to find it.  Did you
> > do 'make install'?
> >  On Dec 9, 2005, at 10:21 PM, Angshu Kar wrote:
> >
> >  Thanks Jason...
> > I'm sorry but I didn't get you.
> > I've installed bioperl as well as bioperl-db module in my system...
> > Now what should be my next step to resolve this problem?
> > I'm sorry again, but as I told that I'm a novice in this domain.
> >
> > Thanks,
> > Angshu
> >
> >
> > On 12/9/05, Jason Stajich <jason.stajich@duke.edu > wrote:
> > >
> > >
> > > Follow the install instructions for bioperl first, you need bioperl
> > > to run bioperl-db.
> > > These include, set your PERL5LIB or install bioperl on your system or
> > > run the load script with -I PATH/TO/BIOPERL
> > >
> > >
> > > On Dec 9, 2005, at 7:54 PM, Angshu Kar wrote:
> > >
> > > > One thing I missed was that my Root.pm <http://root.pm/> resides in
> > > a different
> > > > path...How to
> > > > specify that?
> > > >
> > > > On 12/9/05, Angshu Kar < angshu96@gmail.com> wrote:
> > > >>
> > > >> Thanks a lot Barry.
> > > >>
> > > >> Now I'm getting this error while tryin to run the
> > > >> load_seqdatabase.pl in a
> > > >> linux box (I used :
> > > >> perl load_seqdatabase.pl /akar/seq/ATH1_cds_cm_20040228)
> > > >>
> > > >>
> > > >> Can't locate Bio/Root/Root.pm in @INC (@INC contains:
> > > >> /usr/lib/perl5/5.8.5/i386-linux-thread-multi /usr/lib/perl5/5.8.5
> > > >> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
> > > >> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
> > > >> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
> > > >> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
> > > >> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
> > > >> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
> > > >> /usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4
> > > >> /usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
> > > >> /usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
> > > >> /usr/lib/perl5/site_perl
> > > >> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
> > > >> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
> > > >> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
> > > >> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
> > > >> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
> > > >> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
> > > >> /usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4
> > > >> /usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
> > > >> /usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
> > > >> /usr/lib/perl5/vendor_perl .) at load_seqdatabase.pl line 7.
> > > >> BEGIN failed--compilation aborted at load_seqdatabase.pl line 7.
> > > >>
> > > >> Please guide.
> > > >>
> > > >> Thanks,
> > > >> Angshu
> > > >>
> > > >> On 12/9/05, Barry Moore < bmoore@genetics.utah.edu> wrote:
> > > >>>
> > > >>> Angshu-
> > > >>>
> > > >>> Make the namespace whatever you want it to be.  This is useful if
> > > >>> you
> > > >>> want to load sequence from different sources into the same
> > > >>> database.  As
> > > >>> for the format - you tell us what format is the file in?  You
> > > >>> could just
> > > >>> let bioperl guess, but looking at the file and deciding yourself
> > > >>> would
> > > >>> be your best bet.
> > > >>>
> > > >>> Barry
> > > >>>
> > > >>>> -----Original Message-----
> > > >>>> From: bioperl-l-bounces@portal.open-bio.org [mailto: bioperl-l-
> > > >>>> bounces@portal.open-bio.org ] On Behalf Of Angshu Kar
> > > >>>> Sent: Friday, December 09, 2005 5:22 PM
> > > >>>> To: Sean Davis
> > > >>>> Cc: bioperl-l
> > > >>>> Subject: Re: [Bioperl-l] loading data to biosql tables
> > > >>>>
> > > >>>> Hi Sean,
> > > >>>>
> > > >>>> A small help I need before I run the load_seqdatabase.pl. I've
> > > >>> downloaded
> > > >>>> my
> > > >>>> datafile which is ATH1_cds_cm_20040228 from TAIR. What's the
> > > >>>> namespace
> > > >>>
> > > >>> and
> > > >>>> format for this?
> > > >>>>
> > > >>>> Thanks,
> > > >>>> Angshu
> > > >>>>
> > > >>>> _______________________________________________
> > > >>>> Bioperl-l mailing list
> > > >>>> Bioperl-l@portal.open-bio.org
> > > >>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > > >>>
> > > >>
> > > >>
> > > >
> > > > _______________________________________________
> > > > Bioperl-l mailing list
> > > > Bioperl-l@portal.open-bio.org
> > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > >
> > > --
> > > Jason Stajich
> > > Duke University
> > > http://www.duke.edu/~jes12
> > >
> > >
> > >
> >
> >  --
> > Jason Stajich
> > Duke University
> > http://www.duke.edu/~jes12
> >
> >
> >
> >
>
>
>  --
> Jason Stajich
> Duke University
> http://www.duke.edu/~jes12
>
>
>
>

From jason.stajich at duke.edu  Sat Dec 10 13:11:57 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Sat Dec 10 13:09:23 2005
Subject: [Bioperl-l] HOWTO: take a slice of a split location
In-Reply-To: <CED81D34E37D5043A1211565277A51E5045CEB3B@exchkc02.stowers-institute.org>
References: <CED81D34E37D5043A1211565277A51E5045CEB3B@exchkc02.stowers-institute.org>
Message-ID: <F66ECC83-E898-4160-A4BF-2437EF8C6EE2@duke.edu>

Hi Malcom -
Don't have a chance to look at your code, but my approach to this  
problem would be to first splice the sequence out from the genome
  my $feature = Bio::SeqFeature::Generic->new(-location =>  
$splitlocation);
  my $cdsseq = $feature->spliced_seq;
then just retrieve the last 1000 bases of  this sequence.
  my $threeprime = $cdsseq->subseq($cdsseq->length - 1000, $cdsseq- 
 >length);
(this might be off-by-one?)

There is also a module to map between coordinates -  
Bio::Coordinate::GeneMapper if you need to go from transcript to  
genomic coordinates.

-jason
On Dec 10, 2005, at 2:06 AM, Cook, Malcolm wrote:

> Fellow Bioperlers,
>
> I was in need of extracting the 3'-most 1000 bp of from multiple  
> genomic CDS regions (designing 70mer u-array probes).
>
> I looked in vain for Bio::Location->splice($from,$to);
>
> So I wrote one which works but suffers from actually materializing  
> the list of interger indices into the sequence for every base.
>
> Has anyone a better approach they'd care to share?
>
> Malcolm Cook - mec@stowers-institute.org
> Stowers Institute for Medical Research - Kansas City, MO  USA
>
> P.S. Here' what I wrote:
>
> package Bio::LocationI;		# Code in the interface so it works
>                                 # with both ::Split and ::Simple
>                                 # Bio::Locations
>
> sub _intspans {
>   # Purpose: for a (presumably) monotonically increasing list of
>   # integers, return list of arrays each holding min and max of
>   # the list's internal contiguous spans.
>   #
>   # Example: 1..5,10..20,30 => ([1,5],[10,20],[30,30])
>   my @i = @_;
>   die "nothing passed to intspans" unless @i;
>   my @s = ([$i[0],shift(@i)]);
>   foreach (@i) {
>     if ($_ == 1 + $s[0][1]) {
>       $s[0][1] = $_;
>     } else {
>       unshift @s, [$_, $_]
>     }}
>   reverse @s;
> }
>
> sub slice {
>   # Purpose: compute a slice of the Location, using perls normal slice
>   # semantics, expect that it trims out of range values.
>   my ($self, $from, $to) = @_;
>   my @int = eval (join ',', map {$_->start . '..' . $_->end} $self- 
> >each_Location); # build perl expression using the range (..) and  
> list (,) operators.
>   @int = @int[$from..$to];
>   @int = grep {$_} @int;	# Removing undefs (in case $from/$to out  
> of bounds).
>   my @intspans = _intspans(@int);
>   new  Bio::Location::Split (-strand => $self->strand,
> 			     -locations => [map {new Bio::Location::Simple(-start => $_-> 
> [0],
> 									   -end   => $_->[1],
> 									   -strand => $self->strand,
> 									  )
> 					       } @intspans],
> 			    );
> }
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12


From angshu96 at gmail.com  Sat Dec 10 17:59:19 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Sat Dec 10 18:21:04 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <df8328740512100917t69001252vbff34b2598d64e15@mail.gmail.com>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F14@m.hg.genetics.utah.edu>
	<df8328740512091645g1b1d20f1rb909a28fc65c0536@mail.gmail.com>
	<df8328740512091654p1e5e7b14i7e2c731f87e721c6@mail.gmail.com>
	<3CCC9485-FF57-4C6F-81AF-3B9C9AFDF197@duke.edu>
	<df8328740512091921w175f04a4iead8a34a6f0b8993@mail.gmail.com>
	<2E2A564F-116D-497B-86B1-421CCF368437@duke.edu>
	<df8328740512100851v685b0f6bg7d1d9f6eb983674f@mail.gmail.com>
	<6CE9663B-2666-418C-8322-AC48A7036143@duke.edu>
	<df8328740512100917t69001252vbff34b2598d64e15@mail.gmail.com>
Message-ID: <df8328740512101459v60e481h36a8925095d7d294@mail.gmail.com>

Hi,

Now I'm getting this new error:

Can't locate Bio/DB/BioDB.pm in @INC (@INC contains:
/home/akar/local/perl//i386-linux-thread-multi /home/akar/local/perl/
/usr/lib/perl5/5.8.5/i386-linux-thread-multi /usr/lib/perl5/5.8.5
/usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4
/usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
/usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
/usr/lib/perl5/site_perl
/usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4
/usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
/usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
/usr/lib/perl5/vendor_perl .) at load_seqdatabase.pl line 8.
BEGIN failed--compilation aborted at load_seqdatabase.pl line 8.


I've checked the Bio/DB/ folder but it doesn't contain the BioDB.pm module -
it contains the following:


Ace.pm       DBFetch.pm    Flat        GFF               MeSH.pm
RefSeq.pm     Taxonomy.pm        XEMBLService.pm
Biblio       EMBL.pm       Flat.pm     GFF.pm            NCBIHelper.pm
Registry.pm   Universal.pm
BiblioI.pm   Failover.pm   GDB.pm      InMemoryCache.pm  Query
SeqI.pm       UpdateableSeqI.pm
BioFetch.pm  Fasta.pm      GenBank.pm  Makefile.PL       QueryI.pm
SwissProt.pm  WebDBSeqI.pm
CUTG.pm      FileCache.pm  GenPept.pm  MANIFEST          RandomAccessI.pm
Taxonomy      XEMBL.pm

Have I installed some wrong version of bioperl-db ? (I've used
http://bio.perl.org/Core/Latest/index.shtml)

Could anyone please let me know what I've missed?

Thanks,
Angshu


On 12/10/05, Angshu Kar <angshu96@gmail.com> wrote:
>
> You are marvellous Jason...Thanks a lot for using the lingo thats for a
> freshie like me.
> I'll apply this today to the load_seqdatabase.pl and let you know if any
> problem arises.
>
> Thanks,
> Angshu
>
>
> On 12/10/05, Jason Stajich <jason.stajich@duke.edu> wrote:
> >
> >  From the INSTALL document in the Bioperl distribution
> >
> >
> >    You can explicitly tell perl where to look for modules by using the
> >    lib module which comes standard with perl.
> >
> >
> >    Example:
> >
> >
> >        #!/usr/bin/perl
> >
> >
> >        use lib "/home/users/dag/My_Local_Perl_Modules/";
> >        use Bio::Seq;
> >
> >
> >        <...insert whizzy perl code here...>
> >
> >
> >    Or, you can set the environmental variable PERL5LIB:
> >
> >
> >      csh or tcsh:
> >
> >
> >        setenv PERL5LIB /home/users/dag/My_Local_Perl_Modules/
> >
> >      bash or sh:
> >
> >
> >       export PERL5LIB=/home/users/dag/My_Local_Perl_Modules/
> >
> >
> >
> >  On Dec 10, 2005, at 11:51 AM, Angshu Kar wrote:
> >
> >  Yes Jason. But what I've done is, instead of putting the .pm and .pl
> > files in default locations I've used the LIB and PREFIX arguments to
> > place them in my local directory. This I've done for bioperl as well as
> > bioperl-db modules.
> > Now could you please help me in how to make perl find it?
> >
> > Thanks,
> > Angshu
> >
> >
> > On 12/10/05, Jason Stajich <jason.stajich@duke.edu > wrote:
> > >
> > > you have not installed it so that your perl knows to find it.  Did you
> > > do 'make install'?
> > >  On Dec 9, 2005, at 10:21 PM, Angshu Kar wrote:
> > >
> > >  Thanks Jason...
> > > I'm sorry but I didn't get you.
> > > I've installed bioperl as well as bioperl-db module in my system...
> > > Now what should be my next step to resolve this problem?
> > > I'm sorry again, but as I told that I'm a novice in this domain.
> > >
> > > Thanks,
> > > Angshu
> > >
> > >
> > > On 12/9/05, Jason Stajich <jason.stajich@duke.edu > wrote:
> > > >
> > > >
> > > > Follow the install instructions for bioperl first, you need bioperl
> > > > to run bioperl-db.
> > > > These include, set your PERL5LIB or install bioperl on your system
> > > > or
> > > > run the load script with -I PATH/TO/BIOPERL
> > > >
> > > >
> > > > On Dec 9, 2005, at 7:54 PM, Angshu Kar wrote:
> > > >
> > > > > One thing I missed was that my Root.pm <http://root.pm/> resides
> > > > in a different
> > > > > path...How to
> > > > > specify that?
> > > > >
> > > > > On 12/9/05, Angshu Kar < angshu96@gmail.com> wrote:
> > > > >>
> > > > >> Thanks a lot Barry.
> > > > >>
> > > > >> Now I'm getting this error while tryin to run the
> > > > >> load_seqdatabase.pl in a
> > > > >> linux box (I used :
> > > > >> perl load_seqdatabase.pl /akar/seq/ATH1_cds_cm_20040228)
> > > > >>
> > > > >>
> > > > >> Can't locate Bio/Root/Root.pm in @INC (@INC contains:
> > > > >> /usr/lib/perl5/5.8.5/i386-linux-thread-multi /usr/lib/perl5/5.8.5
> > > >
> > > > >> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
> > > > >> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
> > > > >> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
> > > > >> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
> > > > >> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
> > > > >> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
> > > > >> /usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4
> > > > >> /usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
> > > > >> /usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
> > > > >> /usr/lib/perl5/site_perl
> > > > >> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
> > > > >> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
> > > > >> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
> > > > >> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
> > > > >> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
> > > > >> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
> > > > >> /usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4
> > > > >> /usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
> > > >
> > > > >> /usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
> > > >
> > > > >> /usr/lib/perl5/vendor_perl .) at load_seqdatabase.pl line 7.
> > > > >> BEGIN failed--compilation aborted at load_seqdatabase.pl line 7.
> > > > >>
> > > > >> Please guide.
> > > > >>
> > > > >> Thanks,
> > > > >> Angshu
> > > > >>
> > > > >> On 12/9/05, Barry Moore < bmoore@genetics.utah.edu> wrote:
> > > > >>>
> > > > >>> Angshu-
> > > > >>>
> > > > >>> Make the namespace whatever you want it to be.  This is useful
> > > > if
> > > > >>> you
> > > > >>> want to load sequence from different sources into the same
> > > > >>> database.  As
> > > > >>> for the format - you tell us what format is the file in?  You
> > > > >>> could just
> > > > >>> let bioperl guess, but looking at the file and deciding yourself
> > > > >>> would
> > > > >>> be your best bet.
> > > > >>>
> > > > >>> Barry
> > > > >>>
> > > > >>>> -----Original Message-----
> > > > >>>> From: bioperl-l-bounces@portal.open-bio.org [mailto: bioperl-l-
> > > > >>>> bounces@portal.open-bio.org ] On Behalf Of Angshu Kar
> > > > >>>> Sent: Friday, December 09, 2005 5:22 PM
> > > > >>>> To: Sean Davis
> > > > >>>> Cc: bioperl-l
> > > > >>>> Subject: Re: [Bioperl-l] loading data to biosql tables
> > > > >>>>
> > > > >>>> Hi Sean,
> > > > >>>>
> > > > >>>> A small help I need before I run the load_seqdatabase.pl. I've
> > > > >>> downloaded
> > > > >>>> my
> > > > >>>> datafile which is ATH1_cds_cm_20040228 from TAIR. What's the
> > > > >>>> namespace
> > > > >>>
> > > > >>> and
> > > > >>>> format for this?
> > > > >>>>
> > > > >>>> Thanks,
> > > > >>>> Angshu
> > > > >>>>
> > > > >>>> _______________________________________________
> > > > >>>> Bioperl-l mailing list
> > > > >>>> Bioperl-l@portal.open-bio.org
> > > > >>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > > > >>>
> > > > >>
> > > > >>
> > > > >
> > > > > _______________________________________________
> > > > > Bioperl-l mailing list
> > > > > Bioperl-l@portal.open-bio.org
> > > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > > >
> > > > --
> > > > Jason Stajich
> > > > Duke University
> > > > http://www.duke.edu/~jes12 <http://www.duke.edu/%7Ejes12>
> > > >
> > > >
> > > >
> > >
> > >  --
> > > Jason Stajich
> > > Duke University
> > > http://www.duke.edu/~jes12 <http://www.duke.edu/%7Ejes12>
> > >
> > >
> > >
> > >
> >
> >
> >  --
> > Jason Stajich
> > Duke University
> > http://www.duke.edu/~jes12 <http://www.duke.edu/%7Ejes12>
> >
> >
> >
> >
>
>

From hlapp at gmx.net  Sat Dec 10 21:34:36 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Sat Dec 10 21:32:20 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <df8328740512091358i7fe0e477rc8f3a135adc1e470@mail.gmail.com>
References: <df8328740512071812n7a5507aap71d273f0d8d781fe@mail.gmail.com>
	<3e86c394e54677a898eab8de11d8e002@gmx.net>
	<df8328740512090710n3c47c517x45e378908c81d8cb@mail.gmail.com>
	<2725905b99cf48d0d0740376a1156082@gmx.net>
	<df8328740512091358i7fe0e477rc8f3a135adc1e470@mail.gmail.com>
Message-ID: <0a732bf7655c118d12c4c548d2897aea@gmx.net>

You should download the current biosql-schema from CVS. If my 
recollection is correct then you are on Postgres, so you will want to 
run the file biosqldb-pg.sql through psql. You do not need the other 
Postgres related files there. The rest of the repository, aside from 
support for other RDBMSs (mysql, Oracle, and HSQL), contains 
documentation, an ERD of the schema, and the script for loading the 
NCBI taxonomy database.

	-hilmar

On Dec 9, 2005, at 1:58 PM, Angshu Kar wrote:

> Hi Hilmar,
>
> I'm obliged that you showed me the light. I reanalyzed the schema and 
> found that its no use working with a truncated version of 
> biosql-schema and now I'm planning to install the entire schema. Could 
> you please let me know where can I find the script for that for a Pg 
> db?
>
> Thank you so much. Else I would have to face a lots of problem in the 
> later half of my project.
>
> Gratefully,
> Angshu
>
> On 12/9/05, Hilmar Lapp <hlapp@gmx.net> wrote:Angshu, 
> load_seqdatabase.pl is a script that utilizes the language
>> binding library bioperl-db to load sequences and annotation into
>> Biosql. The object-relational mapping code is all over bioperl-db.
>>
>> I'm sorry, but if you believe it is worth fiddling with that
>> object-relational code to 'save' instantiating a few more tables then
>> you're welcome to do so but you're essentially on your own.
>>
>> Also, if you'd like to work with a schema the language binding of 
>> which
>> allows to arbitrarily drop tables from the schema and still work then
>> Biosql/bioperl-db may not be for you.
>>
>> ????????-hilmar
>>
>> On Dec 9, 2005, at 7:10 AM, Angshu Kar wrote:
>>
>> > Hi Hilmar,
>> >
>> > In the load_seqdatabase.pl script could you please tell me where you
>> > are inserting the data into the db tables, so that I can try and
>> > modify that part to insert data only to the tables that I need ?
>> >
>> > Thanks,
>> > Angshu
>> >
>> >
>> > On 12/8/05, Hilmar Lapp <hlapp@gmx.net> wrote: Any reason you didn't
>> > instantiate the rest of the schema? Any scripts
>> >> and software that have been written against BioSQL will certainly
>> >> expect the rest of the schema be present ...
>> >>
>> >> Bioperl-db is the BioSQL language binding for Bioperl, so that's 
>> what
>> >> you will want to use. It comes with a script load_seqdatabase.pl to
>> >> load any format supported by Bioperl.
>> >>
>> >> However, bioperl-db does expect all of Biosql to be present ...
>>  >>
>> >> -hilmar
>> >>
>> >> On Dec 7, 2005, at 6:12 PM, Angshu Kar wrote:
>> >>
>> >> > Hi,
>> >> >
>> >> > I've created 5 tables (taxon, taxon name, bioentry, biosequence,
>> >> > biodatabase) in my postgresql database (linux box) using the 
>> biosql
>> >> > schema
>> >> > ddl from
>> >> >
>> >> http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/biosql-schema/
>> >> sql/
>> >> >
>> >> biosqldb-pg.sql?rev=1.29&cvsroot=biosql&content-type=text/
>> >> vnd.viewcvs-
>> >> > markup
>> >> >.
>> >> > Now I want to load the tables with arabidopsis data. Could you
>> >> please
>> >> > let me
>> >> > know where can I find such scripts for pgsql? And also I find at
>> >> > http://bio.perl.org/Core/Latest/index.shtml that the DB module 
>> has
>> >> not
>> >> > been
>> >> > updated since 2001. Do I need to install that? Or are there some 
>> new
>> >> > releases?
>> >> >
>> >> > I'll be obliged if you can guide.
>> >> >
>> >> > Thanks,
>> >> > Angshu
>> >> >
>> >> > _______________________________________________
>> >> > Bioperl-l mailing list
>> >> > Bioperl-l@portal.open-bio.org
>> >> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>> >> >
>> >> >
>> >> --
>> >> -------------------------------------------------------------
>> >> Hilmar Lappemail: lapp at gnf.org
>> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> -------------------------------------------------------------
>> >>
>> >>
>> >>
>> --
>> -------------------------------------------------------------
>> Hilmar Lapp????????????????????????????email: lapp at gnf.org
>> GNF, San Diego, Ca. 92121??????????????phone: +1-858-812-1757
>> -------------------------------------------------------------
>>
>>
>>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------



From angshu96 at gmail.com  Sat Dec 10 21:38:12 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Sat Dec 10 21:42:46 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <0a732bf7655c118d12c4c548d2897aea@gmx.net>
References: <df8328740512071812n7a5507aap71d273f0d8d781fe@mail.gmail.com>
	<3e86c394e54677a898eab8de11d8e002@gmx.net>
	<df8328740512090710n3c47c517x45e378908c81d8cb@mail.gmail.com>
	<2725905b99cf48d0d0740376a1156082@gmx.net>
	<df8328740512091358i7fe0e477rc8f3a135adc1e470@mail.gmail.com>
	<0a732bf7655c118d12c4c548d2897aea@gmx.net>
Message-ID: <df8328740512101838v740da930s47843f9833b7568b@mail.gmail.com>

Hi Hilmar,

I've run the biosqldb-pg.sql through psql successfully. It has created 28
tables. :(
Are there any other possibilities?

Thanks,
Angshu


On 12/10/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
> You should download the current biosql-schema from CVS. If my
> recollection is correct then you are on Postgres, so you will want to
> run the file biosqldb-pg.sql through psql. You do not need the other
> Postgres related files there. The rest of the repository, aside from
> support for other RDBMSs (mysql, Oracle, and HSQL), contains
> documentation, an ERD of the schema, and the script for loading the
> NCBI taxonomy database.
>
>         -hilmar
>
> On Dec 9, 2005, at 1:58 PM, Angshu Kar wrote:
>
> > Hi Hilmar,
> >
> > I'm obliged that you showed me the light. I reanalyzed the schema and
> > found that its no use working with a truncated version of
> > biosql-schema and now I'm planning to install the entire schema. Could
> > you please let me know where can I find the script for that for a Pg
> > db?
> >
> > Thank you so much. Else I would have to face a lots of problem in the
> > later half of my project.
> >
> > Gratefully,
> > Angshu
> >
> > On 12/9/05, Hilmar Lapp <hlapp@gmx.net> wrote:Angshu,
> > load_seqdatabase.pl is a script that utilizes the language
> >> binding library bioperl-db to load sequences and annotation into
> >> Biosql. The object-relational mapping code is all over bioperl-db.
> >>
> >> I'm sorry, but if you believe it is worth fiddling with that
> >> object-relational code to 'save' instantiating a few more tables then
> >> you're welcome to do so but you're essentially on your own.
> >>
> >> Also, if you'd like to work with a schema the language binding of
> >> which
> >> allows to arbitrarily drop tables from the schema and still work then
> >> Biosql/bioperl-db may not be for you.
> >>
> >> -hilmar
> >>
> >> On Dec 9, 2005, at 7:10 AM, Angshu Kar wrote:
> >>
> >> > Hi Hilmar,
> >> >
> >> > In the load_seqdatabase.pl script could you please tell me where you
> >> > are inserting the data into the db tables, so that I can try and
> >> > modify that part to insert data only to the tables that I need ?
> >> >
> >> > Thanks,
> >> > Angshu
> >> >
> >> >
> >> > On 12/8/05, Hilmar Lapp <hlapp@gmx.net> wrote: Any reason you didn't
> >> > instantiate the rest of the schema? Any scripts
> >> >> and software that have been written against BioSQL will certainly
> >> >> expect the rest of the schema be present ...
> >> >>
> >> >> Bioperl-db is the BioSQL language binding for Bioperl, so that's
> >> what
> >> >> you will want to use. It comes with a script load_seqdatabase.pl to
> >> >> load any format supported by Bioperl.
> >> >>
> >> >> However, bioperl-db does expect all of Biosql to be present ...
> >>  >>
> >> >> -hilmar
> >> >>
> >> >> On Dec 7, 2005, at 6:12 PM, Angshu Kar wrote:
> >> >>
> >> >> > Hi,
> >> >> >
> >> >> > I've created 5 tables (taxon, taxon name, bioentry, biosequence,
> >> >> > biodatabase) in my postgresql database (linux box) using the
> >> biosql
> >> >> > schema
> >> >> > ddl from
> >> >> >
> >> >> http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/biosql-schema/
> >> >> sql/
> >> >> >
> >> >> biosqldb-pg.sql?rev=1.29&cvsroot=biosql&content-type=text/
> >> >> vnd.viewcvs-
> >> >> > markup
> >> >> >.
> >> >> > Now I want to load the tables with arabidopsis data. Could you
> >> >> please
> >> >> > let me
> >> >> > know where can I find such scripts for pgsql? And also I find at
> >> >> > http://bio.perl.org/Core/Latest/index.shtml that the DB module
> >> has
> >> >> not
> >> >> > been
> >> >> > updated since 2001. Do I need to install that? Or are there some
> >> new
> >> >> > releases?
> >> >> >
> >> >> > I'll be obliged if you can guide.
> >> >> >
> >> >> > Thanks,
> >> >> > Angshu
> >> >> >
> >> >> > _______________________________________________
> >> >> > Bioperl-l mailing list
> >> >> > Bioperl-l@portal.open-bio.org
> >> >> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >> >> >
> >> >> >
> >> >> --
> >> >> -------------------------------------------------------------
> >> >> Hilmar Lappemail: lapp at gnf.org
> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> >> -------------------------------------------------------------
> >> >>
> >> >>
> >> >>
> >> --
> >> -------------------------------------------------------------
> >> Hilmar Lappemail: lapp at gnf.org
> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> -------------------------------------------------------------
> >>
> >>
> >>
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From hlapp at gmx.net  Sat Dec 10 21:48:32 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Sat Dec 10 21:45:52 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <df8328740512101838v740da930s47843f9833b7568b@mail.gmail.com>
References: <df8328740512071812n7a5507aap71d273f0d8d781fe@mail.gmail.com>
	<3e86c394e54677a898eab8de11d8e002@gmx.net>
	<df8328740512090710n3c47c517x45e378908c81d8cb@mail.gmail.com>
	<2725905b99cf48d0d0740376a1156082@gmx.net>
	<df8328740512091358i7fe0e477rc8f3a135adc1e470@mail.gmail.com>
	<0a732bf7655c118d12c4c548d2897aea@gmx.net>
	<df8328740512101838v740da930s47843f9833b7568b@mail.gmail.com>
Message-ID: <5955ab1684c84ab9e31035685c9d6aa8@gmx.net>


On Dec 10, 2005, at 6:38 PM, Angshu Kar wrote:

> Hi Hilmar,
>
> I've run the biosqldb-pg.sql through psql successfully. It has created 
> 28 tables. :(

That sounds good. Why are you unhappy about it?

> Are there any other possibilities?

To achieve what?

	-hilmar

>
> Thanks,
> Angshu
>
>
> On 12/10/05, Hilmar Lapp <hlapp@gmx.net> wrote:You should download the 
> current biosql-schema from CVS. If my
>> recollection is correct then you are on Postgres, so you will want to
>> run the file biosqldb-pg.sql through psql. You do not need the other
>> Postgres related files there. The rest of the repository, aside from
>>  support for other RDBMSs (mysql, Oracle, and HSQL), contains
>> documentation, an ERD of the schema, and the script for loading the
>> NCBI taxonomy database.
>>
>> ????????-hilmar
>>
>> On Dec 9, 2005, at 1:58 PM, Angshu Kar wrote:
>>
>> > Hi Hilmar,
>> >
>> > I'm obliged that you showed me the light. I reanalyzed the schema 
>> and
>> > found that its no use working with a truncated version of
>> > biosql-schema and now I'm planning to install the entire schema. 
>> Could
>> > you please let me know where can I find the script for that for a Pg
>> > db?
>> >
>> > Thank you so much. Else I would have to face a lots of problem in 
>> the
>> > later half of my project.
>> >
>>  > Gratefully,
>> > Angshu
>> >
>> > On 12/9/05, Hilmar Lapp <hlapp@gmx.net> wrote:Angshu,
>> > load_seqdatabase.pl is a script that utilizes the language
>> >> binding library bioperl-db to load sequences and annotation into
>> >> Biosql. The object-relational mapping code is all over bioperl-db.
>> >>
>> >> I'm sorry, but if you believe it is worth fiddling with that
>> >> object-relational code to 'save' instantiating a few more tables 
>> then
>> >> you're welcome to do so but you're essentially on your own.
>> >>
>> >> Also, if you'd like to work with a schema the language binding of
>> >> which
>> >> allows to arbitrarily drop tables from the schema and still work 
>> then
>> >> Biosql/bioperl-db may not be for you.
>> >>
>> >> -hilmar
>> >>
>> >> On Dec 9, 2005, at 7:10 AM, Angshu Kar wrote:
>> >>
>> >> > Hi Hilmar,
>> >> >
>> >> > In the load_seqdatabase.pl script could you please tell me where 
>> you
>> >> > are inserting the data into the db tables, so that I can try and
>> >> > modify that part to insert data only to the tables that I need ?
>> >> >
>> >> > Thanks,
>> >> > Angshu
>> >> >
>> >> >
>> >> > On 12/8/05, Hilmar Lapp <hlapp@gmx.net> wrote: Any reason you 
>> didn't
>> >> > instantiate the rest of the schema? Any scripts
>> >> >> and software that have been written against BioSQL will 
>> certainly
>> >> >> expect the rest of the schema be present ...
>> >> >>
>> >> >> Bioperl-db is the BioSQL language binding for Bioperl, so that's
>> >> what
>> >> >> you will want to use. It comes with a script 
>> load_seqdatabase.pl to
>> >> >> load any format supported by Bioperl.
>> >> >>
>> >> >> However, bioperl-db does expect all of Biosql to be present ...
>> >>??>>
>> >> >> -hilmar
>> >> >>
>> >> >> On Dec 7, 2005, at 6:12 PM, Angshu Kar wrote:
>> >> >>
>> >> >> > Hi,
>> >> >> >
>> >> >> > I've created 5 tables (taxon, taxon name, bioentry, 
>> biosequence,
>> >> >> > biodatabase) in my postgresql database (linux box) using the
>> >> biosql
>> >> >> > schema
>> >> >> > ddl from
>> >> >> >
>> >> >> 
>> http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/biosql-schema/
>> >> >> sql/
>> >> >> >
>> >> >> biosqldb-pg.sql?rev=1.29&cvsroot=biosql&content-type=text/
>> >> >> vnd.viewcvs-
>> >> >> > markup
>> >> >> >.
>> >> >> > Now I want to load the tables with arabidopsis data. Could you
>> >> >> please
>> >> >> > let me
>> >> >> > know where can I find such scripts for pgsql? And also I find 
>> at
>> >> >> > http://bio.perl.org/Core/Latest/index.shtml that the DB module
>> >> has
>> >> >> not
>> >> >> > been
>> >> >> > updated since 2001. Do I need to install that? Or are there 
>> some
>> >> new
>> >> >> > releases?
>> >> >> >
>> >> >> > I'll be obliged if you can guide.
>> >> >> >
>> >> >> > Thanks,
>> >> >> > Angshu
>> >> >> >
>> >> >> > _______________________________________________
>> >> >> > Bioperl-l mailing list
>> >> >> > Bioperl-l@portal.open-bio.org
>> >> >> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>> >> >> >
>> >> >> >
>> >> >> --
>> >> >> -------------------------------------------------------------
>> >> >> Hilmar Lappemail: lapp at gnf.org
>> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> >> -------------------------------------------------------------
>> >> >>
>> >> >>
>> >> >>
>> >> --
>> >> -------------------------------------------------------------
>> >> Hilmar Lappemail: lapp at gnf.org
>> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> -------------------------------------------------------------
>> >>
>> >>
>> >>
>> --
>> -------------------------------------------------------------
>> Hilmar Lapp????????????????????????????email: lapp at gnf.org
>> GNF, San Diego, Ca. 92121??????????????phone: +1-858-812-1757
>> -------------------------------------------------------------
>>
>>
>>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------



From angshu96 at gmail.com  Sat Dec 10 21:51:53 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Sat Dec 10 21:49:18 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <5955ab1684c84ab9e31035685c9d6aa8@gmx.net>
References: <df8328740512071812n7a5507aap71d273f0d8d781fe@mail.gmail.com>
	<3e86c394e54677a898eab8de11d8e002@gmx.net>
	<df8328740512090710n3c47c517x45e378908c81d8cb@mail.gmail.com>
	<2725905b99cf48d0d0740376a1156082@gmx.net>
	<df8328740512091358i7fe0e477rc8f3a135adc1e470@mail.gmail.com>
	<0a732bf7655c118d12c4c548d2897aea@gmx.net>
	<df8328740512101838v740da930s47843f9833b7568b@mail.gmail.com>
	<5955ab1684c84ab9e31035685c9d6aa8@gmx.net>
Message-ID: <df8328740512101851j1894ef9cn7a9912efd2edd15@mail.gmail.com>

Oh...may be u missed my last mail... I'm sedning it again...

Now I'm getting this new error:

Can't locate Bio/DB/BioDB.pm in @INC (@INC contains:
/home/akar/local/perl//i386-linux-thread-multi /home/akar/local/perl/
/usr/lib/perl5/5.8.5/i386-linux-thread-multi /usr/lib/perl5/5.8.5
/usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4
/usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
/usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
/usr/lib/perl5/site_perl
/usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4
/usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
/usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
/usr/lib/perl5/vendor_perl .) at load_seqdatabase.pl line 8.
BEGIN failed--compilation aborted at load_seqdatabase.pl line 8.


I've checked the Bio/DB/ folder but it doesn't contain the BioDB.pm module -
it contains the following:


Ace.pm <http://ace.pm/>       DBFetch.pm    Flat        GFF
MeSH.pm           RefSeq.pm     Taxonomy.pm <http://taxonomy.pm/>
XEMBLService.pm
Biblio       EMBL.pm       Flat.pm <http://flat.pm/>     GFF.pm
NCBIHelper.pm     Registry.pm <http://registry.pm/>  
Universal.pm<http://universal.pm/>
BiblioI.pm   Failover.pm <http://failover.pm/>   GDB.pm
InMemoryCache.pm   Query             SeqI.pm       UpdateableSeqI.pm
BioFetch.pm  Fasta.pm <http://fasta.pm/>      GenBank.pm  Makefile.PL
QueryI.pm         SwissProt.pm  WebDBSeqI.pm
CUTG.pm      FileCache.pm  GenPept.pm  MANIFEST          RandomAccessI.pm
Taxonomy      XEMBL.pm

Have I installed some wrong version of bioperl-db ? (I've used
http://bio.perl.org/Core/Latest/index.shtml)<http://bio.perl.org/Core/Latest/index.shtml%29>

Thanks,
Angshu

On 12/10/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
>
> On Dec 10, 2005, at 6:38 PM, Angshu Kar wrote:
>
> > Hi Hilmar,
> >
> > I've run the biosqldb-pg.sql through psql successfully. It has created
> > 28 tables. :(
>
> That sounds good. Why are you unhappy about it?
>
> > Are there any other possibilities?
>
> To achieve what?
>
>         -hilmar
>
> >
> > Thanks,
> > Angshu
> >
> >
> > On 12/10/05, Hilmar Lapp <hlapp@gmx.net> wrote:You should download the
> > current biosql-schema from CVS. If my
> >> recollection is correct then you are on Postgres, so you will want to
> >> run the file biosqldb-pg.sql through psql. You do not need the other
> >> Postgres related files there. The rest of the repository, aside from
> >>  support for other RDBMSs (mysql, Oracle, and HSQL), contains
> >> documentation, an ERD of the schema, and the script for loading the
> >> NCBI taxonomy database.
> >>
> >> -hilmar
> >>
> >> On Dec 9, 2005, at 1:58 PM, Angshu Kar wrote:
> >>
> >> > Hi Hilmar,
> >> >
> >> > I'm obliged that you showed me the light. I reanalyzed the schema
> >> and
> >> > found that its no use working with a truncated version of
> >> > biosql-schema and now I'm planning to install the entire schema.
> >> Could
> >> > you please let me know where can I find the script for that for a Pg
> >> > db?
> >> >
> >> > Thank you so much. Else I would have to face a lots of problem in
> >> the
> >> > later half of my project.
> >> >
> >>  > Gratefully,
> >> > Angshu
> >> >
> >> > On 12/9/05, Hilmar Lapp <hlapp@gmx.net> wrote:Angshu,
> >> > load_seqdatabase.pl is a script that utilizes the language
> >> >> binding library bioperl-db to load sequences and annotation into
> >> >> Biosql. The object-relational mapping code is all over bioperl-db.
> >> >>
> >> >> I'm sorry, but if you believe it is worth fiddling with that
> >> >> object-relational code to 'save' instantiating a few more tables
> >> then
> >> >> you're welcome to do so but you're essentially on your own.
> >> >>
> >> >> Also, if you'd like to work with a schema the language binding of
> >> >> which
> >> >> allows to arbitrarily drop tables from the schema and still work
> >> then
> >> >> Biosql/bioperl-db may not be for you.
> >> >>
> >> >> -hilmar
> >> >>
> >> >> On Dec 9, 2005, at 7:10 AM, Angshu Kar wrote:
> >> >>
> >> >> > Hi Hilmar,
> >> >> >
> >> >> > In the load_seqdatabase.pl script could you please tell me where
> >> you
> >> >> > are inserting the data into the db tables, so that I can try and
> >> >> > modify that part to insert data only to the tables that I need ?
> >> >> >
> >> >> > Thanks,
> >> >> > Angshu
> >> >> >
> >> >> >
> >> >> > On 12/8/05, Hilmar Lapp <hlapp@gmx.net > wrote: Any reason you
> >> didn't
> >> >> > instantiate the rest of the schema? Any scripts
> >> >> >> and software that have been written against BioSQL will
> >> certainly
> >> >> >> expect the rest of the schema be present ...
> >> >> >>
> >> >> >> Bioperl-db is the BioSQL language binding for Bioperl, so that's
> >> >> what
> >> >> >> you will want to use. It comes with a script
> >> load_seqdatabase.pl to
> >> >> >> load any format supported by Bioperl.
> >> >> >>
> >> >> >> However, bioperl-db does expect all of Biosql to be present ...
> >> >>>>
> >> >> >> -hilmar
> >> >> >>
> >> >> >> On Dec 7, 2005, at 6:12 PM, Angshu Kar wrote:
> >> >> >>
> >> >> >> > Hi,
> >> >> >> >
> >> >> >> > I've created 5 tables (taxon, taxon name, bioentry,
> >> biosequence,
> >> >> >> > biodatabase) in my postgresql database (linux box) using the
> >> >> biosql
> >> >> >> > schema
> >> >> >> > ddl from
> >> >> >> >
> >> >> >>
> >> http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/biosql-schema/
> >> >> >> sql/
> >> >> >> >
> >> >> >> biosqldb-pg.sql?rev=1.29&cvsroot=biosql&content-type=text/
> >> >> >> vnd.viewcvs-
> >> >> >> > markup
> >> >> >> >.
> >> >> >> > Now I want to load the tables with arabidopsis data. Could you
> >> >> >> please
> >> >> >> > let me
> >> >> >> > know where can I find such scripts for pgsql? And also I find
> >> at
> >> >> >> > http://bio.perl.org/Core/Latest/index.shtml that the DB module
> >> >> has
> >> >> >> not
> >> >> >> > been
> >> >> >> > updated since 2001. Do I need to install that? Or are there
> >> some
> >> >> new
> >> >> >> > releases?
> >> >> >> >
> >> >> >> > I'll be obliged if you can guide.
> >> >> >> >
> >> >> >> > Thanks,
> >> >> >> > Angshu
> >> >> >> >
> >> >> >> > _______________________________________________
> >> >> >> > Bioperl-l mailing list
> >> >> >> > Bioperl-l@portal.open-bio.org
> >> >> >> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >> >> >> >
> >> >> >> >
> >> >> >> --
> >> >> >> -------------------------------------------------------------
> >> >> >> Hilmar Lappemail: lapp at gnf.org
> >> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> >> >> -------------------------------------------------------------
> >> >> >>
> >> >> >>
> >> >> >>
> >> >> --
> >> >> -------------------------------------------------------------
> >> >> Hilmar Lappemail: lapp at gnf.org
> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> >> -------------------------------------------------------------
> >> >>
> >> >>
> >> >>
> >> --
> >> -------------------------------------------------------------
> >> Hilmar Lappemail: lapp at gnf.org
> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> -------------------------------------------------------------
> >>
> >>
> >>
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From hlapp at gmx.net  Sat Dec 10 21:51:57 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Sat Dec 10 21:49:22 2005
Subject: [Bioperl-l] loading data to biosql tables
In-Reply-To: <df8328740512101459v60e481h36a8925095d7d294@mail.gmail.com>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F14@m.hg.genetics.utah.edu>
	<df8328740512091645g1b1d20f1rb909a28fc65c0536@mail.gmail.com>
	<df8328740512091654p1e5e7b14i7e2c731f87e721c6@mail.gmail.com>
	<3CCC9485-FF57-4C6F-81AF-3B9C9AFDF197@duke.edu>
	<df8328740512091921w175f04a4iead8a34a6f0b8993@mail.gmail.com>
	<2E2A564F-116D-497B-86B1-421CCF368437@duke.edu>
	<df8328740512100851v685b0f6bg7d1d9f6eb983674f@mail.gmail.com>
	<6CE9663B-2666-418C-8322-AC48A7036143@duke.edu>
	<df8328740512100917t69001252vbff34b2598d64e15@mail.gmail.com>
	<df8328740512101459v60e481h36a8925095d7d294@mail.gmail.com>
Message-ID: <e798ef0b32185719bce4d4e363f2e200@gmx.net>

Well this means that the place where you installed Bioperl-db is  
different from the one you installed Bioperl, and you didn't include it  
in your PERL5LIB setting. You can have multiple directories in  
PERL5LIB, separate them by colon:

	$ setenv PERL5LIB  
/path/to/where/I/installed/bioperl:/path/to/where/I/installed/bioperl- 
db

-hilmar

On Dec 10, 2005, at 2:59 PM, Angshu Kar wrote:

> Hi,
>
> Now I'm getting this new error:
>
> Can't locate Bio/DB/BioDB.pm in @INC (@INC contains:
> /home/akar/local/perl//i386-linux-thread-multi /home/akar/local/perl/
> /usr/lib/perl5/5.8.5/i386-linux-thread-multi /usr/lib/perl5/5.8.5
> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
> /usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4
> /usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
> /usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
> /usr/lib/perl5/site_perl
> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
> /usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4
> /usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
> /usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
> /usr/lib/perl5/vendor_perl .) at load_seqdatabase.pl line 8.
> BEGIN failed--compilation aborted at load_seqdatabase.pl line 8.
>
>
> I've checked the Bio/DB/ folder but it doesn't contain the BioDB.pm  
> module -
> it contains the following:
>
>
> Ace.pm       DBFetch.pm    Flat        GFF               MeSH.pm
> RefSeq.pm     Taxonomy.pm        XEMBLService.pm
> Biblio       EMBL.pm       Flat.pm     GFF.pm            NCBIHelper.pm
> Registry.pm   Universal.pm
> BiblioI.pm   Failover.pm   GDB.pm      InMemoryCache.pm  Query
> SeqI.pm       UpdateableSeqI.pm
> BioFetch.pm  Fasta.pm      GenBank.pm  Makefile.PL       QueryI.pm
> SwissProt.pm  WebDBSeqI.pm
> CUTG.pm      FileCache.pm  GenPept.pm  MANIFEST           
> RandomAccessI.pm
> Taxonomy      XEMBL.pm
>
> Have I installed some wrong version of bioperl-db ? (I've used
> http://bio.perl.org/Core/Latest/index.shtml)
>
> Could anyone please let me know what I've missed?
>
> Thanks,
> Angshu
>
>
> On 12/10/05, Angshu Kar <angshu96@gmail.com> wrote:
>>
>> You are marvellous Jason...Thanks a lot for using the lingo thats for  
>> a
>> freshie like me.
>> I'll apply this today to the load_seqdatabase.pl and let you know if  
>> any
>> problem arises.
>>
>> Thanks,
>> Angshu
>>
>>
>> On 12/10/05, Jason Stajich <jason.stajich@duke.edu> wrote:
>>>
>>>  From the INSTALL document in the Bioperl distribution
>>>
>>>
>>>    You can explicitly tell perl where to look for modules by using  
>>> the
>>>    lib module which comes standard with perl.
>>>
>>>
>>>    Example:
>>>
>>>
>>>        #!/usr/bin/perl
>>>
>>>
>>>        use lib "/home/users/dag/My_Local_Perl_Modules/";
>>>        use Bio::Seq;
>>>
>>>
>>>        <...insert whizzy perl code here...>
>>>
>>>
>>>    Or, you can set the environmental variable PERL5LIB:
>>>
>>>
>>>      csh or tcsh:
>>>
>>>
>>>        setenv PERL5LIB /home/users/dag/My_Local_Perl_Modules/
>>>
>>>      bash or sh:
>>>
>>>
>>>       export PERL5LIB=/home/users/dag/My_Local_Perl_Modules/
>>>
>>>
>>>
>>>  On Dec 10, 2005, at 11:51 AM, Angshu Kar wrote:
>>>
>>>  Yes Jason. But what I've done is, instead of putting the .pm and .pl
>>> files in default locations I've used the LIB and PREFIX arguments to
>>> place them in my local directory. This I've done for bioperl as well  
>>> as
>>> bioperl-db modules.
>>> Now could you please help me in how to make perl find it?
>>>
>>> Thanks,
>>> Angshu
>>>
>>>
>>> On 12/10/05, Jason Stajich <jason.stajich@duke.edu > wrote:
>>>>
>>>> you have not installed it so that your perl knows to find it.  Did  
>>>> you
>>>> do 'make install'?
>>>>  On Dec 9, 2005, at 10:21 PM, Angshu Kar wrote:
>>>>
>>>>  Thanks Jason...
>>>> I'm sorry but I didn't get you.
>>>> I've installed bioperl as well as bioperl-db module in my system...
>>>> Now what should be my next step to resolve this problem?
>>>> I'm sorry again, but as I told that I'm a novice in this domain.
>>>>
>>>> Thanks,
>>>> Angshu
>>>>
>>>>
>>>> On 12/9/05, Jason Stajich <jason.stajich@duke.edu > wrote:
>>>>>
>>>>>
>>>>> Follow the install instructions for bioperl first, you need bioperl
>>>>> to run bioperl-db.
>>>>> These include, set your PERL5LIB or install bioperl on your system
>>>>> or
>>>>> run the load script with -I PATH/TO/BIOPERL
>>>>>
>>>>>
>>>>> On Dec 9, 2005, at 7:54 PM, Angshu Kar wrote:
>>>>>
>>>>>> One thing I missed was that my Root.pm <http://root.pm/> resides
>>>>> in a different
>>>>>> path...How to
>>>>>> specify that?
>>>>>>
>>>>>> On 12/9/05, Angshu Kar < angshu96@gmail.com> wrote:
>>>>>>>
>>>>>>> Thanks a lot Barry.
>>>>>>>
>>>>>>> Now I'm getting this error while tryin to run the
>>>>>>> load_seqdatabase.pl in a
>>>>>>> linux box (I used :
>>>>>>> perl load_seqdatabase.pl /akar/seq/ATH1_cds_cm_20040228)
>>>>>>>
>>>>>>>
>>>>>>> Can't locate Bio/Root/Root.pm in @INC (@INC contains:
>>>>>>> /usr/lib/perl5/5.8.5/i386-linux-thread-multi /usr/lib/perl5/5.8.5
>>>>>
>>>>>>> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
>>>>>>> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
>>>>>>> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
>>>>>>> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
>>>>>>> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
>>>>>>> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
>>>>>>> /usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4
>>>>>>> /usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
>>>>>>> /usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
>>>>>>> /usr/lib/perl5/site_perl
>>>>>>> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
>>>>>>> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
>>>>>>> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
>>>>>>> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
>>>>>>> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
>>>>>>> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
>>>>>>> /usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4
>>>>>>> /usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
>>>>>
>>>>>>> /usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
>>>>>
>>>>>>> /usr/lib/perl5/vendor_perl .) at load_seqdatabase.pl line 7.
>>>>>>> BEGIN failed--compilation aborted at load_seqdatabase.pl line 7.
>>>>>>>
>>>>>>> Please guide.
>>>>>>>
>>>>>>> Thanks,
>>>>>>> Angshu
>>>>>>>
>>>>>>> On 12/9/05, Barry Moore < bmoore@genetics.utah.edu> wrote:
>>>>>>>>
>>>>>>>> Angshu-
>>>>>>>>
>>>>>>>> Make the namespace whatever you want it to be.  This is useful
>>>>> if
>>>>>>>> you
>>>>>>>> want to load sequence from different sources into the same
>>>>>>>> database.  As
>>>>>>>> for the format - you tell us what format is the file in?  You
>>>>>>>> could just
>>>>>>>> let bioperl guess, but looking at the file and deciding yourself
>>>>>>>> would
>>>>>>>> be your best bet.
>>>>>>>>
>>>>>>>> Barry
>>>>>>>>
>>>>>>>>> -----Original Message-----
>>>>>>>>> From: bioperl-l-bounces@portal.open-bio.org [mailto: bioperl-l-
>>>>>>>>> bounces@portal.open-bio.org ] On Behalf Of Angshu Kar
>>>>>>>>> Sent: Friday, December 09, 2005 5:22 PM
>>>>>>>>> To: Sean Davis
>>>>>>>>> Cc: bioperl-l
>>>>>>>>> Subject: Re: [Bioperl-l] loading data to biosql tables
>>>>>>>>>
>>>>>>>>> Hi Sean,
>>>>>>>>>
>>>>>>>>> A small help I need before I run the load_seqdatabase.pl. I've
>>>>>>>> downloaded
>>>>>>>>> my
>>>>>>>>> datafile which is ATH1_cds_cm_20040228 from TAIR. What's the
>>>>>>>>> namespace
>>>>>>>>
>>>>>>>> and
>>>>>>>>> format for this?
>>>>>>>>>
>>>>>>>>> Thanks,
>>>>>>>>> Angshu
>>>>>>>>>
>>>>>>>>> _______________________________________________
>>>>>>>>> Bioperl-l mailing list
>>>>>>>>> Bioperl-l@portal.open-bio.org
>>>>>>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>
>>>>>> _______________________________________________
>>>>>> Bioperl-l mailing list
>>>>>> Bioperl-l@portal.open-bio.org
>>>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>>>
>>>>> --
>>>>> Jason Stajich
>>>>> Duke University
>>>>> http://www.duke.edu/~jes12 <http://www.duke.edu/%7Ejes12>
>>>>>
>>>>>
>>>>>
>>>>
>>>>  --
>>>> Jason Stajich
>>>> Duke University
>>>> http://www.duke.edu/~jes12 <http://www.duke.edu/%7Ejes12>
>>>>
>>>>
>>>>
>>>>
>>>
>>>
>>>  --
>>> Jason Stajich
>>> Duke University
>>> http://www.duke.edu/~jes12 <http://www.duke.edu/%7Ejes12>
>>>
>>>
>>>
>>>
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From hlapp at gmx.net  Sat Dec 10 22:22:48 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Sat Dec 10 22:22:16 2005
Subject: [Bioperl-l] newbies
In-Reply-To: <df8328740512091654p1e5e7b14i7e2c731f87e721c6@mail.gmail.com>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F14@m.hg.genetics.utah.edu>
	<df8328740512091645g1b1d20f1rb909a28fc65c0536@mail.gmail.com>
	<df8328740512091654p1e5e7b14i7e2c731f87e721c6@mail.gmail.com>
Message-ID: <c987b4b78d5ac3dbe5765dceca185cae@gmx.net>

Angshu, somebody else pointed out already that you really need to take 
a look at the documentation. This wasn't a joke - I can only recommend 
you take that advice pretty literally or soon you'll find yourself 
posting questions and being ignored.

You're not the first newbie ever to hit bioperl or bioperl-db, and 
you're not the first one either to face the problems you're facing - 
that's why we have INSTALL documents and FAQs and such. They were 
written exactly for newbie people like you - not for me or Barry or 
Jason - so that most newbie questions DO NOT have to be addressed over 
the mailing list.

People responding to you do so in their spare time out of very busy 
lives. If you don't read documentation you're essentially saying that 
you don't respect other people's time, because you're happily wasting 
that time for questions you could have easily answered yourself had you 
bothered to read the documentation, instead of using people's time to 
assist with problems which are NOT readily addressed in the 
documentation. If you don't respect somebody's time, why should people 
think you respect them themselves?

I recommend you think about that next time you're going to hit the 
keyboard as soon as something doesn't work as expected.

	-hilmar

On Dec 9, 2005, at 4:54 PM, Angshu Kar wrote:

> One thing I missed was that my Root.pm resides in a different 
> path...How to
> specify that?
>
> On 12/9/05, Angshu Kar <angshu96@gmail.com> wrote:
>>
>> Thanks a lot Barry.
>>
>> Now I'm getting this error while tryin to run the load_seqdatabase.pl 
>> in a
>> linux box (I used :
>> perl load_seqdatabase.pl /akar/seq/ATH1_cds_cm_20040228)
>>
>>
>> Can't locate Bio/Root/Root.pm in @INC (@INC contains:
>> /usr/lib/perl5/5.8.5/i386-linux-thread-multi /usr/lib/perl5/5.8.5
>> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4
>> /usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
>> /usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
>> /usr/lib/perl5/site_perl
>> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4
>> /usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
>> /usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
>> /usr/lib/perl5/vendor_perl .) at load_seqdatabase.pl line 7.
>> BEGIN failed--compilation aborted at load_seqdatabase.pl line 7.
>>
>> Please guide.
>>
>> Thanks,
>> Angshu
>>
>> On 12/9/05, Barry Moore < bmoore@genetics.utah.edu> wrote:
>>>
>>> Angshu-
>>>
>>> Make the namespace whatever you want it to be.  This is useful if you
>>> want to load sequence from different sources into the same database. 
>>>  As
>>> for the format - you tell us what format is the file in?  You could 
>>> just
>>> let bioperl guess, but looking at the file and deciding yourself 
>>> would
>>> be your best bet.
>>>
>>> Barry
>>>
>>>> -----Original Message-----
>>>> From: bioperl-l-bounces@portal.open-bio.org [mailto: bioperl-l-
>>>> bounces@portal.open-bio.org] On Behalf Of Angshu Kar
>>>> Sent: Friday, December 09, 2005 5:22 PM
>>>> To: Sean Davis
>>>> Cc: bioperl-l
>>>> Subject: Re: [Bioperl-l] loading data to biosql tables
>>>>
>>>> Hi Sean,
>>>>
>>>> A small help I need before I run the load_seqdatabase.pl. I've
>>> downloaded
>>>> my
>>>> datafile which is ATH1_cds_cm_20040228 from TAIR. What's the 
>>>> namespace
>>>
>>> and
>>>> format for this?
>>>>
>>>> Thanks,
>>>> Angshu
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l@portal.open-bio.org
>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From angshu96 at gmail.com  Sat Dec 10 22:30:08 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Sat Dec 10 22:27:51 2005
Subject: [Bioperl-l] newbies
In-Reply-To: <c987b4b78d5ac3dbe5765dceca185cae@gmx.net>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F14@m.hg.genetics.utah.edu>
	<df8328740512091645g1b1d20f1rb909a28fc65c0536@mail.gmail.com>
	<df8328740512091654p1e5e7b14i7e2c731f87e721c6@mail.gmail.com>
	<c987b4b78d5ac3dbe5765dceca185cae@gmx.net>
Message-ID: <df8328740512101930r369829f4i75d9074797f59d4f@mail.gmail.com>

I'm extremely apologetic about the inconvenience caused by me to you and
other people.
Actually I was getting more gulping and greedy by each of the ready and
easily comprehensive answers that you bright people were posting.
Thanks for pointing out. I really feel self-accusing.
I'm sorry Hilmar. This wouldn't be repeated in future.

Thanks,
Angshu

On 12/10/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
> Angshu, somebody else pointed out already that you really need to take
> a look at the documentation. This wasn't a joke - I can only recommend
> you take that advice pretty literally or soon you'll find yourself
> posting questions and being ignored.
>
> You're not the first newbie ever to hit bioperl or bioperl-db, and
> you're not the first one either to face the problems you're facing -
> that's why we have INSTALL documents and FAQs and such. They were
> written exactly for newbie people like you - not for me or Barry or
> Jason - so that most newbie questions DO NOT have to be addressed over
> the mailing list.
>
> People responding to you do so in their spare time out of very busy
> lives. If you don't read documentation you're essentially saying that
> you don't respect other people's time, because you're happily wasting
> that time for questions you could have easily answered yourself had you
> bothered to read the documentation, instead of using people's time to
> assist with problems which are NOT readily addressed in the
> documentation. If you don't respect somebody's time, why should people
> think you respect them themselves?
>
> I recommend you think about that next time you're going to hit the
> keyboard as soon as something doesn't work as expected.
>
>         -hilmar
>
> On Dec 9, 2005, at 4:54 PM, Angshu Kar wrote:
>
> > One thing I missed was that my Root.pm resides in a different
> > path...How to
> > specify that?
> >
> > On 12/9/05, Angshu Kar <angshu96@gmail.com> wrote:
> >>
> >> Thanks a lot Barry.
> >>
> >> Now I'm getting this error while tryin to run the load_seqdatabase.pl
> >> in a
> >> linux box (I used :
> >> perl load_seqdatabase.pl /akar/seq/ATH1_cds_cm_20040228)
> >>
> >>
> >> Can't locate Bio/Root/Root.pm in @INC (@INC contains:
> >> /usr/lib/perl5/5.8.5/i386-linux-thread-multi /usr/lib/perl5/5.8.5
> >> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
> >> /usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4
> >> /usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
> >> /usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
> >> /usr/lib/perl5/site_perl
> >> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
> >> /usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4
> >> /usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
> >> /usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
> >> /usr/lib/perl5/vendor_perl .) at load_seqdatabase.pl line 7.
> >> BEGIN failed--compilation aborted at load_seqdatabase.pl line 7.
> >>
> >> Please guide.
> >>
> >> Thanks,
> >> Angshu
> >>
> >> On 12/9/05, Barry Moore < bmoore@genetics.utah.edu> wrote:
> >>>
> >>> Angshu-
> >>>
> >>> Make the namespace whatever you want it to be.  This is useful if you
> >>> want to load sequence from different sources into the same database.
> >>>  As
> >>> for the format - you tell us what format is the file in?  You could
> >>> just
> >>> let bioperl guess, but looking at the file and deciding yourself
> >>> would
> >>> be your best bet.
> >>>
> >>> Barry
> >>>
> >>>> -----Original Message-----
> >>>> From: bioperl-l-bounces@portal.open-bio.org [mailto: bioperl-l-
> >>>> bounces@portal.open-bio.org] On Behalf Of Angshu Kar
> >>>> Sent: Friday, December 09, 2005 5:22 PM
> >>>> To: Sean Davis
> >>>> Cc: bioperl-l
> >>>> Subject: Re: [Bioperl-l] loading data to biosql tables
> >>>>
> >>>> Hi Sean,
> >>>>
> >>>> A small help I need before I run the load_seqdatabase.pl. I've
> >>> downloaded
> >>>> my
> >>>> datafile which is ATH1_cds_cm_20040228 from TAIR. What's the
> >>>> namespace
> >>>
> >>> and
> >>>> format for this?
> >>>>
> >>>> Thanks,
> >>>> Angshu
> >>>>
> >>>> _______________________________________________
> >>>> Bioperl-l mailing list
> >>>> Bioperl-l@portal.open-bio.org
> >>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >>>
> >>
> >>
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From bmoore at genetics.utah.edu  Sun Dec 11 08:47:06 2005
From: bmoore at genetics.utah.edu (Barry Moore)
Date: Sun Dec 11 08:43:43 2005
Subject: [Bioperl-l] loading data to biosql tables
Message-ID: <CFE1DF3BA20F424689DA0881A14055BECF2F16@m.hg.genetics.utah.edu>

Angshu-

 

You can either add: 'use lib /path/to/your/Root.pm;' at the top of all
of your perl scripts, or set PERL5LIB to the path of your Root.pm.  For
example, I use the bash shell, and in my .bashrc file I have a line
'export PERL5LIB=/home/bmoore/perl/lib'.

 

Barry

 

 

 

 

-----Original Message-----
From: Angshu Kar [mailto:angshu96@gmail.com] 
Sent: Friday, December 09, 2005 5:55 PM
To: Barry Moore
Cc: bioperl-l
Subject: Re: [Bioperl-l] loading data to biosql tables

 

One thing I missed was that my Root.pm resides in a different path...How
to specify that?

On 12/9/05, Angshu Kar < angshu96@gmail.com <mailto:angshu96@gmail.com>
> wrote:

Thanks a lot Barry.

Now I'm getting this error while tryin to run the load_seqdatabase.pl in
a linux box (I used : 
perl load_seqdatabase.pl /akar/seq/ATH1_cds_cm_20040228)


Can't locate Bio/Root/Root.pm in @INC (@INC contains:
/usr/lib/perl5/5.8.5/i386-linux-thread-multi /usr/lib/perl5/5.8.5
/usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4
/usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
/usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
/usr/lib/perl5/site_perl
/usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4
/usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
/usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
/usr/lib/perl5/vendor_perl .) at load_seqdatabase.pl line 7. 
BEGIN failed--compilation aborted at load_seqdatabase.pl line 7.

Please guide.

Thanks,
Angshu

 

On 12/9/05, Barry Moore < bmoore@genetics.utah.edu
<mailto:bmoore@genetics.utah.edu> > wrote:

Angshu-

Make the namespace whatever you want it to be.  This is useful if you 
want to load sequence from different sources into the same database.  As
for the format - you tell us what format is the file in?  You could just
let bioperl guess, but looking at the file and deciding yourself would 
be your best bet.

Barry

> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org [mailto: bioperl-l-
<mailto:bioperl-l-> 
> bounces@portal.open-bio.org] On Behalf Of Angshu Kar
> Sent: Friday, December 09, 2005 5:22 PM 
> To: Sean Davis
> Cc: bioperl-l
> Subject: Re: [Bioperl-l] loading data to biosql tables
>
> Hi Sean,
>
> A small help I need before I run the load_seqdatabase.pl. I've
downloaded
> my
> datafile which is ATH1_cds_cm_20040228 from TAIR. What's the namespace

and
> format for this?
>
> Thanks,
> Angshu
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l 





 


From chen_li3 at yahoo.com  Sun Dec 11 15:47:02 2005
From: chen_li3 at yahoo.com (chen li)
Date: Sun Dec 11 15:51:05 2005
Subject: [Bioperl-l] load sequence files into Mysql
Message-ID: <20051211204702.14515.qmail@web36805.mail.mud.yahoo.com>

Hi all,

I already install Biosql on my computer and everything
works fine. Now I want to download some mouse EST
database files which can be read into mysql correctly
without anymore modifications. Where can I download
these files or other sequence files?  And I know it
still has some problems to read the fasta files from
NCBI(as Hilmar already points out). The link provided
in the HOWTO is broken.

Any suggestion will be appreciated and thanks in
advance.



Li

__________________________________________________
Do You Yahoo!?
Tired of spam?  Yahoo! Mail has the best spam protection around 
http://mail.yahoo.com 
From hlapp at gmx.net  Sun Dec 11 18:51:19 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Sun Dec 11 18:48:51 2005
Subject: [Bioperl-l] load sequence files into Mysql
In-Reply-To: <20051211204702.14515.qmail@web36805.mail.mud.yahoo.com>
References: <20051211204702.14515.qmail@web36805.mail.mud.yahoo.com>
Message-ID: <bc2e2b83e26b6e1c078f9ffbd659b90f@gmx.net>

Have you tried the GenBank EST database flat files (in GenBank format)?

On Dec 11, 2005, at 12:47 PM, chen li wrote:

> Hi all,
>
> I already install Biosql on my computer and everything
> works fine. Now I want to download some mouse EST
> database files which can be read into mysql correctly
> without anymore modifications. Where can I download
> these files or other sequence files?  And I know it
> still has some problems to read the fasta files from
> NCBI(as Hilmar already points out). The link provided
> in the HOWTO is broken.
>
> Any suggestion will be appreciated and thanks in
> advance.
>
>
>
> Li
>
> __________________________________________________
> Do You Yahoo!?
> Tired of spam?  Yahoo! Mail has the best spam protection around
> http://mail.yahoo.com
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From chen_li3 at yahoo.com  Sun Dec 11 20:29:08 2005
From: chen_li3 at yahoo.com (chen li)
Date: Sun Dec 11 20:33:10 2005
Subject: [Bioperl-l] load sequence files into Mysql
In-Reply-To: <bc2e2b83e26b6e1c078f9ffbd659b90f@gmx.net>
Message-ID: <20051212012908.77276.qmail@web36811.mail.mud.yahoo.com>

Hi Hilmar,

Thanks for the replay.

Do you mean the files in this link:

ftp://ftp.ncbi.nih.gov/repository/dbEST/

There are many files out in this folder. I am not sure
which one belongs to mouse.


Li 

--- Hilmar Lapp <hlapp@gmx.net> wrote:

> Have you tried the GenBank EST database flat files
> (in GenBank format)?
> 
> On Dec 11, 2005, at 12:47 PM, chen li wrote:
> 
> > Hi all,
> >
> > I already install Biosql on my computer and
> everything
> > works fine. Now I want to download some mouse EST
> > database files which can be read into mysql
> correctly
> > without anymore modifications. Where can I
> download
> > these files or other sequence files?  And I know
> it
> > still has some problems to read the fasta files
> from
> > NCBI(as Hilmar already points out). The link
> provided
> > in the HOWTO is broken.
> >
> > Any suggestion will be appreciated and thanks in
> > advance.
> >
> >
> >
> > Li
> >
> > __________________________________________________
> > Do You Yahoo!?
> > Tired of spam?  Yahoo! Mail has the best spam
> protection around
> > http://mail.yahoo.com
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> >
>
http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> -- 
>
-------------------------------------------------------------
> Hilmar Lapp                            email: lapp
> at gnf.org
> GNF, San Diego, Ca. 92121              phone:
> +1-858-812-1757
>
-------------------------------------------------------------
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
>
http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 


__________________________________________________
Do You Yahoo!?
Tired of spam?  Yahoo! Mail has the best spam protection around 
http://mail.yahoo.com 
From heroen.verbruggen at ugent.be  Mon Dec 12 04:37:15 2005
From: heroen.verbruggen at ugent.be (Heroen Verbruggen)
Date: Mon Dec 12 05:04:27 2005
Subject: [Bioperl-l] TreeIO::nexus - multiple trees
Message-ID: <000901c5feff$a2f555b0$f2a4c19d@bikini>

Dear all,

There seems to be a bug in the TreeIO/nexus.pm module. When I tried parsing
a file with multiple trees, I only got every other tree. The problem is that
the parser matches whitespace after each semicolon and requires whitespace
before the subsequent tree (regex on lines 166-167). I've solved it by
removing the terminal whitespace from the regex.

Cheers,

Heroen


From sdavis2 at mail.nih.gov  Mon Dec 12 08:24:40 2005
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Mon Dec 12 08:22:10 2005
Subject: [Bioperl-l] load sequence files into Mysql
In-Reply-To: <20051212012908.77276.qmail@web36811.mail.mud.yahoo.com>
Message-ID: <BFC2E448.1518%sdavis2@mail.nih.gov>




On 12/11/05 8:29 PM, "chen li" <chen_li3@yahoo.com> wrote:

> Hi Hilmar,
> 
> Thanks for the replay.
> 
> Do you mean the files in this link:
> 
> ftp://ftp.ncbi.nih.gov/repository/dbEST/
> 
> There are many files out in this folder. I am not sure
> which one belongs to mouse.

I'm not sure what you need, but UCSC maintains fasta of the mouse for all
mouse genbank records.  See here:

http://hgdownload.cse.ucsc.edu/goldenPath/mm6/bigZips/

They have tables in their database that contain much of the actual genbank
records, but in a relational form.

Sean


From jason.stajich at duke.edu  Mon Dec 12 08:35:47 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Mon Dec 12 08:53:44 2005
Subject: [Bioperl-l] TreeIO::nexus - multiple trees
In-Reply-To: <000901c5feff$a2f555b0$f2a4c19d@bikini>
References: <000901c5feff$a2f555b0$f2a4c19d@bikini>
Message-ID: <1FCC3F1A-9083-482E-8155-14AFB0EC2E47@duke.edu>

Hmm what version of bioperl are you using? That whitespace is  
optional now.
while( $trees =~ /\s+tree\s+(\S+)\s*\=\s*(?:\[\S+\])?\s*([^\;]+;)\s*/ig)


On Dec 12, 2005, at 4:37 AM, Heroen Verbruggen wrote:

> Dear all,
>
> There seems to be a bug in the TreeIO/nexus.pm module. When I tried  
> parsing
> a file with multiple trees, I only got every other tree. The  
> problem is that
> the parser matches whitespace after each semicolon and requires  
> whitespace
> before the subsequent tree (regex on lines 166-167). I've solved it by
> removing the terminal whitespace from the regex.
>
> Cheers,
>
> Heroen
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12


From MEC at stowers-institute.org  Mon Dec 12 10:45:06 2005
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Mon Dec 12 10:43:33 2005
Subject: [Bioperl-l] HOWTO: take a slice of a split location
Message-ID: <CED81D34E37D5043A1211565277A51E5045CEB75@exchkc02.stowers-institute.org>

Thanks Jason, 

If I simply wanted the 3'most 1Kbp of CDS I would have taken your
approach, but, I rather needed to focus my algorithm on this location,
which may be a split location, and then select the 'best' sublocation
(exon) which doesn't span a splice site, so I needed to preserve the
gaps.  

I'm guess I could have simply collected sequence starting at the 3'most
sublocation and stopped when I got my fill... I guess I found the
expressivity of taking an (appropriatly oriented) `slice` of the entire
CDS to compelling to avoid adding it to LocationI, which I hope to do
one I have my implementation performance detail worked out (film at 11).
Any objections to this pending addition?  I think it is in spirit, do
you?

Looking at Bio::Coordinate::GeneMapper, I don't see how this could
address this specifically.  Pointers welcomed!

Cheers,

Malcolm

-----Original Message-----
From: Jason Stajich [mailto:jason.stajich@duke.edu] 
Sent: Saturday, December 10, 2005 12:12 PM
To: Cook, Malcolm
Cc: bioperl-l; Seidel, Christopher
Subject: Re: [Bioperl-l] HOWTO: take a slice of a split location


Hi Malcom -
Don't have a chance to look at your code, but my approach to this  
problem would be to first splice the sequence out from the genome
  my $feature = Bio::SeqFeature::Generic->new(-location =>  
$splitlocation);
  my $cdsseq = $feature->spliced_seq;
then just retrieve the last 1000 bases of  this sequence.
  my $threeprime = $cdsseq->subseq($cdsseq->length - 1000, $cdsseq- 
 >length);
(this might be off-by-one?)

There is also a module to map between coordinates -  
Bio::Coordinate::GeneMapper if you need to go from transcript to  
genomic coordinates.

-jason
On Dec 10, 2005, at 2:06 AM, Cook, Malcolm wrote:

> Fellow Bioperlers,
>
> I was in need of extracting the 3'-most 1000 bp of from multiple  
> genomic CDS regions (designing 70mer u-array probes).
>
> I looked in vain for Bio::Location->splice($from,$to);
>
> So I wrote one which works but suffers from actually materializing  
> the list of interger indices into the sequence for every base.
>
> Has anyone a better approach they'd care to share?
>
> Malcolm Cook - mec@stowers-institute.org
> Stowers Institute for Medical Research - Kansas City, MO  USA
>
> P.S. Here' what I wrote:
>
> package Bio::LocationI;		# Code in the interface so it
works
>                                 # with both ::Split and ::Simple
>                                 # Bio::Locations
>
> sub _intspans {
>   # Purpose: for a (presumably) monotonically increasing list of
>   # integers, return list of arrays each holding min and max of
>   # the list's internal contiguous spans.
>   #
>   # Example: 1..5,10..20,30 => ([1,5],[10,20],[30,30])
>   my @i = @_;
>   die "nothing passed to intspans" unless @i;
>   my @s = ([$i[0],shift(@i)]);
>   foreach (@i) {
>     if ($_ == 1 + $s[0][1]) {
>       $s[0][1] = $_;
>     } else {
>       unshift @s, [$_, $_]
>     }}
>   reverse @s;
> }
>
> sub slice {
>   # Purpose: compute a slice of the Location, using perls normal slice
>   # semantics, expect that it trims out of range values.
>   my ($self, $from, $to) = @_;
>   my @int = eval (join ',', map {$_->start . '..' . $_->end} $self- 
> >each_Location); # build perl expression using the range (..) and  
> list (,) operators.
>   @int = @int[$from..$to];
>   @int = grep {$_} @int;	# Removing undefs (in case $from/$to out

> of bounds).
>   my @intspans = _intspans(@int);
>   new  Bio::Location::Split (-strand => $self->strand,
> 			     -locations => [map {new
Bio::Location::Simple(-start => $_-> 
> [0],
>
-end   => $_->[1],
>
-strand => $self->strand,
>
)
> 					       } @intspans],
> 			    );
> }
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12



From hlapp at gmx.net  Mon Dec 12 13:09:17 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Mon Dec 12 13:06:44 2005
Subject: [Bioperl-l] load sequence files into Mysql
In-Reply-To: <20051212012908.77276.qmail@web36811.mail.mud.yahoo.com>
References: <20051212012908.77276.qmail@web36811.mail.mud.yahoo.com>
Message-ID: <5e252a0be2ad0b3dbfdc3252b9a1b6f8@gmx.net>

Li, you might want to consider to subscribe to the Bulletin Board at 
bioinformatics.org. The genbank database is at 
ftp://ftp.ncbi.nih.gov/genbank. gbest*.seq.gz is the EST database.

It is not segregated by species, but it is easy to screen out by 
species using the --seqfilter option of load_seqdatabase.pl.

	-hilmar

On Dec 11, 2005, at 5:29 PM, chen li wrote:

> Hi Hilmar,
>
> Thanks for the replay.
>
> Do you mean the files in this link:
>
> ftp://ftp.ncbi.nih.gov/repository/dbEST/
>
> There are many files out in this folder. I am not sure
> which one belongs to mouse.
>
>
> Li
>
> --- Hilmar Lapp <hlapp@gmx.net> wrote:
>
>> Have you tried the GenBank EST database flat files
>> (in GenBank format)?
>>
>> On Dec 11, 2005, at 12:47 PM, chen li wrote:
>>
>>> Hi all,
>>>
>>> I already install Biosql on my computer and
>> everything
>>> works fine. Now I want to download some mouse EST
>>> database files which can be read into mysql
>> correctly
>>> without anymore modifications. Where can I
>> download
>>> these files or other sequence files?  And I know
>> it
>>> still has some problems to read the fasta files
>> from
>>> NCBI(as Hilmar already points out). The link
>> provided
>>> in the HOWTO is broken.
>>>
>>> Any suggestion will be appreciated and thanks in
>>> advance.
>>>
>>>
>>>
>>> Li
>>>
>>> __________________________________________________
>>> Do You Yahoo!?
>>> Tired of spam?  Yahoo! Mail has the best spam
>> protection around
>>> http://mail.yahoo.com
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l@portal.open-bio.org
>>>
>>
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>
>> -- 
>>
> -------------------------------------------------------------
>> Hilmar Lapp                            email: lapp
>> at gnf.org
>> GNF, San Diego, Ca. 92121              phone:
>> +1-858-812-1757
>>
> -------------------------------------------------------------
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l@portal.open-bio.org
>>
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>
> __________________________________________________
> Do You Yahoo!?
> Tired of spam?  Yahoo! Mail has the best spam protection around
> http://mail.yahoo.com
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From bmoore at genetics.utah.edu  Mon Dec 12 13:53:10 2005
From: bmoore at genetics.utah.edu (Barry Moore)
Date: Mon Dec 12 13:49:31 2005
Subject: FW: [Bioperl-l] loading data to biosql tables
Message-ID: <CFE1DF3BA20F424689DA0881A14055BECF2F1B@m.hg.genetics.utah.edu>

Angshu-
?
I support Hilmar's previous post about "Newbie's". ?This is the kind of question that you should be able to answer for yourself with a some effort on your part.
?
Barry
?
________________________________________
From: Angshu Kar [mailto:angshu96@gmail.com] 
Sent: Sunday, December 11, 2005 8:59 AM
To: Barry Moore
Subject: Re: [Bioperl-l] loading data to biosql tables
?
But Barry my problem is that despite installing bioperl and bioperl-db module I cannot find the BioDB.pm.
Did I install anything wrong?
?
Thanks,
Angshu

?
On 12/11/05, Barry Moore <bmoore@genetics.utah.edu> wrote: 
Angshu-
?
You can either add: 'use lib /path/to/your/Root.pm;' at the top of all of your perl scripts, or set PERL5LIB to the path of your Root.pm.? For example, I use the bash shell, and in my .bashrc file I have a line 'export PERL5LIB=/home/bmoore/perl/lib'. 
?
Barry
?
?
?
?
-----Original Message-----
From: Angshu Kar [mailto: angshu96@gmail.com] 
Sent: Friday, December 09, 2005 5:55 PM
To: Barry Moore
Cc: bioperl-l
Subject: Re: [Bioperl-l] loading data to biosql tables
?
One thing I missed was that my Root.pm resides in a different path...How to specify that?
On 12/9/05, Angshu Kar < angshu96@gmail.com> wrote:
Thanks a lot Barry.

Now I'm getting this error while tryin to run the load_seqdatabase.pl in a linux box (I used : 
perl load_seqdatabase.pl /akar/seq/ATH1_cds_cm_20040228)


Can't locate Bio/Root/Root.pm in @INC (@INC contains: /usr/lib/perl5/5.8.5/i386-linux-thread-multi /usr/lib/perl5/5.8.5 /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi /usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4 /usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2 /usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0 /usr/lib/perl5/site_perl /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi /usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4 /usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2 /usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0 /usr/lib/perl5/vendor_perl .) at load_seqdatabase.pl line 7. 
BEGIN failed--compilation aborted at load_seqdatabase.pl line 7.

Please guide.

Thanks,
Angshu
?
On 12/9/05, Barry Moore < bmoore@genetics.utah.edu> wrote:
Angshu-

Make the namespace whatever you want it to be.??This is useful if you 
want to load sequence from different sources into the same database.??As 
for the format - you tell us what format is the file in???You could just
let bioperl guess, but looking at the file and deciding yourself would 
be your best bet.

Barry

> -----Original Message----- 
> From: bioperl-l-bounces@portal.open-bio.org [mailto: bioperl-l-
> bounces@portal.open-bio.org] On Behalf Of Angshu Kar
> Sent: Friday, December 09, 2005 5:22 PM 
> To: Sean Davis
> Cc: bioperl-l
> Subject: Re: [Bioperl-l] loading data to biosql tables
>
> Hi Sean,
>
> A small help I need before I run the load_seqdatabase.pl. I've
downloaded 
> my
> datafile which is ATH1_cds_cm_20040228 from TAIR. What's the namespace 
and
> format for this?
>
> Thanks,
> Angshu
>
> _______________________________________________ 
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l 
?
?
?

From chen_li3 at yahoo.com  Mon Dec 12 15:55:42 2005
From: chen_li3 at yahoo.com (chen li)
Date: Mon Dec 12 15:59:46 2005
Subject: [Bioperl-l] load sequence files into Mysql
In-Reply-To: <5e252a0be2ad0b3dbfdc3252b9a1b6f8@gmx.net>
Message-ID: <20051212205542.72957.qmail@web36812.mail.mud.yahoo.com>

Thanks all for the informatiom.

Li

--- Hilmar Lapp <hlapp@gmx.net> wrote:

> Li, you might want to consider to subscribe to the
> Bulletin Board at 
> bioinformatics.org. The genbank database is at 
> ftp://ftp.ncbi.nih.gov/genbank. gbest*.seq.gz is the
> EST database.
> 
> It is not segregated by species, but it is easy to
> screen out by 
> species using the --seqfilter option of
> load_seqdatabase.pl.
> 
> 	-hilmar
> 
> On Dec 11, 2005, at 5:29 PM, chen li wrote:
> 
> > Hi Hilmar,
> >
> > Thanks for the replay.
> >
> > Do you mean the files in this link:
> >
> > ftp://ftp.ncbi.nih.gov/repository/dbEST/
> >
> > There are many files out in this folder. I am not
> sure
> > which one belongs to mouse.
> >
> >
> > Li
> >
> > --- Hilmar Lapp <hlapp@gmx.net> wrote:
> >
> >> Have you tried the GenBank EST database flat
> files
> >> (in GenBank format)?
> >>
> >> On Dec 11, 2005, at 12:47 PM, chen li wrote:
> >>
> >>> Hi all,
> >>>
> >>> I already install Biosql on my computer and
> >> everything
> >>> works fine. Now I want to download some mouse
> EST
> >>> database files which can be read into mysql
> >> correctly
> >>> without anymore modifications. Where can I
> >> download
> >>> these files or other sequence files?  And I know
> >> it
> >>> still has some problems to read the fasta files
> >> from
> >>> NCBI(as Hilmar already points out). The link
> >> provided
> >>> in the HOWTO is broken.
> >>>
> >>> Any suggestion will be appreciated and thanks in
> >>> advance.
> >>>
> >>>
> >>>
> >>> Li
> >>>
> >>>
> __________________________________________________
> >>> Do You Yahoo!?
> >>> Tired of spam?  Yahoo! Mail has the best spam
> >> protection around
> >>> http://mail.yahoo.com
> >>> _______________________________________________
> >>> Bioperl-l mailing list
> >>> Bioperl-l@portal.open-bio.org
> >>>
> >>
> >
>
http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >>>
> >>>
> >> -- 
> >>
> >
>
-------------------------------------------------------------
> >> Hilmar Lapp                            email:
> lapp
> >> at gnf.org
> >> GNF, San Diego, Ca. 92121              phone:
> >> +1-858-812-1757
> >>
> >
>
-------------------------------------------------------------
> >>
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l@portal.open-bio.org
> >>
> >
>
http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >>
> >
> >
> > __________________________________________________
> > Do You Yahoo!?
> > Tired of spam?  Yahoo! Mail has the best spam
> protection around
> > http://mail.yahoo.com
> >
> >
> -- 
>
-------------------------------------------------------------
> Hilmar Lapp                            email: lapp
> at gnf.org
> GNF, San Diego, Ca. 92121              phone:
> +1-858-812-1757
>
-------------------------------------------------------------
> 
> 
> 


__________________________________________________
Do You Yahoo!?
Tired of spam?  Yahoo! Mail has the best spam protection around 
http://mail.yahoo.com 
From angshu96 at gmail.com  Mon Dec 12 20:57:07 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Mon Dec 12 20:54:28 2005
Subject: [Bioperl-l] urgent:load_seqdatabase.pl doesn't seem to like fasta...
Message-ID: <df8328740512121757n2fdb535et18fb46bd19031e09@mail.gmail.com>

Hi,

This is the format that I've :

>At1g01010.1 68414.m00001 no apical meristem (NAM) family protein contains
Pfam PF02365: No apical meristem (NAM) domain; sim
ilar to NAC domain protein NAM GB: AAD17313 GI:4325282 from [Arabidopsis
thaliana]

And with regard to the following discussion:

http://bioperl.org/pipermail/bioperl-l/2004-June/016198.html

Could anyone please let me know whether any fixes have been done for this?

Appreciate your guidance.

Thanks,
Angshu

From torsten.seemann at infotech.monash.edu.au  Mon Dec 12 18:27:10 2005
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Mon Dec 12 21:59:04 2005
Subject: [Bioperl-l] throw, not die
In-Reply-To: <BFBF54F6.668C%osborne1@optonline.net>
References: <BFBF54F6.668C%osborne1@optonline.net>
Message-ID: <1134430030.22447.8.camel@chauvel.csse.monash.edu.au>

On Fri, 2005-12-09 at 15:36 -0500, Brian Osborne wrote:
> Heikki,
> Torsten's idea!
> Brian O.

I only did one change - I just assumed it was an isolated situation as
the module I changed it in was not written by a core developer. 

It's nice to know people read the CVS commit comments :-)

> > I picked up the idea from your recent commits, did a search for 'die' commands
> > in bioperl cvs head and fixed quite a few. I did not touch the Bio::Graphics
> > name space as those do not inherit from Bio::Root::Root. 
> > I hope I was not overly zealous. At least all tests pass.

-- 
Torsten Seemann <torsten.seemann@infotech.monash.edu.au>
Victorian Bioinformatics Consortium

From Marc.Logghe at DEVGEN.com  Tue Dec 13 03:09:54 2005
From: Marc.Logghe at DEVGEN.com (Marc Logghe)
Date: Tue Dec 13 03:19:20 2005
Subject: [Bioperl-l] urgent:load_seqdatabase.pl doesn't seem to like
	fasta...
Message-ID: <0C528E3670D8CE4B8E013F6749231AA62F57BB@ANTARESIA.be.devgen.com>

Hi,

> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org 
> [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Angshu Kar
> Sent: Tuesday, December 13, 2005 2:57 AM
> To: bioperl-l
> Subject: [Bioperl-l] urgent:load_seqdatabase.pl doesn't seem 
> to like fasta...
> 
> Hi,
> 
> This is the format that I've :
> 
> >At1g01010.1 68414.m00001 no apical meristem (NAM) family protein 
> >contains
> Pfam PF02365: No apical meristem (NAM) domain; sim ilar to 
> NAC domain protein NAM GB: AAD17313 GI:4325282 from 
> [Arabidopsis thaliana]
> 
> And with regard to the following discussion:
> 
> http://bioperl.org/pipermail/bioperl-l/2004-June/016198.html
> 
> Could anyone please let me know whether any fixes have been 
> done for this?

Did you transfer the display_id to the accession_number slot ? See
recent discussions at
http://portal.open-bio.org/pipermail/bioperl-l/2005-August/019579.html
and links inside.
HTH,
Marc

From hlapp at gmx.net  Tue Dec 13 03:44:15 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Tue Dec 13 03:41:46 2005
Subject: [Bioperl-l] urgent:load_seqdatabase.pl doesn't seem to like
	fasta...
In-Reply-To: <df8328740512121757n2fdb535et18fb46bd19031e09@mail.gmail.com>
References: <df8328740512121757n2fdb535et18fb46bd19031e09@mail.gmail.com>
Message-ID: <537085143f1159255c1daf6612df1e41@gmx.net>

There is nothing to be fixed; the problem is inherent with FASTA  
formatted files. See here for a response I posted in August:

http://bioperl.org/pipermail/bioperl-l/2005-August/019579.html

Also see the FAQ:

http://bioperl.open-bio.org/wiki/ 
FAQ#Accession_numbers_are_not_present_for_FASTA_sequence_format_files



	-hilmar

On Dec 12, 2005, at 5:57 PM, Angshu Kar wrote:

> Hi,
>
> This is the format that I've :
>
>> At1g01010.1 68414.m00001 no apical meristem (NAM) family protein  
>> contains
> Pfam PF02365: No apical meristem (NAM) domain; sim
> ilar to NAC domain protein NAM GB: AAD17313 GI:4325282 from  
> [Arabidopsis
> thaliana]
>
> And with regard to the following discussion:
>
> http://bioperl.org/pipermail/bioperl-l/2004-June/016198.html
>
> Could anyone please let me know whether any fixes have been done for  
> this?
>
> Appreciate your guidance.
>
> Thanks,
> Angshu
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From hlapp at gmx.net  Tue Dec 13 03:46:29 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Tue Dec 13 03:43:54 2005
Subject: [Bioperl-l] urgent:load_seqdatabase.pl doesn't seem to like
	fasta...
In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA62F57BB@ANTARESIA.be.devgen.com>
References: <0C528E3670D8CE4B8E013F6749231AA62F57BB@ANTARESIA.be.devgen.com>
Message-ID: <4a32aacd6ed0d57260e2676d478579ae@gmx.net>

Sure enough I should have checked whether you haven't responded already 
:-)

On Dec 13, 2005, at 12:09 AM, Marc Logghe wrote:

> Hi,
>
>> -----Original Message-----
>> From: bioperl-l-bounces@portal.open-bio.org
>> [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Angshu Kar
>> Sent: Tuesday, December 13, 2005 2:57 AM
>> To: bioperl-l
>> Subject: [Bioperl-l] urgent:load_seqdatabase.pl doesn't seem
>> to like fasta...
>>
>> Hi,
>>
>> This is the format that I've :
>>
>>> At1g01010.1 68414.m00001 no apical meristem (NAM) family protein
>>> contains
>> Pfam PF02365: No apical meristem (NAM) domain; sim ilar to
>> NAC domain protein NAM GB: AAD17313 GI:4325282 from
>> [Arabidopsis thaliana]
>>
>> And with regard to the following discussion:
>>
>> http://bioperl.org/pipermail/bioperl-l/2004-June/016198.html
>>
>> Could anyone please let me know whether any fixes have been
>> done for this?
>
> Did you transfer the display_id to the accession_number slot ? See
> recent discussions at
> http://portal.open-bio.org/pipermail/bioperl-l/2005-August/019579.html
> and links inside.
> HTH,
> Marc
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From torsten.seemann at infotech.monash.edu.au  Tue Dec 13 02:42:41 2005
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Tue Dec 13 04:38:29 2005
Subject: [Bioperl-l] MailList.html versus MailList.shtml
Message-ID: <1134459761.25884.4.camel@chauvel.csse.monash.edu.au>


I've noticed that a lot of the footers in the BioPerl POD documentation
refer to

	http://bio.perl.org/MailList.html

which does not exist. The working link is:

	http://bio.perl.org/MailList.shtml

Is it possible for a symlink to be made to correct this?

(or will Apache not do the SSI on the .html ?)

-- 
Torsten Seemann <torsten.seemann@infotech.monash.edu.au>
Victorian Bioinformatics Consortium

From akholloway at ucdavis.edu  Mon Dec 12 13:07:45 2005
From: akholloway at ucdavis.edu (Alisha Holloway)
Date: Tue Dec 13 11:44:54 2005
Subject: [Bioperl-l] baseml
Message-ID: <a06230939bfc36b492e0f@[10.0.1.3]>

An HTML attachment was scrubbed...
URL: http://portal.open-bio.org/pipermail/bioperl-l/attachments/20051212/457367e3/attachment.htm
From muratem at eng.uah.edu  Tue Dec 13 11:32:32 2005
From: muratem at eng.uah.edu (Mike Muratet)
Date: Tue Dec 13 11:45:05 2005
Subject: [Bioperl-l] Memory leak in Bio::Root::Root?
Message-ID: <Pine.GSO.4.60.0512131007220.11597@zeus>

Greetings all

I have a problem that surpasses what I know and what I've been able to 
glean from perltoot,perboot,etc. Maybe it's a question for a perl list, 
but here goes...

I was given a package that calculates some statistics regarding base 
repeats in a sequence. It inherits from Bio::Root::Root presumbably to 
obtain the exception behavior bestowed by the class judging from the 
perldocs and to enforce that the argument is a PrimarySeq object. It has
two methods which get called thus:

my $polyn = QStat->polyn($seq_obj);
my $nstat = QStat->nmer_stat($seq_obj);

where the returned values are scalar references. The problem is that 
script quickly uses up all of the 4GB address space (processing lots of 
oligos) and crashes.

I have used Devel::Size to determine the size of these variables and 
get 3.8K and 7K. I have tried to undef them at the end of the loop but it 
has no effect. I commented out the calls and the problem goes away so the 
problem is associated with the QStat object.

The QStat class has a constructor that calls the base constructor:
     my $self = $class->SUPER::new(@args);
would this demand a destructor somewhere?

Does calling a method out of a class like this invoke all the class 
machinery without creating the object with new?

Can someone with experience deriving from Bio::Root::Root offer some 
suggestions on how to get the memory back?

Thanks

Mike
From joecker at freenet.de  Mon Dec 12 10:26:35 2005
From: joecker at freenet.de (joecker@freenet.de)
Date: Tue Dec 13 11:45:44 2005
Subject: [Bioperl-l] translating Sequence in 6 open reading frames
Message-ID: <200512121626.35118.joecker@freenet.de>

Hello,
I try to use BioPerl for the translation of a sequence in 6 reading frames. 
The Sequence is stored in a variable. 
First I create a new Seq object with: 
my $seqobj = Bio::Seq->new ( -seq => $seq,
					   -alphabet  => 'DNA',
					 );
afterwards I use the package Bio::SeqUtils for translating:

 my $util = new Bio::SeqUtils
my $polypeptide_3char = Bio::SeqUtils->seq3($seqobj);
Bio::SeqUtils->seq3($seqobj, $polypeptide_3char);
my @seqs = Bio::SeqUtils->translate_6frames($seqobj);

Unfortunately I was not able to create the object. The program stops, but 
there is no error.
I hope someone can help me.

Thanks a lot for your help,
Anika
From sanges at biogem.it  Tue Dec 13 12:24:11 2005
From: sanges at biogem.it (Remo Sanges)
Date: Tue Dec 13 12:27:25 2005
Subject: [Bioperl-l] translating Sequence in 6 open reading frames
In-Reply-To: <200512121626.35118.joecker@freenet.de>
References: <200512121626.35118.joecker@freenet.de>
Message-ID: <439F03BB.6030102@biogem.it>

joecker@freenet.de wrote:

>Hello,
>I try to use BioPerl for the translation of a sequence in 6 reading frames. 
>The Sequence is stored in a variable. 
>First I create a new Seq object with: 
>my $seqobj = Bio::Seq->new ( -seq => $seq,
>					   -alphabet  => 'DNA',
>					 );
>afterwards I use the package Bio::SeqUtils for translating:
>
> my $util = new Bio::SeqUtils
>my $polypeptide_3char = Bio::SeqUtils->seq3($seqobj);
>Bio::SeqUtils->seq3($seqobj, $polypeptide_3char);
>my @seqs = Bio::SeqUtils->translate_6frames($seqobj);
>
>Unfortunately I was not able to create the object. The program stops, but 
>there is no error.
>I hope someone can help me.
>
>Thanks a lot for your help,
>Anika
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>  
>
Anika,

it is strange that you don't get error:
the seq3 method need to work on a protein
sequence in order to return the the amino
acid sequence as a string of three letter
code from single letter code amino acids.

If I try to run your script I get the exception:

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Not a protein sequence
STACK: Error::throw
STACK: Bio::Root::Root::throw 
/Users/remo/src/bioperl-1.4/Bio/Root/Root.pm:328
STACK: Bio::SeqUtils::seq3 /Users/remo/src/bioperl-1.4/Bio/SeqUtils.pm:159
STACK: pep.pl:16
-----------------------------------------------------------

By the way if you only use translate_6frames
you will get the translations.

Please try to read and well understand the documentation
before cut and paste code from it!

#!/usr/bin/perl
use strict;
use warnings;
use Data::Dumper;
use Bio::Seq;
use Bio::SeqUtils;

my $seq = 'ATGAGAGCTTAGGCGCTAGCGAGCTAGCTAGCTAGCTCTCTCTGAGGCCGACGTCGTAGCAG';

my $seqobj = Bio::Seq->new (-seq => $seq,
                            -alphabet  => 'DNA');

my $utils = new Bio::SeqUtils;

my @seqs = $utils->translate_6frames($seqobj);

print Dumper \@seqs;


HTH

Remo
From madhusudan at gmail.com  Tue Dec 13 12:40:41 2005
From: madhusudan at gmail.com (Madhusudan Natarajan)
Date: Tue Dec 13 13:42:15 2005
Subject: [Bioperl-l] Windows Installation help
Message-ID: <9407cd230512130940o52679f5cu4eed1557256cd0f@mail.gmail.com>

Hi,
  I'm relatively new to the Perl world. I'm trying to install BioPerl on my
windows machine (DOS, not Cygwin) in an attempt to make it work with MATLAB.
I tried using the ppm installer and find one of two problems

1. Using the syntax from the install.WIN file I tried
rep add bioperl http:/bioperl.org/DIST         and then
search bioperl.

This search always yields nothing. I get a "No matches for bioperl; see
'help search'"

After playing with this for a bit and trying all sorts of things I managed
to use

2. rep add ftp://ftp.bioperl.org/pub/DIST     and then
search bioperl                 yields a few packages. However
install [N] fails to install and yields
a 404 with "Failed to download .../File-Temp.ppd"

Why would the first fail and only the second recognize a few ppd archives as
available? I tried looking at list archives and saw identical messages by
Julian Dow almost two years ago -- but seem to find only recommendations for
using Cygwin and no real fixes. Since this isn't really an option for me
(since I want to use it with MATLAB) I'm stuck trying to get this to work.
Is there something I'm missing? Pointers to information would be most
appreciated. If not, if someone has any info on how to get MATLAB's attached
version of perl to recognize a nmake install of bioperl, that would also
save my bacon.

Many thanks.

From osborne1 at optonline.net  Tue Dec 13 14:01:03 2005
From: osborne1 at optonline.net (Brian Osborne)
Date: Tue Dec 13 14:04:23 2005
Subject: [Bioperl-l] translating Sequence in 6 open reading frames
In-Reply-To: <200512121626.35118.joecker@freenet.de>
Message-ID: <BFC4849F.671C%osborne1@optonline.net>

Anika,

In order to get all 6 frames simplify your code, something like:

 my $seqobj = Bio::Seq->new ( -seq => $seq,
   -alphabet  => 'DNA');
 my @seqs = Bio::SeqUtils->translate_6frames($seqobj);


Brian O.


On 12/12/05 10:26 AM, "joecker@freenet.de" <joecker@freenet.de> wrote:

> Hello,
> I try to use BioPerl for the translation of a sequence in 6 reading frames.
> The Sequence is stored in a variable.
> First I create a new Seq object with:
> my $seqobj = Bio::Seq->new ( -seq => $seq,
>   -alphabet  => 'DNA',
> );
> afterwards I use the package Bio::SeqUtils for translating:
> 
>  my $util = new Bio::SeqUtils
> my $polypeptide_3char = Bio::SeqUtils->seq3($seqobj);
> Bio::SeqUtils->seq3($seqobj, $polypeptide_3char);
> my @seqs = Bio::SeqUtils->translate_6frames($seqobj);
> 
> Unfortunately I was not able to create the object. The program stops, but
> there is no error.
> I hope someone can help me.
> 
> Thanks a lot for your help,
> Anika
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From bmoore at genetics.utah.edu  Tue Dec 13 16:25:54 2005
From: bmoore at genetics.utah.edu (Barry Moore)
Date: Tue Dec 13 16:22:10 2005
Subject: [Bioperl-l] Windows Installation help
Message-ID: <CFE1DF3BA20F424689DA0881A14055BECF2F1F@m.hg.genetics.utah.edu>

Madhusudan-

What version and installation of perl? What version of Window?
Regardless of the above two questions if you have a perl recent enough
to pass perl's requirements (currently 5.005 - but note the caveat in
INSTALL) you should be able to build it with nmake.  I don't know
anything about MATLAB's attached version of perl - what is it?  Why
wouldn't it use an nmake installation of bioperl if you install it into
a path found in your @INC or you 'use lib ...' in your script etc.

Barry

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Madhusudan
Natarajan
Sent: Tuesday, December 13, 2005 10:41 AM
To: bioperl-l@portal.open-bio.org
Subject: [Bioperl-l] Windows Installation help

Hi,
  I'm relatively new to the Perl world. I'm trying to install BioPerl on
my
windows machine (DOS, not Cygwin) in an attempt to make it work with
MATLAB.
I tried using the ppm installer and find one of two problems

1. Using the syntax from the install.WIN file I tried
rep add bioperl http:/bioperl.org/DIST         and then
search bioperl.

This search always yields nothing. I get a "No matches for bioperl; see
'help search'"

After playing with this for a bit and trying all sorts of things I
managed
to use

2. rep add ftp://ftp.bioperl.org/pub/DIST     and then
search bioperl                 yields a few packages. However
install [N] fails to install and yields
a 404 with "Failed to download .../File-Temp.ppd"

Why would the first fail and only the second recognize a few ppd
archives as
available? I tried looking at list archives and saw identical messages
by
Julian Dow almost two years ago -- but seem to find only recommendations
for
using Cygwin and no real fixes. Since this isn't really an option for me
(since I want to use it with MATLAB) I'm stuck trying to get this to
work.
Is there something I'm missing? Pointers to information would be most
appreciated. If not, if someone has any info on how to get MATLAB's
attached
version of perl to recognize a nmake install of bioperl, that would also
save my bacon.

Many thanks.

_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l

From shpanah at yahoo.com  Tue Dec 13 21:43:55 2005
From: shpanah at yahoo.com (shahin panah)
Date: Tue Dec 13 21:47:55 2005
Subject: [Bioperl-l] mail
Message-ID: <20051214024355.18283.qmail@web50312.mail.yahoo.com>


Please remove my name from your mailing list.
my e-mail is shpanah@yahoo.com

__________________________________________________
Do You Yahoo!?
Tired of spam?  Yahoo! Mail has the best spam protection around 
http://mail.yahoo.com 
From bmoore at genetics.utah.edu  Wed Dec 14 00:06:07 2005
From: bmoore at genetics.utah.edu (Barry Moore)
Date: Wed Dec 14 00:02:31 2005
Subject: [Bioperl-l] LocalBlast.pm running under Apache
Message-ID: <CFE1DF3BA20F424689DA0881A14055BECF2F23@m.hg.genetics.utah.edu>

I'm working on an application to implement a local blast server with a
web interface.  In this case wwwblast from NCBI won't do because I need
more control over the output, so I'm using Bio::Tool::Run::LocalBlast
and Bio::SearchIO::Writer::HTMLResultWriter to run the blast and
generate the HTML report, and a CGI script to parse the initial form and
post the results.  I mocked up the script first without CGI, and it
works perfectly.  I drop that into a CGI script, and I get no results.
I do get output so I know that the blast executable is running.  I can
dump the Seq object, and the LocalBlast object to the browser and see
that the sequence is there, and that the parameters passed to blastall
are correct.  I know that the database path is correct, because in the
output I see:

 

Database: /usr/local/share/blast-2.2.12/data/trans_recode_orfs 

           1,544,970 sequences; 188,483,908 total letters

 

which is correct.

 

The output is well formed, it just says "***** No hits found ******".
The exact same search with the same sequence runs fine in a non-CGI
script, and finds many hits, but within the CGI script it finds no hits.
The CGI script is actually built within the framework of a larger
CGI::Application system, so I can't claim that the script running under
CGI is identical to my non-CGI version, but the subroutine that does the
work under CGI::Application is essentially identical to it's non-CGI
counterpart.  I'm left to conclude that the only real difference is that
one runs as bmoore, and the other as apache.  I tried to su to apache so
I could run the non-CGI version as apache, but even as root and with
httpd stopped I get 'This account is currently not available'. I can't
imagine why blastall would care who's running the script as long as the
database, matrix files, and input is available.  I'm running out of
ideas on debugging this one.  Any thoughts?

 

Barry

 

Barry Moore

Department of Human Genetics

University of Utah

Salt Lake City, UT 84112

 

 


From bmoore at genetics.utah.edu  Wed Dec 14 00:29:43 2005
From: bmoore at genetics.utah.edu (Barry Moore)
Date: Wed Dec 14 00:25:58 2005
Subject: [Bioperl-l] LocalBlast.pm running under Apache
Message-ID: <CFE1DF3BA20F424689DA0881A14055BECF2F25@m.hg.genetics.utah.edu>

Ignore this question.  There's some problem with access to BLOSUM62 even
though the permissions look fine and BLASTMAT is set correctly for
apache.  It's late so I'll worry about it tomorrow, but it's not a
bioperl problem.

Barry

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Barry Moore
Sent: Tuesday, December 13, 2005 10:06 PM
To: bioperl-l
Subject: [Bioperl-l] LocalBlast.pm running under Apache

I'm working on an application to implement a local blast server with a
web interface.  In this case wwwblast from NCBI won't do because I need
more control over the output, so I'm using Bio::Tool::Run::LocalBlast
and Bio::SearchIO::Writer::HTMLResultWriter to run the blast and
generate the HTML report, and a CGI script to parse the initial form and
post the results.  I mocked up the script first without CGI, and it
works perfectly.  I drop that into a CGI script, and I get no results.
I do get output so I know that the blast executable is running.  I can
dump the Seq object, and the LocalBlast object to the browser and see
that the sequence is there, and that the parameters passed to blastall
are correct.  I know that the database path is correct, because in the
output I see:

 

Database: /usr/local/share/blast-2.2.12/data/trans_recode_orfs 

           1,544,970 sequences; 188,483,908 total letters

 

which is correct.

 

The output is well formed, it just says "***** No hits found ******".
The exact same search with the same sequence runs fine in a non-CGI
script, and finds many hits, but within the CGI script it finds no hits.
The CGI script is actually built within the framework of a larger
CGI::Application system, so I can't claim that the script running under
CGI is identical to my non-CGI version, but the subroutine that does the
work under CGI::Application is essentially identical to it's non-CGI
counterpart.  I'm left to conclude that the only real difference is that
one runs as bmoore, and the other as apache.  I tried to su to apache so
I could run the non-CGI version as apache, but even as root and with
httpd stopped I get 'This account is currently not available'. I can't
imagine why blastall would care who's running the script as long as the
database, matrix files, and input is available.  I'm running out of
ideas on debugging this one.  Any thoughts?

 

Barry

 

Barry Moore

Department of Human Genetics

University of Utah

Salt Lake City, UT 84112

 

 


_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l

From jason.stajich at duke.edu  Tue Dec 13 23:19:37 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Wed Dec 14 00:42:06 2005
Subject: [Bioperl-l] Memory leak in Bio::Root::Root?
In-Reply-To: <Pine.GSO.4.60.0512131007220.11597@zeus>
References: <Pine.GSO.4.60.0512131007220.11597@zeus>
Message-ID: <3221492C-8A26-42C8-ADF7-30FF98D45638@duke.edu>


polyn returns a scalar object (blessed) or just some scalar data?
If you are really calling QStat->polyn( $obj) then 'new' is never  
called in the first place for the Qstat package.

Destructors are automatic, but you can create your own to see when/if  
the destructor is called.
sub DESTROY {
  my $self =shift;
  warn("I am calling destroy in the Qstat object\n");
  $self->SUPER::DESTROY;
}
You can also inherit from Bio::Root::RootI and call bless on your own  
if you want to play with whether this is Bio::Root::Root induced  
behavior.  I'm not sure I understand enough of how it works to tell  
you where else to look.

Is a new $seq_obj getting created every iteration of the loop?  Are  
these getting cleaned up or is Qstat keeping references  to them, and  
they are sticking around?  Devel::Cycle doesn't show any memory cycles?

On Dec 13, 2005, at 11:32 AM, Mike Muratet wrote:

> Greetings all
>
> I have a problem that surpasses what I know and what I've been able  
> to glean from perltoot,perboot,etc. Maybe it's a question for a  
> perl list, but here goes...
>
> I was given a package that calculates some statistics regarding  
> base repeats in a sequence. It inherits from Bio::Root::Root  
> presumbably to obtain the exception behavior bestowed by the class  
> judging from the perldocs and to enforce that the argument is a  
> PrimarySeq object. It has
> two methods which get called thus:
>
> my $polyn = QStat->polyn($seq_obj);
> my $nstat = QStat->nmer_stat($seq_obj);
>
> where the returned values are scalar references. The problem is  
> that script quickly uses up all of the 4GB address space  
> (processing lots of oligos) and crashes.
>
> I have used Devel::Size to determine the size of these variables  
> and get 3.8K and 7K. I have tried to undef them at the end of the  
> loop but it has no effect. I commented out the calls and the  
> problem goes away so the problem is associated with the QStat object.
>
> The QStat class has a constructor that calls the base constructor:
>     my $self = $class->SUPER::new(@args);
> would this demand a destructor somewhere?
>
> Does calling a method out of a class like this invoke all the class  
> machinery without creating the object with new?
>
> Can someone with experience deriving from Bio::Root::Root offer  
> some suggestions on how to get the memory back?
>
> Thanks
>
> Mike
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12


From indapa at gmail.com  Wed Dec 14 11:13:31 2005
From: indapa at gmail.com (Amit Indap)
Date: Wed Dec 14 11:36:53 2005
Subject: [Bioperl-l] extracting CDS portion of RefSeqs
Message-ID: <3cfaa4040512140813w472b1d47k9685bd55d3cb0f7b@mail.gmail.com>

Hi,

I want to extract the CDS portion of human refseqs. I downloaded the
genbank flat file of the most recent Refseq release. I was going to
parse the Genbank file and write out the CDS porition of the sequence
like so:

my $seqio = Bio::SeqIO->new(-file => $ARGV[0],
		      -format => 'GenBank');


foreach my $feat ( $seq->get_SeqFeatures() ) {
             if( $feat->primary_tag eq 'CDS' ) {
		 my $start = $feat->start;
		 my $end = $feat->end;
	 my $seqstr   = $seq->subseq($start,$end); #
		 my $displayid = $seq->display_name;
		 #my $seqobj = Bio::Seq->new( -display_id => "$displayid:$start..$end",
		#			     -seq => $seqstr);
		# my $out = Bio::SeqIO->new(-format => 'Fasta');
		# $out->write_seq($seqobj);
		
		
#                 print STDOUT "Location ",$feat->start,":",
#                    $feat->end," GFF[",$feat->gff_string,"]\n";
             }
         }
--
Amit Indap
http://www.bscb.cornell.edu/Homepages/Amit_Indap/

From bmoore at genetics.utah.edu  Wed Dec 14 12:14:50 2005
From: bmoore at genetics.utah.edu (Barry Moore)
Date: Wed Dec 14 12:11:03 2005
Subject: [Bioperl-l] extracting CDS portion of RefSeqs
Message-ID: <CFE1DF3BA20F424689DA0881A14055BECF2F27@m.hg.genetics.utah.edu>

Amit,

Don't do the substr and instantiate a new seqobj yourself, let bioperl
do it.

my $seqstr = $feat->seq;

Barry

> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-
> bounces@portal.open-bio.org] On Behalf Of Amit Indap
> Sent: Wednesday, December 14, 2005 9:14 AM
> To: bioperl-l@portal.open-bio.org
> Subject: [Bioperl-l] extracting CDS portion of RefSeqs
> 
> Hi,
> 
> I want to extract the CDS portion of human refseqs. I downloaded the
> genbank flat file of the most recent Refseq release. I was going to
> parse the Genbank file and write out the CDS porition of the sequence
> like so:
> 
> my $seqio = Bio::SeqIO->new(-file => $ARGV[0],
> 		      -format => 'GenBank');
> 
> 
> foreach my $feat ( $seq->get_SeqFeatures() ) {
>              if( $feat->primary_tag eq 'CDS' ) {
> 		 my $start = $feat->start;
> 		 my $end = $feat->end;
> 	 my $seqstr   = $seq->subseq($start,$end); #
> 		 my $displayid = $seq->display_name;
> 		 #my $seqobj = Bio::Seq->new( -display_id =>
> "$displayid:$start..$end",
> 		#			     -seq => $seqstr);
> 		# my $out = Bio::SeqIO->new(-format => 'Fasta');
> 		# $out->write_seq($seqobj);
> 
> 
> #                 print STDOUT "Location ",$feat->start,":",
> #                    $feat->end," GFF[",$feat->gff_string,"]\n";
>              }
>          }
> --
> Amit Indap
> http://www.bscb.cornell.edu/Homepages/Amit_Indap/
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

From muratem at eng.uah.edu  Wed Dec 14 12:15:17 2005
From: muratem at eng.uah.edu (Mike Muratet)
Date: Wed Dec 14 12:12:46 2005
Subject: [Bioperl-l] Memory leak in Bio::Root::Root?
In-Reply-To: <3221492C-8A26-42C8-ADF7-30FF98D45638@duke.edu>
References: <Pine.GSO.4.60.0512131007220.11597@zeus>
	<3221492C-8A26-42C8-ADF7-30FF98D45638@duke.edu>
Message-ID: <Pine.GSO.4.60.0512141102290.24764@zeus>



Jason

>
> polyn returns a scalar object (blessed) or just some scalar data?
> If you are really calling QStat->polyn( $obj) then 'new' is never called in 
> the first place for the Qstat package.
>

polyn returns a reference to some scalar data. My understanding is that 
'new' would not be called, but then I'm at a loss to explain where all the 
extra memory goes.

> Destructors are automatic, but you can create your own to see when/if the 
> destructor is called.
> sub DESTROY {
> my $self =shift;
> warn("I am calling destroy in the Qstat object\n");
> $self->SUPER::DESTROY;
> }

I will try this.

> You can also inherit from Bio::Root::RootI and call bless on your own if you 
> want to play with whether this is Bio::Root::Root induced behavior.  I'm not 
> sure I understand enough of how it works to tell you where else to look.
>

I will try this, too.

> Is a new $seq_obj getting created every iteration of the loop?  Are these 
> getting cleaned up or is Qstat keeping references  to them, and they are 
> sticking around?  Devel::Cycle doesn't show any memory cycles?
>

A new $seq_obj gets created in every loop of the method that calls QStats 
with the $seq_obj as an argument, but I undef it at the bottom of the 
loop. Should this not be enough to get perl to recycle the memory? I 
haven't tried Devel::Cycle but I will include it to see what it says.

I saw on some of the perl lists a reference to a memory leak in perl 5.8 
with the s/// operator. Have you heard about such a problem?

Thanks for the help

Mike

> On Dec 13, 2005, at 11:32 AM, Mike Muratet wrote:
>
>> Greetings all
>> 
>> I have a problem that surpasses what I know and what I've been able to 
>> glean from perltoot,perboot,etc. Maybe it's a question for a perl list, 
>> but here goes...
>> 
>> I was given a package that calculates some statistics regarding base 
>> repeats in a sequence. It inherits from Bio::Root::Root presumbably to 
>> obtain the exception behavior bestowed by the class judging from the 
>> perldocs and to enforce that the argument is a PrimarySeq object. It has
>> two methods which get called thus:
>> 
>> my $polyn = QStat->polyn($seq_obj);
>> my $nstat = QStat->nmer_stat($seq_obj);
>> 
>> where the returned values are scalar references. The problem is that 
>> script quickly uses up all of the 4GB address space (processing lots of 
>> oligos) and crashes.
>> 
>> I have used Devel::Size to determine the size of these variables and get 
>> 3.8K and 7K. I have tried to undef them at the end of the loop but it has 
>> no effect. I commented out the calls and the problem goes away so the 
>> problem is associated with the QStat object.
>> 
>> The QStat class has a constructor that calls the base constructor:
>>     my $self = $class->SUPER::new(@args);
>> would this demand a destructor somewhere?
>> 
>> Does calling a method out of a class like this invoke all the class 
>> machinery without creating the object with new?
>> 
>> Can someone with experience deriving from Bio::Root::Root offer some 
>> suggestions on how to get the memory back?
>> 
>> Thanks
>> 
>> Mike
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l@portal.open-bio.org
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
> --
> Jason Stajich
> Duke University
> http://www.duke.edu/~jes12
>
>
>
From bmoore at genetics.utah.edu  Wed Dec 14 12:37:28 2005
From: bmoore at genetics.utah.edu (Barry Moore)
Date: Wed Dec 14 12:33:48 2005
Subject: FW: [Bioperl-l] LocalBlast.pm running under Apache
Message-ID: <CFE1DF3BA20F424689DA0881A14055BECF2F28@m.hg.genetics.utah.edu>

 Marc-
 
 You are exactly right.  Thanks a million, you saved me hours of
 frustration.  I'm really going to have to sit down and read that Apache
 manual sitting on my desk - or at least open it and look at the index!
 Even though this isn't a bioperl problem, I'll detail it a bit here so
 that it will hopefully Google for others searching for a similar
answer.
 
 While setting up a local BLAST server with a web interface using
 Bio::Tool::Run::LocalBlast and Bio::SearchIO::Writer::HTMLResultWriter
I
 came across the problem that the same BLAST search would work correctly
 while running as non-CGI script, but would return "***** No hits found
 ******" if running as a CGI script.  The thing that was confusing me
was
 that I expected BLAST to crash if it wasn't seeing both BLASTDB and
 BLASTMAT correctly.  I had explicitly set the path to the database in
the
 call to Bio::Tools::Run::StandAloneBlast->new which was apparently
 allowing BLAST to run, but finally noticed in the apache error logs
that
 apache was 'Unable to open BLOSUM62'.  This is where Marc came to the
 rescue pointing out to me that even if I had set BLASTMAT and BLASTDB
for
 the apache user, I would have to add the following line to
httpd.conf...
 
 PassEnv BLASTMAT BLASTDB
 
 ...so that those environment variables would be passed to the script.
 
 > -----Original Message-----
 > From: Marc Logghe [mailto:Marc.Logghe@DEVGEN.com]
 > Sent: Wednesday, December 14, 2005 1:05 AM
 > To: Barry Moore
 > Subject: RE: [Bioperl-l] LocalBlast.pm running under Apache
 >
 >
 > > -----Original Message-----
 > > From: bioperl-l-bounces@portal.open-bio.org
 > > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of
 > > Barry Moore
 > > Sent: Wednesday, December 14, 2005 6:30 AM
 > > To: Barry Moore; bioperl-l
 > > Subject: RE: [Bioperl-l] LocalBlast.pm running under Apache
 > >
 > > Ignore this question.  There's some problem with access to
 > > BLOSUM62 even though the permissions look fine and BLASTMAT
 > > is set correctly for apache.  It's late so I'll worry about
 > > it tomorrow, but it's not a bioperl problem.
 > Hi Barry,
 > Don't know if this is the issue here or not but I think I will never
 > forget this one (cos I spent ages to find out what was going wrong):
 > even if an environmental variable is set for user apache it is not
 > automatically exported when apache is launched. You have to set
(SetEnv)
 > or pass it (PassEnv) explicitely in httpd.conf.
 > Cheers,
 > Marc

From skirov at utk.edu  Wed Dec 14 12:37:42 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Wed Dec 14 12:35:11 2005
Subject: [Bioperl-l] Memory leak in Bio::Root::Root?
In-Reply-To: <Pine.GSO.4.60.0512141102290.24764@zeus>
References: <Pine.GSO.4.60.0512131007220.11597@zeus>
	<3221492C-8A26-42C8-ADF7-30FF98D45638@duke.edu>
	<Pine.GSO.4.60.0512141102290.24764@zeus>
Message-ID: <43A05866.1050707@utk.edu>

My two cents: have you looked for cyclic referencing. Then your objects 
will not get destroyed properly. You can try Devel::Cycle to track 
those. If you post some more code we may have better idea what is going on.
Stefan

Mike Muratet wrote:

>
>
> Jason
>
>>
>> polyn returns a scalar object (blessed) or just some scalar data?
>> If you are really calling QStat->polyn( $obj) then 'new' is never 
>> called in the first place for the Qstat package.
>>
>
> polyn returns a reference to some scalar data. My understanding is 
> that 'new' would not be called, but then I'm at a loss to explain 
> where all the extra memory goes.
>
>> Destructors are automatic, but you can create your own to see when/if 
>> the destructor is called.
>> sub DESTROY {
>> my $self =shift;
>> warn("I am calling destroy in the Qstat object\n");
>> $self->SUPER::DESTROY;
>> }
>
>
> I will try this.
>
>> You can also inherit from Bio::Root::RootI and call bless on your own 
>> if you want to play with whether this is Bio::Root::Root induced 
>> behavior.  I'm not sure I understand enough of how it works to tell 
>> you where else to look.
>>
>
> I will try this, too.
>
>> Is a new $seq_obj getting created every iteration of the loop?  Are 
>> these getting cleaned up or is Qstat keeping references  to them, and 
>> they are sticking around?  Devel::Cycle doesn't show any memory cycles?
>>
>
> A new $seq_obj gets created in every loop of the method that calls 
> QStats with the $seq_obj as an argument, but I undef it at the bottom 
> of the loop. Should this not be enough to get perl to recycle the 
> memory? I haven't tried Devel::Cycle but I will include it to see what 
> it says.
>
> I saw on some of the perl lists a reference to a memory leak in perl 
> 5.8 with the s/// operator. Have you heard about such a problem?
>
> Thanks for the help
>
> Mike
>
>> On Dec 13, 2005, at 11:32 AM, Mike Muratet wrote:
>>
>>> Greetings all
>>>
>>> I have a problem that surpasses what I know and what I've been able 
>>> to glean from perltoot,perboot,etc. Maybe it's a question for a perl 
>>> list, but here goes...
>>>
>>> I was given a package that calculates some statistics regarding base 
>>> repeats in a sequence. It inherits from Bio::Root::Root presumbably 
>>> to obtain the exception behavior bestowed by the class judging from 
>>> the perldocs and to enforce that the argument is a PrimarySeq 
>>> object. It has
>>> two methods which get called thus:
>>>
>>> my $polyn = QStat->polyn($seq_obj);
>>> my $nstat = QStat->nmer_stat($seq_obj);
>>>
>>> where the returned values are scalar references. The problem is that 
>>> script quickly uses up all of the 4GB address space (processing lots 
>>> of oligos) and crashes.
>>>
>>> I have used Devel::Size to determine the size of these variables and 
>>> get 3.8K and 7K. I have tried to undef them at the end of the loop 
>>> but it has no effect. I commented out the calls and the problem goes 
>>> away so the problem is associated with the QStat object.
>>>
>>> The QStat class has a constructor that calls the base constructor:
>>>     my $self = $class->SUPER::new(@args);
>>> would this demand a destructor somewhere?
>>>
>>> Does calling a method out of a class like this invoke all the class 
>>> machinery without creating the object with new?
>>>
>>> Can someone with experience deriving from Bio::Root::Root offer some 
>>> suggestions on how to get the memory back?
>>>
>>> Thanks
>>>
>>> Mike
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l@portal.open-bio.org
>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
>> -- 
>> Jason Stajich
>> Duke University
>> http://www.duke.edu/~jes12
>>
>>
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


-- 
Stefan Kirov, Ph.D.
University of Tennessee/Oak Ridge National Laboratory
5700 bldg, PO BOX 2008 MS6164
Oak Ridge TN 37831-6164
USA
tel +865 576 5120
fax +865-576-5332
e-mail: skirov@utk.edu
sao@ornl.gov

"And the wars go on with brainwashed pride
For the love of God and our human rights
And all these things are swept aside"

From smarkel at scitegic.com  Wed Dec 14 12:31:02 2005
From: smarkel at scitegic.com (Scott Markel)
Date: Wed Dec 14 12:41:05 2005
Subject: [Bioperl-l] extracting CDS portion of RefSeqs
In-Reply-To: <3cfaa4040512140813w472b1d47k9685bd55d3cb0f7b@mail.gmail.com>
References: <3cfaa4040512140813w472b1d47k9685bd55d3cb0f7b@mail.gmail.com>
Message-ID: <43A056D6.7010904@scitegic.com>

Amit,

You can make a seq call directly on $feat.  This reduces
your code to the following.  Note that I also moved the
creation of $out outside the loop.

my $seqio = Bio::SeqIO->new(-file   => $ARGV[0],
		            -format => 'GenBank');

my $out = Bio::SeqIO->new(-file   => $ARGV[1],
                           -format => 'Fasta');

foreach my $feat ( $seq->get_SeqFeatures() ) {
              if( $feat->primary_tag eq 'CDS' ) {
		 my $seqobj = $feat->seq;
		 $out->write_seq($seqobj);
              }
          }

Scott

Amit Indap wrote:

> Hi,
> 
> I want to extract the CDS portion of human refseqs. I downloaded the
> genbank flat file of the most recent Refseq release. I was going to
> parse the Genbank file and write out the CDS porition of the sequence
> like so:
> 
> my $seqio = Bio::SeqIO->new(-file => $ARGV[0],
> 		      -format => 'GenBank');
> 
> 
> foreach my $feat ( $seq->get_SeqFeatures() ) {
>              if( $feat->primary_tag eq 'CDS' ) {
> 		 my $start = $feat->start;
> 		 my $end = $feat->end;
> 	 my $seqstr   = $seq->subseq($start,$end); #
> 		 my $displayid = $seq->display_name;
> 		 #my $seqobj = Bio::Seq->new( -display_id => "$displayid:$start..$end",
> 		#			     -seq => $seqstr);
> 		# my $out = Bio::SeqIO->new(-format => 'Fasta');
> 		# $out->write_seq($seqobj);
> 		
> 		
> #                 print STDOUT "Location ",$feat->start,":",
> #                    $feat->end," GFF[",$feat->gff_string,"]\n";
>              }
>          }
> --
> Amit Indap
> http://www.bscb.cornell.edu/Homepages/Amit_Indap/
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 
> 

-- 
Scott Markel, Ph.D.
Principal Bioinformatics Architect  email:  smarkel@scitegic.com
SciTegic Inc.                       mobile: +1 858 205 3653
9665 Chesapeake Drive, Suite 401    voice:  +1 858 279 8800, ext. 253
San Diego, CA 92123                 fax:    +1 858 279 8804
USA                                 web:    http://www.scitegic.com

From iain.m.wallace at gmail.com  Wed Dec 14 10:59:17 2005
From: iain.m.wallace at gmail.com (Iain Wallace)
Date: Wed Dec 14 14:35:26 2005
Subject: [Bioperl-l] Problem with Graphics
Message-ID: <8cff3eb80512140759w1f434423t4cbd4939e5fe798c@mail.gmail.com>

Hi,

I am trying to use the Bio::Graphics module, but am unable to view my
output file. When I try to view the file I am told the file is
corrupt.

Below is the code that I tried and it seems to work (i.e. it doesn't
crash and generates an output file)

Unfortunately I have no idea what the error could be.
Any help/pointers would be greatly appreciated

Thanks

Iain
---- Code from the How To ---

#!/usr/bin/perl

    use strict;

    use Bio::Graphics;
    use Bio::SeqFeature::Generic;

  my $panel = Bio::Graphics::Panel->new(-length => 1000,-width  => 800);
    my $track = $panel->add_track(-glyph => 'generic',-label  => 1);

    while (<>) { # read blast file
      chomp;
      next if /^\#/;  # ignore comments
     my($name,$score,$start,$end) = split /\t+/;
     my $feature =
Bio::SeqFeature::Generic->new(-display_name=>$name,-score=>$score,
                                                 -start=>$start,-end=>$end);
     $track->add_feature($feature);
   }

   print $panel->png;

From jason.stajich at duke.edu  Wed Dec 14 14:42:34 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Wed Dec 14 14:40:01 2005
Subject: [Bioperl-l] Problem with Graphics
In-Reply-To: <8cff3eb80512140759w1f434423t4cbd4939e5fe798c@mail.gmail.com>
References: <8cff3eb80512140759w1f434423t4cbd4939e5fe798c@mail.gmail.com>
Message-ID: <4BF51350-BB17-4A50-9ABD-357EE920439F@duke.edu>

Are you on windows?

Try adding this before calling print.
binmode (STDOUT);

On Dec 14, 2005, at 10:59 AM, Iain Wallace wrote:

> Hi,
>
> I am trying to use the Bio::Graphics module, but am unable to view my
> output file. When I try to view the file I am told the file is
> corrupt.
>
> Below is the code that I tried and it seems to work (i.e. it doesn't
> crash and generates an output file)
>
> Unfortunately I have no idea what the error could be.
> Any help/pointers would be greatly appreciated
>
> Thanks
>
> Iain
> ---- Code from the How To ---
>
> #!/usr/bin/perl
>
>     use strict;
>
>     use Bio::Graphics;
>     use Bio::SeqFeature::Generic;
>
>   my $panel = Bio::Graphics::Panel->new(-length => 1000,-width  =>  
> 800);
>     my $track = $panel->add_track(-glyph => 'generic',-label  => 1);
>
>     while (<>) { # read blast file
>       chomp;
>       next if /^\#/;  # ignore comments
>      my($name,$score,$start,$end) = split /\t+/;
>      my $feature =
> Bio::SeqFeature::Generic->new(-display_name=>$name,-score=>$score,
>                                                  -start=>$start,- 
> end=>$end);
>      $track->add_feature($feature);
>    }
>
>    print $panel->png;
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12


From angshu96 at gmail.com  Wed Dec 14 15:34:55 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Wed Dec 14 15:32:59 2005
Subject: [Bioperl-l] load_seqdatabase didn't load the taxon ids
Message-ID: <df8328740512141234s5abaf9a0r4910b508d97cf2dd@mail.gmail.com>

Hi,

After running the load_seqdatabase.pl I see that it hasn't loaded the
bioentry table with the taxon ids from the taxon table!!! Could you please
suggest a remedy to this?

Thanks,
Angshu

From angshu96 at gmail.com  Wed Dec 14 16:29:43 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Wed Dec 14 16:33:56 2005
Subject: [Bioperl-l] parsing a BLAST output
In-Reply-To: <df8328740512130829h7a5fcac0vb06d70a266c1c7a8@mail.gmail.com>
References: <df8328740512041732g9b22143y42f01182357e2e96@mail.gmail.com>
	<82B9FC7C-BE37-4961-85BB-6014CEADE8E7@duke.edu>
	<df8328740512130741x384b303akc481c7384e2c695f@mail.gmail.com>
	<2C3A32DA-FE2F-46B8-ABAD-0266CFAF3B61@duke.edu>
	<df8328740512130829h7a5fcac0vb06d70a266c1c7a8@mail.gmail.com>
Message-ID: <df8328740512141329k287c5b96i82835d73695b3afb@mail.gmail.com>

Hi Jason,

So again, what I want is the following:

query sequence
----------------------------------
        |   alignment    |
--------------------------------
hit sequence

The length of the alignment should be at least 50% of the
length of the query sequence, and at least 50% of the length
of the hit sequence.

Now I try to convert it to bioperl language:


   if($hit->length_aln()/hit->length()>=0.5 and
$hit->length_aln()/result->query_length()>=0.5)
                    {
 print $line{$result->query_accession} . "\t" . $line{$hit->name} .
"\t" . $hit->hsp-evalue . "\n";
                    }

Is the statement after "if" correctly represent what I mean?

Appreciate your guidance.

Thanks,
Angshu



On 12/13/05, Angshu Kar <angshu96@gmail.com> wrote:
> Thanks Jason...
>
>
>
> On 12/13/05, Jason Stajich <jason.stajich@duke.edu> wrote:
> >
> > http://doc.bioperl.org/releases/bioperl-1.4/Bio/Search/Hit/GenericHit.html#POD30
> >
> >
> > http://doc.bioperl.org/releases/bioperl-1.4/Bio/Search/Hit/GenericHit.html#POD31
> >
> > On Dec 13, 2005, at 10:41 AM, Angshu Kar wrote:
> >
> >
> > Hi Jason,
> >
> > Could you please send in the link where I can find something about the HitI interface? I couldn't find those two functions there.
> >
> > Thanks,
> > Angshu
> >
> >
> > On 12/4/05, Jason Stajich <jason.stajich@duke.edu > wrote:
> > > frac_identical gives the fraction of bases in the HSP that are
> > > identical.
> > >
> > > overlap would be calculated from (length of the query aligned) /
> > > (length of query) or (length of hit aligned) / (length of hit).
> > >
> > > So for an HSP you can calculate this
> > > $fracqaligned = $hsp->query->length / $result->query_length;
> > > $frachaligned = $hsp->hit->length / $hit->length;
> > >
> > > But remember there may be multiple HSPs so you may need to merge the
> > > HSP information to get the total length aligned.  If there is a
> > > repeated domain or multiple high scoring suboptimal alignments this
> > > can cause things to get a little tricky.
> > >
> > > There are two methods provided in the HitI interface called
> > > frac_aligned_query() and frac_aligned_hit() do try and take all of
> > > this into account for you, but I admit this is less well tested
> > > code.  But do give them a try:
> > > $fracqaligned = $hit->frac_aligned_query();
> > > $frachaligned = $hit->frac_aligned_hit();
> > >
> > >
> > > If you are using WU-BLASTP add the -postsw option to get a refined
> > > alignment which will merge HSPs where appropriate so you should use
> > > that.
> > >
> > > You can also use the -links option to get WU-BLAST to get the logical
> > > ordering and a consistent path through the HSPs.
> > >
> > >
> > > On Dec 4, 2005, at 8:32 PM, Angshu Kar wrote:
> > >
> > > > Hi,
> > > >
> > >  > To begin with, I'm new to Bioperl.
> > > > Now, I've written the following simple piece of code to parse a WU-
> > > > Blast
> > > > output which filters data *for a given e-value and >50% overlap*.
> > > >
> > > > I'm writing the main algorithm here:
> > > >
> > > > my $blast_report = $ARG[1];
> > > > my $threshold_evalue = $ARG[2];
> > > >
> > > > my $in = new Bio::SearchIO(-format => 'blast', -file =>
> > > > $blast_report);
> > > >
> > > > while (my $result = $in -> next_result)
> > > >    {
> > > >       while(my $hit = $result->next_hit)
> > > >          {
> > > >             if(($line{$hit->name} == $line{$result->query_accession}))
> > > >                {
> > > >                   next;
> > > >                }
> > > >             if($hit->hsp->evalue <= $threshold_evalue)
> > > >                {
> > > >                   if($hit->hsp->frac_indentical>=0.5)
> > > >                      {
> > > >                         print $line{$result->query_accession} . "\t" .
> > > > $line{$hit->name} . "\t" . $hit->hsp-evalue . "\n";
> > > >                     }
> > > >               }
> > > >       }
> > > > }
> > > >
> > > > My questions are:
> > > >
> > > > 1. does the frac_identical gives the measure of % overlap? Or, are
> > > > there any
> > > > other methods?
> > > > 2. now, i don't have any blast data sets to test my code  upon.could
> > > > any of
> > > > the experienced users let me know whether the algorithm is fine?any
> > > > tip-offs on any point (from optimization to syntactical errors) are
> > > > heartily
> > > > welcome.
> > > > 3. could any one please let me know if i can find sample wu-blast
> > > > outputs to
> > > > test my script upon?
> > >
> > > http://fungal.genome.duke.edu/~jes12/BGT203.2005/sample_reports/
> > >
> > > Also checkout the biodata repository from bioperl and look in the
> > > DB_Searching directory, we had started a  project cataloging example
> > > reports in all the different formats.  This sort of fizzled out, but
> > > could still use some volunteers to better organize things and
> > > incorporate more examples.
> > >
> > >  http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/biodata/
> > > DB_Searching/
> > >
> > >
> > > > Appreciate your guidance.
> > > >
> > > > Thanks,
> > > > Angshu
> > > >
> > > > _______________________________________________
> > > > Bioperl-l mailing list
> > > > Bioperl-l@portal.open-bio.org
> > > >  http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > >
> > > --
> > > Jason Stajich
> > > Duke University
> > > http://www.duke.edu/~jes12
> > >
> > >
> > >
> >
> >
> >
> >
> >
> > --
> > Jason Stajich
> > Duke University
> > http://www.duke.edu/~jes12
> >
> >
>
>

From angshu96 at gmail.com  Wed Dec 14 17:19:06 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Wed Dec 14 17:16:23 2005
Subject: [Bioperl-l] parsing a BLAST output
In-Reply-To: <43A098B6.7090908@cenix-bioscience.com>
References: <df8328740512041732g9b22143y42f01182357e2e96@mail.gmail.com>
	<82B9FC7C-BE37-4961-85BB-6014CEADE8E7@duke.edu>
	<df8328740512130741x384b303akc481c7384e2c695f@mail.gmail.com>
	<2C3A32DA-FE2F-46B8-ABAD-0266CFAF3B61@duke.edu>
	<df8328740512130829h7a5fcac0vb06d70a266c1c7a8@mail.gmail.com>
	<df8328740512141329k287c5b96i82835d73695b3afb@mail.gmail.com>
	<43A098B6.7090908@cenix-bioscience.com>
Message-ID: <df8328740512141419o28b20f5ct8e3a1ea3c1aabd8@mail.gmail.com>

Hi Andrew,

I don't have a test dataset to test the code! That's my main problem! :(
That's why I'm seeking experieced help like yours...Could you please
comment just seeing the code?
It'll be very helpful for me.

Thanks a lot,
Angshu

On 12/14/05, Andrew Walsh <walsh@cenix-bioscience.com> wrote:
> If you're not sure what your code is doing, you should write a test for
> it.  Create different alignments that meet and don't meet your
> requirements and test that your code does the correct thing.
>
>
> Angshu Kar wrote:
> > Hi Jason,
> >
> > So again, what I want is the following:
> >
> > query sequence
> > ----------------------------------
> >         |   alignment    |
> > --------------------------------
> > hit sequence
> >
> > The length of the alignment should be at least 50% of the
> > length of the query sequence, and at least 50% of the length
> > of the hit sequence.
> >
> > Now I try to convert it to bioperl language:
> >
> >
> >    if($hit->length_aln()/hit->length()>=0.5 and
> > $hit->length_aln()/result->query_length()>=0.5)
> >                     {
> >  print $line{$result->query_accession} . "\t" . $line{$hit->name} .
> > "\t" . $hit->hsp-evalue . "\n";
> >                     }
> >
> > Is the statement after "if" correctly represent what I mean?
> >
> > Appreciate your guidance.
> >
> > Thanks,
> > Angshu
> >
> >
> >
> > On 12/13/05, Angshu Kar <angshu96@gmail.com> wrote:
> >
> >>Thanks Jason...
> >>
> >>
> >>
> >>On 12/13/05, Jason Stajich <jason.stajich@duke.edu> wrote:
> >>
> >>>http://doc.bioperl.org/releases/bioperl-1.4/Bio/Search/Hit/GenericHit.html#POD30
> >>>
> >>>
> >>>http://doc.bioperl.org/releases/bioperl-1.4/Bio/Search/Hit/GenericHit.html#POD31
> >>>
> >>>On Dec 13, 2005, at 10:41 AM, Angshu Kar wrote:
> >>>
> >>>
> >>>Hi Jason,
> >>>
> >>>Could you please send in the link where I can find something about the HitI interface? I couldn't find those two functions there.
> >>>
> >>>Thanks,
> >>>Angshu
> >>>
> >>>
> >>>On 12/4/05, Jason Stajich <jason.stajich@duke.edu > wrote:
> >>>
> >>>>frac_identical gives the fraction of bases in the HSP that are
> >>>>identical.
> >>>>
> >>>>overlap would be calculated from (length of the query aligned) /
> >>>>(length of query) or (length of hit aligned) / (length of hit).
> >>>>
> >>>>So for an HSP you can calculate this
> >>>>$fracqaligned = $hsp->query->length / $result->query_length;
> >>>>$frachaligned = $hsp->hit->length / $hit->length;
> >>>>
> >>>>But remember there may be multiple HSPs so you may need to merge the
> >>>>HSP information to get the total length aligned.  If there is a
> >>>>repeated domain or multiple high scoring suboptimal alignments this
> >>>>can cause things to get a little tricky.
> >>>>
> >>>>There are two methods provided in the HitI interface called
> >>>>frac_aligned_query() and frac_aligned_hit() do try and take all of
> >>>>this into account for you, but I admit this is less well tested
> >>>>code.  But do give them a try:
> >>>>$fracqaligned = $hit->frac_aligned_query();
> >>>>$frachaligned = $hit->frac_aligned_hit();
> >>>>
> >>>>
> >>>>If you are using WU-BLASTP add the -postsw option to get a refined
> >>>>alignment which will merge HSPs where appropriate so you should use
> >>>>that.
> >>>>
> >>>>You can also use the -links option to get WU-BLAST to get the logical
> >>>>ordering and a consistent path through the HSPs.
> >>>>
> >>>>
> >>>>On Dec 4, 2005, at 8:32 PM, Angshu Kar wrote:
> >>>>
> >>>>
> >>>>>Hi,
> >>>>>
> >>>>
> >>>> > To begin with, I'm new to Bioperl.
> >>>>
> >>>>>Now, I've written the following simple piece of code to parse a WU-
> >>>>>Blast
> >>>>>output which filters data *for a given e-value and >50% overlap*.
> >>>>>
> >>>>>I'm writing the main algorithm here:
> >>>>>
> >>>>>my $blast_report = $ARG[1];
> >>>>>my $threshold_evalue = $ARG[2];
> >>>>>
> >>>>>my $in = new Bio::SearchIO(-format => 'blast', -file =>
> >>>>>$blast_report);
> >>>>>
> >>>>>while (my $result = $in -> next_result)
> >>>>>   {
> >>>>>      while(my $hit = $result->next_hit)
> >>>>>         {
> >>>>>            if(($line{$hit->name} == $line{$result->query_accession}))
> >>>>>               {
> >>>>>                  next;
> >>>>>               }
> >>>>>            if($hit->hsp->evalue <= $threshold_evalue)
> >>>>>               {
> >>>>>                  if($hit->hsp->frac_indentical>=0.5)
> >>>>>                     {
> >>>>>                        print $line{$result->query_accession} . "\t" .
> >>>>>$line{$hit->name} . "\t" . $hit->hsp-evalue . "\n";
> >>>>>                    }
> >>>>>              }
> >>>>>      }
> >>>>>}
> >>>>>
> >>>>>My questions are:
> >>>>>
> >>>>>1. does the frac_identical gives the measure of % overlap? Or, are
> >>>>>there any
> >>>>>other methods?
> >>>>>2. now, i don't have any blast data sets to test my code  upon.could
> >>>>>any of
> >>>>>the experienced users let me know whether the algorithm is fine?any
> >>>>>tip-offs on any point (from optimization to syntactical errors) are
> >>>>>heartily
> >>>>>welcome.
> >>>>>3. could any one please let me know if i can find sample wu-blast
> >>>>>outputs to
> >>>>>test my script upon?
> >>>>
> >>>>http://fungal.genome.duke.edu/~jes12/BGT203.2005/sample_reports/
> >>>>
> >>>>Also checkout the biodata repository from bioperl and look in the
> >>>>DB_Searching directory, we had started a  project cataloging example
> >>>>reports in all the different formats.  This sort of fizzled out, but
> >>>>could still use some volunteers to better organize things and
> >>>>incorporate more examples.
> >>>>
> >>>> http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/biodata/
> >>>>DB_Searching/
> >>>>
> >>>>
> >>>>
> >>>>>Appreciate your guidance.
> >>>>>
> >>>>>Thanks,
> >>>>>Angshu
> >>>>>
> >>>>>_______________________________________________
> >>>>>Bioperl-l mailing list
> >>>>>Bioperl-l@portal.open-bio.org
> >>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >>>>
> >>>>--
> >>>>Jason Stajich
> >>>>Duke University
> >>>>http://www.duke.edu/~jes12
> >>>>
> >>>>
> >>>>
> >>>
> >>>
> >>>
> >>>
> >>>
> >>>--
> >>>Jason Stajich
> >>>Duke University
> >>>http://www.duke.edu/~jes12
> >>>
> >>>
> >>
> >>
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
>
>
> --
> ------------------------------------------------------------------
> Andrew Walsh, M.Sc.
> Senior Bioinformatics Software Engineer
> IT Unit
> Cenix BioScience GmbH
> Tatzberg 47
> 01307 Dresden
> Germany
> Tel. +49-351-4173 137
> Fax  +49-351-4173 109
>
> public key: http://www.cenix-bioscience.com/public_keys/walsh.gpg
> ------------------------------------------------------------------
>
>

From angshu96 at gmail.com  Wed Dec 14 17:42:31 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Wed Dec 14 17:39:46 2005
Subject: [Bioperl-l] load_seqdatabase didn't load the taxon ids
In-Reply-To: <1134599289.30464.26.camel@chauvel.csse.monash.edu.au>
References: <df8328740512141234s5abaf9a0r4910b508d97cf2dd@mail.gmail.com>
	<1134599289.30464.26.camel@chauvel.csse.monash.edu.au>
Message-ID: <df8328740512141442y15fae93co1f0915891b540e7f@mail.gmail.com>

Hi Torsten,

Thanks for your help. But I've loaded the taxon tables.
Only thing I'm doing differently is loading my data from a fasta file
instead of the genbank, swissprot format. Does that matter anyhow?

Thanks,
Angshu

On 12/14/05, Torsten Seemann <torsten.seemann@infotech.monash.edu.au> wrote:
> Angshu,
>
> > After running the load_seqdatabase.pl I see that it hasn't loaded the
> > bioentry table with the taxon ids from the taxon table!!! Could you please
> > suggest a remedy to this?
>
> Did you put the taxons in the database first ?
>
> >From bioperl-cvs/biosql-schema/INSTALL :
>
> "With bioperl and bioperl-db installed you are ready to load some data.
> It is advisable to pre-load the NCBI taxonomy database (use
> scripts/load_taxonomy.pl in the biosql-schema package, the details are
> in its documentation)."
>
> Use bioperl-cvs/biosql-schema/scripts/load_ncbi_taxonomy.pl :
>
> "Usage: load_ncbi_taxonomy.pl" ... (try --help option)
>
> The BioPerl authors have been very patient answering your questions so
> far, but I think you should read the INSTALL files in biosql-schema and
> bioperl-db first before asking further questions.
>
> --
> Torsten Seemann <torsten.seemann@infotech.monash.edu.au>
> Victorian Bioinformatics Consortium
>
>
>

From walsh at cenix-bioscience.com  Wed Dec 14 17:12:06 2005
From: walsh at cenix-bioscience.com (Andrew Walsh)
Date: Wed Dec 14 17:41:57 2005
Subject: [Bioperl-l] parsing a BLAST output
In-Reply-To: <df8328740512141329k287c5b96i82835d73695b3afb@mail.gmail.com>
References: <df8328740512041732g9b22143y42f01182357e2e96@mail.gmail.com>	<82B9FC7C-BE37-4961-85BB-6014CEADE8E7@duke.edu>	<df8328740512130741x384b303akc481c7384e2c695f@mail.gmail.com>	<2C3A32DA-FE2F-46B8-ABAD-0266CFAF3B61@duke.edu>	<df8328740512130829h7a5fcac0vb06d70a266c1c7a8@mail.gmail.com>
	<df8328740512141329k287c5b96i82835d73695b3afb@mail.gmail.com>
Message-ID: <43A098B6.7090908@cenix-bioscience.com>

If you're not sure what your code is doing, you should write a test for 
it.  Create different alignments that meet and don't meet your 
requirements and test that your code does the correct thing.


Angshu Kar wrote:
> Hi Jason,
> 
> So again, what I want is the following:
> 
> query sequence
> ----------------------------------
>         |   alignment    |
> --------------------------------
> hit sequence
> 
> The length of the alignment should be at least 50% of the
> length of the query sequence, and at least 50% of the length
> of the hit sequence.
> 
> Now I try to convert it to bioperl language:
> 
> 
>    if($hit->length_aln()/hit->length()>=0.5 and
> $hit->length_aln()/result->query_length()>=0.5)
>                     {
>  print $line{$result->query_accession} . "\t" . $line{$hit->name} .
> "\t" . $hit->hsp-evalue . "\n";
>                     }
> 
> Is the statement after "if" correctly represent what I mean?
> 
> Appreciate your guidance.
> 
> Thanks,
> Angshu
> 
> 
> 
> On 12/13/05, Angshu Kar <angshu96@gmail.com> wrote:
> 
>>Thanks Jason...
>>
>>
>>
>>On 12/13/05, Jason Stajich <jason.stajich@duke.edu> wrote:
>>
>>>http://doc.bioperl.org/releases/bioperl-1.4/Bio/Search/Hit/GenericHit.html#POD30
>>>
>>>
>>>http://doc.bioperl.org/releases/bioperl-1.4/Bio/Search/Hit/GenericHit.html#POD31
>>>
>>>On Dec 13, 2005, at 10:41 AM, Angshu Kar wrote:
>>>
>>>
>>>Hi Jason,
>>>
>>>Could you please send in the link where I can find something about the HitI interface? I couldn't find those two functions there.
>>>
>>>Thanks,
>>>Angshu
>>>
>>>
>>>On 12/4/05, Jason Stajich <jason.stajich@duke.edu > wrote:
>>>
>>>>frac_identical gives the fraction of bases in the HSP that are
>>>>identical.
>>>>
>>>>overlap would be calculated from (length of the query aligned) /
>>>>(length of query) or (length of hit aligned) / (length of hit).
>>>>
>>>>So for an HSP you can calculate this
>>>>$fracqaligned = $hsp->query->length / $result->query_length;
>>>>$frachaligned = $hsp->hit->length / $hit->length;
>>>>
>>>>But remember there may be multiple HSPs so you may need to merge the
>>>>HSP information to get the total length aligned.  If there is a
>>>>repeated domain or multiple high scoring suboptimal alignments this
>>>>can cause things to get a little tricky.
>>>>
>>>>There are two methods provided in the HitI interface called
>>>>frac_aligned_query() and frac_aligned_hit() do try and take all of
>>>>this into account for you, but I admit this is less well tested
>>>>code.  But do give them a try:
>>>>$fracqaligned = $hit->frac_aligned_query();
>>>>$frachaligned = $hit->frac_aligned_hit();
>>>>
>>>>
>>>>If you are using WU-BLASTP add the -postsw option to get a refined
>>>>alignment which will merge HSPs where appropriate so you should use
>>>>that.
>>>>
>>>>You can also use the -links option to get WU-BLAST to get the logical
>>>>ordering and a consistent path through the HSPs.
>>>>
>>>>
>>>>On Dec 4, 2005, at 8:32 PM, Angshu Kar wrote:
>>>>
>>>>
>>>>>Hi,
>>>>>
>>>>
>>>> > To begin with, I'm new to Bioperl.
>>>>
>>>>>Now, I've written the following simple piece of code to parse a WU-
>>>>>Blast
>>>>>output which filters data *for a given e-value and >50% overlap*.
>>>>>
>>>>>I'm writing the main algorithm here:
>>>>>
>>>>>my $blast_report = $ARG[1];
>>>>>my $threshold_evalue = $ARG[2];
>>>>>
>>>>>my $in = new Bio::SearchIO(-format => 'blast', -file =>
>>>>>$blast_report);
>>>>>
>>>>>while (my $result = $in -> next_result)
>>>>>   {
>>>>>      while(my $hit = $result->next_hit)
>>>>>         {
>>>>>            if(($line{$hit->name} == $line{$result->query_accession}))
>>>>>               {
>>>>>                  next;
>>>>>               }
>>>>>            if($hit->hsp->evalue <= $threshold_evalue)
>>>>>               {
>>>>>                  if($hit->hsp->frac_indentical>=0.5)
>>>>>                     {
>>>>>                        print $line{$result->query_accession} . "\t" .
>>>>>$line{$hit->name} . "\t" . $hit->hsp-evalue . "\n";
>>>>>                    }
>>>>>              }
>>>>>      }
>>>>>}
>>>>>
>>>>>My questions are:
>>>>>
>>>>>1. does the frac_identical gives the measure of % overlap? Or, are
>>>>>there any
>>>>>other methods?
>>>>>2. now, i don't have any blast data sets to test my code  upon.could
>>>>>any of
>>>>>the experienced users let me know whether the algorithm is fine?any
>>>>>tip-offs on any point (from optimization to syntactical errors) are
>>>>>heartily
>>>>>welcome.
>>>>>3. could any one please let me know if i can find sample wu-blast
>>>>>outputs to
>>>>>test my script upon?
>>>>
>>>>http://fungal.genome.duke.edu/~jes12/BGT203.2005/sample_reports/
>>>>
>>>>Also checkout the biodata repository from bioperl and look in the
>>>>DB_Searching directory, we had started a  project cataloging example
>>>>reports in all the different formats.  This sort of fizzled out, but
>>>>could still use some volunteers to better organize things and
>>>>incorporate more examples.
>>>>
>>>> http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/biodata/
>>>>DB_Searching/
>>>>
>>>>
>>>>
>>>>>Appreciate your guidance.
>>>>>
>>>>>Thanks,
>>>>>Angshu
>>>>>
>>>>>_______________________________________________
>>>>>Bioperl-l mailing list
>>>>>Bioperl-l@portal.open-bio.org
>>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>>--
>>>>Jason Stajich
>>>>Duke University
>>>>http://www.duke.edu/~jes12
>>>>
>>>>
>>>>
>>>
>>>
>>>
>>>
>>>
>>>--
>>>Jason Stajich
>>>Duke University
>>>http://www.duke.edu/~jes12
>>>
>>>
>>
>>
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 


-- 
------------------------------------------------------------------
Andrew Walsh, M.Sc.
Senior Bioinformatics Software Engineer
IT Unit
Cenix BioScience GmbH
Tatzberg 47
01307 Dresden
Germany
Tel. +49-351-4173 137
Fax  +49-351-4173 109

public key: http://www.cenix-bioscience.com/public_keys/walsh.gpg
------------------------------------------------------------------

From jason.stajich at duke.edu  Wed Dec 14 18:55:11 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Wed Dec 14 18:52:37 2005
Subject: [Bioperl-l] load_seqdatabase didn't load the taxon ids
In-Reply-To: <df8328740512141442y15fae93co1f0915891b540e7f@mail.gmail.com>
References: <df8328740512141234s5abaf9a0r4910b508d97cf2dd@mail.gmail.com>
	<1134599289.30464.26.camel@chauvel.csse.monash.edu.au>
	<df8328740512141442y15fae93co1f0915891b540e7f@mail.gmail.com>
Message-ID: <660FA5FE-2A7E-461C-9E4B-809344CCBEAF@duke.edu>

Well let's try to think this through together Angshu - how do you  
think the loading mechanism should be guessing what the species is  
for a FASTA file....  (Hint: it doesn't)
-jason

On Dec 14, 2005, at 5:42 PM, Angshu Kar wrote:

> Hi Torsten,
>
> Thanks for your help. But I've loaded the taxon tables.
> Only thing I'm doing differently is loading my data from a fasta file
> instead of the genbank, swissprot format. Does that matter anyhow?
>
> Thanks,
> Angshu
>
> On 12/14/05, Torsten Seemann  
> <torsten.seemann@infotech.monash.edu.au> wrote:
>> Angshu,
>>
>>> After running the load_seqdatabase.pl I see that it hasn't loaded  
>>> the
>>> bioentry table with the taxon ids from the taxon table!!! Could  
>>> you please
>>> suggest a remedy to this?
>>
>> Did you put the taxons in the database first ?
>>
>>> From bioperl-cvs/biosql-schema/INSTALL :
>>
>> "With bioperl and bioperl-db installed you are ready to load some  
>> data.
>> It is advisable to pre-load the NCBI taxonomy database (use
>> scripts/load_taxonomy.pl in the biosql-schema package, the details  
>> are
>> in its documentation)."
>>
>> Use bioperl-cvs/biosql-schema/scripts/load_ncbi_taxonomy.pl :
>>
>> "Usage: load_ncbi_taxonomy.pl" ... (try --help option)
>>
>> The BioPerl authors have been very patient answering your  
>> questions so
>> far, but I think you should read the INSTALL files in biosql- 
>> schema and
>> bioperl-db first before asking further questions.
>>
>> --
>> Torsten Seemann <torsten.seemann@infotech.monash.edu.au>
>> Victorian Bioinformatics Consortium
>>
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12


From torsten.seemann at infotech.monash.edu.au  Wed Dec 14 18:56:46 2005
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Wed Dec 14 19:13:01 2005
Subject: [Bioperl-l] load_seqdatabase didn't load the taxon ids
In-Reply-To: <df8328740512141442y15fae93co1f0915891b540e7f@mail.gmail.com>
References: <df8328740512141234s5abaf9a0r4910b508d97cf2dd@mail.gmail.com>
	<1134599289.30464.26.camel@chauvel.csse.monash.edu.au>
	<df8328740512141442y15fae93co1f0915891b540e7f@mail.gmail.com>
Message-ID: <1134604607.30464.36.camel@chauvel.csse.monash.edu.au>

> Thanks for your help. But I've loaded the taxon tables.
> Only thing I'm doing differently is loading my data from a fasta file
> instead of the genbank, swissprot format. Does that matter anyhow?

A FASTA file usually contains much less non-sequence information than a
Genbank or Swissprot file. The latter usually
have /taxon_id, /organism, /strain fields etc which I assume can be used
to make the correct links in the BioSQL database.

Depending on what is stored in the ">" lines in your FASTA file, you may
need to write a custom SeqProccesor class, as Hilmar Lapp has mentioned
before in his replies to you:

See http://bioperl.org/pipermail/bioperl-l/2005-August/019579.html

-- 
Torsten Seemann <torsten.seemann@infotech.monash.edu.au>
Victorian Bioinformatics Consortium

From indapa at gmail.com  Wed Dec 14 11:18:01 2005
From: indapa at gmail.com (Amit Indap)
Date: Wed Dec 14 19:28:51 2005
Subject: [Bioperl-l] extracting CDS portion of RefSeqs
Message-ID: <3cfaa4040512140818q72c17e22se9409151c04c7706@mail.gmail.com>

Sorry, I hit send before I finished my email

Anyways, I want to extract out the CDS portion of human refseqs. I
downloaded the most recent refseq release in genbank format. I was
extracting out the CDS portion this way:

 foreach my $feat ( $seq->get_SeqFeatures() ) {
             if( $feat->primary_tag eq 'CDS' ) {
		 my $start = $feat->start;
		 my $end = $feat->end;
		
		 my $seqstr   = $seq->subseq($start,$end);
		 my $displayid = $seq->display_name;
		 my $seqobj = Bio::Seq->new( -display_id => "$displayid:$start..$end",
					     -seq => $seqstr);
		 my $out = Bio::SeqIO->new(-format => 'Fasta');
		 $out->write_seq($seqobj);

But this is quite slow since the refseq genbank file is quite large.
Is there anyway to download the CDS portion of refseq from NCBI? Is
there a quicker BioPerl solution than the one I have?

Thanks for your help.

Amit

--
Amit Indap
http://www.bscb.cornell.edu/Homepages/Amit_Indap/

From WiersmaP at AGR.GC.CA  Tue Dec 13 16:09:53 2005
From: WiersmaP at AGR.GC.CA (Wiersma, Paul)
Date: Wed Dec 14 20:08:50 2005
Subject: [Bioperl-l] Is there a way to search archives of Bioperl-l?
Message-ID: <5F0D2715D84F2842A9B857E8D7888F120C4BB8@onncrxms5.agr.gc.ca>

Skipped content of type multipart/alternative-------------- next part --------------
A non-text attachment was scrubbed...
Name: not available
Type: image/jpeg
Size: 3190 bytes
Desc: image001.jpg
Url : http://portal.open-bio.org/pipermail/bioperl-l/attachments/20051213/c5ce8925/attachment.jpg
From torsten.seemann at infotech.monash.edu.au  Wed Dec 14 17:28:09 2005
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Wed Dec 14 20:19:05 2005
Subject: [Bioperl-l] load_seqdatabase didn't load the taxon ids
In-Reply-To: <df8328740512141234s5abaf9a0r4910b508d97cf2dd@mail.gmail.com>
References: <df8328740512141234s5abaf9a0r4910b508d97cf2dd@mail.gmail.com>
Message-ID: <1134599289.30464.26.camel@chauvel.csse.monash.edu.au>

Angshu,

> After running the load_seqdatabase.pl I see that it hasn't loaded the
> bioentry table with the taxon ids from the taxon table!!! Could you please
> suggest a remedy to this?

Did you put the taxons in the database first ?

>From bioperl-cvs/biosql-schema/INSTALL :

"With bioperl and bioperl-db installed you are ready to load some data.
It is advisable to pre-load the NCBI taxonomy database (use
scripts/load_taxonomy.pl in the biosql-schema package, the details are
in its documentation)."

Use bioperl-cvs/biosql-schema/scripts/load_ncbi_taxonomy.pl :

"Usage: load_ncbi_taxonomy.pl" ... (try --help option)

The BioPerl authors have been very patient answering your questions so
far, but I think you should read the INSTALL files in biosql-schema and
bioperl-db first before asking further questions.

-- 
Torsten Seemann <torsten.seemann@infotech.monash.edu.au>
Victorian Bioinformatics Consortium


From angshu96 at gmail.com  Wed Dec 14 22:14:14 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Wed Dec 14 22:11:49 2005
Subject: [Bioperl-l] load_seqdatabase didn't load the taxon ids
In-Reply-To: <660FA5FE-2A7E-461C-9E4B-809344CCBEAF@duke.edu>
References: <df8328740512141234s5abaf9a0r4910b508d97cf2dd@mail.gmail.com>
	<1134599289.30464.26.camel@chauvel.csse.monash.edu.au>
	<df8328740512141442y15fae93co1f0915891b540e7f@mail.gmail.com>
	<660FA5FE-2A7E-461C-9E4B-809344CCBEAF@duke.edu>
Message-ID: <df8328740512141914p7ae6f8bbj846e107f5c40c90f@mail.gmail.com>

Thanks Jason

On 12/14/05, Jason Stajich <jason.stajich@duke.edu> wrote:
>
> Well let's try to think this through together Angshu - how do you
> think the loading mechanism should be guessing what the species is
> for a FASTA file....  (Hint: it doesn't)
> -jason
>
> On Dec 14, 2005, at 5:42 PM, Angshu Kar wrote:
>
> > Hi Torsten,
> >
> > Thanks for your help. But I've loaded the taxon tables.
> > Only thing I'm doing differently is loading my data from a fasta file
> > instead of the genbank, swissprot format. Does that matter anyhow?
> >
> > Thanks,
> > Angshu
> >
> > On 12/14/05, Torsten Seemann
> > <torsten.seemann@infotech.monash.edu.au> wrote:
> >> Angshu,
> >>
> >>> After running the load_seqdatabase.pl I see that it hasn't loaded
> >>> the
> >>> bioentry table with the taxon ids from the taxon table!!! Could
> >>> you please
> >>> suggest a remedy to this?
> >>
> >> Did you put the taxons in the database first ?
> >>
> >>> From bioperl-cvs/biosql-schema/INSTALL :
> >>
> >> "With bioperl and bioperl-db installed you are ready to load some
> >> data.
> >> It is advisable to pre-load the NCBI taxonomy database (use
> >> scripts/load_taxonomy.pl in the biosql-schema package, the details
> >> are
> >> in its documentation)."
> >>
> >> Use bioperl-cvs/biosql-schema/scripts/load_ncbi_taxonomy.pl :
> >>
> >> "Usage: load_ncbi_taxonomy.pl" ... (try --help option)
> >>
> >> The BioPerl authors have been very patient answering your
> >> questions so
> >> far, but I think you should read the INSTALL files in biosql-
> >> schema and
> >> bioperl-db first before asking further questions.
> >>
> >> --
> >> Torsten Seemann <torsten.seemann@infotech.monash.edu.au>
> >> Victorian Bioinformatics Consortium
> >>
> >>
> >>
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
> --
> Jason Stajich
> Duke University
> http://www.duke.edu/~jes12
>
>
>

From angshu96 at gmail.com  Wed Dec 14 22:14:00 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Wed Dec 14 22:39:56 2005
Subject: [Bioperl-l] load_seqdatabase didn't load the taxon ids
In-Reply-To: <1134604607.30464.36.camel@chauvel.csse.monash.edu.au>
References: <df8328740512141234s5abaf9a0r4910b508d97cf2dd@mail.gmail.com>
	<1134599289.30464.26.camel@chauvel.csse.monash.edu.au>
	<df8328740512141442y15fae93co1f0915891b540e7f@mail.gmail.com>
	<1134604607.30464.36.camel@chauvel.csse.monash.edu.au>
Message-ID: <df8328740512141914x38695fcbqf55ca395d1a5cc84@mail.gmail.com>

Thanks Torsten

On 12/14/05, Torsten Seemann <torsten.seemann@infotech.monash.edu.au> wrote:
>
> > Thanks for your help. But I've loaded the taxon tables.
> > Only thing I'm doing differently is loading my data from a fasta file
> > instead of the genbank, swissprot format. Does that matter anyhow?
>
> A FASTA file usually contains much less non-sequence information than a
> Genbank or Swissprot file. The latter usually
> have /taxon_id, /organism, /strain fields etc which I assume can be used
> to make the correct links in the BioSQL database.
>
> Depending on what is stored in the ">" lines in your FASTA file, you may
> need to write a custom SeqProccesor class, as Hilmar Lapp has mentioned
> before in his replies to you:
>
> See http://bioperl.org/pipermail/bioperl-l/2005-August/019579.html
>
> --
> Torsten Seemann <torsten.seemann@infotech.monash.edu.au>
> Victorian Bioinformatics Consortium
>
>

From bmoore at genetics.utah.edu  Wed Dec 14 23:35:36 2005
From: bmoore at genetics.utah.edu (Barry Moore)
Date: Wed Dec 14 23:31:57 2005
Subject: [Bioperl-l] Is there a way to search archives of Bioperl-l?
Message-ID: <CFE1DF3BA20F424689DA0881A14055BECF2F2F@m.hg.genetics.utah.edu>

I always just google site:bioperl.org although there is http://search.open-bio.org/cgi-bin/mail-search.cgi.  Is this the thread you're looking for http://portal.open-bio.org/pipermail/bioperl-l/2004-February/014905.html?

Barry

> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-
> bounces@portal.open-bio.org] On Behalf Of Wiersma, Paul
> Sent: Tuesday, December 13, 2005 2:10 PM
> To: bioperl-l@portal.open-bio.org
> Subject: [Bioperl-l] Is there a way to search archives of Bioperl-l?
> 
> I came upon a pod statement discussing Tm calculation that suggests
> looking up the discussion on this list but the archive is getting to be a
> very large.  Is there an archive search engine?
> 
> 
> 
> Paul A. Wiersma
> Agriculture and Agri-Food Canada/Agriculture et Agroalimentaire Canada
> Telephone/T?l?phone: 250-494-6388
> Facsimile/T?l?copieur: 250-494-0755
> 
> Box 5000, 4200 Hwy 97
> 
> Summerland, BC
> V0H 1Z0
> wiersmap@agr.gc.ca
> 
> 
> 
> 
> 
> 
> 
> 


From MEC at stowers-institute.org  Thu Dec 15 14:06:58 2005
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Thu Dec 15 14:19:53 2005
Subject: [Bioperl-l] extracting CDS portion of RefSeqs
Message-ID: <CED81D34E37D5043A1211565277A51E5045CECCC@exchkc02.stowers-institute.org>

Amit,

An issue which you seem to be ignoring is that the CDS will often be a
'Join'

i.e., from http://www.ncbi.nlm.nih.gov/projects/collab/FT/

A more complex description:
Key             Location/Qualifiers
CDS             join(544..589,688..>1032)
                /product="T-cell receptor beta-chain"

which materializes in BioPerl as $feat having a Bio::Location::Split as
its location.

So, simply taking the $start and $end can yield you intronic sequence,
which I think you don't want.

You can pass the cds's location to subseq though.

So, your code becomes:

...
		 my $seqstr   = $seq->subseq($feat->location);
...


Regarding performance, I've never tried it, but you might look at 
http://doc.bioperl.org/bioperl-live/Bio/Seq/SeqBuilder.html, which shows
you how to tell SeqIO that you only need to read sequence and features.

I'd be curious to know if it speeds things up for you...

If not, you could filter the input to remove all but essential lines.

Or, just run it and wait...

Malcolm Cook - mec@stowers-institute.org - 816-926-4449
Database Applications Manager - Bioinformatics
Stowers Institute for Medical Research - Kansas City, MO  USA 




>-----Original Message-----
>From: bioperl-l-bounces@portal.open-bio.org 
>[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Amit Indap
>Sent: Wednesday, December 14, 2005 10:18 AM
>To: bioperl-l@portal.open-bio.org
>Subject: [Bioperl-l] extracting CDS portion of RefSeqs
>
>Sorry, I hit send before I finished my email
>
>Anyways, I want to extract out the CDS portion of human refseqs. I
>downloaded the most recent refseq release in genbank format. I was
>extracting out the CDS portion this way:
>
> foreach my $feat ( $seq->get_SeqFeatures() ) {
>             if( $feat->primary_tag eq 'CDS' ) {
>		 my $start = $feat->start;
>		 my $end = $feat->end;
>		
>		 my $seqstr   = $seq->subseq($start,$end);
>		 my $displayid = $seq->display_name;
>		 my $seqobj = Bio::Seq->new( -display_id => 
>"$displayid:$start..$end",
>					     -seq => $seqstr);
>		 my $out = Bio::SeqIO->new(-format => 'Fasta');
>		 $out->write_seq($seqobj);
>
>But this is quite slow since the refseq genbank file is quite large.
>Is there anyway to download the CDS portion of refseq from NCBI? Is
>there a quicker BioPerl solution than the one I have?
>
>Thanks for your help.
>
>Amit
>
>--
>Amit Indap
>http://www.bscb.cornell.edu/Homepages/Amit_Indap/
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

From muratem at eng.uah.edu  Thu Dec 15 14:47:54 2005
From: muratem at eng.uah.edu (Mike Muratet)
Date: Thu Dec 15 14:45:33 2005
Subject: [Bioperl-l] Memory leak in Bio::Root::Root?
In-Reply-To: <43A05866.1050707@utk.edu>
References: <Pine.GSO.4.60.0512131007220.11597@zeus>
	<3221492C-8A26-42C8-ADF7-30FF98D45638@duke.edu>
	<Pine.GSO.4.60.0512141102290.24764@zeus> <43A05866.1050707@utk.edu>
Message-ID: <Pine.GSO.4.60.0512151342430.9590@zeus>



On Wed, 14 Dec 2005, Stefan Kirov wrote:

> My two cents: have you looked for cyclic referencing. Then your objects will 
> not get destroyed properly. You can try Devel::Cycle to track those. If you 
> post some more code we may have better idea what is going on.
> Stefan
>

I included Devel::Cycle and tried find_cycle($polyn) and 
find_cycle($nmer_statistics) but got no output. Can I assume that no 
references were found?

Here is the code for the max_polyn method:

sub max_polyn {

     my $seqobj;
     my $_is_strict;
     my $_is_instance = 1 ;
     my $self = shift @_;
     my $object_argument = shift @_;
     my ($maxpolyn, $tempmaxpolyn, $polya,$polyc,$polyg,$polyt, $tempseq , 
$lpolya, $lpolyc, $lpolyg, $lpolyt);


     if (defined $object_argument) {
         $_is_instance = 0;
     }

     # If we are using an instance object...
     if ($_is_instance) {
         if ($maxpolyn = $self->{'_max_polyn'}) {
             return $maxpolyn;        # return count if previously 
calculated
         }
         $_is_strict =  $self->{'_is_strict'}; # retrieve "strictness"
         $seqobj =  $self->{'_seqref'};
     } else {
          #  otherwise...
         $seqobj =  $object_argument;

     #  Following two lines lead to error in "throw" routine
         $seqobj->isa("Bio::PrimarySeqI") ||
             $self->throw(" SeqStats works only on PrimarySeqI objects 
\n");
         # is alphabet OK? Is it strict?
         #$_is_strict =  _is_alphabet_strict($seqobj);
     }

     $tempseq =   $seqobj->seq();
     #$gccontent =   100 * ($gc_cnt =~ 
tr/gcGC/gcGC/)/length($seqobj->seq());

     $maxpolyn = 0;
     my $lcount = 0;
     my $polyn;
     while ($lcount < length($seqobj->seq())) {

 	($polyn = $tempseq)  =~ s/^\w{$lcount}(\w)\w*$/$1/;

 	if ($polyn=~/a/i) {
 	    $lpolya++;
 	     $lpolyc =  $lpolyg =  $lpolyt = 0
 	}elsif ($polyn =~/c/i) {
 	    $lpolyc++;
 	     $lpolya = $lpolyg = $lpolyt = 0;
 	}elsif ($polyn =~/g/i) {
 	    $lpolyg++;
 	    $lpolya = $lpolyc = $lpolyt = 0;
 	}elsif ($polyn =~/t/i) {
 	    $lpolyt++;;
 	     $lpolya = $lpolyc = $lpolyg = 0;
 	}
 	($tempmaxpolyn ) = sort {$b <=> $a} $lpolya, $lpolyc, $lpolyg, 
$lpolyt;
 	$maxpolyn = $tempmaxpolyn if ($tempmaxpolyn > $maxpolyn);
 	$lcount++;
     }

     my ($rmaxpolyn) = \$maxpolyn;
     if ($_is_instance) {
         $self->{'_max_polyn'} = $rmaxpolyn;  # Save in case called again 
later
     }

     return  $rmaxpolyn;
}

Do you see anything that would create a memory leak?

Thanks for the help

Mike

> Mike Muratet wrote:
>
>> 
>> 
>> Jason
>> 
>>> 
>>> polyn returns a scalar object (blessed) or just some scalar data?
>>> If you are really calling QStat->polyn( $obj) then 'new' is never called 
>>> in the first place for the Qstat package.
>>> 
>> 
>> polyn returns a reference to some scalar data. My understanding is that 
>> 'new' would not be called, but then I'm at a loss to explain where all the 
>> extra memory goes.
>> 
>>> Destructors are automatic, but you can create your own to see when/if 
>>> the destructor is called.
>>> sub DESTROY {
>>> my $self =shift;
>>> warn("I am calling destroy in the Qstat object\n");
>>> $self->SUPER::DESTROY;
>>> }
>> 
>> 
>> I will try this.
>> 
>>> You can also inherit from Bio::Root::RootI and call bless on your own if 
>>> you want to play with whether this is Bio::Root::Root induced behavior. 
>>> I'm not sure I understand enough of how it works to tell you where else 
>>> to look.
>>> 
>> 
>> I will try this, too.
>> 
>>> Is a new $seq_obj getting created every iteration of the loop?  Are 
>>> these getting cleaned up or is Qstat keeping references  to them, and 
>>> they are sticking around?  Devel::Cycle doesn't show any memory cycles?
>>> 
>> 
>> A new $seq_obj gets created in every loop of the method that calls QStats 
>> with the $seq_obj as an argument, but I undef it at the bottom of the 
>> loop. Should this not be enough to get perl to recycle the memory? I 
>> haven't tried Devel::Cycle but I will include it to see what it says.
>> 
>> I saw on some of the perl lists a reference to a memory leak in perl 5.8 
>> with the s/// operator. Have you heard about such a problem?
>> 
>> Thanks for the help
>> 
>> Mike
>> 
>>> On Dec 13, 2005, at 11:32 AM, Mike Muratet wrote:
>>> 
>>>> Greetings all
>>>> 
>>>> I have a problem that surpasses what I know and what I've been able to 
>>>> glean from perltoot,perboot,etc. Maybe it's a question for a perl 
>>>> list, but here goes...
>>>> 
>>>> I was given a package that calculates some statistics regarding base 
>>>> repeats in a sequence. It inherits from Bio::Root::Root presumbably to 
>>>> obtain the exception behavior bestowed by the class judging from the 
>>>> perldocs and to enforce that the argument is a PrimarySeq object. It 
>>>> has
>>>> two methods which get called thus:
>>>> 
>>>> my $polyn = QStat->polyn($seq_obj);
>>>> my $nstat = QStat->nmer_stat($seq_obj);
>>>> 
>>>> where the returned values are scalar references. The problem is that 
>>>> script quickly uses up all of the 4GB address space (processing lots 
>>>> of oligos) and crashes.
>>>> 
>>>> I have used Devel::Size to determine the size of these variables and 
>>>> get 3.8K and 7K. I have tried to undef them at the end of the loop but 
>>>> it has no effect. I commented out the calls and the problem goes away 
>>>> so the problem is associated with the QStat object.
>>>> 
>>>> The QStat class has a constructor that calls the base constructor:
>>>>     my $self = $class->SUPER::new(@args);
>>>> would this demand a destructor somewhere?
>>>> 
>>>> Does calling a method out of a class like this invoke all the class 
>>>> machinery without creating the object with new?
>>>> 
>>>> Can someone with experience deriving from Bio::Root::Root offer some 
>>>> suggestions on how to get the memory back?
>>>> 
>>>> Thanks
>>>> 
>>>> Mike
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l@portal.open-bio.org
>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>> 
>>> 
>>> -- 
>>> Jason Stajich
>>> Duke University
>>> http://www.duke.edu/~jes12
>>> 
>>> 
>>> 
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l@portal.open-bio.org
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
> -- Stefan Kirov, Ph.D.
> University of Tennessee/Oak Ridge National Laboratory
> 5700 bldg, PO BOX 2008 MS6164
> Oak Ridge TN 37831-6164
> USA
> tel +865 576 5120
> fax +865-576-5332
> e-mail: skirov@utk.edu
> sao@ornl.gov
>
> "And the wars go on with brainwashed pride
> For the love of God and our human rights
> And all these things are swept aside"
>
>
From muratem at eng.uah.edu  Thu Dec 15 15:31:36 2005
From: muratem at eng.uah.edu (Mike Muratet)
Date: Thu Dec 15 15:29:16 2005
Subject: [Bioperl-l] Memory leak in Bio::Root::Root?
In-Reply-To: <43A05866.1050707@utk.edu>
References: <Pine.GSO.4.60.0512131007220.11597@zeus>
	<3221492C-8A26-42C8-ADF7-30FF98D45638@duke.edu>
	<Pine.GSO.4.60.0512141102290.24764@zeus> <43A05866.1050707@utk.edu>
Message-ID: <Pine.GSO.4.60.0512151424460.9590@zeus>

Hello Again

I have discovered a few things. I took the methods out of the package they 
were in and put them directly into the calling module with the result that 
the memory consumption increased with bound. I therefore conclude that it 
has nothing to do with the Qstat class or Bio::Root::Root.

By commenting out various portions of the methods I have discovered that 
the (a?) single offending line is is:

($polyn = $tempseq)  =~ s/^\w{$lcount}(\w)\w*$/$1/;

I'm off trying to understand why this keeps sucking up memory.

Mike

On Wed, 14 Dec 2005, Stefan Kirov wrote:

> My two cents: have you looked for cyclic referencing. Then your objects will 
> not get destroyed properly. You can try Devel::Cycle to track those. If you 
> post some more code we may have better idea what is going on.
> Stefan
>
> Mike Muratet wrote:
>
>> 
>> 
>> Jason
>> 
>>> 
>>> polyn returns a scalar object (blessed) or just some scalar data?
>>> If you are really calling QStat->polyn( $obj) then 'new' is never called 
>>> in the first place for the Qstat package.
>>> 
>> 
>> polyn returns a reference to some scalar data. My understanding is that 
>> 'new' would not be called, but then I'm at a loss to explain where all the 
>> extra memory goes.
>> 
>>> Destructors are automatic, but you can create your own to see when/if 
>>> the destructor is called.
>>> sub DESTROY {
>>> my $self =shift;
>>> warn("I am calling destroy in the Qstat object\n");
>>> $self->SUPER::DESTROY;
>>> }
>> 
>> 
>> I will try this.
>> 
>>> You can also inherit from Bio::Root::RootI and call bless on your own if 
>>> you want to play with whether this is Bio::Root::Root induced behavior. 
>>> I'm not sure I understand enough of how it works to tell you where else 
>>> to look.
>>> 
>> 
>> I will try this, too.
>> 
>>> Is a new $seq_obj getting created every iteration of the loop?  Are 
>>> these getting cleaned up or is Qstat keeping references  to them, and 
>>> they are sticking around?  Devel::Cycle doesn't show any memory cycles?
>>> 
>> 
>> A new $seq_obj gets created in every loop of the method that calls QStats 
>> with the $seq_obj as an argument, but I undef it at the bottom of the 
>> loop. Should this not be enough to get perl to recycle the memory? I 
>> haven't tried Devel::Cycle but I will include it to see what it says.
>> 
>> I saw on some of the perl lists a reference to a memory leak in perl 5.8 
>> with the s/// operator. Have you heard about such a problem?
>> 
>> Thanks for the help
>> 
>> Mike
>> 
>>> On Dec 13, 2005, at 11:32 AM, Mike Muratet wrote:
>>> 
>>>> Greetings all
>>>> 
>>>> I have a problem that surpasses what I know and what I've been able to 
>>>> glean from perltoot,perboot,etc. Maybe it's a question for a perl 
>>>> list, but here goes...
>>>> 
>>>> I was given a package that calculates some statistics regarding base 
>>>> repeats in a sequence. It inherits from Bio::Root::Root presumbably to 
>>>> obtain the exception behavior bestowed by the class judging from the 
>>>> perldocs and to enforce that the argument is a PrimarySeq object. It 
>>>> has
>>>> two methods which get called thus:
>>>> 
>>>> my $polyn = QStat->polyn($seq_obj);
>>>> my $nstat = QStat->nmer_stat($seq_obj);
>>>> 
>>>> where the returned values are scalar references. The problem is that 
>>>> script quickly uses up all of the 4GB address space (processing lots 
>>>> of oligos) and crashes.
>>>> 
>>>> I have used Devel::Size to determine the size of these variables and 
>>>> get 3.8K and 7K. I have tried to undef them at the end of the loop but 
>>>> it has no effect. I commented out the calls and the problem goes away 
>>>> so the problem is associated with the QStat object.
>>>> 
>>>> The QStat class has a constructor that calls the base constructor:
>>>>     my $self = $class->SUPER::new(@args);
>>>> would this demand a destructor somewhere?
>>>> 
>>>> Does calling a method out of a class like this invoke all the class 
>>>> machinery without creating the object with new?
>>>> 
>>>> Can someone with experience deriving from Bio::Root::Root offer some 
>>>> suggestions on how to get the memory back?
>>>> 
>>>> Thanks
>>>> 
>>>> Mike
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l@portal.open-bio.org
>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>> 
>>> 
>>> -- 
>>> Jason Stajich
>>> Duke University
>>> http://www.duke.edu/~jes12
>>> 
>>> 
>>> 
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l@portal.open-bio.org
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
> -- Stefan Kirov, Ph.D.
> University of Tennessee/Oak Ridge National Laboratory
> 5700 bldg, PO BOX 2008 MS6164
> Oak Ridge TN 37831-6164
> USA
> tel +865 576 5120
> fax +865-576-5332
> e-mail: skirov@utk.edu
> sao@ornl.gov
>
> "And the wars go on with brainwashed pride
> For the love of God and our human rights
> And all these things are swept aside"
>
>
From skirov at utk.edu  Thu Dec 15 15:46:49 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Thu Dec 15 15:44:20 2005
Subject: [Bioperl-l] Memory leak in Bio::Root::Root?
In-Reply-To: <Pine.GSO.4.60.0512151342430.9590@zeus>
References: <Pine.GSO.4.60.0512131007220.11597@zeus>
	<3221492C-8A26-42C8-ADF7-30FF98D45638@duke.edu>
	<Pine.GSO.4.60.0512141102290.24764@zeus> <43A05866.1050707@utk.edu>
	<Pine.GSO.4.60.0512151342430.9590@zeus>
Message-ID: <43A1D639.7060806@utk.edu>

You should check find_cycle($self) and the same for seqobj. Also 
shouldn't it be
my $tempseq =   $seqobj->seq();
as opposed to
$tempseq =   $seqobj->seq();
I don't see anything wrong with the regexp (your next post).
Stefan


Mike Muratet wrote:

>
>
> On Wed, 14 Dec 2005, Stefan Kirov wrote:
>
>> My two cents: have you looked for cyclic referencing. Then your 
>> objects will not get destroyed properly. You can try Devel::Cycle to 
>> track those. If you post some more code we may have better idea what 
>> is going on.
>> Stefan
>>
>
> I included Devel::Cycle and tried find_cycle($polyn) and 
> find_cycle($nmer_statistics) but got no output. Can I assume that no 
> references were found?
>
> Here is the code for the max_polyn method:
>
> sub max_polyn {
>
>     my $seqobj;
>     my $_is_strict;
>     my $_is_instance = 1 ;
>     my $self = shift @_;
>     my $object_argument = shift @_;
>     my ($maxpolyn, $tempmaxpolyn, $polya,$polyc,$polyg,$polyt, 
> $tempseq , $lpolya, $lpolyc, $lpolyg, $lpolyt);
>
>
>     if (defined $object_argument) {
>         $_is_instance = 0;
>     }
>
>     # If we are using an instance object...
>     if ($_is_instance) {
>         if ($maxpolyn = $self->{'_max_polyn'}) {
>             return $maxpolyn;        # return count if previously 
> calculated
>         }
>         $_is_strict =  $self->{'_is_strict'}; # retrieve "strictness"
>         $seqobj =  $self->{'_seqref'};
>     } else {
>          #  otherwise...
>         $seqobj =  $object_argument;
>
>     #  Following two lines lead to error in "throw" routine
>         $seqobj->isa("Bio::PrimarySeqI") ||
>             $self->throw(" SeqStats works only on PrimarySeqI objects 
> \n");
>         # is alphabet OK? Is it strict?
>         #$_is_strict =  _is_alphabet_strict($seqobj);
>     }
>
>     $tempseq =   $seqobj->seq();
>     #$gccontent =   100 * ($gc_cnt =~ 
> tr/gcGC/gcGC/)/length($seqobj->seq());
>
>     $maxpolyn = 0;
>     my $lcount = 0;
>     my $polyn;
>     while ($lcount < length($seqobj->seq())) {
>
>     ($polyn = $tempseq)  =~ s/^\w{$lcount}(\w)\w*$/$1/;
>
>     if ($polyn=~/a/i) {
>         $lpolya++;
>          $lpolyc =  $lpolyg =  $lpolyt = 0
>     }elsif ($polyn =~/c/i) {
>         $lpolyc++;
>          $lpolya = $lpolyg = $lpolyt = 0;
>     }elsif ($polyn =~/g/i) {
>         $lpolyg++;
>         $lpolya = $lpolyc = $lpolyt = 0;
>     }elsif ($polyn =~/t/i) {
>         $lpolyt++;;
>          $lpolya = $lpolyc = $lpolyg = 0;
>     }
>     ($tempmaxpolyn ) = sort {$b <=> $a} $lpolya, $lpolyc, $lpolyg, 
> $lpolyt;
>     $maxpolyn = $tempmaxpolyn if ($tempmaxpolyn > $maxpolyn);
>     $lcount++;
>     }
>
>     my ($rmaxpolyn) = \$maxpolyn;
>     if ($_is_instance) {
>         $self->{'_max_polyn'} = $rmaxpolyn;  # Save in case called 
> again later
>     }
>
>     return  $rmaxpolyn;
> }
>
> Do you see anything that would create a memory leak?
>
> Thanks for the help
>
> Mike
>
>> Mike Muratet wrote:
>>
>>>
>>>
>>> Jason
>>>
>>>>
>>>> polyn returns a scalar object (blessed) or just some scalar data?
>>>> If you are really calling QStat->polyn( $obj) then 'new' is never 
>>>> called in the first place for the Qstat package.
>>>>
>>>
>>> polyn returns a reference to some scalar data. My understanding is 
>>> that 'new' would not be called, but then I'm at a loss to explain 
>>> where all the extra memory goes.
>>>
>>>> Destructors are automatic, but you can create your own to see 
>>>> when/if the destructor is called.
>>>> sub DESTROY {
>>>> my $self =shift;
>>>> warn("I am calling destroy in the Qstat object\n");
>>>> $self->SUPER::DESTROY;
>>>> }
>>>
>>>
>>>
>>> I will try this.
>>>
>>>> You can also inherit from Bio::Root::RootI and call bless on your 
>>>> own if you want to play with whether this is Bio::Root::Root 
>>>> induced behavior. I'm not sure I understand enough of how it works 
>>>> to tell you where else to look.
>>>>
>>>
>>> I will try this, too.
>>>
>>>> Is a new $seq_obj getting created every iteration of the loop?  Are 
>>>> these getting cleaned up or is Qstat keeping references  to them, 
>>>> and they are sticking around?  Devel::Cycle doesn't show any memory 
>>>> cycles?
>>>>
>>>
>>> A new $seq_obj gets created in every loop of the method that calls 
>>> QStats with the $seq_obj as an argument, but I undef it at the 
>>> bottom of the loop. Should this not be enough to get perl to recycle 
>>> the memory? I haven't tried Devel::Cycle but I will include it to 
>>> see what it says.
>>>
>>> I saw on some of the perl lists a reference to a memory leak in perl 
>>> 5.8 with the s/// operator. Have you heard about such a problem?
>>>
>>> Thanks for the help
>>>
>>> Mike
>>>
>>>> On Dec 13, 2005, at 11:32 AM, Mike Muratet wrote:
>>>>
>>>>> Greetings all
>>>>>
>>>>> I have a problem that surpasses what I know and what I've been 
>>>>> able to glean from perltoot,perboot,etc. Maybe it's a question for 
>>>>> a perl list, but here goes...
>>>>>
>>>>> I was given a package that calculates some statistics regarding 
>>>>> base repeats in a sequence. It inherits from Bio::Root::Root 
>>>>> presumbably to obtain the exception behavior bestowed by the class 
>>>>> judging from the perldocs and to enforce that the argument is a 
>>>>> PrimarySeq object. It has
>>>>> two methods which get called thus:
>>>>>
>>>>> my $polyn = QStat->polyn($seq_obj);
>>>>> my $nstat = QStat->nmer_stat($seq_obj);
>>>>>
>>>>> where the returned values are scalar references. The problem is 
>>>>> that script quickly uses up all of the 4GB address space 
>>>>> (processing lots of oligos) and crashes.
>>>>>
>>>>> I have used Devel::Size to determine the size of these variables 
>>>>> and get 3.8K and 7K. I have tried to undef them at the end of the 
>>>>> loop but it has no effect. I commented out the calls and the 
>>>>> problem goes away so the problem is associated with the QStat object.
>>>>>
>>>>> The QStat class has a constructor that calls the base constructor:
>>>>>     my $self = $class->SUPER::new(@args);
>>>>> would this demand a destructor somewhere?
>>>>>
>>>>> Does calling a method out of a class like this invoke all the 
>>>>> class machinery without creating the object with new?
>>>>>
>>>>> Can someone with experience deriving from Bio::Root::Root offer 
>>>>> some suggestions on how to get the memory back?
>>>>>
>>>>> Thanks
>>>>>
>>>>> Mike
>>>>> _______________________________________________
>>>>> Bioperl-l mailing list
>>>>> Bioperl-l@portal.open-bio.org
>>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>>
>>>>
>>>> -- 
>>>> Jason Stajich
>>>> Duke University
>>>> http://www.duke.edu/~jes12
>>>>
>>>>
>>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l@portal.open-bio.org
>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
>>
>> -- Stefan Kirov, Ph.D.
>> University of Tennessee/Oak Ridge National Laboratory
>> 5700 bldg, PO BOX 2008 MS6164
>> Oak Ridge TN 37831-6164
>> USA
>> tel +865 576 5120
>> fax +865-576-5332
>> e-mail: skirov@utk.edu
>> sao@ornl.gov
>>
>> "And the wars go on with brainwashed pride
>> For the love of God and our human rights
>> And all these things are swept aside"
>>
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


-- 
Stefan Kirov, Ph.D.
University of Tennessee/Oak Ridge National Laboratory
5700 bldg, PO BOX 2008 MS6164
Oak Ridge TN 37831-6164
USA
tel +865 576 5120
fax +865-576-5332
e-mail: skirov@utk.edu
sao@ornl.gov

"And the wars go on with brainwashed pride
For the love of God and our human rights
And all these things are swept aside"

From muratem at eng.uah.edu  Thu Dec 15 17:06:12 2005
From: muratem at eng.uah.edu (Mike Muratet)
Date: Thu Dec 15 17:03:46 2005
Subject: [Bioperl-l] Memory leak in Bio::Root::Root?
In-Reply-To: <1134680844.1415.5.camel@chauvel.csse.monash.edu.au>
References: <Pine.GSO.4.60.0512131007220.11597@zeus>
	<3221492C-8A26-42C8-ADF7-30FF98D45638@duke.edu>
	<Pine.GSO.4.60.0512141102290.24764@zeus>
	<43A05866.1050707@utk.edu> <Pine.GSO.4.60.0512151424460.9590@zeus>
	<1134680844.1415.5.camel@chauvel.csse.monash.edu.au>
Message-ID: <Pine.GSO.4.60.0512151558320.9590@zeus>



On Fri, 16 Dec 2005, Torsten Seemann wrote:

> Mike,
>
>> By commenting out various portions of the methods I have discovered that
>> the (a?) single offending line is is:
>> I'm off trying to understand why this keeps sucking up memory
>>
>> ($polyn = $tempseq)  =~ s/^\w{$lcount}(\w)\w*$/$1/;
>
> You could try replacing those lines with:
>
> $polyn = $tempseq;
> my $minw = $lcount+1;
> if ($polyn =~ m/^\w{$minw,}$/) {
>  $polyn = substr($polyn, $lcount, 1);
> }
>
> and see if it chnages the behaviour?
>
> (And please correct my logic if it is wrong :-)
>

Thanks to Jason, Stefan and Torsen for the help.

I can't see anything wrong with the regular expression, either, except 
that it is inefficient as noted above and by Jason. I'll take the issue 
over to the perl lists and see if anybody has anything to say. In any 
event, Torsten's logic above is similar to that in a script I found by 
Google at stein.cshl.org as part of a perl course. It seems to me that you 
should be able to write a regular expression which would just find the 
longest repeat (because it's greedy) and I've seen some posts that do 
things like /(.)[^\1]+\1/ but I can't seem to get anything like this to 
work the way I expect or need. So, I'll use the loop to find the longest 
repeat.

Thanks

Mike


> --
> Torsten Seemann <torsten.seemann@infotech.monash.edu.au>
> Victorian Bioinformatics Consortium
>
>
From angshu96 at gmail.com  Thu Dec 15 18:10:56 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Thu Dec 15 18:08:15 2005
Subject: [Bioperl-l] load_seqdatabase failed to run with .gbk
Message-ID: <df8328740512151510m57b24db4tc2d908956dc44903@mail.gmail.com>

Hi,

The load_seqdatabase.pl failed to run with .gbk:

akar@denton2 ~]$ ./load_seqdatabase.pl --dbname=USDA --dbuser=postgres
--format=genbank  --driver=Pg --debug  NC_003076.gbk
Loading NC_003076.gbk ...
attempting to load adaptor class for Bio::Seq::RichSeq
        attempting to load module Bio::DB::BioSQL::RichSeqAdaptor
attempting to load adaptor class for Bio::Seq
        attempting to load module Bio::DB::BioSQL::SeqAdaptor
instantiating adaptor class Bio::DB::BioSQL::SeqAdaptor
attempting to load adaptor class for Bio::Species
        attempting to load module Bio::DB::BioSQL::SpeciesAdaptor
instantiating adaptor class Bio::DB::BioSQL::SpeciesAdaptor
attempting to load adaptor class for Bio::Annotation::Collection
        attempting to load module Bio::DB::BioSQL::CollectionAdaptor
attempting to load adaptor class for Bio::Root::Root
        attempting to load module Bio::DB::BioSQL::RootAdaptor
attempting to load adaptor class for Bio::Root::RootI
        attempting to load module Bio::DB::BioSQL::RootIAdaptor
        attempting to load module Bio::DB::BioSQL::RootAdaptor
attempting to load adaptor class for Bio::AnnotationCollectionI
        attempting to load module
Bio::DB::BioSQL::AnnotationCollectionIAdaptor
        attempting to load module
Bio::DB::BioSQL::AnnotationCollectionAdaptor
instantiating adaptor class Bio::DB::BioSQL::AnnotationCollectionAdaptor
attempting to load adaptor class for Bio::Annotation::TypeManager
        attempting to load module Bio::DB::BioSQL::TypeManagerAdaptor
no adaptor found for class Bio::Annotation::TypeManager
attempting to load adaptor class for Bio::Annotation::SimpleValue
        attempting to load module Bio::DB::BioSQL::SimpleValueAdaptor
instantiating adaptor class Bio::DB::BioSQL::SimpleValueAdaptor
attempting to load adaptor class for Bio::Annotation::Comment
        attempting to load module Bio::DB::BioSQL::CommentAdaptor
instantiating adaptor class Bio::DB::BioSQL::CommentAdaptor
attempting to load adaptor class for Bio::PrimarySeq
        attempting to load module Bio::DB::BioSQL::PrimarySeqAdaptor
instantiating adaptor class Bio::DB::BioSQL::PrimarySeqAdaptor
attempting to load adaptor class for Bio::SeqFeature::Generic
        attempting to load module Bio::DB::BioSQL::GenericAdaptor
attempting to load adaptor class for Bio::SeqFeatureI
        attempting to load module Bio::DB::BioSQL::SeqFeatureIAdaptor
        attempting to load module Bio::DB::BioSQL::SeqFeatureAdaptor
instantiating adaptor class Bio::DB::BioSQL::SeqFeatureAdaptor
attempting to load adaptor class for Bio::Location::Simple
        attempting to load module Bio::DB::BioSQL::SimpleAdaptor
attempting to load adaptor class for Bio::Location::Atomic
        attempting to load module Bio::DB::BioSQL::AtomicAdaptor
attempting to load adaptor class for Bio::LocationI
        attempting to load module Bio::DB::BioSQL::LocationIAdaptor
        attempting to load module Bio::DB::BioSQL::LocationAdaptor
instantiating adaptor class Bio::DB::BioSQL::LocationAdaptor
attempting to load adaptor class for Bio::Location::Split
        attempting to load module Bio::DB::BioSQL::SplitAdaptor
attempting to load adaptor class for Bio::Location::Fuzzy
        attempting to load module Bio::DB::BioSQL::FuzzyAdaptor
no adaptor found for class Bio::Annotation::TypeManager
attempting to load adaptor class for BioNamespace
        attempting to load module Bio::DB::BioSQL::BioNamespaceAdaptor
instantiating adaptor class Bio::DB::BioSQL::BioNamespaceAdaptor
no adaptor found for class Bio::Annotation::TypeManager
attempting to load driver for adaptor class
Bio::DB::BioSQL::BioNamespaceAdaptor
attempting to load driver for adaptor class
Bio::DB::BioSQL::BasePersistenceAdaptor
Using Bio::DB::BioSQL::Pg::BasePersistenceAdaptorDriver as driver peer for
Bio::DB::BioSQL::BioNamespaceAdaptor
preparing UK select statement: SELECT biodatabase.biodatabase_id,
biodatabase.name, biodatabase.authority FROM biodatabase WHERE name = ?
BioNamespaceAdaptor: binding UK column 1 to "bioperl" (namespace)
preparing INSERT statement: INSERT INTO biodatabase (name, authority) VALUES
(?, ?)
BioNamespaceAdaptor::insert: binding column 1 to "bioperl" (namespace)
BioNamespaceAdaptor::insert: binding column 2 to "" (authority)
attempting to load driver for adaptor class Bio::DB::BioSQL::SpeciesAdaptor
Using Bio::DB::BioSQL::Pg::SpeciesAdaptorDriver as driver peer for
Bio::DB::BioSQL::SpeciesAdaptor
preparing UK select statement: SELECT taxon_name.taxon_id, NULL, NULL,
taxon.ncbi_taxon_id, taxon_name.name, NULL FROM taxon, taxon_name WHERE
taxon.taxon_id = taxon_name.taxon_id AND name_class = ? AND ncbi_taxon_id =
?
SpeciesAdaptor: binding UK column 1 to "scientific name" (name_class)
SpeciesAdaptor: binding UK column 2 to "3702" (ncbi_taxid)
prepare SELECT CLASSIFICATION: SELECT name.name, node.node_rank FROM taxon
node, taxon taxon, taxon_name name WHERE name.taxon_id = node.taxon_id AND
taxon.left_value BETWEEN node.left_value AND node.right_value AND
taxon.taxon_id = ? AND name.name_class = 'scientific name' ORDER BY
node.left_value
attempting to load driver for adaptor class Bio::DB::BioSQL::SeqAdaptor
attempting to load driver for adaptor class
Bio::DB::BioSQL::PrimarySeqAdaptor
attempting to load driver for adaptor class
Bio::DB::BioSQL::BasePersistenceAdaptor
Using Bio::DB::BioSQL::Pg::BasePersistenceAdaptorDriver as driver peer for
Bio::DB::BioSQL::SeqAdaptor
preparing INSERT statement: INSERT INTO bioentry (name, identifier,
accession, description, version, division, biodatabase_id, taxon_id) VALUES
(?, ?, ?, ?, ?, ?, ?, ?)
SeqAdaptor::insert: binding column 1 to "NC_003076" (display_id)
SeqAdaptor::insert: binding column 2 to "30698605" (primary_id)
SeqAdaptor::insert: binding column 3 to "NC_003076" (accession_number)
SeqAdaptor::insert: binding column 4 to "Arabidopsis thaliana chromosome 5,
complete sequence." (desc)
SeqAdaptor::insert: binding column 5 to "4" (version)
SeqAdaptor::insert: binding column 6 to "PLN" (division)
SeqAdaptor::insert: binding column 7 to "14" (FK to
Bio::DB::Persistent::BioNamespace)
SeqAdaptor::insert: binding column 8 to "3702" (FK to Bio::Species)
attempting to load adaptor class for Biosequence
        attempting to load module Bio::DB::BioSQL::BiosequenceAdaptor
instantiating adaptor class Bio::DB::BioSQL::BiosequenceAdaptor
no adaptor found for class Bio::Annotation::TypeManager
attempting to load driver for adaptor class
Bio::DB::BioSQL::BiosequenceAdaptor
Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as driver peer for
Bio::DB::BioSQL::BiosequenceAdaptor
preparing SELECT statement: SELECT bioentry_id FROM biosequence WHERE
bioentry_id = ?
Killed

Appreciate your guidance.

Thanks,
Angshu


On 12/13/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
> Sure enough I should have checked whether you haven't responded already
> :-)
>
> On Dec 13, 2005, at 12:09 AM, Marc Logghe wrote:
>
> > Hi,
> >
> >> -----Original Message-----
> >> From: bioperl-l-bounces@portal.open-bio.org
> >> [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Angshu Kar
> >> Sent: Tuesday, December 13, 2005 2:57 AM
> >> To: bioperl-l
> >> Subject: [Bioperl-l] urgent:load_seqdatabase.pl doesn't seem
> >> to like fasta...
> >>
> >> Hi,
> >>
> >> This is the format that I've :
> >>
> >>> At1g01010.1 68414.m00001 no apical meristem (NAM) family protein
> >>> contains
> >> Pfam PF02365: No apical meristem (NAM) domain; sim ilar to
> >> NAC domain protein NAM GB: AAD17313 GI:4325282 from
> >> [Arabidopsis thaliana]
> >>
> >> And with regard to the following discussion:
> >>
> >> http://bioperl.org/pipermail/bioperl-l/2004-June/016198.html
> >>
> >> Could anyone please let me know whether any fixes have been
> >> done for this?
> >
> > Did you transfer the display_id to the accession_number slot ? See
> > recent discussions at
> > http://portal.open-bio.org/pipermail/bioperl-l/2005-August/019579.html
> > and links inside.
> > HTH,
> > Marc
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From torsten.seemann at infotech.monash.edu.au  Thu Dec 15 16:07:24 2005
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Thu Dec 15 21:27:38 2005
Subject: [Bioperl-l] Memory leak in Bio::Root::Root?
In-Reply-To: <Pine.GSO.4.60.0512151424460.9590@zeus>
References: <Pine.GSO.4.60.0512131007220.11597@zeus>
	<3221492C-8A26-42C8-ADF7-30FF98D45638@duke.edu>
	<Pine.GSO.4.60.0512141102290.24764@zeus> <43A05866.1050707@utk.edu>
	<Pine.GSO.4.60.0512151424460.9590@zeus>
Message-ID: <1134680844.1415.5.camel@chauvel.csse.monash.edu.au>

Mike,

> By commenting out various portions of the methods I have discovered that 
> the (a?) single offending line is is:
> I'm off trying to understand why this keeps sucking up memory
>
> ($polyn = $tempseq)  =~ s/^\w{$lcount}(\w)\w*$/$1/;

You could try replacing those lines with:

$polyn = $tempseq;
my $minw = $lcount+1;
if ($polyn =~ m/^\w{$minw,}$/) {
  $polyn = substr($polyn, $lcount, 1);
}

and see if it chnages the behaviour?

(And please correct my logic if it is wrong :-)

-- 
Torsten Seemann <torsten.seemann@infotech.monash.edu.au>
Victorian Bioinformatics Consortium

From sdavis2 at mail.nih.gov  Fri Dec 16 06:26:48 2005
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Fri Dec 16 06:24:09 2005
Subject: [Bioperl-l] load_seqdatabase failed to run with .gbk
In-Reply-To: <df8328740512151510m57b24db4tc2d908956dc44903@mail.gmail.com>
Message-ID: <BFC80EA8.1BD9%sdavis2@mail.nih.gov>




On 12/15/05 6:10 PM, "Angshu Kar" <angshu96@gmail.com> wrote:

> Hi,
> 
> The load_seqdatabase.pl failed to run with .gbk:
> 
> akar@denton2 ~]$ ./load_seqdatabase.pl --dbname=USDA --dbuser=postgres
> --format=genbank  --driver=Pg --debug  NC_003076.gbk
> Loading NC_003076.gbk ...
> attempting to load adaptor class for Bio::Seq::RichSeq
>         attempting to load module Bio::DB::BioSQL::RichSeqAdaptor
> attempting to load adaptor class for Bio::Seq
>         attempting to load module Bio::DB::BioSQL::SeqAdaptor
> instantiating adaptor class Bio::DB::BioSQL::SeqAdaptor
> attempting to load adaptor class for Bio::Species
>         attempting to load module Bio::DB::BioSQL::SpeciesAdaptor
> instantiating adaptor class Bio::DB::BioSQL::SpeciesAdaptor
> attempting to load adaptor class for Bio::Annotation::Collection
>         attempting to load module Bio::DB::BioSQL::CollectionAdaptor
> attempting to load adaptor class for Bio::Root::Root
>         attempting to load module Bio::DB::BioSQL::RootAdaptor
> attempting to load adaptor class for Bio::Root::RootI
>         attempting to load module Bio::DB::BioSQL::RootIAdaptor
>         attempting to load module Bio::DB::BioSQL::RootAdaptor
> attempting to load adaptor class for Bio::AnnotationCollectionI
>         attempting to load module
> Bio::DB::BioSQL::AnnotationCollectionIAdaptor
>         attempting to load module
> Bio::DB::BioSQL::AnnotationCollectionAdaptor
> instantiating adaptor class Bio::DB::BioSQL::AnnotationCollectionAdaptor
> attempting to load adaptor class for Bio::Annotation::TypeManager
>         attempting to load module Bio::DB::BioSQL::TypeManagerAdaptor
> no adaptor found for class Bio::Annotation::TypeManager
> attempting to load adaptor class for Bio::Annotation::SimpleValue
>         attempting to load module Bio::DB::BioSQL::SimpleValueAdaptor
> instantiating adaptor class Bio::DB::BioSQL::SimpleValueAdaptor
> attempting to load adaptor class for Bio::Annotation::Comment
>         attempting to load module Bio::DB::BioSQL::CommentAdaptor
> instantiating adaptor class Bio::DB::BioSQL::CommentAdaptor
> attempting to load adaptor class for Bio::PrimarySeq
>         attempting to load module Bio::DB::BioSQL::PrimarySeqAdaptor
> instantiating adaptor class Bio::DB::BioSQL::PrimarySeqAdaptor
> attempting to load adaptor class for Bio::SeqFeature::Generic
>         attempting to load module Bio::DB::BioSQL::GenericAdaptor
> attempting to load adaptor class for Bio::SeqFeatureI
>         attempting to load module Bio::DB::BioSQL::SeqFeatureIAdaptor
>         attempting to load module Bio::DB::BioSQL::SeqFeatureAdaptor
> instantiating adaptor class Bio::DB::BioSQL::SeqFeatureAdaptor
> attempting to load adaptor class for Bio::Location::Simple
>         attempting to load module Bio::DB::BioSQL::SimpleAdaptor
> attempting to load adaptor class for Bio::Location::Atomic
>         attempting to load module Bio::DB::BioSQL::AtomicAdaptor
> attempting to load adaptor class for Bio::LocationI
>         attempting to load module Bio::DB::BioSQL::LocationIAdaptor
>         attempting to load module Bio::DB::BioSQL::LocationAdaptor
> instantiating adaptor class Bio::DB::BioSQL::LocationAdaptor
> attempting to load adaptor class for Bio::Location::Split
>         attempting to load module Bio::DB::BioSQL::SplitAdaptor
> attempting to load adaptor class for Bio::Location::Fuzzy
>         attempting to load module Bio::DB::BioSQL::FuzzyAdaptor
> no adaptor found for class Bio::Annotation::TypeManager
> attempting to load adaptor class for BioNamespace
>         attempting to load module Bio::DB::BioSQL::BioNamespaceAdaptor
> instantiating adaptor class Bio::DB::BioSQL::BioNamespaceAdaptor
> no adaptor found for class Bio::Annotation::TypeManager
> attempting to load driver for adaptor class
> Bio::DB::BioSQL::BioNamespaceAdaptor
> attempting to load driver for adaptor class
> Bio::DB::BioSQL::BasePersistenceAdaptor
> Using Bio::DB::BioSQL::Pg::BasePersistenceAdaptorDriver as driver peer for
> Bio::DB::BioSQL::BioNamespaceAdaptor
> preparing UK select statement: SELECT biodatabase.biodatabase_id,
> biodatabase.name, biodatabase.authority FROM biodatabase WHERE name = ?
> BioNamespaceAdaptor: binding UK column 1 to "bioperl" (namespace)
> preparing INSERT statement: INSERT INTO biodatabase (name, authority) VALUES
> (?, ?)
> BioNamespaceAdaptor::insert: binding column 1 to "bioperl" (namespace)
> BioNamespaceAdaptor::insert: binding column 2 to "" (authority)
> attempting to load driver for adaptor class Bio::DB::BioSQL::SpeciesAdaptor
> Using Bio::DB::BioSQL::Pg::SpeciesAdaptorDriver as driver peer for
> Bio::DB::BioSQL::SpeciesAdaptor
> preparing UK select statement: SELECT taxon_name.taxon_id, NULL, NULL,
> taxon.ncbi_taxon_id, taxon_name.name, NULL FROM taxon, taxon_name WHERE
> taxon.taxon_id = taxon_name.taxon_id AND name_class = ? AND ncbi_taxon_id =
> ?
> SpeciesAdaptor: binding UK column 1 to "scientific name" (name_class)
> SpeciesAdaptor: binding UK column 2 to "3702" (ncbi_taxid)
> prepare SELECT CLASSIFICATION: SELECT name.name, node.node_rank FROM taxon
> node, taxon taxon, taxon_name name WHERE name.taxon_id = node.taxon_id AND
> taxon.left_value BETWEEN node.left_value AND node.right_value AND
> taxon.taxon_id = ? AND name.name_class = 'scientific name' ORDER BY
> node.left_value
> attempting to load driver for adaptor class Bio::DB::BioSQL::SeqAdaptor
> attempting to load driver for adaptor class
> Bio::DB::BioSQL::PrimarySeqAdaptor
> attempting to load driver for adaptor class
> Bio::DB::BioSQL::BasePersistenceAdaptor
> Using Bio::DB::BioSQL::Pg::BasePersistenceAdaptorDriver as driver peer for
> Bio::DB::BioSQL::SeqAdaptor
> preparing INSERT statement: INSERT INTO bioentry (name, identifier,
> accession, description, version, division, biodatabase_id, taxon_id) VALUES
> (?, ?, ?, ?, ?, ?, ?, ?)
> SeqAdaptor::insert: binding column 1 to "NC_003076" (display_id)
> SeqAdaptor::insert: binding column 2 to "30698605" (primary_id)
> SeqAdaptor::insert: binding column 3 to "NC_003076" (accession_number)
> SeqAdaptor::insert: binding column 4 to "Arabidopsis thaliana chromosome 5,
> complete sequence." (desc)
> SeqAdaptor::insert: binding column 5 to "4" (version)
> SeqAdaptor::insert: binding column 6 to "PLN" (division)
> SeqAdaptor::insert: binding column 7 to "14" (FK to
> Bio::DB::Persistent::BioNamespace)
> SeqAdaptor::insert: binding column 8 to "3702" (FK to Bio::Species)
> attempting to load adaptor class for Biosequence
>         attempting to load module Bio::DB::BioSQL::BiosequenceAdaptor
> instantiating adaptor class Bio::DB::BioSQL::BiosequenceAdaptor
> no adaptor found for class Bio::Annotation::TypeManager
> attempting to load driver for adaptor class
> Bio::DB::BioSQL::BiosequenceAdaptor
> Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as driver peer for
> Bio::DB::BioSQL::BiosequenceAdaptor
> preparing SELECT statement: SELECT bioentry_id FROM biosequence WHERE
> bioentry_id = ?
> Killed

What does "Killed" mean?  Did you get an error?

Sean


From osborne1 at optonline.net  Fri Dec 16 10:08:22 2005
From: osborne1 at optonline.net (Brian Osborne)
Date: Fri Dec 16 10:12:14 2005
Subject: [Bioperl-l] Re: [Bug 1837] Bio::Ext::Align
In-Reply-To: <20051216100458.nd1pfbch6sm8cgs4@imp1.uta.fi>
Message-ID: <BFC84296.679D%osborne1@optonline.net>

Jouni,

What happens when you change "1.5.1" to "1.51" in Bio/SeqIO/staden/read.pm?
Does "perl Makefile.PL" work?

Brian O


On 12/16/05 3:04 AM, "Jouni Valiaho" <Jouni.Valiaho@uta.fi> wrote:

> Hi Brian,
> 
> Thank you for your answer.
> I tried again to install the latest bioperl-ext package. The procedure
> is shown below.
> 
> $ wget http://bioperl.org/DIST/current_ext_unstable.tar.gz
> --08:57:25--  http://bioperl.org/DIST/current_ext_unstable.tar.gz
>           => `current_ext_unstable.tar.gz'
> Resolving bioperl.org... 65.246.187.176
> Connecting to bioperl.org|65.246.187.176|:80... connected.
> HTTP request sent, awaiting response... 200 OK
> Length: 398,120 (389K) [application/x-gzip]
> 
> 100%[====================================>] 398,120       98.74K/s
> ETA 00:00
> 
> 08:57:29 (98.51 KB/s) - `current_ext_unstable.tar.gz' saved [398120/398120]
> 
> $  tar -zxvf current_ext_unstable.tar.gz
> bioperl-ext-1.5.1/
> bioperl-ext-1.5.1/CVS/
> bioperl-ext-1.5.1/CVS/Root
> bioperl-ext-1.5.1/CVS/Repository
> bioperl-ext-1.5.1/CVS/Entries
> bioperl-ext-1.5.1/CVS/Tag
> bioperl-ext-1.5.1/Makefile.PL
> bioperl-ext-1.5.1/README
> bioperl-ext-1.5.1/Bio/
> bioperl-ext-1.5.1/Bio/CVS/
> bioperl-ext-1.5.1/Bio/CVS/Root
> bioperl-ext-1.5.1/Bio/CVS/Repository
> bioperl-ext-1.5.1/Bio/CVS/Entries
> bioperl-ext-1.5.1/Bio/CVS/Tag
> bioperl-ext-1.5.1/Bio/Ext/
> bioperl-ext-1.5.1/Bio/Ext/CVS/
> bioperl-ext-1.5.1/Bio/Ext/CVS/Root
> bioperl-ext-1.5.1/Bio/Ext/CVS/Repository
> bioperl-ext-1.5.1/Bio/Ext/CVS/Entries
> bioperl-ext-1.5.1/Bio/Ext/CVS/Tag
> bioperl-ext-1.5.1/Bio/Ext/Align/
> bioperl-ext-1.5.1/Bio/Ext/Align/CVS/
> bioperl-ext-1.5.1/Bio/Ext/Align/CVS/Root
> bioperl-ext-1.5.1/Bio/Ext/Align/CVS/Repository
> bioperl-ext-1.5.1/Bio/Ext/Align/CVS/Entries
> bioperl-ext-1.5.1/Bio/Ext/Align/CVS/Tag
> bioperl-ext-1.5.1/Bio/Ext/Align/Align.pm
> bioperl-ext-1.5.1/Bio/Ext/Align/Align.xs
> bioperl-ext-1.5.1/Bio/Ext/Align/Makefile.PL
> bioperl-ext-1.5.1/Bio/Ext/Align/blosum45.mat
> bioperl-ext-1.5.1/Bio/Ext/Align/blosum50.mat
> bioperl-ext-1.5.1/Bio/Ext/Align/blosum62.bla
> bioperl-ext-1.5.1/Bio/Ext/Align/blosum62.mat
> bioperl-ext-1.5.1/Bio/Ext/Align/md_20.mat
> bioperl-ext-1.5.1/Bio/Ext/Align/test.pl
> bioperl-ext-1.5.1/Bio/Ext/Align/typemap
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/CVS/
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/CVS/Root
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/CVS/Repository
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/CVS/Entries
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/CVS/Tag
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/aln.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/aln.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/alnconvert.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/alnconvert.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/alnrange.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/alnrange.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/asciibtcanvas.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/asciibtcanvas.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/basematrix.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/basematrix.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/btcanvas.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/btcanvas.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/codon.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/codon.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/commandline.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/commandline.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/complexconsensi.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/complexconsensi.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/complexevalset.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/complexevalset.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/complexsequence.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/complexsequence.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/compmat.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/compmat.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/database.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/dna.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/dna.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/dnamatrix.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/dnamatrix.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/dpalign.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/dpalign.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/dpenvelope.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/dpenvelope.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/dyna.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/dynlibcross.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/dynlibcross.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/histogram.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/histogram.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/hscore.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/hscore.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/linesubs.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/linesubs.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/linspc.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/makefile
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/packaln.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/packaln.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/probability.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/probability.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/protein.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/protein.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/proteindb.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/proteindb.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/proteinsw.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/proteinsw.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/seqaligndisplay.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/seqaligndisplay.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/sequence.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/sequence.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/sequencedb.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/sequencedb.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/sw.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/sw_wrap.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/sw_wrap.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/wisebase.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/wiseconfig.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/wiseconfig.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/wiseerror.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/wiseerror.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/wisefile.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/wisefile.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/wisememman.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/wisememman.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/wiseoverlay.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/wiseoverlay.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/wiserandom.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/wiserandom.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/wisestring.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/wisestring.h
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/wisetime.c
> bioperl-ext-1.5.1/Bio/Ext/Align/libs/wisetime.h
> bioperl-ext-1.5.1/Bio/Ext/HMM/
> bioperl-ext-1.5.1/Bio/Ext/HMM/CVS/
> bioperl-ext-1.5.1/Bio/Ext/HMM/CVS/Root
> bioperl-ext-1.5.1/Bio/Ext/HMM/CVS/Repository
> bioperl-ext-1.5.1/Bio/Ext/HMM/CVS/Entries
> bioperl-ext-1.5.1/Bio/Ext/HMM/CVS/Tag
> bioperl-ext-1.5.1/Bio/Ext/HMM/HMM.pm
> bioperl-ext-1.5.1/Bio/Ext/HMM/HMM.xs
> bioperl-ext-1.5.1/Bio/Ext/HMM/Makefile.PL
> bioperl-ext-1.5.1/Bio/Ext/HMM/hmm.h
> bioperl-ext-1.5.1/Bio/Ext/HMM/hmmlib.c
> bioperl-ext-1.5.1/Bio/Ext/HMM/test.pl
> bioperl-ext-1.5.1/Bio/Ext/HMM/typemap
> bioperl-ext-1.5.1/Bio/SeqIO/
> bioperl-ext-1.5.1/Bio/SeqIO/CVS/
> bioperl-ext-1.5.1/Bio/SeqIO/CVS/Root
> bioperl-ext-1.5.1/Bio/SeqIO/CVS/Repository
> bioperl-ext-1.5.1/Bio/SeqIO/CVS/Entries
> bioperl-ext-1.5.1/Bio/SeqIO/CVS/Tag
> bioperl-ext-1.5.1/Bio/SeqIO/staden/
> bioperl-ext-1.5.1/Bio/SeqIO/staden/CVS/
> bioperl-ext-1.5.1/Bio/SeqIO/staden/CVS/Root
> bioperl-ext-1.5.1/Bio/SeqIO/staden/CVS/Repository
> bioperl-ext-1.5.1/Bio/SeqIO/staden/CVS/Entries
> bioperl-ext-1.5.1/Bio/SeqIO/staden/CVS/Tag
> bioperl-ext-1.5.1/Bio/SeqIO/staden/Makefile.PL
> bioperl-ext-1.5.1/Bio/SeqIO/staden/read.pm
> bioperl-ext-1.5.1/Bio/SeqIO/staden/test.pl
> bioperl-ext-1.5.1/t/
> bioperl-ext-1.5.1/t/CVS/
> bioperl-ext-1.5.1/t/CVS/Root
> bioperl-ext-1.5.1/t/CVS/Repository
> bioperl-ext-1.5.1/t/CVS/Entries
> bioperl-ext-1.5.1/t/CVS/Tag
> bioperl-ext-1.5.1/t/Test.pm
> bioperl-ext-1.5.1/t/basic.t
> bioperl-ext-1.5.1/t/data/
> bioperl-ext-1.5.1/t/data/CVS/
> bioperl-ext-1.5.1/t/data/CVS/Root
> bioperl-ext-1.5.1/t/data/CVS/Repository
> bioperl-ext-1.5.1/t/data/CVS/Entries
> bioperl-ext-1.5.1/t/data/CVS/Tag
> bioperl-ext-1.5.1/t/data/readtest.abi
> bioperl-ext-1.5.1/t/data/readtest.ctf
> bioperl-ext-1.5.1/t/data/readtest.exp
> bioperl-ext-1.5.1/t/data/readtest.pln
> bioperl-ext-1.5.1/t/data/readtest.ztr
> bioperl-ext-1.5.1/t/data/readtestabi.fa
> bioperl-ext-1.5.1/t/data/readtestref.scf
> 
> $ cd bioperl-ext-1.5.1/
> 
> $ perl Makefile.PL
> Writing Makefile for Bio::Ext::Align
> ERROR from evaluation of
> /home/java/perl/bioperl-ext-1.5.1/Bio/SeqIO/staden/Makefile.PL:
> Invalid version '

' for Bio::SeqIO::staden::read.
> Must be of the form '#.##'. (For instance '1.23')
> at ./Makefile.PL line 4
> 
> It didn't make makefile
> 
> $ ls -a
> .  ..  Bio  CVS  Makefile.PL  README  t
> 
> 
> I guess that the problem above may not related to the bug I previously
> reported.
> I am sorry about minor information that I provided for bug report.
> I have only limited experiences about using perl and I have no
> experience about Perl
> Inline. I had no idea what kind information could be useful related to bug.
> 
> Regards,
> Jouni V?liaho
> 
> 
> Quoting bugzilla-daemon@portal.open-bio.org:
> 
>> http://bugzilla.open-bio.org/show_bug.cgi?id=1837
>> 
>> 
>> osborne1@optonline.net changed:
>> 
>>           What    |Removed                     |Added
>> ----------------------------------------------------------------------------
>>             Status|NEW                         |RESOLVED
>>         Resolution|                            |WORKSFORME
>> 
>> 
>> 
>> 
>> ------- Comment #1 from osborne1@optonline.net  2005-12-15 09:38 -------
>> Jouni, thank you for the submission. I think that I'll close this bug as I've
>> been able to install bioperl-ext without the manual copy you used. Without a
>> bit more information it's difficult to determine what went wrong with your
>> install and since everything works for you now...
>> 
>> 
>> 
>> 
>> ------- You are receiving this mail because: -------
>> You reported the bug, or are watching the reporter.
>> 
> 
> 
> 
> --------------------------------------------------------------------
> Jouni V?liaho, Research scientist       Phone: +358-3-215 8916
> Institute of Medical Technology         Fax: +358-3-215 7710
> FI-33014 University of Tampere          E-mail: jouni.valiaho@uta.fi
> Finland                                 http://bioinf.uta.fi/
> --------------------------------------------------------------------



From angshu96 at gmail.com  Fri Dec 16 10:27:05 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec 16 10:26:05 2005
Subject: [Bioperl-l] load_seqdatabase failed to run with .gbk
In-Reply-To: <BFC80EA8.1BD9%sdavis2@mail.nih.gov>
References: <df8328740512151510m57b24db4tc2d908956dc44903@mail.gmail.com>
	<BFC80EA8.1BD9%sdavis2@mail.nih.gov>
Message-ID: <df8328740512160727ne93bc1di243804b7deab8449@mail.gmail.com>

That was the entire  error msg when i used the debug option...and then
nothing got loaded in the tables...

On 12/16/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
>
>
>
>
> On 12/15/05 6:10 PM, "Angshu Kar" <angshu96@gmail.com> wrote:
>
> > Hi,
> >
> > The load_seqdatabase.pl failed to run with .gbk:
> >
> > akar@denton2 ~]$ ./load_seqdatabase.pl --dbname=USDA --dbuser=postgres
> > --format=genbank  --driver=Pg --debug  NC_003076.gbk
> > Loading NC_003076.gbk ...
> > attempting to load adaptor class for Bio::Seq::RichSeq
> >         attempting to load module Bio::DB::BioSQL::RichSeqAdaptor
> > attempting to load adaptor class for Bio::Seq
> >         attempting to load module Bio::DB::BioSQL::SeqAdaptor
> > instantiating adaptor class Bio::DB::BioSQL::SeqAdaptor
> > attempting to load adaptor class for Bio::Species
> >         attempting to load module Bio::DB::BioSQL::SpeciesAdaptor
> > instantiating adaptor class Bio::DB::BioSQL::SpeciesAdaptor
> > attempting to load adaptor class for Bio::Annotation::Collection
> >         attempting to load module Bio::DB::BioSQL::CollectionAdaptor
> > attempting to load adaptor class for Bio::Root::Root
> >         attempting to load module Bio::DB::BioSQL::RootAdaptor
> > attempting to load adaptor class for Bio::Root::RootI
> >         attempting to load module Bio::DB::BioSQL::RootIAdaptor
> >         attempting to load module Bio::DB::BioSQL::RootAdaptor
> > attempting to load adaptor class for Bio::AnnotationCollectionI
> >         attempting to load module
> > Bio::DB::BioSQL::AnnotationCollectionIAdaptor
> >         attempting to load module
> > Bio::DB::BioSQL::AnnotationCollectionAdaptor
> > instantiating adaptor class Bio::DB::BioSQL::AnnotationCollectionAdaptor
> > attempting to load adaptor class for Bio::Annotation::TypeManager
> >         attempting to load module Bio::DB::BioSQL::TypeManagerAdaptor
> > no adaptor found for class Bio::Annotation::TypeManager
> > attempting to load adaptor class for Bio::Annotation::SimpleValue
> >         attempting to load module Bio::DB::BioSQL::SimpleValueAdaptor
> > instantiating adaptor class Bio::DB::BioSQL::SimpleValueAdaptor
> > attempting to load adaptor class for Bio::Annotation::Comment
> >         attempting to load module Bio::DB::BioSQL::CommentAdaptor
> > instantiating adaptor class Bio::DB::BioSQL::CommentAdaptor
> > attempting to load adaptor class for Bio::PrimarySeq
> >         attempting to load module Bio::DB::BioSQL::PrimarySeqAdaptor
> > instantiating adaptor class Bio::DB::BioSQL::PrimarySeqAdaptor
> > attempting to load adaptor class for Bio::SeqFeature::Generic
> >         attempting to load module Bio::DB::BioSQL::GenericAdaptor
> > attempting to load adaptor class for Bio::SeqFeatureI
> >         attempting to load module Bio::DB::BioSQL::SeqFeatureIAdaptor
> >         attempting to load module Bio::DB::BioSQL::SeqFeatureAdaptor
> > instantiating adaptor class Bio::DB::BioSQL::SeqFeatureAdaptor
> > attempting to load adaptor class for Bio::Location::Simple
> >         attempting to load module Bio::DB::BioSQL::SimpleAdaptor
> > attempting to load adaptor class for Bio::Location::Atomic
> >         attempting to load module Bio::DB::BioSQL::AtomicAdaptor
> > attempting to load adaptor class for Bio::LocationI
> >         attempting to load module Bio::DB::BioSQL::LocationIAdaptor
> >         attempting to load module Bio::DB::BioSQL::LocationAdaptor
> > instantiating adaptor class Bio::DB::BioSQL::LocationAdaptor
> > attempting to load adaptor class for Bio::Location::Split
> >         attempting to load module Bio::DB::BioSQL::SplitAdaptor
> > attempting to load adaptor class for Bio::Location::Fuzzy
> >         attempting to load module Bio::DB::BioSQL::FuzzyAdaptor
> > no adaptor found for class Bio::Annotation::TypeManager
> > attempting to load adaptor class for BioNamespace
> >         attempting to load module Bio::DB::BioSQL::BioNamespaceAdaptor
> > instantiating adaptor class Bio::DB::BioSQL::BioNamespaceAdaptor
> > no adaptor found for class Bio::Annotation::TypeManager
> > attempting to load driver for adaptor class
> > Bio::DB::BioSQL::BioNamespaceAdaptor
> > attempting to load driver for adaptor class
> > Bio::DB::BioSQL::BasePersistenceAdaptor
> > Using Bio::DB::BioSQL::Pg::BasePersistenceAdaptorDriver as driver peer
> for
> > Bio::DB::BioSQL::BioNamespaceAdaptor
> > preparing UK select statement: SELECT biodatabase.biodatabase_id,
> > biodatabase.name, biodatabase.authority FROM biodatabase WHERE name = ?
> > BioNamespaceAdaptor: binding UK column 1 to "bioperl" (namespace)
> > preparing INSERT statement: INSERT INTO biodatabase (name, authority)
> VALUES
> > (?, ?)
> > BioNamespaceAdaptor::insert: binding column 1 to "bioperl" (namespace)
> > BioNamespaceAdaptor::insert: binding column 2 to "" (authority)
> > attempting to load driver for adaptor class
> Bio::DB::BioSQL::SpeciesAdaptor
> > Using Bio::DB::BioSQL::Pg::SpeciesAdaptorDriver as driver peer for
> > Bio::DB::BioSQL::SpeciesAdaptor
> > preparing UK select statement: SELECT taxon_name.taxon_id, NULL, NULL,
> > taxon.ncbi_taxon_id, taxon_name.name, NULL FROM taxon, taxon_name WHERE
> > taxon.taxon_id = taxon_name.taxon_id AND name_class = ? AND
> ncbi_taxon_id =
> > ?
> > SpeciesAdaptor: binding UK column 1 to "scientific name" (name_class)
> > SpeciesAdaptor: binding UK column 2 to "3702" (ncbi_taxid)
> > prepare SELECT CLASSIFICATION: SELECT name.name, node.node_rank FROM
> taxon
> > node, taxon taxon, taxon_name name WHERE name.taxon_id = node.taxon_idAND
> > taxon.left_value BETWEEN node.left_value AND node.right_value AND
> > taxon.taxon_id = ? AND name.name_class = 'scientific name' ORDER BY
> > node.left_value
> > attempting to load driver for adaptor class Bio::DB::BioSQL::SeqAdaptor
> > attempting to load driver for adaptor class
> > Bio::DB::BioSQL::PrimarySeqAdaptor
> > attempting to load driver for adaptor class
> > Bio::DB::BioSQL::BasePersistenceAdaptor
> > Using Bio::DB::BioSQL::Pg::BasePersistenceAdaptorDriver as driver peer
> for
> > Bio::DB::BioSQL::SeqAdaptor
> > preparing INSERT statement: INSERT INTO bioentry (name, identifier,
> > accession, description, version, division, biodatabase_id, taxon_id)
> VALUES
> > (?, ?, ?, ?, ?, ?, ?, ?)
> > SeqAdaptor::insert: binding column 1 to "NC_003076" (display_id)
> > SeqAdaptor::insert: binding column 2 to "30698605" (primary_id)
> > SeqAdaptor::insert: binding column 3 to "NC_003076" (accession_number)
> > SeqAdaptor::insert: binding column 4 to "Arabidopsis thaliana chromosome
> 5,
> > complete sequence." (desc)
> > SeqAdaptor::insert: binding column 5 to "4" (version)
> > SeqAdaptor::insert: binding column 6 to "PLN" (division)
> > SeqAdaptor::insert: binding column 7 to "14" (FK to
> > Bio::DB::Persistent::BioNamespace)
> > SeqAdaptor::insert: binding column 8 to "3702" (FK to Bio::Species)
> > attempting to load adaptor class for Biosequence
> >         attempting to load module Bio::DB::BioSQL::BiosequenceAdaptor
> > instantiating adaptor class Bio::DB::BioSQL::BiosequenceAdaptor
> > no adaptor found for class Bio::Annotation::TypeManager
> > attempting to load driver for adaptor class
> > Bio::DB::BioSQL::BiosequenceAdaptor
> > Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as driver peer for
> > Bio::DB::BioSQL::BiosequenceAdaptor
> > preparing SELECT statement: SELECT bioentry_id FROM biosequence WHERE
> > bioentry_id = ?
> > Killed
>
> What does "Killed" mean?  Did you get an error?
>
> Sean
>
>
>

From hlapp at gmx.net  Fri Dec 16 12:54:35 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri Dec 16 12:59:04 2005
Subject: [Bioperl-l] extracting CDS portion of RefSeqs
In-Reply-To: <CED81D34E37D5043A1211565277A51E5045CECCC@exchkc02.stowers-institute.org>
References: <CED81D34E37D5043A1211565277A51E5045CECCC@exchkc02.stowers-institute.org>
Message-ID: <f76cf48035fde644617340bb9ad21662@gmx.net>


On Dec 15, 2005, at 11:06 AM, Cook, Malcolm wrote:

> Regarding performance, I've never tried it, but you might look at
> http://doc.bioperl.org/bioperl-live/Bio/Seq/SeqBuilder.html, which 
> shows
> you how to tell SeqIO that you only need to read sequence and features.
>

BTW right now only genbank.pm supports the SeqBuilder interface. If 
anyone of those people who posted recently that they'd like to 
volunteer read this, this would be a nice opportunity to take a fully 
working implementation as an example and transfer it to other 
applicable parsers, e.g. embl and swiss.

	-hilmar
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From hlapp at gmx.net  Fri Dec 16 13:19:09 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri Dec 16 13:16:24 2005
Subject: [Bioperl-l] load_seqdatabase failed to run with .gbk
In-Reply-To: <df8328740512160727ne93bc1di243804b7deab8449@mail.gmail.com>
References: <df8328740512151510m57b24db4tc2d908956dc44903@mail.gmail.com>
	<BFC80EA8.1BD9%sdavis2@mail.nih.gov>
	<df8328740512160727ne93bc1di243804b7deab8449@mail.gmail.com>
Message-ID: <bf15c6d95fc81090404be9b344d74c78@gmx.net>

So something kills your process - if it's not you or a sysadmin who 
doesn't like you then it is the OS. The OS would kill your process if 
it exceeds the per-process limits; on some systems (I thought you were 
on linux?) a segmentation fault or other compiled code or shared object 
problem could have the same symptom.

So, either you have already a huge number of processes running and the 
OS thinks you reached the limit, or your machine is running out of 
memory (what's your hardware, and how did you configure Postgres), or 
there is a problem in a shared library being used (C runtime library? 
Pg client library? DBD::Pg shared object?). My #1 suspect would be the 
latter. Have you run the DBD::Pg tests? Was there any problem?

Also, you still haven't commented on whether you ran the bioperl-db 
tests. It's hard to imagine that those would succeed but the script 
fails like this.

	-hilmar

On Dec 16, 2005, at 7:27 AM, Angshu Kar wrote:

> That was the entire  error msg when i used the debug option...and then
> nothing got loaded in the tables...
>
> On 12/16/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
>>
>>
>>
>>
>> On 12/15/05 6:10 PM, "Angshu Kar" <angshu96@gmail.com> wrote:
>>
>>> Hi,
>>>
>>> The load_seqdatabase.pl failed to run with .gbk:
>>>
>>> akar@denton2 ~]$ ./load_seqdatabase.pl --dbname=USDA 
>>> --dbuser=postgres
>>> --format=genbank  --driver=Pg --debug  NC_003076.gbk
>>> Loading NC_003076.gbk ...
>>> attempting to load adaptor class for Bio::Seq::RichSeq
>>>         attempting to load module Bio::DB::BioSQL::RichSeqAdaptor
>>> attempting to load adaptor class for Bio::Seq
>>>         attempting to load module Bio::DB::BioSQL::SeqAdaptor
>>> instantiating adaptor class Bio::DB::BioSQL::SeqAdaptor
>>> attempting to load adaptor class for Bio::Species
>>>         attempting to load module Bio::DB::BioSQL::SpeciesAdaptor
>>> instantiating adaptor class Bio::DB::BioSQL::SpeciesAdaptor
>>> attempting to load adaptor class for Bio::Annotation::Collection
>>>         attempting to load module Bio::DB::BioSQL::CollectionAdaptor
>>> attempting to load adaptor class for Bio::Root::Root
>>>         attempting to load module Bio::DB::BioSQL::RootAdaptor
>>> attempting to load adaptor class for Bio::Root::RootI
>>>         attempting to load module Bio::DB::BioSQL::RootIAdaptor
>>>         attempting to load module Bio::DB::BioSQL::RootAdaptor
>>> attempting to load adaptor class for Bio::AnnotationCollectionI
>>>         attempting to load module
>>> Bio::DB::BioSQL::AnnotationCollectionIAdaptor
>>>         attempting to load module
>>> Bio::DB::BioSQL::AnnotationCollectionAdaptor
>>> instantiating adaptor class 
>>> Bio::DB::BioSQL::AnnotationCollectionAdaptor
>>> attempting to load adaptor class for Bio::Annotation::TypeManager
>>>         attempting to load module Bio::DB::BioSQL::TypeManagerAdaptor
>>> no adaptor found for class Bio::Annotation::TypeManager
>>> attempting to load adaptor class for Bio::Annotation::SimpleValue
>>>         attempting to load module Bio::DB::BioSQL::SimpleValueAdaptor
>>> instantiating adaptor class Bio::DB::BioSQL::SimpleValueAdaptor
>>> attempting to load adaptor class for Bio::Annotation::Comment
>>>         attempting to load module Bio::DB::BioSQL::CommentAdaptor
>>> instantiating adaptor class Bio::DB::BioSQL::CommentAdaptor
>>> attempting to load adaptor class for Bio::PrimarySeq
>>>         attempting to load module Bio::DB::BioSQL::PrimarySeqAdaptor
>>> instantiating adaptor class Bio::DB::BioSQL::PrimarySeqAdaptor
>>> attempting to load adaptor class for Bio::SeqFeature::Generic
>>>         attempting to load module Bio::DB::BioSQL::GenericAdaptor
>>> attempting to load adaptor class for Bio::SeqFeatureI
>>>         attempting to load module Bio::DB::BioSQL::SeqFeatureIAdaptor
>>>         attempting to load module Bio::DB::BioSQL::SeqFeatureAdaptor
>>> instantiating adaptor class Bio::DB::BioSQL::SeqFeatureAdaptor
>>> attempting to load adaptor class for Bio::Location::Simple
>>>         attempting to load module Bio::DB::BioSQL::SimpleAdaptor
>>> attempting to load adaptor class for Bio::Location::Atomic
>>>         attempting to load module Bio::DB::BioSQL::AtomicAdaptor
>>> attempting to load adaptor class for Bio::LocationI
>>>         attempting to load module Bio::DB::BioSQL::LocationIAdaptor
>>>         attempting to load module Bio::DB::BioSQL::LocationAdaptor
>>> instantiating adaptor class Bio::DB::BioSQL::LocationAdaptor
>>> attempting to load adaptor class for Bio::Location::Split
>>>         attempting to load module Bio::DB::BioSQL::SplitAdaptor
>>> attempting to load adaptor class for Bio::Location::Fuzzy
>>>         attempting to load module Bio::DB::BioSQL::FuzzyAdaptor
>>> no adaptor found for class Bio::Annotation::TypeManager
>>> attempting to load adaptor class for BioNamespace
>>>         attempting to load module 
>>> Bio::DB::BioSQL::BioNamespaceAdaptor
>>> instantiating adaptor class Bio::DB::BioSQL::BioNamespaceAdaptor
>>> no adaptor found for class Bio::Annotation::TypeManager
>>> attempting to load driver for adaptor class
>>> Bio::DB::BioSQL::BioNamespaceAdaptor
>>> attempting to load driver for adaptor class
>>> Bio::DB::BioSQL::BasePersistenceAdaptor
>>> Using Bio::DB::BioSQL::Pg::BasePersistenceAdaptorDriver as driver 
>>> peer
>> for
>>> Bio::DB::BioSQL::BioNamespaceAdaptor
>>> preparing UK select statement: SELECT biodatabase.biodatabase_id,
>>> biodatabase.name, biodatabase.authority FROM biodatabase WHERE name 
>>> = ?
>>> BioNamespaceAdaptor: binding UK column 1 to "bioperl" (namespace)
>>> preparing INSERT statement: INSERT INTO biodatabase (name, authority)
>> VALUES
>>> (?, ?)
>>> BioNamespaceAdaptor::insert: binding column 1 to "bioperl" 
>>> (namespace)
>>> BioNamespaceAdaptor::insert: binding column 2 to "" (authority)
>>> attempting to load driver for adaptor class
>> Bio::DB::BioSQL::SpeciesAdaptor
>>> Using Bio::DB::BioSQL::Pg::SpeciesAdaptorDriver as driver peer for
>>> Bio::DB::BioSQL::SpeciesAdaptor
>>> preparing UK select statement: SELECT taxon_name.taxon_id, NULL, 
>>> NULL,
>>> taxon.ncbi_taxon_id, taxon_name.name, NULL FROM taxon, taxon_name 
>>> WHERE
>>> taxon.taxon_id = taxon_name.taxon_id AND name_class = ? AND
>> ncbi_taxon_id =
>>> ?
>>> SpeciesAdaptor: binding UK column 1 to "scientific name" (name_class)
>>> SpeciesAdaptor: binding UK column 2 to "3702" (ncbi_taxid)
>>> prepare SELECT CLASSIFICATION: SELECT name.name, node.node_rank FROM
>> taxon
>>> node, taxon taxon, taxon_name name WHERE name.taxon_id = 
>>> node.taxon_idAND
>>> taxon.left_value BETWEEN node.left_value AND node.right_value AND
>>> taxon.taxon_id = ? AND name.name_class = 'scientific name' ORDER BY
>>> node.left_value
>>> attempting to load driver for adaptor class 
>>> Bio::DB::BioSQL::SeqAdaptor
>>> attempting to load driver for adaptor class
>>> Bio::DB::BioSQL::PrimarySeqAdaptor
>>> attempting to load driver for adaptor class
>>> Bio::DB::BioSQL::BasePersistenceAdaptor
>>> Using Bio::DB::BioSQL::Pg::BasePersistenceAdaptorDriver as driver 
>>> peer
>> for
>>> Bio::DB::BioSQL::SeqAdaptor
>>> preparing INSERT statement: INSERT INTO bioentry (name, identifier,
>>> accession, description, version, division, biodatabase_id, taxon_id)
>> VALUES
>>> (?, ?, ?, ?, ?, ?, ?, ?)
>>> SeqAdaptor::insert: binding column 1 to "NC_003076" (display_id)
>>> SeqAdaptor::insert: binding column 2 to "30698605" (primary_id)
>>> SeqAdaptor::insert: binding column 3 to "NC_003076" 
>>> (accession_number)
>>> SeqAdaptor::insert: binding column 4 to "Arabidopsis thaliana 
>>> chromosome
>> 5,
>>> complete sequence." (desc)
>>> SeqAdaptor::insert: binding column 5 to "4" (version)
>>> SeqAdaptor::insert: binding column 6 to "PLN" (division)
>>> SeqAdaptor::insert: binding column 7 to "14" (FK to
>>> Bio::DB::Persistent::BioNamespace)
>>> SeqAdaptor::insert: binding column 8 to "3702" (FK to Bio::Species)
>>> attempting to load adaptor class for Biosequence
>>>         attempting to load module Bio::DB::BioSQL::BiosequenceAdaptor
>>> instantiating adaptor class Bio::DB::BioSQL::BiosequenceAdaptor
>>> no adaptor found for class Bio::Annotation::TypeManager
>>> attempting to load driver for adaptor class
>>> Bio::DB::BioSQL::BiosequenceAdaptor
>>> Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as driver peer 
>>> for
>>> Bio::DB::BioSQL::BiosequenceAdaptor
>>> preparing SELECT statement: SELECT bioentry_id FROM biosequence WHERE
>>> bioentry_id = ?
>>> Killed
>>
>> What does "Killed" mean?  Did you get an error?
>>
>> Sean
>>
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From angshu96 at gmail.com  Fri Dec 16 13:22:40 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec 16 13:19:56 2005
Subject: [Bioperl-l] load_seqdatabase failed to run with .gbk
In-Reply-To: <bf15c6d95fc81090404be9b344d74c78@gmx.net>
References: <df8328740512151510m57b24db4tc2d908956dc44903@mail.gmail.com>
	<BFC80EA8.1BD9%sdavis2@mail.nih.gov>
	<df8328740512160727ne93bc1di243804b7deab8449@mail.gmail.com>
	<bf15c6d95fc81090404be9b344d74c78@gmx.net>
Message-ID: <df8328740512161022vafbd71i9238d9be3b68d12a@mail.gmail.com>

Thanks Hilmar for your great inroads and suggestions. And yes, I'm in a
linux box...I would surely run the DBD::Pg tests and let you know the
results.

Thanks,
Angshu


On 12/16/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
> So something kills your process - if it's not you or a sysadmin who
> doesn't like you then it is the OS. The OS would kill your process if
> it exceeds the per-process limits; on some systems (I thought you were
> on linux?) a segmentation fault or other compiled code or shared object
> problem could have the same symptom.
>
> So, either you have already a huge number of processes running and the
> OS thinks you reached the limit, or your machine is running out of
> memory (what's your hardware, and how did you configure Postgres), or
> there is a problem in a shared library being used (C runtime library?
> Pg client library? DBD::Pg shared object?). My #1 suspect would be the
> latter. Have you run the DBD::Pg tests? Was there any problem?
>
> Also, you still haven't commented on whether you ran the bioperl-db
> tests. It's hard to imagine that those would succeed but the script
> fails like this.
>
>        -hilmar
>
> On Dec 16, 2005, at 7:27 AM, Angshu Kar wrote:
>
> > That was the entire  error msg when i used the debug option...and then
> > nothing got loaded in the tables...
> >
> > On 12/16/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
> >>
> >>
> >>
> >>
> >> On 12/15/05 6:10 PM, "Angshu Kar" <angshu96@gmail.com> wrote:
> >>
> >>> Hi,
> >>>
> >>> The load_seqdatabase.pl failed to run with .gbk:
> >>>
> >>> akar@denton2 ~]$ ./load_seqdatabase.pl --dbname=USDA
> >>> --dbuser=postgres
> >>> --format=genbank  --driver=Pg --debug  NC_003076.gbk
> >>> Loading NC_003076.gbk ...
> >>> attempting to load adaptor class for Bio::Seq::RichSeq
> >>>         attempting to load module Bio::DB::BioSQL::RichSeqAdaptor
> >>> attempting to load adaptor class for Bio::Seq
> >>>         attempting to load module Bio::DB::BioSQL::SeqAdaptor
> >>> instantiating adaptor class Bio::DB::BioSQL::SeqAdaptor
> >>> attempting to load adaptor class for Bio::Species
> >>>         attempting to load module Bio::DB::BioSQL::SpeciesAdaptor
> >>> instantiating adaptor class Bio::DB::BioSQL::SpeciesAdaptor
> >>> attempting to load adaptor class for Bio::Annotation::Collection
> >>>         attempting to load module Bio::DB::BioSQL::CollectionAdaptor
> >>> attempting to load adaptor class for Bio::Root::Root
> >>>         attempting to load module Bio::DB::BioSQL::RootAdaptor
> >>> attempting to load adaptor class for Bio::Root::RootI
> >>>         attempting to load module Bio::DB::BioSQL::RootIAdaptor
> >>>         attempting to load module Bio::DB::BioSQL::RootAdaptor
> >>> attempting to load adaptor class for Bio::AnnotationCollectionI
> >>>         attempting to load module
> >>> Bio::DB::BioSQL::AnnotationCollectionIAdaptor
> >>>         attempting to load module
> >>> Bio::DB::BioSQL::AnnotationCollectionAdaptor
> >>> instantiating adaptor class
> >>> Bio::DB::BioSQL::AnnotationCollectionAdaptor
> >>> attempting to load adaptor class for Bio::Annotation::TypeManager
> >>>         attempting to load module Bio::DB::BioSQL::TypeManagerAdaptor
> >>> no adaptor found for class Bio::Annotation::TypeManager
> >>> attempting to load adaptor class for Bio::Annotation::SimpleValue
> >>>         attempting to load module Bio::DB::BioSQL::SimpleValueAdaptor
> >>> instantiating adaptor class Bio::DB::BioSQL::SimpleValueAdaptor
> >>> attempting to load adaptor class for Bio::Annotation::Comment
> >>>         attempting to load module Bio::DB::BioSQL::CommentAdaptor
> >>> instantiating adaptor class Bio::DB::BioSQL::CommentAdaptor
> >>> attempting to load adaptor class for Bio::PrimarySeq
> >>>         attempting to load module Bio::DB::BioSQL::PrimarySeqAdaptor
> >>> instantiating adaptor class Bio::DB::BioSQL::PrimarySeqAdaptor
> >>> attempting to load adaptor class for Bio::SeqFeature::Generic
> >>>         attempting to load module Bio::DB::BioSQL::GenericAdaptor
> >>> attempting to load adaptor class for Bio::SeqFeatureI
> >>>         attempting to load module Bio::DB::BioSQL::SeqFeatureIAdaptor
> >>>         attempting to load module Bio::DB::BioSQL::SeqFeatureAdaptor
> >>> instantiating adaptor class Bio::DB::BioSQL::SeqFeatureAdaptor
> >>> attempting to load adaptor class for Bio::Location::Simple
> >>>         attempting to load module Bio::DB::BioSQL::SimpleAdaptor
> >>> attempting to load adaptor class for Bio::Location::Atomic
> >>>         attempting to load module Bio::DB::BioSQL::AtomicAdaptor
> >>> attempting to load adaptor class for Bio::LocationI
> >>>         attempting to load module Bio::DB::BioSQL::LocationIAdaptor
> >>>         attempting to load module Bio::DB::BioSQL::LocationAdaptor
> >>> instantiating adaptor class Bio::DB::BioSQL::LocationAdaptor
> >>> attempting to load adaptor class for Bio::Location::Split
> >>>         attempting to load module Bio::DB::BioSQL::SplitAdaptor
> >>> attempting to load adaptor class for Bio::Location::Fuzzy
> >>>         attempting to load module Bio::DB::BioSQL::FuzzyAdaptor
> >>> no adaptor found for class Bio::Annotation::TypeManager
> >>> attempting to load adaptor class for BioNamespace
> >>>         attempting to load module
> >>> Bio::DB::BioSQL::BioNamespaceAdaptor
> >>> instantiating adaptor class Bio::DB::BioSQL::BioNamespaceAdaptor
> >>> no adaptor found for class Bio::Annotation::TypeManager
> >>> attempting to load driver for adaptor class
> >>> Bio::DB::BioSQL::BioNamespaceAdaptor
> >>> attempting to load driver for adaptor class
> >>> Bio::DB::BioSQL::BasePersistenceAdaptor
> >>> Using Bio::DB::BioSQL::Pg::BasePersistenceAdaptorDriver as driver
> >>> peer
> >> for
> >>> Bio::DB::BioSQL::BioNamespaceAdaptor
> >>> preparing UK select statement: SELECT biodatabase.biodatabase_id,
> >>> biodatabase.name, biodatabase.authority FROM biodatabase WHERE name
> >>> = ?
> >>> BioNamespaceAdaptor: binding UK column 1 to "bioperl" (namespace)
> >>> preparing INSERT statement: INSERT INTO biodatabase (name, authority)
> >> VALUES
> >>> (?, ?)
> >>> BioNamespaceAdaptor::insert: binding column 1 to "bioperl"
> >>> (namespace)
> >>> BioNamespaceAdaptor::insert: binding column 2 to "" (authority)
> >>> attempting to load driver for adaptor class
> >> Bio::DB::BioSQL::SpeciesAdaptor
> >>> Using Bio::DB::BioSQL::Pg::SpeciesAdaptorDriver as driver peer for
> >>> Bio::DB::BioSQL::SpeciesAdaptor
> >>> preparing UK select statement: SELECT taxon_name.taxon_id, NULL,
> >>> NULL,
> >>> taxon.ncbi_taxon_id, taxon_name.name, NULL FROM taxon, taxon_name
> >>> WHERE
> >>> taxon.taxon_id = taxon_name.taxon_id AND name_class = ? AND
> >> ncbi_taxon_id =
> >>> ?
> >>> SpeciesAdaptor: binding UK column 1 to "scientific name" (name_class)
> >>> SpeciesAdaptor: binding UK column 2 to "3702" (ncbi_taxid)
> >>> prepare SELECT CLASSIFICATION: SELECT name.name, node.node_rank FROM
> >> taxon
> >>> node, taxon taxon, taxon_name name WHERE name.taxon_id =
> >>> node.taxon_idAND
> >>> taxon.left_value BETWEEN node.left_value AND node.right_value AND
> >>> taxon.taxon_id = ? AND name.name_class = 'scientific name' ORDER BY
> >>> node.left_value
> >>> attempting to load driver for adaptor class
> >>> Bio::DB::BioSQL::SeqAdaptor
> >>> attempting to load driver for adaptor class
> >>> Bio::DB::BioSQL::PrimarySeqAdaptor
> >>> attempting to load driver for adaptor class
> >>> Bio::DB::BioSQL::BasePersistenceAdaptor
> >>> Using Bio::DB::BioSQL::Pg::BasePersistenceAdaptorDriver as driver
> >>> peer
> >> for
> >>> Bio::DB::BioSQL::SeqAdaptor
> >>> preparing INSERT statement: INSERT INTO bioentry (name, identifier,
> >>> accession, description, version, division, biodatabase_id, taxon_id)
> >> VALUES
> >>> (?, ?, ?, ?, ?, ?, ?, ?)
> >>> SeqAdaptor::insert: binding column 1 to "NC_003076" (display_id)
> >>> SeqAdaptor::insert: binding column 2 to "30698605" (primary_id)
> >>> SeqAdaptor::insert: binding column 3 to "NC_003076"
> >>> (accession_number)
> >>> SeqAdaptor::insert: binding column 4 to "Arabidopsis thaliana
> >>> chromosome
> >> 5,
> >>> complete sequence." (desc)
> >>> SeqAdaptor::insert: binding column 5 to "4" (version)
> >>> SeqAdaptor::insert: binding column 6 to "PLN" (division)
> >>> SeqAdaptor::insert: binding column 7 to "14" (FK to
> >>> Bio::DB::Persistent::BioNamespace)
> >>> SeqAdaptor::insert: binding column 8 to "3702" (FK to Bio::Species)
> >>> attempting to load adaptor class for Biosequence
> >>>         attempting to load module Bio::DB::BioSQL::BiosequenceAdaptor
> >>> instantiating adaptor class Bio::DB::BioSQL::BiosequenceAdaptor
> >>> no adaptor found for class Bio::Annotation::TypeManager
> >>> attempting to load driver for adaptor class
> >>> Bio::DB::BioSQL::BiosequenceAdaptor
> >>> Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as driver peer
> >>> for
> >>> Bio::DB::BioSQL::BiosequenceAdaptor
> >>> preparing SELECT statement: SELECT bioentry_id FROM biosequence WHERE
> >>> bioentry_id = ?
> >>> Killed
> >>
> >> What does "Killed" mean?  Did you get an error?
> >>
> >> Sean
> >>
> >>
> >>
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From cjfields at uiuc.edu  Fri Dec 16 13:39:47 2005
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri Dec 16 13:50:54 2005
Subject: [Bioperl-l] GenBank subseq retrieval
Message-ID: <000901c60270$16f9f330$15327e82@pyrimidine>

I saw in Bugzilla that there was an attempt to add seq_start and seq_end
(among other features) to Bio::DB::Genbank to allow subsequence retrieval
through the efetch interface at NCBI:
http://bugzilla.bioperl.org/show_bug.cgi?id=1405.  

I didn't see the proposed updates in bioperl-live CVS.  Is this implemented
yet or is there an alternative way to do this w/o downloading the entire
sequence?  I am parsing rnamotif hits from GenBank files to determine the
genomic context of the region where the hit occurred.

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 

From osborne1 at optonline.net  Fri Dec 16 18:18:23 2005
From: osborne1 at optonline.net (Brian Osborne)
Date: Fri Dec 16 18:20:36 2005
Subject: [Bioperl-l] Puzzled...
Message-ID: <BFC8B56F.67BE%osborne1@optonline.net>

Bioperl-l,

The module I have in mind is simple, it queries the Sequence Revision
History page at NCBI and extracts useful information, something like:

    use NCBIRevision;

    my $q = new NCBIRevision;

    my $result = $q->get_history($id);

    # all GIs, which may include the GI used to query
    my @all_gis = $result->get_all();

    # the most recent GI, may or may not be the id used to query
    my $live_gi = $result->get_live();

My perplexity arises when I take a look around and see the different ways
that these sorts of things have been accomplished in Bioperl. WebDBSeqI is
out, this is about constructing Sequence objects from the query results.
SimpleWebAnalysis doesn?t look exactly right, this is designed to submit
Sequence objects to the Web server and return the results in various ways.
Then we have WebAgent (DB/MeSH, DB/CUTG) and Root::HTTPGet (DB/Taxonomy,
DB/Expression). Of course every one of these is HTTP::Request and
LWP::UserAgent underneath.

Is there a preferred approach? I could just strike out and write this based
on those last 2 modules but that doesn?t seem right either.

Brian O.

From miroslavac at health.nb.ca  Fri Dec 16 09:13:58 2005
From: miroslavac at health.nb.ca (Miroslava Cuperlovic-Culf)
Date: Fri Dec 16 21:39:28 2005
Subject: [Bioperl-l] Protein ID to Gene ID 
Message-ID: <NNECJLONEGDNDBHEIGKHIEEBDEAA.miroslavac@health.nb.ca>

Dear All,

I am trying to make a small program that would get the GeneBank gene ID from
GenBank protein ID. I think that DBSOURCE in GenBank entry for protein has
the number I need. So I wrote something like this:

my $ac = $seq->annotation;

my @values = $ac->get_Annotations('dblink');

for my $value ( @values ) {

print "DBSOURCE ", ",$value->tagname,$value->as_text,"\n";

}

But I get nothing. What is going on here? Any info/ideas would be greatly
appreciated,

Sincerely,

Mira
From osborne1 at optonline.net  Fri Dec 16 22:12:02 2005
From: osborne1 at optonline.net (Brian Osborne)
Date: Fri Dec 16 22:15:49 2005
Subject: [Bioperl-l] Protein ID to Gene ID
In-Reply-To: <NNECJLONEGDNDBHEIGKHIEEBDEAA.miroslavac@health.nb.ca>
Message-ID: <BFC8EC32.67C4%osborne1@optonline.net>

Mira,

What sequence is that?

Brian O.


On 12/16/05 9:13 AM, "Miroslava Cuperlovic-Culf" <miroslavac@health.nb.ca>
wrote:

> Dear All,
> 
> I am trying to make a small program that would get the GeneBank gene ID from
> GenBank protein ID. I think that DBSOURCE in GenBank entry for protein has
> the number I need. So I wrote something like this:
> 
> my $ac = $seq->annotation;
> 
> my @values = $ac->get_Annotations('dblink');
> 
> for my $value ( @values ) {
> 
> print "DBSOURCE ", ",$value->tagname,$value->as_text,"\n";
> 
> }
> 
> But I get nothing. What is going on here? Any info/ideas would be greatly
> appreciated,
> 
> Sincerely,
> 
> Mira
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From boris.steipe at utoronto.ca  Fri Dec 16 21:57:10 2005
From: boris.steipe at utoronto.ca (Boris Steipe)
Date: Fri Dec 16 23:02:02 2005
Subject: [Bioperl-l] Protein ID to Gene ID 
In-Reply-To: <NNECJLONEGDNDBHEIGKHIEEBDEAA.miroslavac@health.nb.ca>
References: <NNECJLONEGDNDBHEIGKHIEEBDEAA.miroslavac@health.nb.ca>
Message-ID: <073E419B-443A-4910-9A98-73536A732C65@utoronto.ca>

unmatched quotation marks.

b.


On 16 Dec 2005, at 09:13, Miroslava Cuperlovic-Culf wrote:

> print "DBSOURCE ", ",$value->tagname,$value->as_text,"\n";

From osborne1 at optonline.net  Fri Dec 16 23:42:00 2005
From: osborne1 at optonline.net (Brian Osborne)
Date: Fri Dec 16 23:39:53 2005
Subject: [Bioperl-l] GenBank subseq retrieval
In-Reply-To: <000901c60270$16f9f330$15327e82@pyrimidine>
Message-ID: <BFC90148.67CB%osborne1@optonline.net>

Chris,

Bug 1405, or enhancement 1405, is fixed. Try it out and see if it works for
you.

Brian O.


On 12/16/05 1:39 PM, "Chris Fields" <cjfields@uiuc.edu> wrote:

> I saw in Bugzilla that there was an attempt to add seq_start and seq_end
> (among other features) to Bio::DB::Genbank to allow subsequence retrieval
> through the efetch interface at NCBI:
> http://bugzilla.bioperl.org/show_bug.cgi?id=1405.
> 
> I didn't see the proposed updates in bioperl-live CVS.  Is this implemented
> yet or is there an alternative way to do this w/o downloading the entire
> sequence?  I am parsing rnamotif hits from GenBank files to determine the
> genomic context of the region where the hit occurred.
> 
> Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From heikki.lehvaslaiho at gmail.com  Sun Dec 18 16:28:58 2005
From: heikki.lehvaslaiho at gmail.com (Heikki Lehvaslaiho)
Date: Sun Dec 18 18:04:25 2005
Subject: [Bioperl-l] Puzzled...
In-Reply-To: <BFC8B56F.67BE%osborne1@optonline.net>
References: <BFC8B56F.67BE%osborne1@optonline.net>
Message-ID: <200512182328.58504.heikki.lehvaslaiho@gmail.com>

Brian,

Bio::WebDBSeqI is, like you said for retrieving sequences. This is the oldest 
code of the lot. A good rewrite has been asked for years.

Bio::Root::HTTPGet does not depend on LWP::UserAgent but duplicates core 
functionality, see the docs..

Bio::WebAgent adds bioperl idioms into LWP::UserAgent and is meant to be used 
as a basis of more specific implementations.

Bio::Tools::Analysis::SimpleAnalysisBase is a base class for doing Web based 
sequence analysis. It is based on Bio::WebAgent and implements 
Bio::SimpleAnalysisI.


If you need to create something new, base it either on Bio::Root::HTTPGet or 
Bio::WebAgent or even better: to use primarily Bio::WebAgent but fall back to 
Bio::Root::HTTPGet if LWP::Useragent is not present.


I do not want to complicate matters, but do have a look at 

  http://www.ebi.ac.uk/cgi-bin/sva/sva.pl?&help=1

It would be great if the bioperl implementation of nucleotide sequence version 
retrieval could be as generic and complete as possible  ;-) .


	-Heikki


On Saturday 17 December 2005 01:18, Brian Osborne wrote:
> Bioperl-l,
>
> The module I have in mind is simple, it queries the Sequence Revision
> History page at NCBI and extracts useful information, something like:
>
>     use NCBIRevision;
>
>     my $q = new NCBIRevision;
>
>     my $result = $q->get_history($id);
>
>     # all GIs, which may include the GI used to query
>     my @all_gis = $result->get_all();
>
>     # the most recent GI, may or may not be the id used to query
>     my $live_gi = $result->get_live();
>
> My perplexity arises when I take a look around and see the different ways
> that these sorts of things have been accomplished in Bioperl. WebDBSeqI is
> out, this is about constructing Sequence objects from the query results.
> SimpleWebAnalysis doesn?t look exactly right, this is designed to submit
> Sequence objects to the Web server and return the results in various ways.
> Then we have WebAgent (DB/MeSH, DB/CUTG) and Root::HTTPGet (DB/Taxonomy,
> DB/Expression). Of course every one of these is HTTP::Request and
> LWP::UserAgent underneath.
>
> Is there a preferred approach? I could just strike out and write this based
> on those last 2 modules but that doesn?t seem right either.
>
> Brian O.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of the Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________

From osborne1 at optonline.net  Sun Dec 18 18:08:09 2005
From: osborne1 at optonline.net (Brian Osborne)
Date: Sun Dec 18 18:11:05 2005
Subject: [Bioperl-l] Puzzled...
In-Reply-To: <200512182328.58504.heikki.lehvaslaiho@gmail.com>
Message-ID: <BFCB5609.67EA%osborne1@optonline.net>

Heikki,

I don't have the time to be complete, that's a significant undertaking (e.g.
both NCBI and EMBL and others, diffs of versions, correlating GIs to version
numbers, dates, release numbers, "status", and so on). You may have
correctly deduced from my examples that all I really care about is old and
new GI numbers. But I can certainly add files in such a way as to allow
these methods or modules to appear later if someone wanted to add them.

So in order to satisfy genericiy we could have Bio::DB::Version::ncbi. Or
were you thinking about tying this all a bit closer to the Seq object, as in
Bio::Seq::Version::<something> rather than Bio::DB? Or...?


Brian O.


On 12/18/05 4:28 PM, "Heikki Lehvaslaiho" <heikki.lehvaslaiho@gmail.com>
wrote:

> It would be great if the bioperl implementation of nucleotide sequence version
> retrieval could be as generic and complete as possible  ;-) .


From hlapp at gmx.net  Sun Dec 18 23:22:20 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Sun Dec 18 23:19:46 2005
Subject: [Bioperl-l] Protein ID to Gene ID 
In-Reply-To: <NNECJLONEGDNDBHEIGKHIEEBDEAA.miroslavac@health.nb.ca>
References: <NNECJLONEGDNDBHEIGKHIEEBDEAA.miroslavac@health.nb.ca>
Message-ID: <2c0f46ee80128f2776b75753b5918ae1@gmx.net>

GenBank has the protein-mRNA cross-reference in the feature table, 
hence you would need to look into the tag/value pairs of a sequence's 
features. DBSOURCE I believe is only present for those entries 
originating from UniProt (i.e., not natively from GenBank).

On top of all that, the tags GenBank uses for their entry annotation 
are not the ones BioPerl uses to tag its annotation objects - BioPerl 
is not an API solely for GenBank. Consult the Bio::SeqIO::genbank POD 
for documentation on what goes where in the BioPerl object model.

	-hilmar

On Dec 16, 2005, at 6:13 AM, Miroslava Cuperlovic-Culf wrote:

> Dear All,
>
> I am trying to make a small program that would get the GeneBank gene 
> ID from
> GenBank protein ID. I think that DBSOURCE in GenBank entry for protein 
> has
> the number I need. So I wrote something like this:
>
> my $ac = $seq->annotation;
>
> my @values = $ac->get_Annotations('dblink');
>
> for my $value ( @values ) {
>
> print "DBSOURCE ", ",$value->tagname,$value->as_text,"\n";
>
> }
>
> But I get nothing. What is going on here? Any info/ideas would be 
> greatly
> appreciated,
>
> Sincerely,
>
> Mira
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From angshu96 at gmail.com  Mon Dec 19 12:31:32 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Mon Dec 19 12:28:49 2005
Subject: [Bioperl-l] arabidopsis + load_seqdatabase.pl
Message-ID: <df8328740512190931u69907f6fpbc3c444c85ff56cf@mail.gmail.com>

Hi,

I'm not fully sure whether to post this question in this community. But I
feel those who are working in plant genomics using bioperl can possibly
answer this. I'm trying to use load_seqdatabase.pl to load data into the
biosql schema.Can anyone please suggest an arabidopsis data file source that
has all the additional information (probably GENBANK format) but only holds
the CDSs?
I'll be obliged if anyone of you who has used such a file helps me with the
answer.

Thanks,
Angshu

From hlapp at gmx.net  Mon Dec 19 13:07:31 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Mon Dec 19 13:04:45 2005
Subject: [Bioperl-l] arabidopsis + load_seqdatabase.pl
In-Reply-To: <df8328740512190931u69907f6fpbc3c444c85ff56cf@mail.gmail.com>
References: <df8328740512190931u69907f6fpbc3c444c85ff56cf@mail.gmail.com>
Message-ID: <b379b40264b4f051433ebde9e5cc80a4@gmx.net>

I don't have an answer for you, but did you also try the Bulletin Board 
at bioinformatics.org?

On Dec 19, 2005, at 9:31 AM, Angshu Kar wrote:

> Hi,
>
> I'm not fully sure whether to post this question in this community. 
> But I
> feel those who are working in plant genomics using bioperl can possibly
> answer this. I'm trying to use load_seqdatabase.pl to load data into 
> the
> biosql schema.Can anyone please suggest an arabidopsis data file 
> source that
> has all the additional information (probably GENBANK format) but only 
> holds
> the CDSs?
> I'll be obliged if anyone of you who has used such a file helps me 
> with the
> answer.
>
> Thanks,
> Angshu
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From heikki.lehvaslaiho at gmail.com  Mon Dec 19 12:04:30 2005
From: heikki.lehvaslaiho at gmail.com (Heikki Lehvaslaiho)
Date: Mon Dec 19 13:04:59 2005
Subject: [Bioperl-l] Puzzled...
In-Reply-To: <BFCB5609.67EA%osborne1@optonline.net>
References: <BFCB5609.67EA%osborne1@optonline.net>
Message-ID: <200512191904.30592.heikki.lehvaslaiho@gmail.com>

On Monday 19 December 2005 01:08, Brian Osborne wrote:
> Heikki,
>
> I don't have the time to be complete, that's a significant undertaking
> (e.g. both NCBI and EMBL and others, diffs of versions, correlating GIs to
> version numbers, dates, release numbers, "status", and so on). You may have
> correctly deduced from my examples that all I really care about is old and
> new GI numbers. But I can certainly add files in such a way as to allow
> these methods or modules to appear later if someone wanted to add them.

That is good enough.

> So in order to satisfy genericiy we could have Bio::DB::Version::ncbi. Or
> were you thinking about tying this all a bit closer to the Seq object, as
> in Bio::Seq::Version::<something> rather than Bio::DB? Or...?
>
Nah, the returned objects are plain old sequences. The new bit might be in the 
way you treat sets of seq ids that might be linked to time points and 
releases etc - but I have not given it much thought.

It might be clearer if you use Bio::DB::SeqVersion name space?

	-Heikki


> Brian O.
>
>
> On 12/18/05 4:28 PM, "Heikki Lehvaslaiho" <heikki.lehvaslaiho@gmail.com>
>
> wrote:
> > It would be great if the bioperl implementation of nucleotide sequence
> > version retrieval could be as generic and complete as possible  ;-) .

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of the Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________
From sdavis2 at mail.nih.gov  Mon Dec 19 13:54:06 2005
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Mon Dec 19 13:51:16 2005
Subject: [Bioperl-l] arabidopsis + load_seqdatabase.pl
In-Reply-To: <df8328740512190931u69907f6fpbc3c444c85ff56cf@mail.gmail.com>
Message-ID: <BFCC6BFE.1E65%sdavis2@mail.nih.gov>




On 12/19/05 12:31 PM, "Angshu Kar" <angshu96@gmail.com> wrote:

> Hi,
> 
> I'm not fully sure whether to post this question in this community. But I
> feel those who are working in plant genomics using bioperl can possibly
> answer this. I'm trying to use load_seqdatabase.pl to load data into the
> biosql schema.Can anyone please suggest an arabidopsis data file source that
> has all the additional information (probably GENBANK format) but only holds
> the CDSs?
> I'll be obliged if anyone of you who has used such a file helps me with the
> answer.

Angshu,

What information do you need from these files, specifically?  And what is
your definition of a gene?  If you want to stick to Refseq genes, you can
download from here:

ftp://ftp.ncbi.nih.gov/refseq/release/plant

But, the question is really, what EXACT information do you need and what is
the question that you want to answer?  It is only by deciding what you need
that you will know what files will suit (or not suit) your needs (and this
may be a question that you have to decide for yourself).

If you are going to be using NCBI resources (like the link above), I highly
suggest looking at the NCBI handbook here before proceeding too far:

http://www.ncbi.nlm.nih.gov/books/bv.fcgi?call=bv.View..ShowTOC&rid=handbook
.TOC&depth=2

Sean


From cjfields at uiuc.edu  Mon Dec 19 13:48:19 2005
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon Dec 19 14:01:33 2005
Subject: [Bioperl-l] GenBank subseq retrieval
In-Reply-To: <BFC90148.67CB%osborne1@optonline.net>
Message-ID: <000001c604cc$c93a04a0$15327e82@pyrimidine>

I'll give it a go today or tomorrow; since I'm working with WinXP it's a bit
more problematic (and using nmake to install works okay but doesn't work for
tests for some reason).  

In a nutshell, what I would like to do is get the region around a rnamotif
hit in the available microbial genomes, with annotation included, in order
to determine the genomic context of the hit.  It's tricky b/c each gi would
have a different start/stop for the sequences.  I could parse through each
genome file, maybe using GFF, but it should be possible getting the subseq
with annotation directly from GenBank using efetch.  

I'll toy around with it and suggest some things maybe to improve it.

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 
-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Brian Osborne
Sent: Friday, December 16, 2005 10:42 PM
To: Chris Fields; bioperl-l
Subject: Re: [Bioperl-l] GenBank subseq retrieval

Chris,

Bug 1405, or enhancement 1405, is fixed. Try it out and see if it works for
you.

Brian O.


On 12/16/05 1:39 PM, "Chris Fields" <cjfields@uiuc.edu> wrote:

> I saw in Bugzilla that there was an attempt to add seq_start and seq_end
> (among other features) to Bio::DB::Genbank to allow subsequence retrieval
> through the efetch interface at NCBI:
> http://bugzilla.bioperl.org/show_bug.cgi?id=1405.
> 
> I didn't see the proposed updates in bioperl-live CVS.  Is this
implemented
> yet or is there an alternative way to do this w/o downloading the entire
> sequence?  I am parsing rnamotif hits from GenBank files to determine the
> genomic context of the region where the hit occurred.
> 
> Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l

From osborne1 at optonline.net  Mon Dec 19 14:10:36 2005
From: osborne1 at optonline.net (Brian Osborne)
Date: Mon Dec 19 14:13:19 2005
Subject: [Bioperl-l] Puzzled...
In-Reply-To: <200512191904.30592.heikki.lehvaslaiho@gmail.com>
Message-ID: <BFCC6FDC.6809%osborne1@optonline.net>

Heikki,

Yes, this is my preference as well. Very good, I'll get started, see where
it takes me...

Brian O.


On 12/19/05 12:04 PM, "Heikki Lehvaslaiho" <heikki.lehvaslaiho@gmail.com>
wrote:

> On Monday 19 December 2005 01:08, Brian Osborne wrote:
>> Heikki,
>> 
>> I don't have the time to be complete, that's a significant undertaking
>> (e.g. both NCBI and EMBL and others, diffs of versions, correlating GIs to
>> version numbers, dates, release numbers, "status", and so on). You may have
>> correctly deduced from my examples that all I really care about is old and
>> new GI numbers. But I can certainly add files in such a way as to allow
>> these methods or modules to appear later if someone wanted to add them.
> 
> That is good enough.
> 
>> So in order to satisfy genericiy we could have Bio::DB::Version::ncbi. Or
>> were you thinking about tying this all a bit closer to the Seq object, as
>> in Bio::Seq::Version::<something> rather than Bio::DB? Or...?
>> 
> Nah, the returned objects are plain old sequences. The new bit might be in the
> way you treat sets of seq ids that might be linked to time points and
> releases etc - but I have not given it much thought.
> 
> It might be clearer if you use Bio::DB::SeqVersion name space?
> 
> -Heikki
> 
> 
>> Brian O.
>> 
>> 
>> On 12/18/05 4:28 PM, "Heikki Lehvaslaiho" <heikki.lehvaslaiho@gmail.com>
>> 
>> wrote:
>>> It would be great if the bioperl implementation of nucleotide sequence
>>> version retrieval could be as generic and complete as possible  ;-) .


From angshu96 at gmail.com  Mon Dec 19 14:10:46 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Mon Dec 19 14:14:04 2005
Subject: [Bioperl-l] arabidopsis + load_seqdatabase.pl
In-Reply-To: <BFCC6BFE.1E65%sdavis2@mail.nih.gov>
References: <df8328740512190931u69907f6fpbc3c444c85ff56cf@mail.gmail.com>
	<BFCC6BFE.1E65%sdavis2@mail.nih.gov>
Message-ID: <df8328740512191110o28bbe63fve1e28aad002b1566@mail.gmail.com>

Hi Sean,

What I need is precisely the latest arabidopsis files (peptide as well
as dna) that has loaded the database successfully *when used with the
load_seqdatabase.pl* script.
I've tried some other files but they doesn't load all the tables correctly (
e.g. cannot distinguish between accession #, name and identifier etc and
load same data in all the 3 columns).

Please let me know if you have any queries.

Thanks,
Angshu


On 12/19/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
>
>
>
>
> On 12/19/05 12:31 PM, "Angshu Kar" <angshu96@gmail.com> wrote:
>
> > Hi,
> >
> > I'm not fully sure whether to post this question in this community. But
> I
> > feel those who are working in plant genomics using bioperl can possibly
> > answer this. I'm trying to use load_seqdatabase.pl to load data into the
> > biosql schema.Can anyone please suggest an arabidopsis data file source
> that
> > has all the additional information (probably GENBANK format) but only
> holds
> > the CDSs?
> > I'll be obliged if anyone of you who has used such a file helps me with
> the
> > answer.
>
> Angshu,
>
> What information do you need from these files, specifically?  And what is
> your definition of a gene?  If you want to stick to Refseq genes, you can
> download from here:
>
> ftp://ftp.ncbi.nih.gov/refseq/release/plant
>
> But, the question is really, what EXACT information do you need and what
> is
> the question that you want to answer?  It is only by deciding what you
> need
> that you will know what files will suit (or not suit) your needs (and this
> may be a question that you have to decide for yourself).
>
> If you are going to be using NCBI resources (like the link above), I
> highly
> suggest looking at the NCBI handbook here before proceeding too far:
>
>
> http://www.ncbi.nlm.nih.gov/books/bv.fcgi?call=bv.View..ShowTOC&rid=handbook
> .TOC&depth=2
>
> Sean
>
>
>

From sdavis2 at mail.nih.gov  Mon Dec 19 14:27:01 2005
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Mon Dec 19 14:24:11 2005
Subject: [Bioperl-l] arabidopsis + load_seqdatabase.pl
In-Reply-To: <df8328740512191110o28bbe63fve1e28aad002b1566@mail.gmail.com>
Message-ID: <BFCC73B5.1E6E%sdavis2@mail.nih.gov>




On 12/19/05 2:10 PM, "Angshu Kar" <angshu96@gmail.com> wrote:

> Hi Sean,
>  
> What I need is precisely the latest arabidopsis files (peptide as well as dna)
> that has loaded the database successfully when used with the
> load_seqdatabase.pl script.
> I've tried some other files but they doesn't load all the tables correctly
> (e.g. cannot distinguish between accession #, name and identifier etc and load
> same data in all the 3 columns).

I might approach this in a different way.  I would seek to find the file or
files that contain all the information that I want to store--this is the
hard part in this case, perhaps.  If the data comes from TAIR (that looks to
be a good source of genome information for arabidopsis), then you need to
learn what files are there, what format they are in, what is in each of
them, and what isn't.  Then, and only then, should you try to load the data
into a database.  Only then can you determine what the problem is (if there
is one) with loading data into bioperl-db.  Imagine, for example, that the
datafile that you are trying to load includes only an accession.  In that
case, bioperl-db can't load other information, because there isn't any to
load.  So, you need to diagnose your own problem here, I think and determine
what is in the files that you have and why you have the situation in the
database you have.

So, what format file do you have right now and does bioperl support it?
What is expected to be in that file?  Is everything that you need in the
files that you have (you have to look at the files and understand them, not
at the bioperl parsing of them)?

Sean


From angshu96 at gmail.com  Mon Dec 19 15:20:44 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Mon Dec 19 15:24:49 2005
Subject: [Bioperl-l] arabidopsis + load_seqdatabase.pl
In-Reply-To: <BFCC73B5.1E6E%sdavis2@mail.nih.gov>
References: <df8328740512191110o28bbe63fve1e28aad002b1566@mail.gmail.com>
	<BFCC73B5.1E6E%sdavis2@mail.nih.gov>
Message-ID: <df8328740512191220w4a3b15ccsb25eb1814366c52a@mail.gmail.com>

Sean,

I've used files from
ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V . But the
script cannot parse them according to biosql-schema.
So, I want some files that the script can parse correctly.
Else, I've to load each and every file onto the biodb and then check whether
it has been parsed correctly!

Thanks,
Angshu


On 12/19/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
>
>
>
>
> On 12/19/05 2:10 PM, "Angshu Kar" <angshu96@gmail.com> wrote:
>
> > Hi Sean,
> >
> > What I need is precisely the latest arabidopsis files (peptide as well
> as dna)
> > that has loaded the database successfully when used with the
> > load_seqdatabase.pl script.
> > I've tried some other files but they doesn't load all the tables
> correctly
> > (e.g. cannot distinguish between accession #, name and identifier etc
> and load
> > same data in all the 3 columns).
>
> I might approach this in a different way.  I would seek to find the file
> or
> files that contain all the information that I want to store--this is the
> hard part in this case, perhaps.  If the data comes from TAIR (that looks
> to
> be a good source of genome information for arabidopsis), then you need to
> learn what files are there, what format they are in, what is in each of
> them, and what isn't.  Then, and only then, should you try to load the
> data
> into a database.  Only then can you determine what the problem is (if
> there
> is one) with loading data into bioperl-db.  Imagine, for example, that the
> datafile that you are trying to load includes only an accession.  In that
> case, bioperl-db can't load other information, because there isn't any to
> load.  So, you need to diagnose your own problem here, I think and
> determine
> what is in the files that you have and why you have the situation in the
> database you have.
>
> So, what format file do you have right now and does bioperl support it?
> What is expected to be in that file?  Is everything that you need in the
> files that you have (you have to look at the files and understand them,
> not
> at the bioperl parsing of them)?
>
> Sean
>
>
>

From sdavis2 at mail.nih.gov  Mon Dec 19 16:50:20 2005
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Mon Dec 19 16:47:33 2005
Subject: [Bioperl-l] arabidopsis + load_seqdatabase.pl
In-Reply-To: <df8328740512191220w4a3b15ccsb25eb1814366c52a@mail.gmail.com>
Message-ID: <BFCC954C.1EA8%sdavis2@mail.nih.gov>




On 12/19/05 3:20 PM, "Angshu Kar" <angshu96@gmail.com> wrote:

> Sean,
>  
> I've used files from
> ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V  . But the script
> cannot parse them according to biosql-schema.
> So, I want some files that the script can parse correctly.
> Else, I've to load each and every file onto the biodb and then check whether
> it has been parsed correctly!

Which file are you trying to load?  What format is it in?  What values are
you expecting to be loaded that aren't?  For the answer to the last
question, it will likely help folks to see exactly what line of the input
file isn't being loaded as you think it should be.  For example, if there is
a line in a file that contains

     foo         /note="bar"

Then you can point out that you would like to know where, if at all, the
annotation associated with the foo tag is stored.

Sean


From angshu96 at gmail.com  Mon Dec 19 17:39:37 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Mon Dec 19 17:43:32 2005
Subject: [Bioperl-l] arabidopsis + load_seqdatabase.pl
In-Reply-To: <BFCC954C.1EA8%sdavis2@mail.nih.gov>
References: <df8328740512191220w4a3b15ccsb25eb1814366c52a@mail.gmail.com>
	<BFCC954C.1EA8%sdavis2@mail.nih.gov>
Message-ID: <df8328740512191439s3477cee1oaa070c5e88da93d5@mail.gmail.com>

Sean,

I've tried .faa, .fna and .gbk files in the link mentioned below. After
running the script when I saw the loaded database, I saw that in the
bioentry table the 3 fields accession, identifier and name containing the
same data.Also, the version column was not populated. I want them to be
correctly parsed. So I want an arabidopsis data file that "goes well" with
the load_seqdatabase.pl script.

Thanks,
Angshu


On 12/19/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
>
>
>
>
> On 12/19/05 3:20 PM, "Angshu Kar" <angshu96@gmail.com> wrote:
>
> > Sean,
> >
> > I've used files from
> > ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V  . But the
> script
> > cannot parse them according to biosql-schema.
> > So, I want some files that the script can parse correctly.
> > Else, I've to load each and every file onto the biodb and then check
> whether
> > it has been parsed correctly!
>
> Which file are you trying to load?  What format is it in?  What values are
> you expecting to be loaded that aren't?  For the answer to the last
> question, it will likely help folks to see exactly what line of the input
> file isn't being loaded as you think it should be.  For example, if there
> is
> a line in a file that contains
>
>     foo         /note="bar"
>
> Then you can point out that you would like to know where, if at all, the
> annotation associated with the foo tag is stored.
>
> Sean
>
>
>

From chen_li3 at yahoo.com  Mon Dec 19 22:22:16 2005
From: chen_li3 at yahoo.com (chen li)
Date: Mon Dec 19 22:26:16 2005
Subject: [Bioperl-l] path of Primer3 
Message-ID: <20051220032216.69229.qmail@web36804.mail.mud.yahoo.com>

Hi all,

 I download primer3 from the website:
http://www-genome.wi.mit.edu/genome_software/other/primer3.html.
I decompress  software and install it following the
instructions and everything looks fine. My question:
how do I know where it is installed (the path) on my
Redhat linux Fedora core 4 computer after  the
compiling?

Thanks in advance,

Li 

__________________________________________________
Do You Yahoo!?
Tired of spam?  Yahoo! Mail has the best spam protection around 
http://mail.yahoo.com 
From angshu96 at gmail.com  Tue Dec 20 00:12:01 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Tue Dec 20 00:09:17 2005
Subject: [Bioperl-l] arabidopsis + load_seqdatabase.pl
In-Reply-To: <BFCCB08E.1EC5%sdavis2@mail.nih.gov>
References: <df8328740512191439s3477cee1oaa070c5e88da93d5@mail.gmail.com>
	<BFCCB08E.1EC5%sdavis2@mail.nih.gov>
Message-ID: <df8328740512192112l593e98c7n7fd0763aa291a6ca@mail.gmail.com>

Sean,

Arabidopsis is the datasource on which we need to work upon. Thats why i
need to load all arabidopsis info into the biosql schema.

Thanks for your info.

Angshu


On 12/19/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
>
>
>
>
> On 12/19/05 5:39 PM, "Angshu Kar" <angshu96@gmail.com> wrote:
>
> > Sean,
> >
> > I've tried .faa, .fna and .gbk files in the link mentioned below. After
> > running the script when I saw the loaded database, I saw that in the
> bioentry
> > table the 3 fields accession, identifier and name containing the same
> > data.Also, the version column was not populated. I want them to be
> correctly
> > parsed. So I want an arabidopsis data file that "goes well" with the
> > load_seqdatabase.pl script.
>
> I would suggest reading the NCBI handbook on genbank format files and then
> look at and go through the exercises here:
>
> http://bioperl.org/HOWTOs/html/Feature-Annotation.html
>
> Do this with your genbank file of interest and see where things end
> up.  My
> guess is that all the things that you think of as sequences end up as
> sequence features--look at the genbank file.  That is probably (though I'm
> not sure) where the answer is.
>
> Again, why do you want these information in a biosql database?  Just
> curious....  There may be a much easier way to go about what you want to
> do,
> but I can't be sure.
>
> Sean
>
>
>

From sdavis2 at mail.nih.gov  Tue Dec 20 07:11:07 2005
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Tue Dec 20 07:08:27 2005
Subject: [Bioperl-l] arabidopsis + load_seqdatabase.pl
In-Reply-To: <df8328740512192112l593e98c7n7fd0763aa291a6ca@mail.gmail.com>
Message-ID: <BFCD5F0B.1F54%sdavis2@mail.nih.gov>




On 12/20/05 12:12 AM, "Angshu Kar" <angshu96@gmail.com> wrote:

> Sean,
>  
> Arabidopsis is the datasource on which we need to work upon. Thats why i need
> to load all arabidopsis info into the biosql schema.

Not exactly what I meant.  Do you need sequences for sequence analysis?  Do
you need to know what protein domains are present in proteins?  Do you need
to know location on the genome for any reason?  Or are you going to be
blasting against the arabidopsis genes?  What are you going to be doing with
the data?  Or is your project just to load a biosql database so that someone
else can use it?

Sean


From sdavis2 at mail.nih.gov  Tue Dec 20 07:13:22 2005
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Tue Dec 20 08:32:55 2005
Subject: [Bioperl-l] path of Primer3 
In-Reply-To: <20051220032216.69229.qmail@web36804.mail.mud.yahoo.com>
Message-ID: <BFCD5F92.1F56%sdavis2@mail.nih.gov>




On 12/19/05 10:22 PM, "chen li" <chen_li3@yahoo.com> wrote:

> Hi all,
> 
>  I download primer3 from the website:
> http://www-genome.wi.mit.edu/genome_software/other/primer3.html.
> I decompress  software and install it following the
> instructions and everything looks fine. My question:
> how do I know where it is installed (the path) on my
> Redhat linux Fedora core 4 computer after  the
> compiling?

Does FC4 have a locate command?  You might try that.  I'm not sure what the
default location for primer3 is.

Sean


From markus.riester at student.uni-tuebingen.de  Tue Dec 20 11:02:10 2005
From: markus.riester at student.uni-tuebingen.de (markus.riester@student.uni-tuebingen.de)
Date: Tue Dec 20 11:30:35 2005
Subject: [Bioperl-l] Annotation:_typemap remembers removed types
Message-ID: <twig.1135094530.78092@mail.uni-tuebingen.de>

Hi,

not sure if the current behaviour is a bug or a feature. This trivial patch
removes the type from _typemap after removal.

Markus

Bio/Annotation/Collection.pm

321,322c321,323
<     foreach (@keys) {
<       delete $self->{'_annotation'}->{$_};
---
>     foreach my $key (@keys) {
>       delete $self->{'_annotation'}->{$key};
>       delete $self->{'_typemap'}->{'_type'}->{$key};


From osborne1 at optonline.net  Tue Dec 20 12:35:14 2005
From: osborne1 at optonline.net (Brian Osborne)
Date: Tue Dec 20 12:33:18 2005
Subject: [Bioperl-l] arabidopsis + load_seqdatabase.pl
In-Reply-To: <df8328740512191439s3477cee1oaa070c5e88da93d5@mail.gmail.com>
Message-ID: <BFCDAB02.6832%osborne1@optonline.net>

Angshu,

>I want them to be correctly parsed.

They have been correctly parsed but you're looking in the wrong place. The
names and identifiers associated with things like "CDS" or "gene" will not
be found in the Bioentry table. The Bioentry is the entire NC_* record, the
genes, mRNAs, and proteins are called features. Read the Feature-Annotation
HOWTO and doc/schema-overview.txt in the biosql package.

Brian O.


On 12/19/05 5:39 PM, "Angshu Kar" <angshu96@gmail.com> wrote:

> Sean,
> 
> I've tried .faa, .fna and .gbk files in the link mentioned below. After
> running the script when I saw the loaded database, I saw that in the
> bioentry table the 3 fields accession, identifier and name containing the
> same data.Also, the version column was not populated. I want them to be
> correctly parsed. So I want an arabidopsis data file that "goes well" with
> the load_seqdatabase.pl script.
> 
> Thanks,
> Angshu
> 
> 
> On 12/19/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
>> 
>> 
>> 
>> 
>> On 12/19/05 3:20 PM, "Angshu Kar" <angshu96@gmail.com> wrote:
>> 
>>> Sean,
>>> 
>>> I've used files from
>>> ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V  . But the
>> script
>>> cannot parse them according to biosql-schema.
>>> So, I want some files that the script can parse correctly.
>>> Else, I've to load each and every file onto the biodb and then check
>> whether
>>> it has been parsed correctly!
>> 
>> Which file are you trying to load?  What format is it in?  What values are
>> you expecting to be loaded that aren't?  For the answer to the last
>> question, it will likely help folks to see exactly what line of the input
>> file isn't being loaded as you think it should be.  For example, if there
>> is
>> a line in a file that contains
>> 
>>     foo         /note="bar"
>> 
>> Then you can point out that you would like to know where, if at all, the
>> annotation associated with the foo tag is stored.
>> 
>> Sean
>> 
>> 
>> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From hlapp at gmx.net  Tue Dec 20 12:42:55 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Tue Dec 20 12:40:11 2005
Subject: [Bioperl-l] Annotation:_typemap remembers removed types
In-Reply-To: <twig.1135094530.78092@mail.uni-tuebingen.de>
References: <twig.1135094530.78092@mail.uni-tuebingen.de>
Message-ID: <eff0a6341b8a701e37c7e55d637414ba@gmx.net>

I need to think whether this may have unwanted side effects but it does 
look like a good idea. Just to be sure it doesn't get lost, can you 
post this as a bug report with patch to bugzilla 
(bugzilla.bioperl.org)?

	-hilmar

On Dec 20, 2005, at 8:02 AM, <markus.riester@student.uni-tuebingen.de> 
wrote:

> Hi,
>
> not sure if the current behaviour is a bug or a feature. This trivial 
> patch
> removes the type from _typemap after removal.
>
> Markus
>
> Bio/Annotation/Collection.pm
>
> 321,322c321,323
> <     foreach (@keys) {
> <       delete $self->{'_annotation'}->{$_};
> ---
>>     foreach my $key (@keys) {
>>       delete $self->{'_annotation'}->{$key};
>>       delete $self->{'_typemap'}->{'_type'}->{$key};
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From angshu96 at gmail.com  Tue Dec 20 12:43:32 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Tue Dec 20 13:04:58 2005
Subject: [Bioperl-l] arabidopsis + load_seqdatabase.pl
In-Reply-To: <BFCDAB02.6832%osborne1@optonline.net>
References: <df8328740512191439s3477cee1oaa070c5e88da93d5@mail.gmail.com>
	<BFCDAB02.6832%osborne1@optonline.net>
Message-ID: <df8328740512200943j2cc89fe8s2b1721e8f440649d@mail.gmail.com>

Thanks Brian.


On 12/20/05, Brian Osborne <osborne1@optonline.net> wrote:
>
> Angshu,
>
> >I want them to be correctly parsed.
>
> They have been correctly parsed but you're looking in the wrong place. The
> names and identifiers associated with things like "CDS" or "gene" will not
> be found in the Bioentry table. The Bioentry is the entire NC_* record,
> the
> genes, mRNAs, and proteins are called features. Read the
> Feature-Annotation
> HOWTO and doc/schema-overview.txt in the biosql package.
>
> Brian O.
>
>
> On 12/19/05 5:39 PM, "Angshu Kar" <angshu96@gmail.com> wrote:
>
> > Sean,
> >
> > I've tried .faa, .fna and .gbk files in the link mentioned below. After
> > running the script when I saw the loaded database, I saw that in the
> > bioentry table the 3 fields accession, identifier and name containing
> the
> > same data.Also, the version column was not populated. I want them to be
> > correctly parsed. So I want an arabidopsis data file that "goes well"
> with
> > the load_seqdatabase.pl script.
> >
> > Thanks,
> > Angshu
> >
> >
> > On 12/19/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
> >>
> >>
> >>
> >>
> >> On 12/19/05 3:20 PM, "Angshu Kar" <angshu96@gmail.com> wrote:
> >>
> >>> Sean,
> >>>
> >>> I've used files from
> >>> ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V  . But the
> >> script
> >>> cannot parse them according to biosql-schema.
> >>> So, I want some files that the script can parse correctly.
> >>> Else, I've to load each and every file onto the biodb and then check
> >> whether
> >>> it has been parsed correctly!
> >>
> >> Which file are you trying to load?  What format is it in?  What values
> are
> >> you expecting to be loaded that aren't?  For the answer to the last
> >> question, it will likely help folks to see exactly what line of the
> input
> >> file isn't being loaded as you think it should be.  For example, if
> there
> >> is
> >> a line in a file that contains
> >>
> >>     foo         /note="bar"
> >>
> >> Then you can point out that you would like to know where, if at all,
> the
> >> annotation associated with the foo tag is stored.
> >>
> >> Sean
> >>
> >>
> >>
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
>

From hlapp at gmx.net  Tue Dec 20 13:28:27 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Tue Dec 20 13:25:40 2005
Subject: [Bioperl-l] arabidopsis + load_seqdatabase.pl
In-Reply-To: <BFCDAB02.6832%osborne1@optonline.net>
References: <BFCDAB02.6832%osborne1@optonline.net>
Message-ID: <245419c72c3558a9d619d05a12478b92@gmx.net>

100% agreed.

Angshu, sometimes it goes a long way if you are precise in the way you 
state things or either people have great difficulty understanding what 
exactly your problem is, or you come across as clueless, or both.

So, do keep in mind that it is the Bioperl SeqIO parser that does the 
parsing, not load_seqdatabase.pl. Also, load_seqdatabase.pl doesn't 
manipulate the sequence object returned by the parser, nor does 
bioperl-db. If accession, identifier, and name have the same values, 
then that is what the SeqIO parser does - and probably it does so for a 
reason. If you don't like the way SeqIO builds the object then write 
your own SeqProcessor as mentioned before and you are free to entirely 
rearrange the object. If you feel the SeqIO parser is in error then 
file or post a bug report, in which you will need to state what exactly 
is it that you find to be in error.

So, please stop asking for files to be parsed correctly - they *are* 
parsed correctly. Instead, take a moment to step back and read Sean's 
email again and then stick to the advice given there:

	1) What exactly is it out of those or any other files that you want 
represented in biosql? Not a single one of your answers indicates that 
you know the answer to this question. In other words, not a single one 
of your answers indicates that you know precisely what you want. How do 
you expect others to help you achieve what you want if you don't even 
know what you want, let alone be able to explain it to others.

	2) What have you tried to get what you need? Why did the outcome of 
those attempts fall short of what you want? When doing so, do not label 
software you used in the process as yielding 'incorrect' results unless 
you can back that up with a solid bug report, because almost always the 
one who is 'incorrect' is you, expecting things that you shouldn't have 
expected, or executing things wrongly.

For example, you could state that 1) what you want is all A.thaliana 
transcripts in a biosql database, with each bioentry ideally being a 
CDS, or at least a transcript, with as much annotation as contained in 
the input file, and that 2) you used the NC_* records in GenBank format 
with load_seqdatabase.pl but found yourself with only the contigs as 
bioentries, not the transcripts or CDS records.

At this point, most people will have understood what your goal is, and 
people more experienced in bioperl will also have understood that you 
fell for a common misconception many people new to bioperl have, namely 
to confuse features with the main entry (i.e., sequence).

It would then have been straightforward to point out that your desired 
CDS annotation is surely present in your Biosql instance (if annotated 
in the NC* record), but as rows in seqfeature because they were 
features on the sequences as they came out of the parser.

It would also be straightforward to suggest a solution to this problem, 
namely by either writing a SeqProcessor that converts the CDS features 
of the contig sequences to first-class sequence objects (that's for 
instance what I do for the EMBL formatted Ensembl dumps), or by using 
an input file that has transcripts as primary records instead of as 
feature annotation on a contig.

Given that you could then set out to locate GenBank or EMBL formatted 
files containing A.thaliana transcripts as their records, instead of 
asking others to search the internet for you.

I'm afraid that as far as I'm concerned I won't be able to lend you any 
more of my time unless you are specific and precise in stating what 
your goal is and what you got.

	-hilmar

On Dec 20, 2005, at 9:35 AM, Brian Osborne wrote:

> Angshu,
>
>> I want them to be correctly parsed.
>
> They have been correctly parsed but you're looking in the wrong place. 
> The
> names and identifiers associated with things like "CDS" or "gene" will 
> not
> be found in the Bioentry table. The Bioentry is the entire NC_* 
> record, the
> genes, mRNAs, and proteins are called features. Read the 
> Feature-Annotation
> HOWTO and doc/schema-overview.txt in the biosql package.
>
> Brian O.
>
>
> On 12/19/05 5:39 PM, "Angshu Kar" <angshu96@gmail.com> wrote:
>
>> Sean,
>>
>> I've tried .faa, .fna and .gbk files in the link mentioned below. 
>> After
>> running the script when I saw the loaded database, I saw that in the
>> bioentry table the 3 fields accession, identifier and name containing 
>> the
>> same data.Also, the version column was not populated. I want them to 
>> be
>> correctly parsed. So I want an arabidopsis data file that "goes well" 
>> with
>> the load_seqdatabase.pl script.
>>
>> Thanks,
>> Angshu
>>
>>
>> On 12/19/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
>>>
>>>
>>>
>>>
>>> On 12/19/05 3:20 PM, "Angshu Kar" <angshu96@gmail.com> wrote:
>>>
>>>> Sean,
>>>>
>>>> I've used files from
>>>> ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V  . But the
>>> script
>>>> cannot parse them according to biosql-schema.
>>>> So, I want some files that the script can parse correctly.
>>>> Else, I've to load each and every file onto the biodb and then check
>>> whether
>>>> it has been parsed correctly!
>>>
>>> Which file are you trying to load?  What format is it in?  What 
>>> values are
>>> you expecting to be loaded that aren't?  For the answer to the last
>>> question, it will likely help folks to see exactly what line of the 
>>> input
>>> file isn't being loaded as you think it should be.  For example, if 
>>> there
>>> is
>>> a line in a file that contains
>>>
>>>     foo         /note="bar"
>>>
>>> Then you can point out that you would like to know where, if at all, 
>>> the
>>> annotation associated with the foo tag is stored.
>>>
>>> Sean
>>>
>>>
>>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l@portal.open-bio.org
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From angshu96 at gmail.com  Tue Dec 20 13:34:38 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Tue Dec 20 13:31:58 2005
Subject: [Bioperl-l] arabidopsis + load_seqdatabase.pl
In-Reply-To: <245419c72c3558a9d619d05a12478b92@gmx.net>
References: <BFCDAB02.6832%osborne1@optonline.net>
	<245419c72c3558a9d619d05a12478b92@gmx.net>
Message-ID: <df8328740512201034w3b176732n48d7d7f71e400e7a@mail.gmail.com>

Thanks Hilmar.

On 12/20/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
> 100% agreed.
>
> Angshu, sometimes it goes a long way if you are precise in the way you
> state things or either people have great difficulty understanding what
> exactly your problem is, or you come across as clueless, or both.
>
> So, do keep in mind that it is the Bioperl SeqIO parser that does the
> parsing, not load_seqdatabase.pl. Also, load_seqdatabase.pl doesn't
> manipulate the sequence object returned by the parser, nor does
> bioperl-db. If accession, identifier, and name have the same values,
> then that is what the SeqIO parser does - and probably it does so for a
> reason. If you don't like the way SeqIO builds the object then write
> your own SeqProcessor as mentioned before and you are free to entirely
> rearrange the object. If you feel the SeqIO parser is in error then
> file or post a bug report, in which you will need to state what exactly
> is it that you find to be in error.
>
> So, please stop asking for files to be parsed correctly - they *are*
> parsed correctly. Instead, take a moment to step back and read Sean's
> email again and then stick to the advice given there:
>
>        1) What exactly is it out of those or any other files that you want
> represented in biosql? Not a single one of your answers indicates that
> you know the answer to this question. In other words, not a single one
> of your answers indicates that you know precisely what you want. How do
> you expect others to help you achieve what you want if you don't even
> know what you want, let alone be able to explain it to others.
>
>        2) What have you tried to get what you need? Why did the outcome of
> those attempts fall short of what you want? When doing so, do not label
> software you used in the process as yielding 'incorrect' results unless
> you can back that up with a solid bug report, because almost always the
> one who is 'incorrect' is you, expecting things that you shouldn't have
> expected, or executing things wrongly.
>
> For example, you could state that 1) what you want is all A.thaliana
> transcripts in a biosql database, with each bioentry ideally being a
> CDS, or at least a transcript, with as much annotation as contained in
> the input file, and that 2) you used the NC_* records in GenBank format
> with load_seqdatabase.pl but found yourself with only the contigs as
> bioentries, not the transcripts or CDS records.
>
> At this point, most people will have understood what your goal is, and
> people more experienced in bioperl will also have understood that you
> fell for a common misconception many people new to bioperl have, namely
> to confuse features with the main entry (i.e., sequence).
>
> It would then have been straightforward to point out that your desired
> CDS annotation is surely present in your Biosql instance (if annotated
> in the NC* record), but as rows in seqfeature because they were
> features on the sequences as they came out of the parser.
>
> It would also be straightforward to suggest a solution to this problem,
> namely by either writing a SeqProcessor that converts the CDS features
> of the contig sequences to first-class sequence objects (that's for
> instance what I do for the EMBL formatted Ensembl dumps), or by using
> an input file that has transcripts as primary records instead of as
> feature annotation on a contig.
>
> Given that you could then set out to locate GenBank or EMBL formatted
> files containing A.thaliana transcripts as their records, instead of
> asking others to search the internet for you.
>
> I'm afraid that as far as I'm concerned I won't be able to lend you any
> more of my time unless you are specific and precise in stating what
> your goal is and what you got.
>
>        -hilmar
>
> On Dec 20, 2005, at 9:35 AM, Brian Osborne wrote:
>
> > Angshu,
> >
> >> I want them to be correctly parsed.
> >
> > They have been correctly parsed but you're looking in the wrong place.
> > The
> > names and identifiers associated with things like "CDS" or "gene" will
> > not
> > be found in the Bioentry table. The Bioentry is the entire NC_*
> > record, the
> > genes, mRNAs, and proteins are called features. Read the
> > Feature-Annotation
> > HOWTO and doc/schema-overview.txt in the biosql package.
> >
> > Brian O.
> >
> >
> > On 12/19/05 5:39 PM, "Angshu Kar" <angshu96@gmail.com> wrote:
> >
> >> Sean,
> >>
> >> I've tried .faa, .fna and .gbk files in the link mentioned below.
> >> After
> >> running the script when I saw the loaded database, I saw that in the
> >> bioentry table the 3 fields accession, identifier and name containing
> >> the
> >> same data.Also, the version column was not populated. I want them to
> >> be
> >> correctly parsed. So I want an arabidopsis data file that "goes well"
> >> with
> >> the load_seqdatabase.pl script.
> >>
> >> Thanks,
> >> Angshu
> >>
> >>
> >> On 12/19/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
> >>>
> >>>
> >>>
> >>>
> >>> On 12/19/05 3:20 PM, "Angshu Kar" <angshu96@gmail.com> wrote:
> >>>
> >>>> Sean,
> >>>>
> >>>> I've used files from
> >>>> ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V  . But the
> >>> script
> >>>> cannot parse them according to biosql-schema.
> >>>> So, I want some files that the script can parse correctly.
> >>>> Else, I've to load each and every file onto the biodb and then check
> >>> whether
> >>>> it has been parsed correctly!
> >>>
> >>> Which file are you trying to load?  What format is it in?  What
> >>> values are
> >>> you expecting to be loaded that aren't?  For the answer to the last
> >>> question, it will likely help folks to see exactly what line of the
> >>> input
> >>> file isn't being loaded as you think it should be.  For example, if
> >>> there
> >>> is
> >>> a line in a file that contains
> >>>
> >>>     foo         /note="bar"
> >>>
> >>> Then you can point out that you would like to know where, if at all,
> >>> the
> >>> annotation associated with the foo tag is stored.
> >>>
> >>> Sean
> >>>
> >>>
> >>>
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l@portal.open-bio.org
> >> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From bmoore at genetics.utah.edu  Tue Dec 20 13:36:07 2005
From: bmoore at genetics.utah.edu (Barry Moore)
Date: Tue Dec 20 13:32:09 2005
Subject: [Bioperl-l] path of Primer3 
Message-ID: <CFE1DF3BA20F424689DA0881A14055BECF2F43@m.hg.genetics.utah.edu>

After you run make you should find the binary primer3_core in the src
subdirectory of the location you unzipped/untarred.  It's up to you to
move or link that binary somewhere into your path.  On my system I
created a link to primer3_core in /usr/local/bin.

Barry

> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-
> bounces@portal.open-bio.org] On Behalf Of Sean Davis
> Sent: Tuesday, December 20, 2005 5:13 AM
> To: chen li; Bioperl
> Subject: Re: [Bioperl-l] path of Primer3
> 
> 
> 
> 
> On 12/19/05 10:22 PM, "chen li" <chen_li3@yahoo.com> wrote:
> 
> > Hi all,
> >
> >  I download primer3 from the website:
> > http://www-genome.wi.mit.edu/genome_software/other/primer3.html.
> > I decompress  software and install it following the
> > instructions and everything looks fine. My question:
> > how do I know where it is installed (the path) on my
> > Redhat linux Fedora core 4 computer after  the
> > compiling?
> 
> Does FC4 have a locate command?  You might try that.  I'm not sure
what
> the
> default location for primer3 is.
> 
> Sean
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

From chen_li3 at yahoo.com  Tue Dec 20 23:18:25 2005
From: chen_li3 at yahoo.com (chen li)
Date: Tue Dec 20 23:22:23 2005
Subject: [Bioperl-l] path of Primer3 
In-Reply-To: <CFE1DF3BA20F424689DA0881A14055BECF2F43@m.hg.genetics.utah.edu>
Message-ID: <20051221041825.37292.qmail@web36809.mail.mud.yahoo.com>

Barry,

  Thank you very much.

  I use " find" command to find the path of primer3
after compiling. I find it in this path: 

/home/alex/primer3_1.0.0/src/primer3_core

I am just not sure it is the so-called primer3. I look
for the   mailing list archives on Bioperl website. It
looks like it is.

BTW how do you create a link to primer3_core in
/usr/local/bin?

Thanks,

Li


--- Barry Moore <bmoore@genetics.utah.edu> wrote:

> After you run make you should find the binary
> primer3_core in the src
> subdirectory of the location you unzipped/untarred. 
> It's up to you to
> move or link that binary somewhere into your path. 
> On my system I
> created a link to primer3_core in /usr/local/bin.
> 
> Barry
> 
> > -----Original Message-----
> > From: bioperl-l-bounces@portal.open-bio.org
> [mailto:bioperl-l-
> > bounces@portal.open-bio.org] On Behalf Of Sean
> Davis
> > Sent: Tuesday, December 20, 2005 5:13 AM
> > To: chen li; Bioperl
> > Subject: Re: [Bioperl-l] path of Primer3
> > 
> > 
> > 
> > 
> > On 12/19/05 10:22 PM, "chen li"
> <chen_li3@yahoo.com> wrote:
> > 
> > > Hi all,
> > >
> > >  I download primer3 from the website:
> > >
>
http://www-genome.wi.mit.edu/genome_software/other/primer3.html.
> > > I decompress  software and install it following
> the
> > > instructions and everything looks fine. My
> question:
> > > how do I know where it is installed (the path)
> on my
> > > Redhat linux Fedora core 4 computer after  the
> > > compiling?
> > 
> > Does FC4 have a locate command?  You might try
> that.  I'm not sure
> what
> > the
> > default location for primer3 is.
> > 
> > Sean
> > 
> > 
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> >
>
http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 


__________________________________________________
Do You Yahoo!?
Tired of spam?  Yahoo! Mail has the best spam protection around 
http://mail.yahoo.com 
From taerwin at gmail.com  Tue Dec 20 23:41:36 2005
From: taerwin at gmail.com (Tim Erwin)
Date: Wed Dec 21 00:42:05 2005
Subject: [Bioperl-l] path of Primer3
In-Reply-To: <20051221041825.37292.qmail@web36809.mail.mud.yahoo.com>
References: <CFE1DF3BA20F424689DA0881A14055BECF2F43@m.hg.genetics.utah.edu>
	<20051221041825.37292.qmail@web36809.mail.mud.yahoo.com>
Message-ID: <c7d2b5330512202041m5af5100di2fc850ae59bf628a@mail.gmail.com>

primer3_core is the primer3 binary you can create a symbolic link via:

$ ln -s /home/alex/primer3_1.0.0/src/primer3_core /usr/local/bin/primer3

Regards,

Tim

On 12/21/05, chen li <chen_li3@yahoo.com> wrote:
> Barry,
>
>   Thank you very much.
>
>   I use " find" command to find the path of primer3
> after compiling. I find it in this path:
>
> /home/alex/primer3_1.0.0/src/primer3_core
>
> I am just not sure it is the so-called primer3. I look
> for the   mailing list archives on Bioperl website. It
> looks like it is.
>
> BTW how do you create a link to primer3_core in
> /usr/local/bin?
>
> Thanks,
>
> Li
>
>
> --- Barry Moore <bmoore@genetics.utah.edu> wrote:
>
> > After you run make you should find the binary
> > primer3_core in the src
> > subdirectory of the location you unzipped/untarred.
> > It's up to you to
> > move or link that binary somewhere into your path.
> > On my system I
> > created a link to primer3_core in /usr/local/bin.
> >
> > Barry
> >
> > > -----Original Message-----
> > > From: bioperl-l-bounces@portal.open-bio.org
> > [mailto:bioperl-l-
> > > bounces@portal.open-bio.org] On Behalf Of Sean
> > Davis
> > > Sent: Tuesday, December 20, 2005 5:13 AM
> > > To: chen li; Bioperl
> > > Subject: Re: [Bioperl-l] path of Primer3
> > >
> > >
> > >
> > >
> > > On 12/19/05 10:22 PM, "chen li"
> > <chen_li3@yahoo.com> wrote:
> > >
> > > > Hi all,
> > > >
> > > >  I download primer3 from the website:
> > > >
> >
> http://www-genome.wi.mit.edu/genome_software/other/primer3.html.
> > > > I decompress  software and install it following
> > the
> > > > instructions and everything looks fine. My
> > question:
> > > > how do I know where it is installed (the path)
> > on my
> > > > Redhat linux Fedora core 4 computer after  the
> > > > compiling?
> > >
> > > Does FC4 have a locate command?  You might try
> > that.  I'm not sure
> > what
> > > the
> > > default location for primer3 is.
> > >
> > > Sean
> > >
> > >
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l@portal.open-bio.org
> > >
> >
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
>
>
> __________________________________________________
> Do You Yahoo!?
> Tired of spam?  Yahoo! Mail has the best spam protection around
> http://mail.yahoo.com
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

From heikki.lehvaslaiho at gmail.com  Wed Dec 21 01:29:13 2005
From: heikki.lehvaslaiho at gmail.com (Heikki Lehvaslaiho)
Date: Wed Dec 21 02:12:21 2005
Subject: [Bioperl-l] Test writing
Message-ID: <200512210829.14024.heikki.lehvaslaiho@gmail.com>



This message is for module authors and for anyone looking for something to do 
for BioPerl. 


I've modified the 'maintenance/modules.pl --untested' code so that it reads in 
all test files, extracts 'use'd or 'required' Bio classes, now *recursively* 
marks all super classes and 'use'd classes as tested. In addition, I manually 
ignore all Bio::Search and Bio::SearchIO classes. That is because although 
there are extensive tests for modules in these name spaces, new classes are 
instantiated based on attributes to the constructor. This might be true to 
other classes, too. If this is the case, I can see two possible actions: 


1. Add them to the list of ignored class names at the end of function 
'untested' in the script. 


2. If the classes are never called directly, rename them to start with lower 
case letter which by convention means that they are "component classes" like 
Bio::SeqIO::genbank. 



All other classes should have tests written for them or - ultimately - removed 
from the repository. 


The aim of this exercise is to come up with a first pass list of BioPerl 
classes that do not have any tests written for them and get them written. The 
next pass will be to find untested methods within classes. 



When writing tests, please follow conventions in existing files and remember 
to test all public methods. If you do not have a cvs login, post the new 
tests to bugzilla.bioperl.org, not to the list. We are more than happy to 
give cvs access to anyone committing more than a couple new tests. 


       -Heikki


List of BioPerl classes needing tests:

Bio::Align::Utilities
Bio::Annotation::AnnotationFactory
Bio::Annotation::Target
Bio::DB::Ace
Bio::DB::Expression
Bio::DB::Fasta::Stream
Bio::DB::Flat::BDB
Bio::DB::Flat::BinarySearch
Bio::DB::GFF::ID_Iterator
Bio::DB::Universal
Bio::DB::XEMBLService
Bio::Expression::Contact
Bio::Expression::DataSet
Bio::Expression::FeatureGroup
Bio::Expression::FeatureGroup::FeatureGroupMas50
Bio::Expression::FeatureSet::FeatureSetMas50
Bio::Expression::Platform
Bio::Expression::Sample
Bio::FeatureIO
Bio::Graphics::FeatureFile::Iterator
Bio::Graphics::Glyph
Bio::Graphics::Util
Bio::Index::Fastq
Bio::Index::Hmmer
Bio::LiveSeq::IO::SRS
Bio::Location::AvWithinCoordPolicy
Bio::Location::NarrowestCoordPolicy
Bio::Map::Clone
Bio::Map::Contig
Bio::Map::FPCMarker
Bio::Map::OrderedPositionWithDistance
Bio::Map::Physical
Bio::Matrix::PSM::Psm
Bio::Matrix::PSM::PsmHeader
Bio::Matrix::Scoring
Bio::Ontology::InterProTerm
Bio::Ontology::Path
Bio::Ontology::SimpleGOEngine
Bio::OntologyIO::Handlers::InterProHandler
Bio::OntologyIO::Handlers::InterPro_BioSQL_Handler
Bio::OntologyIO::InterProParser
Bio::PrimarySeq::Fasta
Bio::Root::Err
Bio::Root::Global
Bio::Root::IOManager
Bio::Root::Utilities
Bio::Root::Vector
Bio::Root::Xref
Bio::SeqFeature::Gene::Promoter
Bio::SeqFeature::PositionProxy
Bio::SeqFeature::Tools::FeatureNamer
Bio::SeqFeature::Tools::IDHandler
Bio::SeqFeature::Tools::TypeMapper
Bio::SeqIO::FTHelper
Bio::Structure::SecStr::DSSP::Res
Bio::Structure::SecStr::STRIDE::Res
Bio::Taxonomy
Bio::Taxonomy::Taxon
Bio::Taxonomy::Tree
Bio::Tools::AlignFactory
Bio::Tools::Blast::HSP
Bio::Tools::Blast::HTML
Bio::Tools::Blast::Sbjct
Bio::Tools::Blat
Bio::Tools::Coil
Bio::Tools::ESTScan
Bio::Tools::Eponine
Bio::Tools::Fgenesh
Bio::Tools::Gel
Bio::Tools::Grail
Bio::Tools::HMM
Bio::Tools::Hmmpfam
Bio::Tools::Primer::Feature
Bio::Tools::Primer::Pair
Bio::Tools::Prints
Bio::Tools::Profile
Bio::Tools::PrositeScan
Bio::Tools::Run::GenericParameters
Bio::Tools::Seg
Bio::Tools::Signalp
Bio::Tools::Tmhmm
Bio::Tools::WWW
Bio::Tools::WebBlat
Bio::Tree::Compatible
Bio::Tree::Draw::Cladogram
Bio::Tree::NodeNHX
FeatureStore  # in Bio::DB::GFF::Adaptor::berkeleydb.pm
interpro   # class defined in Bio::SeqIO::interpro, mistake?

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of the Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________
From anst at kvl.dk  Wed Dec 21 04:10:48 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Wed Dec 21 04:29:32 2005
Subject: [Bioperl-l] blast doesn't work
Message-ID: <s3a92a45.002@gwia.kvl.dk>

Hi! 
 
I have used bioperl blast many times before on redhat linux Os and windows PC with luck. 
I am now using SUSE 10.0 on my job and perl bptutorial.pl 22 returns: 
 
Beginning run_remoteblast example... 
submitted Blast job 
retrieving results... 
-------------------- WARNING --------------------- 
MSG: Possible error (1) while parsing BLAST report! 
--------------------------------------------------- 
 
 
futhermore perl bptutorial.pl 23 returns: 
 
Beginning run_standaloneblast example... 
blastall program not found. Skipping StandAloneBlast example 
 
I have tried to install it all again (Bundle + Bioperl) manually and set the enviroment variable like: 
 
export BLASTDIR=/usr/local/blast 
 
in my bash shell, but it didn't change much. This blast dir is a separate blast program I have downloaded from NCBI that works outside bioperl. 
 
I have asked my administrator but no luck. 
 
I figure it has something to do with setting the enviroment variable, but I just don't know where else to set it! 
 
Anders. 


From torsten.seemann at infotech.monash.edu.au  Wed Dec 21 05:25:46 2005
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Wed Dec 21 05:22:54 2005
Subject: [Bioperl-l] blast doesn't work
In-Reply-To: <s3a92a45.002@gwia.kvl.dk>
References: <s3a92a45.002@gwia.kvl.dk>
Message-ID: <43A92DAA.7030403@infotech.monash.edu.au>

Anders,

> futhermore perl bptutorial.pl 23 returns: 
>  
> Beginning run_standaloneblast example... 
> blastall program not found. Skipping StandAloneBlast example 
>  
> I have tried to install it all again (Bundle + Bioperl) manually and set the enviroment variable like: 
>  
> export BLASTDIR=/usr/local/blast 

Does your BLASTDIR actually contain the 'blastall' binary?

In my installation I have to do:
	export BLASTDIR=/usr/local/ncbi_blast/bin

Also, to run test 23 in bptutorial you have to run it from a directory 
with a ./t/data/ subdirectory. This is in CVS bioperl-live and the 
orginal tar.gz distribution.

-- 
Torsten Seemann
Victorian Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/
From torsten.seemann at infotech.monash.edu.au  Wed Dec 21 06:37:12 2005
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Wed Dec 21 06:34:22 2005
Subject: [Bioperl-l] Test writing
In-Reply-To: <200512210829.14024.heikki.lehvaslaiho@gmail.com>
References: <200512210829.14024.heikki.lehvaslaiho@gmail.com>
Message-ID: <43A93E68.6000007@infotech.monash.edu.au>

Heikki,

> I've modified the 'maintenance/modules.pl --untested' code so that it reads in 
> all test files, extracts 'use'd or 'required' Bio classes, now *recursively* 
> List of BioPerl classes needing tests:

Nice work!

It's already paid off because...

> Bio::Root::Utilities

I found 3 bugs in this module while writing the new t/Root-Utilites.t !

(not sure if anyone actually uses that module though :-)

-- 
Torsten Seemann
Victorian Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/
From anst at kvl.dk  Wed Dec 21 06:39:24 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Wed Dec 21 06:39:28 2005
Subject: [Bioperl-l] blast doesn't work
Message-ID: <s3a94d15.023@gwia.kvl.dk>

Torsten, 
 
I have tried 
 
export BLASTDIR=/usr/local/blast/bin  (where my blastall binary is) 
 
I get the same? 
 
Anders.

>>>Torsten Seemann <torsten.seemann@infotech.monash.edu.au> 12/21/05 11:25 am >>>
Anders,

>futhermore perl bptutorial.pl 23 returns:
> 
>Beginning run_standaloneblast example...
>blastall program not found. Skipping StandAloneBlast example
> 
>I have tried to install it all again (Bundle + Bioperl) manually and set the enviroment variable like:
> 
>export BLASTDIR=/usr/local/blast

Does your BLASTDIR actually contain the 'blastall' binary?

In my installation I have to do:
export BLASTDIR=/usr/local/ncbi_blast/bin

Also, to run test 23 in bptutorial you have to run it from a directory
with a ./t/data/ subdirectory. This is in CVS bioperl-live and the
orginal tar.gz distribution.

--
Torsten Seemann
Victorian Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/


From anst at kvl.dk  Wed Dec 21 06:44:39 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Wed Dec 21 06:43:35 2005
Subject: [Bioperl-l] blast doesn't work
Message-ID: <s3a94e54.085@gwia.kvl.dk>

Torsten, 
 
I am running bptutorial 23 from a directory with a ./t/data/ subdirectory. Namely in the bioperl-1.4 directory with the ./t/data subdirectory. 
 
Anders.

>>>Torsten Seemann <torsten.seemann@infotech.monash.edu.au> 12/21/05 11:25 am >>>
Anders,

>futhermore perl bptutorial.pl 23 returns:
> 
>Beginning run_standaloneblast example...
>blastall program not found. Skipping StandAloneBlast example
> 
>I have tried to install it all again (Bundle + Bioperl) manually and set the enviroment variable like:
> 
>export BLASTDIR=/usr/local/blast

Does your BLASTDIR actually contain the 'blastall' binary?

In my installation I have to do:
export BLASTDIR=/usr/local/ncbi_blast/bin

Also, to run test 23 in bptutorial you have to run it from a directory
with a ./t/data/ subdirectory. This is in CVS bioperl-live and the
orginal tar.gz distribution.

--
Torsten Seemann
Victorian Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/

Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From torsten.seemann at infotech.monash.edu.au  Wed Dec 21 06:50:18 2005
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Wed Dec 21 06:47:22 2005
Subject: [Bioperl-l] blast doesn't work
In-Reply-To: <s3a94d15.023@gwia.kvl.dk>
References: <s3a94d15.023@gwia.kvl.dk>
Message-ID: <43A9417A.20208@infotech.monash.edu.au>

> I have tried  
> export BLASTDIR=/usr/local/blast/bin  (where my blastall binary is)
> I get the same?

(I assume you are on Unix, not Windows)

Does it work when you do this?

	export PATH=/usr/local/blast/bin:$PATH
	./bptutorial 23

Is there definitely a file called 'blastall' in /usr/local/blast/bin 
which is EXECUTABLE and READABLE by the user running the tutorial?

-- 
Torsten Seemann
Victorian Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/
From anst at kvl.dk  Wed Dec 21 07:11:31 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Wed Dec 21 07:08:50 2005
Subject: Fwd: Re: [Bioperl-l] blast doesn't work
Message-ID: <s3a9548e.076@gwia.kvl.dk>



>>>Torsten Seemann <torsten.seemann@infotech.monash.edu.au> 12/21/05 11:25 am >>>
Anders,

>futhermore perl bptutorial.pl 23 returns:
> 
>Beginning run_standaloneblast example...
>blastall program not found. Skipping StandAloneBlast example
> 
>I have tried to install it all again (Bundle + Bioperl) manually and set the enviroment variable like:
> 
>export BLASTDIR=/usr/local/blast

Does your BLASTDIR actually contain the 'blastall' binary?

In my installation I have to do:
export BLASTDIR=/usr/local/ncbi_blast/bin

Also, to run test 23 in bptutorial you have to run it from a directory
with a ./t/data/ subdirectory. This is in CVS bioperl-live and the
orginal tar.gz distribution.

--
Torsten Seemann
Victorian Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/



From anst at kvl.dk  Wed Dec 21 07:12:10 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Wed Dec 21 07:09:52 2005
Subject: Fwd: Re: [Bioperl-l] blast doesn't work
Message-ID: <s3a954d0.083@gwia.kvl.dk>



>>>Torsten Seemann <torsten.seemann@infotech.monash.edu.au> 12/21/05 11:25 am >>>
Anders,

>futhermore perl bptutorial.pl 23 returns:
> 
>Beginning run_standaloneblast example...
>blastall program not found. Skipping StandAloneBlast example
> 
>I have tried to install it all again (Bundle + Bioperl) manually and set the enviroment variable like:
> 
>export BLASTDIR=/usr/local/blast

Does your BLASTDIR actually contain the 'blastall' binary?

In my installation I have to do:
export BLASTDIR=/usr/local/ncbi_blast/bin

Also, to run test 23 in bptutorial you have to run it from a directory
with a ./t/data/ subdirectory. This is in CVS bioperl-live and the
orginal tar.gz distribution.

--
Torsten Seemann
Victorian Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/

Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l



From anst at kvl.dk  Wed Dec 21 08:41:26 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Wed Dec 21 08:39:03 2005
Subject: [Bioperl-l] Blast doesn't work
Message-ID: <s3a969b0.087@gwia.kvl.dk>

Torsten, 
  
SUSE 10.0 is the brand new version the linux SUSE OS. 
  
writing: export PATH=/usr/local/blast/bin:$PATH./bptutorial 23 
  
gives me: 
 
bash: export PATH=/usr/local/blast/bin:/home/anst/bin:/usr/local/bin:/usr/bin:/usr/X11R6/bin:/bin:/home/anst/blast/bin:/usr/games:/opt/gnome/bin:/opt/kde3/bin:/usr/lib/mit/bin:/usr/lib/mit/sbin./bptutorial 23: No such file or directory 
  
Yes! there is definitely a file called blastall in the /usr/local/blast/bin directory and it works if I use it independently of bioperl. 
  
The thing is that I have never before needed/used to download the ncbi blast program independently. 
Shouldn't it be enough to install the Bundle? 
  
Also, when writing 
  
perl -w bptutorial.pl 23 
  
I get: 
  
Beginning run_standaloneblast example... 
[blastall] WARNING: Test1: Unable to open ecoli.nt.nin 
  
------------- EXCEPTION  ------------- 
MSG: blastall call crashed: 256 /usr/local/blast/bin/blastall -p  blastn  -d  /usr/local/blast/bin/data/ecoli.nt  -i  /tmp/zM1t9HD2jq  -o  /tmp/FCGPZQlclD 
  
STACK Bio::Tools::Run::StandAloneBlast::_runblast Bio/Tools/Run/StandAloneBlast.pm:732 
STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast Bio/Tools/Run/StandAloneBlast.pm:680 
STACK Bio::Tools::Run::StandAloneBlast::blastall Bio/Tools/Run/StandAloneBlast.pm:536 
STACK main::__ANON__ bptutorial.pl:3279 
STACK main::run_examples bptutorial.pl:4156 
STACK toplevel bptutorial.pl:4245 
  
Notice in line 2: Unable to open ecoli.nt.nin. This is a remnant from an E.coli. database formatation I did much earlier and independently of bioperl. 
Thus, the ncbi standaloneblast program works, but not with bioperl! 
  
Why does bioperl fetch an unrelated file in the /usr/local/blast/data directory? 
Is like it is trying to run something it shouldn't. 
  
Anders. 
 >>>Torsten Seemann <torsten.seemann@infotech.monash.edu.au> 12/21/05 12:50 pm >>> >I have tried  >export BLASTDIR=/usr/local/blast/bin  (where my blastall binary is) >I get the same?  (I assume you are on Unix, not Windows)  Does it work when you do this?  export PATH=/usr/local/blast/bin:$PATH ./bptutorial 23  Is there definitely a file called 'blastall' in /usr/local/blast/bin which is EXECUTABLE and READABLE by the user running the tutorial?  -- Torsten Seemann Victorian Bioinformatics Consortium, Monash University, Australia http://www.vicbioinformatics.com/ 


From michael.watson at bbsrc.ac.uk  Wed Dec 21 09:01:08 2005
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Wed Dec 21 09:03:57 2005
Subject: [Bioperl-l] Blast doesn't work
Message-ID: <8975119BCD0AC5419D61A9CF1A923E95024C5612@iahce2ksrv1.iah.bbsrc.ac.uk>

Dude

Try

find / -name ecoli.nt.nin 

This will give you the location of your blast data directory.  For an
example, mine is in /usr/local/blast/data/ecoli.nt.nin

Now

export PATH=$PATH:/usr/local/blast/bin
export BLASTDB=/usr/local/blast/data/ # get this from the "find" command
above
export BLASTMAT=/usr/local/blast/data/ # get this from the "find"
command above

perl -w bptutorial.pl 23

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Anders
Stegmann
Sent: 21 December 2005 13:41
To: bioperl-l@bioperl.org
Subject: [Bioperl-l] Blast doesn't work

Torsten, 
  
SUSE 10.0 is the brand new version the linux SUSE OS. 
  
writing: export PATH=/usr/local/blast/bin:$PATH./bptutorial 23 
  
gives me: 
 
bash: export
PATH=/usr/local/blast/bin:/home/anst/bin:/usr/local/bin:/usr/bin:/usr/X1
1R6/bin:/bin:/home/anst/blast/bin:/usr/games:/opt/gnome/bin:/opt/kde3/bi
n:/usr/lib/mit/bin:/usr/lib/mit/sbin./bptutorial 23: No such file or
directory 
  
Yes! there is definitely a file called blastall in the
/usr/local/blast/bin directory and it works if I use it independently of
bioperl. 
  
The thing is that I have never before needed/used to download the ncbi
blast program independently. 
Shouldn't it be enough to install the Bundle? 
  
Also, when writing 
  
perl -w bptutorial.pl 23 
  
I get: 
  
Beginning run_standaloneblast example... 
[blastall] WARNING: Test1: Unable to open ecoli.nt.nin 
  
------------- EXCEPTION  -------------
MSG: blastall call crashed: 256 /usr/local/blast/bin/blastall -p  blastn
-d  /usr/local/blast/bin/data/ecoli.nt  -i  /tmp/zM1t9HD2jq  -o
/tmp/FCGPZQlclD 
  
STACK Bio::Tools::Run::StandAloneBlast::_runblast
Bio/Tools/Run/StandAloneBlast.pm:732
STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
Bio/Tools/Run/StandAloneBlast.pm:680
STACK Bio::Tools::Run::StandAloneBlast::blastall
Bio/Tools/Run/StandAloneBlast.pm:536
STACK main::__ANON__ bptutorial.pl:3279 STACK main::run_examples
bptutorial.pl:4156 STACK toplevel bptutorial.pl:4245 
  
Notice in line 2: Unable to open ecoli.nt.nin. This is a remnant from an
E.coli. database formatation I did much earlier and independently of
bioperl. 
Thus, the ncbi standaloneblast program works, but not with bioperl! 
  
Why does bioperl fetch an unrelated file in the /usr/local/blast/data
directory? 
Is like it is trying to run something it shouldn't. 
  
Anders. 
 >>>Torsten Seemann <torsten.seemann@infotech.monash.edu.au> 12/21/05
12:50 pm >>> >I have tried  >export BLASTDIR=/usr/local/blast/bin
(where my blastall binary is) >I get the same?  (I assume you are on
Unix, not Windows)  Does it work when you do this?  export
PATH=/usr/local/blast/bin:$PATH ./bptutorial 23  Is there definitely a
file called 'blastall' in /usr/local/blast/bin which is EXECUTABLE and
READABLE by the user running the tutorial?  -- Torsten Seemann Victorian
Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/ 


_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l

From anst at kvl.dk  Wed Dec 21 09:50:59 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Wed Dec 21 09:48:35 2005
Subject: [Bioperl-l] Blast doesn't work
Message-ID: <s3a979f5.088@gwia.kvl.dk>

michael, 
 
Thanks for replying! 
 
I then get: 
 
Beginning run_standaloneblast example... 
[blastall] WARNING: Test1: Unable to open ecoli.nt.nin 
 
------------- EXCEPTION  ------------- 
MSG: blastall call crashed: 256 /usr/local/blast/bin/blastall -p  blastn  -d  /home/anst/blast/ecoli.nt.nin/home/anst/blast/ecoli.nt.nin/ecoli.nt  -i  /tmp/6tbl1I7i52  -o  /tmp/NTwbTioMdD 
 
STACK Bio::Tools::Run::StandAloneBlast::_runblast Bio/Tools/Run/StandAloneBlast.pm:732 
STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast Bio/Tools/Run/StandAloneBlast.pm:680 
STACK Bio::Tools::Run::StandAloneBlast::blastall Bio/Tools/Run/StandAloneBlast.pm:536 
STACK main::__ANON__ bptutorial.pl:3279 
STACK main::run_examples bptutorial.pl:4156 
STACK toplevel bptutorial.pl:4245 
 
The thing is that bioperl is trying to use the ecoli.nt.nin file (in my blast/data directory) which it shouldn't. 
 
But I found out that my blast/data dir is in the /home/anst/blast/data path and that my blast/bin dir is in the /usr/local/blast/bin pathway. 
 
Anders.

>>>michael watson (IAH-C) <michael.watson@bbsrc.ac.uk> 12/21/05 3:01 pm >>>
Dude

Try

find / -name ecoli.nt.nin

This will give you the location of your blast data directory.  For an
example, mine is in /usr/local/blast/data/ecoli.nt.nin

Now

export PATH=$PATH:/usr/local/blast/bin
export BLASTDB=/usr/local/blast/data/ # get this from the find command
above
export BLASTMAT=/usr/local/blast/data/ # get this from the find
command above

perl -w bptutorial.pl 23

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Anders
Stegmann
Sent: 21 December 2005 13:41
To: bioperl-l@bioperl.org
Subject: [Bioperl-l] Blast doesn't work

Torsten,
 
SUSE 10.0 is the brand new version the linux SUSE OS.
 
writing: export PATH=/usr/local/blast/bin:$PATH./bptutorial 23
 
gives me:

bash: export
PATH=/usr/local/blast/bin:/home/anst/bin:/usr/local/bin:/usr/bin:/usr/X1
1R6/bin:/bin:/home/anst/blast/bin:/usr/games:/opt/gnome/bin:/opt/kde3/bi
n:/usr/lib/mit/bin:/usr/lib/mit/sbin./bptutorial 23: No such file or
directory
 
Yes! there is definitely a file called blastall in the
/usr/local/blast/bin directory and it works if I use it independently of
bioperl.
 
The thing is that I have never before needed/used to download the ncbi
blast program independently.
Shouldn't it be enough to install the Bundle?
 
Also, when writing
 
perl -w bptutorial.pl 23
 
I get:
 
Beginning run_standaloneblast example...
[blastall] WARNING: Test1: Unable to open ecoli.nt.nin
 
------------- EXCEPTION  -------------
MSG: blastall call crashed: 256 /usr/local/blast/bin/blastall -p  blastn
-d  /usr/local/blast/bin/data/ecoli.nt  -i  /tmp/zM1t9HD2jq  -o
/tmp/FCGPZQlclD
 
STACK Bio::Tools::Run::StandAloneBlast::_runblast
Bio/Tools/Run/StandAloneBlast.pm:732
STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
Bio/Tools/Run/StandAloneBlast.pm:680
STACK Bio::Tools::Run::StandAloneBlast::blastall
Bio/Tools/Run/StandAloneBlast.pm:536
STACK main::__ANON__ bptutorial.pl:3279 STACK main::run_examples
bptutorial.pl:4156 STACK toplevel bptutorial.pl:4245
 
Notice in line 2: Unable to open ecoli.nt.nin. This is a remnant from an
E.coli. database formatation I did much earlier and independently of
bioperl.
Thus, the ncbi standaloneblast program works, but not with bioperl!
 
Why does bioperl fetch an unrelated file in the /usr/local/blast/data
directory?
Is like it is trying to run something it shouldn't.
 
Anders.
>>>Torsten Seemann <torsten.seemann@infotech.monash.edu.au> 12/21/05
12:50 pm >>> >I have tried  >export BLASTDIR=/usr/local/blast/bin
(where my blastall binary is) >I get the same?  (I assume you are on
Unix, not Windows)  Does it work when you do this?  export
PATH=/usr/local/blast/bin:$PATH ./bptutorial 23  Is there definitely a
file called 'blastall' in /usr/local/blast/bin which is EXECUTABLE and
READABLE by the user running the tutorial?  -- Torsten Seemann Victorian
Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/



Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l



From andreas.boehm at virchow.uni-wuerzburg.de  Wed Dec 21 09:26:59 2005
From: andreas.boehm at virchow.uni-wuerzburg.de (Andreas Boehm)
Date: Wed Dec 21 09:54:52 2005
Subject: [Bioperl-l] Blast doesn't work
In-Reply-To: <s3a969b0.087@gwia.kvl.dk>
References: <s3a969b0.087@gwia.kvl.dk>
Message-ID: <43A96633.1050409@virchow.uni-wuerzburg.de>

Anders,

did you create a file named .ncbirc in your working directory?
If yes, then please post a snipped of an strace. We then can have a look 
on what your program is trying to to.

regards,
Andreas


Anders Stegmann wrote:
> Torsten, 
>   
> SUSE 10.0 is the brand new version the linux SUSE OS. 
>   
> writing: export PATH=/usr/local/blast/bin:$PATH./bptutorial 23 
>   
> gives me: 
>  
> bash: export PATH=/usr/local/blast/bin:/home/anst/bin:/usr/local/bin:/usr/bin:/usr/X11R6/bin:/bin:/home/anst/blast/bin:/usr/games:/opt/gnome/bin:/opt/kde3/bin:/usr/lib/mit/bin:/usr/lib/mit/sbin./bptutorial 23: No such file or directory 
>   
> Yes! there is definitely a file called blastall in the /usr/local/blast/bin directory and it works if I use it independently of bioperl. 
>   
> The thing is that I have never before needed/used to download the ncbi blast program independently. 
> Shouldn't it be enough to install the Bundle? 
>   
> Also, when writing 
>   
> perl -w bptutorial.pl 23 
>   
> I get: 
>   
> Beginning run_standaloneblast example... 
> [blastall] WARNING: Test1: Unable to open ecoli.nt.nin 
>   
> ------------- EXCEPTION  ------------- 
> MSG: blastall call crashed: 256 /usr/local/blast/bin/blastall -p  blastn  -d  /usr/local/blast/bin/data/ecoli.nt  -i  /tmp/zM1t9HD2jq  -o  /tmp/FCGPZQlclD 
>   
> STACK Bio::Tools::Run::StandAloneBlast::_runblast Bio/Tools/Run/StandAloneBlast.pm:732 
> STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast Bio/Tools/Run/StandAloneBlast.pm:680 
> STACK Bio::Tools::Run::StandAloneBlast::blastall Bio/Tools/Run/StandAloneBlast.pm:536 
> STACK main::__ANON__ bptutorial.pl:3279 
> STACK main::run_examples bptutorial.pl:4156 
> STACK toplevel bptutorial.pl:4245 
>   
> Notice in line 2: Unable to open ecoli.nt.nin. This is a remnant from an E.coli. database formatation I did much earlier and independently of bioperl. 
> Thus, the ncbi standaloneblast program works, but not with bioperl! 
>   
> Why does bioperl fetch an unrelated file in the /usr/local/blast/data directory? 
> Is like it is trying to run something it shouldn't. 
>   
> Anders. 
>  >>>Torsten Seemann <torsten.seemann@infotech.monash.edu.au> 12/21/05 12:50 pm >>> >I have tried  >export BLASTDIR=/usr/local/blast/bin  (where my blastall binary is) >I get the same?  (I assume you are on Unix, not Windows)  Does it work when you do this?  export PATH=/usr/local/blast/bin:$PATH ./bptutorial 23  Is there definitely a file called 'blastall' in /usr/local/blast/bin which is EXECUTABLE and READABLE by the user running the tutorial?  -- Torsten Seemann Victorian Bioinformatics Consortium, Monash University, Australia http://www.vicbioinformatics.com/ 
> 
> 
> _______________________________________________

From anst at kvl.dk  Wed Dec 21 10:02:06 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Wed Dec 21 09:59:31 2005
Subject: [Bioperl-l] Blast doesn't work
Message-ID: <s3a97c92.080@gwia.kvl.dk>

Michael, 
 
It worked as root!!! 
 
the blaststandalone bptutorial 23 is working! 
 
great job. 
 
BUT bptutorial 22 is still not working. still getting 
 
Beginning run_remoteblast example... 
submitted Blast job 
retrieving results... 
 
-------------------- WARNING --------------------- 
MSG: Possible error (1) while parsing BLAST report! 
--------------------------------------------------- 
Use of uninitialized value in substitution (s///) at Bio/Tools/BPlite.pm line 337, <GEN3> line 29. 
Use of uninitialized value in substitution (s///) at Bio/Tools/BPlite.pm line 338, <GEN3> line 29. 
Use of uninitialized value in substitution (s///) at Bio/Tools/BPlite.pm line 339, <GEN3> line 29. 
Use of uninitialized value in patt
 
any suggestions? 
 
Anders. 
 
 

>>>michael watson (IAH-C) <michael.watson@bbsrc.ac.uk> 12/21/05 3:01 pm >>>
Dude

Try

find / -name ecoli.nt.nin

This will give you the location of your blast data directory.  For an
example, mine is in /usr/local/blast/data/ecoli.nt.nin

Now

export PATH=$PATH:/usr/local/blast/bin
export BLASTDB=/usr/local/blast/data/ # get this from the find command
above
export BLASTMAT=/usr/local/blast/data/ # get this from the find
command above

perl -w bptutorial.pl 23

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Anders
Stegmann
Sent: 21 December 2005 13:41
To: bioperl-l@bioperl.org
Subject: [Bioperl-l] Blast doesn't work

Torsten,
 
SUSE 10.0 is the brand new version the linux SUSE OS.
 
writing: export PATH=/usr/local/blast/bin:$PATH./bptutorial 23
 
gives me:

bash: export
PATH=/usr/local/blast/bin:/home/anst/bin:/usr/local/bin:/usr/bin:/usr/X1
1R6/bin:/bin:/home/anst/blast/bin:/usr/games:/opt/gnome/bin:/opt/kde3/bi
n:/usr/lib/mit/bin:/usr/lib/mit/sbin./bptutorial 23: No such file or
directory
 
Yes! there is definitely a file called blastall in the
/usr/local/blast/bin directory and it works if I use it independently of
bioperl.
 
The thing is that I have never before needed/used to download the ncbi
blast program independently.
Shouldn't it be enough to install the Bundle?
 
Also, when writing
 
perl -w bptutorial.pl 23
 
I get:
 
Beginning run_standaloneblast example...
[blastall] WARNING: Test1: Unable to open ecoli.nt.nin
 
------------- EXCEPTION  -------------
MSG: blastall call crashed: 256 /usr/local/blast/bin/blastall -p  blastn
-d  /usr/local/blast/bin/data/ecoli.nt  -i  /tmp/zM1t9HD2jq  -o
/tmp/FCGPZQlclD
 
STACK Bio::Tools::Run::StandAloneBlast::_runblast
Bio/Tools/Run/StandAloneBlast.pm:732
STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
Bio/Tools/Run/StandAloneBlast.pm:680
STACK Bio::Tools::Run::StandAloneBlast::blastall
Bio/Tools/Run/StandAloneBlast.pm:536
STACK main::__ANON__ bptutorial.pl:3279 STACK main::run_examples
bptutorial.pl:4156 STACK toplevel bptutorial.pl:4245
 
Notice in line 2: Unable to open ecoli.nt.nin. This is a remnant from an
E.coli. database formatation I did much earlier and independently of
bioperl.
Thus, the ncbi standaloneblast program works, but not with bioperl!
 
Why does bioperl fetch an unrelated file in the /usr/local/blast/data
directory?
Is like it is trying to run something it shouldn't.
 
Anders.
>>>Torsten Seemann <torsten.seemann@infotech.monash.edu.au> 12/21/05
12:50 pm >>> >I have tried  >export BLASTDIR=/usr/local/blast/bin
(where my blastall binary is) >I get the same?  (I assume you are on
Unix, not Windows)  Does it work when you do this?  export
PATH=/usr/local/blast/bin:$PATH ./bptutorial 23  Is there definitely a
file called 'blastall' in /usr/local/blast/bin which is EXECUTABLE and
READABLE by the user running the tutorial?  -- Torsten Seemann Victorian
Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/



Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l



From michael.watson at bbsrc.ac.uk  Wed Dec 21 10:05:48 2005
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Wed Dec 21 10:03:05 2005
Subject: [Bioperl-l] Blast doesn't work
Message-ID: <8975119BCD0AC5419D61A9CF1A923E95024C5627@iahce2ksrv1.iah.bbsrc.ac.uk>

Can you send me the output from

printenv | grep BLAST

Please? 

And in future, include all the commands you use :)

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Anders
Stegmann
Sent: 21 December 2005 14:51
To: bioperl-l@bioperl.org
Subject: RE: [Bioperl-l] Blast doesn't work

michael, 
 
Thanks for replying! 
 
I then get: 
 
Beginning run_standaloneblast example... 
[blastall] WARNING: Test1: Unable to open ecoli.nt.nin 
 
------------- EXCEPTION  -------------
MSG: blastall call crashed: 256 /usr/local/blast/bin/blastall -p  blastn
-d  /home/anst/blast/ecoli.nt.nin/home/anst/blast/ecoli.nt.nin/ecoli.nt
-i  /tmp/6tbl1I7i52  -o  /tmp/NTwbTioMdD 
 
STACK Bio::Tools::Run::StandAloneBlast::_runblast
Bio/Tools/Run/StandAloneBlast.pm:732
STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
Bio/Tools/Run/StandAloneBlast.pm:680
STACK Bio::Tools::Run::StandAloneBlast::blastall
Bio/Tools/Run/StandAloneBlast.pm:536
STACK main::__ANON__ bptutorial.pl:3279 STACK main::run_examples
bptutorial.pl:4156 STACK toplevel bptutorial.pl:4245 
 
The thing is that bioperl is trying to use the ecoli.nt.nin file (in my
blast/data directory) which it shouldn't. 
 
But I found out that my blast/data dir is in the /home/anst/blast/data
path and that my blast/bin dir is in the /usr/local/blast/bin pathway. 
 
Anders.

>>>michael watson (IAH-C) <michael.watson@bbsrc.ac.uk> 12/21/05 3:01 pm 
>>>>>>
Dude

Try

find / -name ecoli.nt.nin

This will give you the location of your blast data directory.  For an
example, mine is in /usr/local/blast/data/ecoli.nt.nin

Now

export PATH=$PATH:/usr/local/blast/bin
export BLASTDB=/usr/local/blast/data/ # get this from the find command
above export BLASTMAT=/usr/local/blast/data/ # get this from the find
command above

perl -w bptutorial.pl 23

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Anders
Stegmann
Sent: 21 December 2005 13:41
To: bioperl-l@bioperl.org
Subject: [Bioperl-l] Blast doesn't work

Torsten,
 
SUSE 10.0 is the brand new version the linux SUSE OS.
 
writing: export PATH=/usr/local/blast/bin:$PATH./bptutorial 23
 
gives me:

bash: export
PATH=/usr/local/blast/bin:/home/anst/bin:/usr/local/bin:/usr/bin:/usr/X1
1R6/bin:/bin:/home/anst/blast/bin:/usr/games:/opt/gnome/bin:/opt/kde3/bi
n:/usr/lib/mit/bin:/usr/lib/mit/sbin./bptutorial 23: No such file or
directory
 
Yes! there is definitely a file called blastall in the
/usr/local/blast/bin directory and it works if I use it independently of
bioperl.
 
The thing is that I have never before needed/used to download the ncbi
blast program independently.
Shouldn't it be enough to install the Bundle?
 
Also, when writing
 
perl -w bptutorial.pl 23
 
I get:
 
Beginning run_standaloneblast example...
[blastall] WARNING: Test1: Unable to open ecoli.nt.nin
 
------------- EXCEPTION  -------------
MSG: blastall call crashed: 256 /usr/local/blast/bin/blastall -p  blastn
-d  /usr/local/blast/bin/data/ecoli.nt  -i  /tmp/zM1t9HD2jq  -o
/tmp/FCGPZQlclD
 
STACK Bio::Tools::Run::StandAloneBlast::_runblast
Bio/Tools/Run/StandAloneBlast.pm:732
STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
Bio/Tools/Run/StandAloneBlast.pm:680
STACK Bio::Tools::Run::StandAloneBlast::blastall
Bio/Tools/Run/StandAloneBlast.pm:536
STACK main::__ANON__ bptutorial.pl:3279 STACK main::run_examples
bptutorial.pl:4156 STACK toplevel bptutorial.pl:4245
 
Notice in line 2: Unable to open ecoli.nt.nin. This is a remnant from an
E.coli. database formatation I did much earlier and independently of
bioperl.
Thus, the ncbi standaloneblast program works, but not with bioperl!
 
Why does bioperl fetch an unrelated file in the /usr/local/blast/data
directory?
Is like it is trying to run something it shouldn't.
 
Anders.
>>>Torsten Seemann <torsten.seemann@infotech.monash.edu.au> 12/21/05
12:50 pm >>> >I have tried  >export BLASTDIR=/usr/local/blast/bin (where
my blastall binary is) >I get the same?  (I assume you are on Unix, not
Windows)  Does it work when you do this?  export
PATH=/usr/local/blast/bin:$PATH ./bptutorial 23  Is there definitely a
file called 'blastall' in /usr/local/blast/bin which is EXECUTABLE and
READABLE by the user running the tutorial?  -- Torsten Seemann Victorian
Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/



Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l



_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l

From anst at kvl.dk  Wed Dec 21 10:15:01 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Wed Dec 21 10:17:03 2005
Subject: [Bioperl-l] Blast doesn't work
Message-ID: <s3a97f91.084@gwia.kvl.dk>

Okay, 
 
anst@omyil1:~/bioperl-1.4> printenv | grep BLAST 
BLASTDIR=/usr/local/blast/bin 
BLASTMAt=/home/anst/blast 
BLASTDB=/home/anst/blast 
BLASTMAT=/home/anst/blast/ecoli.nt.nin 
 
anders.

>>>michael watson (IAH-C) <michael.watson@bbsrc.ac.uk> 12/21/05 4:05 pm >>>
Can you send me the output from

printenv | grep BLAST

Please?

And in future, include all the commands you use :)

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Anders
Stegmann
Sent: 21 December 2005 14:51
To: bioperl-l@bioperl.org
Subject: RE: [Bioperl-l] Blast doesn't work

michael,

Thanks for replying!

I then get:

Beginning run_standaloneblast example...
[blastall] WARNING: Test1: Unable to open ecoli.nt.nin

------------- EXCEPTION  -------------
MSG: blastall call crashed: 256 /usr/local/blast/bin/blastall -p  blastn
-d  /home/anst/blast/ecoli.nt.nin/home/anst/blast/ecoli.nt.nin/ecoli.nt
-i  /tmp/6tbl1I7i52  -o  /tmp/NTwbTioMdD

STACK Bio::Tools::Run::StandAloneBlast::_runblast
Bio/Tools/Run/StandAloneBlast.pm:732
STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
Bio/Tools/Run/StandAloneBlast.pm:680
STACK Bio::Tools::Run::StandAloneBlast::blastall
Bio/Tools/Run/StandAloneBlast.pm:536
STACK main::__ANON__ bptutorial.pl:3279 STACK main::run_examples
bptutorial.pl:4156 STACK toplevel bptutorial.pl:4245

The thing is that bioperl is trying to use the ecoli.nt.nin file (in my
blast/data directory) which it shouldn't.

But I found out that my blast/data dir is in the /home/anst/blast/data
path and that my blast/bin dir is in the /usr/local/blast/bin pathway.

Anders.

>>>michael watson (IAH-C) <michael.watson@bbsrc.ac.uk> 12/21/05 3:01 pm
>>>>>>
Dude

Try

find / -name ecoli.nt.nin

This will give you the location of your blast data directory.  For an
example, mine is in /usr/local/blast/data/ecoli.nt.nin

Now

export PATH=$PATH:/usr/local/blast/bin
export BLASTDB=/usr/local/blast/data/ # get this from the find command
above export BLASTMAT=/usr/local/blast/data/ # get this from the find
command above

perl -w bptutorial.pl 23

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Anders
Stegmann
Sent: 21 December 2005 13:41
To: bioperl-l@bioperl.org
Subject: [Bioperl-l] Blast doesn't work

Torsten,

SUSE 10.0 is the brand new version the linux SUSE OS.

writing: export PATH=/usr/local/blast/bin:$PATH./bptutorial 23

gives me:

bash: export
PATH=/usr/local/blast/bin:/home/anst/bin:/usr/local/bin:/usr/bin:/usr/X1
1R6/bin:/bin:/home/anst/blast/bin:/usr/games:/opt/gnome/bin:/opt/kde3/bi
n:/usr/lib/mit/bin:/usr/lib/mit/sbin./bptutorial 23: No such file or
directory

Yes! there is definitely a file called blastall in the
/usr/local/blast/bin directory and it works if I use it independently of
bioperl.

The thing is that I have never before needed/used to download the ncbi
blast program independently.
Shouldn't it be enough to install the Bundle?

Also, when writing

perl -w bptutorial.pl 23

I get:

Beginning run_standaloneblast example...
[blastall] WARNING: Test1: Unable to open ecoli.nt.nin

------------- EXCEPTION  -------------
MSG: blastall call crashed: 256 /usr/local/blast/bin/blastall -p  blastn
-d  /usr/local/blast/bin/data/ecoli.nt  -i  /tmp/zM1t9HD2jq  -o
/tmp/FCGPZQlclD

STACK Bio::Tools::Run::StandAloneBlast::_runblast
Bio/Tools/Run/StandAloneBlast.pm:732
STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
Bio/Tools/Run/StandAloneBlast.pm:680
STACK Bio::Tools::Run::StandAloneBlast::blastall
Bio/Tools/Run/StandAloneBlast.pm:536
STACK main::__ANON__ bptutorial.pl:3279 STACK main::run_examples
bptutorial.pl:4156 STACK toplevel bptutorial.pl:4245

Notice in line 2: Unable to open ecoli.nt.nin. This is a remnant from an
E.coli. database formatation I did much earlier and independently of
bioperl.
Thus, the ncbi standaloneblast program works, but not with bioperl!

Why does bioperl fetch an unrelated file in the /usr/local/blast/data
directory?
Is like it is trying to run something it shouldn't.

Anders.
>>>Torsten Seemann <torsten.seemann@infotech.monash.edu.au> 12/21/05
12:50 pm >>> >I have tried  >export BLASTDIR=/usr/local/blast/bin (where
my blastall binary is) >I get the same?  (I assume you are on Unix, not
Windows)  Does it work when you do this?  export
PATH=/usr/local/blast/bin:$PATH ./bptutorial 23  Is there definitely a
file called 'blastall' in /usr/local/blast/bin which is EXECUTABLE and
READABLE by the user running the tutorial?  -- Torsten Seemann Victorian
Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/



Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l




Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l



From anst at kvl.dk  Wed Dec 21 10:33:56 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Wed Dec 21 10:34:49 2005
Subject: [Bioperl-l] Blast doesn't work
Message-ID: <s3a98406.053@gwia.kvl.dk>

Andreas, 
 
Yes, I did create a file named .ncbirc and it is placed in my blast working dir (/home/anst/blast/). It say's: 

[NCBI] 
Data=/home/anst/blast/data 
 
Anders. 
 
 

>>>Andreas Boehm <andreas.boehm@virchow.uni-wuerzburg.de> 12/21/05 3:26 pm >>>
Anders,

did you create a file named .ncbirc in your working directory?
If yes, then please post a snipped of an strace. We then can have a look
on what your program is trying to to.

regards,
Andreas


Anders Stegmann wrote:
>Torsten,
>  
>SUSE 10.0 is the brand new version the linux SUSE OS.
>  
>writing: export PATH=/usr/local/blast/bin:$PATH./bptutorial 23
>  
>gives me:
> 
>bash: export PATH=/usr/local/blast/bin:/home/anst/bin:/usr/local/bin:/usr/bin:/usr/X11R6/bin:/bin:/home/anst/blast/bin:/usr/games:/opt/gnome/bin:/opt/kde3/bin:/usr/lib/mit/bin:/usr/lib/mit/sbin./bptutorial 23: No such file or directory
>  
>Yes! there is definitely a file called blastall in the /usr/local/blast/bin directory and it works if I use it independently of bioperl.
>  
>The thing is that I have never before needed/used to download the ncbi blast program independently.
>Shouldn't it be enough to install the Bundle?
>  
>Also, when writing
>  
>perl -w bptutorial.pl 23
>  
>I get:
>  
>Beginning run_standaloneblast example...
>[blastall] WARNING: Test1: Unable to open ecoli.nt.nin
>  
>------------- EXCEPTION  -------------
>MSG: blastall call crashed: 256 /usr/local/blast/bin/blastall -p  blastn  -d  /usr/local/blast/bin/data/ecoli.nt  -i  /tmp/zM1t9HD2jq  -o  /tmp/FCGPZQlclD
>  
>STACK Bio::Tools::Run::StandAloneBlast::_runblast Bio/Tools/Run/StandAloneBlast.pm:732
>STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast Bio/Tools/Run/StandAloneBlast.pm:680
>STACK Bio::Tools::Run::StandAloneBlast::blastall Bio/Tools/Run/StandAloneBlast.pm:536
>STACK main::__ANON__ bptutorial.pl:3279
>STACK main::run_examples bptutorial.pl:4156
>STACK toplevel bptutorial.pl:4245
>  
>Notice in line 2: Unable to open ecoli.nt.nin. This is a remnant from an E.coli. database formatation I did much earlier and independently of bioperl.
>Thus, the ncbi standaloneblast program works, but not with bioperl!
>  
>Why does bioperl fetch an unrelated file in the /usr/local/blast/data directory?
>Is like it is trying to run something it shouldn't.
>  
>Anders.
> >>>Torsten Seemann <torsten.seemann@infotech.monash.edu.au> 12/21/05 12:50 pm >>> >I have tried  >export BLASTDIR=/usr/local/blast/bin  (where my blastall binary is) >I get the same?  (I assume you are on Unix, not Windows)  Does it work when you do this?  export PATH=/usr/local/blast/bin:$PATH ./bptutorial 23  Is there definitely a file called 'blastall' in /usr/local/blast/bin which is EXECUTABLE and READABLE by the user running the tutorial?  -- Torsten Seemann Victorian Bioinformatics Consortium, Monash University, Australia http://www.vicbioinformatics.com/
>
>
>


Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l



From anst at kvl.dk  Wed Dec 21 10:48:43 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Wed Dec 21 10:46:26 2005
Subject: [Bioperl-l] Blast doesn't work
Message-ID: <s3a9877e.020@gwia.kvl.dk>

You were right! 
 
Bioperl-1.5.1 is working perfectly with blast. 
 
Thanks very much for all the help everybody, It was very nice of you :-). 
 
Anders.

>>>Jason Stajich <jason.stajich@duke.edu> 12/21/05 4:09 pm >>>
Make sure you are using the latest version of bioperl - NCBI changed 
the interface and we now have Bio::SearchIO as the default parser.  
It works fine for me on bioperl 1.5.1

#23 shouldn't have to work as root, but I haven't been following the 
thread so I don't know what you are changing.

On Dec 21, 2005, at 10:02 AM, Anders Stegmann wrote:

>Michael,
>
>It worked as root!!!
>
>the blaststandalone bptutorial 23 is working!
>
>great job.
>
>BUT bptutorial 22 is still not working. still getting
>
>Beginning run_remoteblast example...
>submitted Blast job
>retrieving results...
>
>-------------------- WARNING ---------------------
>MSG: Possible error (1) while parsing BLAST report!
>---------------------------------------------------
>Use of uninitialized value in substitution (s///) at Bio/Tools/
>BPlite.pm line 337, <GEN3> line 29.
>Use of uninitialized value in substitution (s///) at Bio/Tools/
>BPlite.pm line 338, <GEN3> line 29.
>Use of uninitialized value in substitution (s///) at Bio/Tools/
>BPlite.pm line 339, <GEN3> line 29.
>Use of uninitialized value in patt
>
>any suggestions?
>
>Anders.
>
>
>
>>>>michael watson (IAH-C) <michael.watson@bbsrc.ac.uk> 12/21/05 
>>>>3:01 pm >>>
>Dude
>
>Try
>
>find / -name ecoli.nt.nin
>
>This will give you the location of your blast data directory.  For an
>example, mine is in /usr/local/blast/data/ecoli.nt.nin
>
>Now
>
>export PATH=$PATH:/usr/local/blast/bin
>export BLASTDB=/usr/local/blast/data/ # get this from the find command
>above
>export BLASTMAT=/usr/local/blast/data/ # get this from the find
>command above
>
>perl -w bptutorial.pl 23
>
>-----Original Message-----
>From: bioperl-l-bounces@portal.open-bio.org
>[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Anders
>Stegmann
>Sent: 21 December 2005 13:41
>To: bioperl-l@bioperl.org
>Subject: [Bioperl-l] Blast doesn't work
>
>Torsten,
>
>SUSE 10.0 is the brand new version the linux SUSE OS.
>
>writing: export PATH=/usr/local/blast/bin:$PATH./bptutorial 23
>
>gives me:
>
>bash: export
>PATH=/usr/local/blast/bin:/home/anst/bin:/usr/local/bin:/usr/bin:/
>usr/X1
>1R6/bin:/bin:/home/anst/blast/bin:/usr/games:/opt/gnome/bin:/opt/
>kde3/bi
>n:/usr/lib/mit/bin:/usr/lib/mit/sbin./bptutorial 23: No such file or
>directory
>
>Yes! there is definitely a file called blastall in the
>/usr/local/blast/bin directory and it works if I use it 
>independently of
>bioperl.
>
>The thing is that I have never before needed/used to download the ncbi
>blast program independently.
>Shouldn't it be enough to install the Bundle?
>
>Also, when writing
>
>perl -w bptutorial.pl 23
>
>I get:
>
>Beginning run_standaloneblast example...
>[blastall] WARNING: Test1: Unable to open ecoli.nt.nin
>
>------------- EXCEPTION  -------------
>MSG: blastall call crashed: 256 /usr/local/blast/bin/blastall -p  
>blastn
>-d  /usr/local/blast/bin/data/ecoli.nt  -i  /tmp/zM1t9HD2jq  -o
>/tmp/FCGPZQlclD
>
>STACK Bio::Tools::Run::StandAloneBlast::_runblast
>Bio/Tools/Run/StandAloneBlast.pm:732
>STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
>Bio/Tools/Run/StandAloneBlast.pm:680
>STACK Bio::Tools::Run::StandAloneBlast::blastall
>Bio/Tools/Run/StandAloneBlast.pm:536
>STACK main::__ANON__ bptutorial.pl:3279 STACK main::run_examples
>bptutorial.pl:4156 STACK toplevel bptutorial.pl:4245
>
>Notice in line 2: Unable to open ecoli.nt.nin. This is a remnant 
>from an
>E.coli. database formatation I did much earlier and independently of
>bioperl.
>Thus, the ncbi standaloneblast program works, but not with bioperl!
>
>Why does bioperl fetch an unrelated file in the /usr/local/blast/data
>directory?
>Is like it is trying to run something it shouldn't.
>
>Anders.
>>>>Torsten Seemann <torsten.seemann@infotech.monash.edu.au> 12/21/05
>12:50 pm >>> >I have tried  >export BLASTDIR=/usr/local/blast/bin
>(where my blastall binary is) >I get the same?  (I assume you are on
>Unix, not Windows)  Does it work when you do this?  export
>PATH=/usr/local/blast/bin:$PATH ./bptutorial 23  Is there definitely a
>file called 'blastall' in /usr/local/blast/bin which is EXECUTABLE and
>READABLE by the user running the tutorial?  -- Torsten Seemann 
>Victorian
>Bioinformatics Consortium, Monash University, Australia
>http://www.vicbioinformatics.com/
>
>
>
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
>
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12





From jason.stajich at duke.edu  Wed Dec 21 10:09:36 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Wed Dec 21 11:26:47 2005
Subject: [Bioperl-l] Blast doesn't work
In-Reply-To: <s3a97c92.080@gwia.kvl.dk>
References: <s3a97c92.080@gwia.kvl.dk>
Message-ID: <EEC56D86-B522-4AEF-ADCC-12F103CA739A@duke.edu>

Make sure you are using the latest version of bioperl - NCBI changed  
the interface and we now have Bio::SearchIO as the default parser.   
It works fine for me on bioperl 1.5.1

#23 shouldn't have to work as root, but I haven't been following the  
thread so I don't know what you are changing.

On Dec 21, 2005, at 10:02 AM, Anders Stegmann wrote:

> Michael,
>
> It worked as root!!!
>
> the blaststandalone bptutorial 23 is working!
>
> great job.
>
> BUT bptutorial 22 is still not working. still getting
>
> Beginning run_remoteblast example...
> submitted Blast job
> retrieving results...
>
> -------------------- WARNING ---------------------
> MSG: Possible error (1) while parsing BLAST report!
> ---------------------------------------------------
> Use of uninitialized value in substitution (s///) at Bio/Tools/ 
> BPlite.pm line 337, <GEN3> line 29.
> Use of uninitialized value in substitution (s///) at Bio/Tools/ 
> BPlite.pm line 338, <GEN3> line 29.
> Use of uninitialized value in substitution (s///) at Bio/Tools/ 
> BPlite.pm line 339, <GEN3> line 29.
> Use of uninitialized value in patt
>
> any suggestions?
>
> Anders.
>
>
>
>>>> michael watson (IAH-C) <michael.watson@bbsrc.ac.uk> 12/21/05  
>>>> 3:01 pm >>>
> Dude
>
> Try
>
> find / -name ecoli.nt.nin
>
> This will give you the location of your blast data directory.  For an
> example, mine is in /usr/local/blast/data/ecoli.nt.nin
>
> Now
>
> export PATH=$PATH:/usr/local/blast/bin
> export BLASTDB=/usr/local/blast/data/ # get this from the find command
> above
> export BLASTMAT=/usr/local/blast/data/ # get this from the find
> command above
>
> perl -w bptutorial.pl 23
>
> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org
> [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Anders
> Stegmann
> Sent: 21 December 2005 13:41
> To: bioperl-l@bioperl.org
> Subject: [Bioperl-l] Blast doesn't work
>
> Torsten,
>
> SUSE 10.0 is the brand new version the linux SUSE OS.
>
> writing: export PATH=/usr/local/blast/bin:$PATH./bptutorial 23
>
> gives me:
>
> bash: export
> PATH=/usr/local/blast/bin:/home/anst/bin:/usr/local/bin:/usr/bin:/ 
> usr/X1
> 1R6/bin:/bin:/home/anst/blast/bin:/usr/games:/opt/gnome/bin:/opt/ 
> kde3/bi
> n:/usr/lib/mit/bin:/usr/lib/mit/sbin./bptutorial 23: No such file or
> directory
>
> Yes! there is definitely a file called blastall in the
> /usr/local/blast/bin directory and it works if I use it  
> independently of
> bioperl.
>
> The thing is that I have never before needed/used to download the ncbi
> blast program independently.
> Shouldn't it be enough to install the Bundle?
>
> Also, when writing
>
> perl -w bptutorial.pl 23
>
> I get:
>
> Beginning run_standaloneblast example...
> [blastall] WARNING: Test1: Unable to open ecoli.nt.nin
>
> ------------- EXCEPTION  -------------
> MSG: blastall call crashed: 256 /usr/local/blast/bin/blastall -p   
> blastn
> -d  /usr/local/blast/bin/data/ecoli.nt  -i  /tmp/zM1t9HD2jq  -o
> /tmp/FCGPZQlclD
>
> STACK Bio::Tools::Run::StandAloneBlast::_runblast
> Bio/Tools/Run/StandAloneBlast.pm:732
> STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
> Bio/Tools/Run/StandAloneBlast.pm:680
> STACK Bio::Tools::Run::StandAloneBlast::blastall
> Bio/Tools/Run/StandAloneBlast.pm:536
> STACK main::__ANON__ bptutorial.pl:3279 STACK main::run_examples
> bptutorial.pl:4156 STACK toplevel bptutorial.pl:4245
>
> Notice in line 2: Unable to open ecoli.nt.nin. This is a remnant  
> from an
> E.coli. database formatation I did much earlier and independently of
> bioperl.
> Thus, the ncbi standaloneblast program works, but not with bioperl!
>
> Why does bioperl fetch an unrelated file in the /usr/local/blast/data
> directory?
> Is like it is trying to run something it shouldn't.
>
> Anders.
>>>> Torsten Seemann <torsten.seemann@infotech.monash.edu.au> 12/21/05
> 12:50 pm >>> >I have tried  >export BLASTDIR=/usr/local/blast/bin
> (where my blastall binary is) >I get the same?  (I assume you are on
> Unix, not Windows)  Does it work when you do this?  export
> PATH=/usr/local/blast/bin:$PATH ./bptutorial 23  Is there definitely a
> file called 'blastall' in /usr/local/blast/bin which is EXECUTABLE and
> READABLE by the user running the tutorial?  -- Torsten Seemann  
> Victorian
> Bioinformatics Consortium, Monash University, Australia
> http://www.vicbioinformatics.com/
>
>
>
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12


From Marc.Logghe at DEVGEN.com  Wed Dec 21 11:21:14 2005
From: Marc.Logghe at DEVGEN.com (Marc Logghe)
Date: Wed Dec 21 11:30:29 2005
Subject: [Bioperl-l] Blast doesn't work
Message-ID: <0C528E3670D8CE4B8E013F6749231AA67469D6@ANTARESIA.be.devgen.com>

Hi Anders,
I use to set the blast environment explicitely in the script itself in a
BEGIN block, e.g.
BEGIN
{
    $ENV{BLASTDIR} = '/usr/local/blast/bin';
    $ENV{BLASTDATADIR} = '/home/anst/blast/data';
}

HTH,
Marc



> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org 
> [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of 
> Anders Stegmann
> Sent: Wednesday, December 21, 2005 4:34 PM
> To: bioperl-l@bioperl.org
> Subject: Re: [Bioperl-l] Blast doesn't work
> 
> Andreas, 
>  
> Yes, I did create a file named .ncbirc and it is placed in my 
> blast working dir (/home/anst/blast/). It say's: 
> 
> [NCBI]
> Data=/home/anst/blast/data 
>  
> Anders. 
>  
>  
> 
> >>>Andreas Boehm <andreas.boehm@virchow.uni-wuerzburg.de> 
> 12/21/05 3:26 
> >>>pm >>>
> Anders,
> 
> did you create a file named .ncbirc in your working directory?
> If yes, then please post a snipped of an strace. We then can 
> have a look on what your program is trying to to.
> 
> regards,
> Andreas
> 
> 
> Anders Stegmann wrote:
> >Torsten,
> >  
> >SUSE 10.0 is the brand new version the linux SUSE OS.
> >  
> >writing: export PATH=/usr/local/blast/bin:$PATH./bptutorial 23
> >  
> >gives me:
> > 
> >bash: export 
> >PATH=/usr/local/blast/bin:/home/anst/bin:/usr/local/bin:/usr/
> bin:/usr/X
> >11R6/bin:/bin:/home/anst/blast/bin:/usr/games:/opt/gnome/bin:
> /opt/kde3/
> >bin:/usr/lib/mit/bin:/usr/lib/mit/sbin./bptutorial 23: No 
> such file or 
> >directory
> >  
> >Yes! there is definitely a file called blastall in the 
> /usr/local/blast/bin directory and it works if I use it 
> independently of bioperl.
> >  
> >The thing is that I have never before needed/used to 
> download the ncbi blast program independently.
> >Shouldn't it be enough to install the Bundle?
> >  
> >Also, when writing
> >  
> >perl -w bptutorial.pl 23
> >  
> >I get:
> >  
> >Beginning run_standaloneblast example...
> >[blastall] WARNING: Test1: Unable to open ecoli.nt.nin
> >  
> >------------- EXCEPTION  -------------
> >MSG: blastall call crashed: 256 /usr/local/blast/bin/blastall -p  
> >blastn  -d  /usr/local/blast/bin/data/ecoli.nt  -i  
> /tmp/zM1t9HD2jq  -o  
> >/tmp/FCGPZQlclD
> >  
> >STACK Bio::Tools::Run::StandAloneBlast::_runblast 
> >Bio/Tools/Run/StandAloneBlast.pm:732
> >STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast 
> >Bio/Tools/Run/StandAloneBlast.pm:680
> >STACK Bio::Tools::Run::StandAloneBlast::blastall 
> >Bio/Tools/Run/StandAloneBlast.pm:536
> >STACK main::__ANON__ bptutorial.pl:3279 STACK main::run_examples 
> >bptutorial.pl:4156 STACK toplevel bptutorial.pl:4245
> >  
> >Notice in line 2: Unable to open ecoli.nt.nin. This is a 
> remnant from an E.coli. database formatation I did much 
> earlier and independently of bioperl.
> >Thus, the ncbi standaloneblast program works, but not with bioperl!
> >  
> >Why does bioperl fetch an unrelated file in the 
> /usr/local/blast/data directory?
> >Is like it is trying to run something it shouldn't.
> >  
> >Anders.
> > >>>Torsten Seemann <torsten.seemann@infotech.monash.edu.au> 
> 12/21/05 
> > >>>12:50 pm >>> >I have tried  >export 
> BLASTDIR=/usr/local/blast/bin  
> > >>>(where my blastall binary is) >I get the same?  (I 
> assume you are 
> > >>>on Unix, not Windows)  Does it work when you do this?  export 
> > >>>PATH=/usr/local/blast/bin:$PATH ./bptutorial 23  Is there 
> > >>>definitely a file called 'blastall' in 
> /usr/local/blast/bin which 
> > >>>is EXECUTABLE and READABLE by the user running the tutorial?  -- 
> > >>>Torsten Seemann Victorian Bioinformatics Consortium, Monash 
> > >>>University, Australia http://www.vicbioinformatics.com/
> >
> >
> >
> 
> 
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 

From MEC at stowers-institute.org  Wed Dec 21 12:59:34 2005
From: MEC at stowers-institute.org (Cook, Malcolm)
Date: Wed Dec 21 12:57:09 2005
Subject: [Bioperl-l] extracting CDS portion of RefSeqs
Message-ID: <CED81D34E37D5043A1211565277A51E5045CEE50@exchkc02.stowers-institute.org>

Hilmar,

re: "only genbank.pm supports the SeqBuilder interface" 

Ah, that explains why I saw no speedup when I compared reading EMBL with
and without running 

$builder->want_none();
$builder->add_wanted_slot('display_id','features','seq')

(and also why I noticed that my feature processing sub worked even if I
didn't add_wanted_slot on 'features' !!)

FYI - using the $builder as above to read 46 GenBank mRNA RefSeq
containing lots of REFERENCE data gave me ~ 33% speed up
HOWEVER, I get %52 speed up if instead I pre-filtered the genbank
flatfile using:
	perl -n -e "print if (m'^(LOCUS|ACCESSION)' ||
(m'^FEATURES'...m'^//'))"

-- Malcolm

>-----Original Message-----
>From: Hilmar Lapp [mailto:hlapp@gmx.net] 
>Sent: Friday, December 16, 2005 11:55 AM
>To: Cook, Malcolm
>Cc: bioperl-l@portal.open-bio.org; Amit Indap
>Subject: Re: [Bioperl-l] extracting CDS portion of RefSeqs
>
>
>On Dec 15, 2005, at 11:06 AM, Cook, Malcolm wrote:
>
>> Regarding performance, I've never tried it, but you might look at
>> http://doc.bioperl.org/bioperl-live/Bio/Seq/SeqBuilder.html, which 
>> shows
>> you how to tell SeqIO that you only need to read sequence 
>and features.
>>
>
>BTW right now only genbank.pm supports the SeqBuilder interface. If 
>anyone of those people who posted recently that they'd like to 
>volunteer read this, this would be a nice opportunity to take a fully 
>working implementation as an example and transfer it to other 
>applicable parsers, e.g. embl and swiss.
>
>	-hilmar
>-- 
>-------------------------------------------------------------
>Hilmar Lapp                            email: lapp at gnf.org
>GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
>-------------------------------------------------------------
>
>
>

From murali at i122server.vu-wien.ac.at  Mon Dec 19 10:16:33 2005
From: murali at i122server.vu-wien.ac.at (Muralidhar Metta)
Date: Wed Dec 21 23:25:50 2005
Subject: [Bioperl-l] bioper installation
Message-ID: <c865b5f881621882b4b03014f413b82b@i122server.vu-wien.ac.at>

Dear Dr. Steven Cannon,
I have installed current version of bioperl in my system as per the  
instruction given on your website. my OS is Mac OSX. when i'm running a  
program which has implemented bioperl in it, i'm getting the following  
error:

Can't locate LWP/UserAgent.pm in @INC (@INC contains:  
/System/Library/Perl/5.8.1/darwin-thread-multi-2level  
/System/Library/Perl/5.8.1  
/Library/Perl/5.8.1/darwin-thread-multi-2level /Library/Perl/5.8.1  
/Library/Perl /Network/Library/Perl/5.8.1/darwin-thread-multi-2level  
/Network/Library/Perl/5.8.1 /Network/Library/Perl .) at  
/System/Library/Perl/5.8.1/darwin-thread-multi-2level/Bio/DB/ 
WebDBSeqI.pm line 81.
BEGIN failed--compilation aborted at  
/System/Library/Perl/5.8.1/darwin-thread-multi-2level/Bio/DB/ 
WebDBSeqI.pm line 81.
Compilation failed in require at  
/System/Library/Perl/5.8.1/darwin-thread-multi-2level/Bio/DB/ 
NCBIHelper.pm line 82.
BEGIN failed--compilation aborted at  
/System/Library/Perl/5.8.1/darwin-thread-multi-2level/Bio/DB/ 
NCBIHelper.pm line 82.
Compilation failed in require at  
/System/Library/Perl/5.8.1/darwin-thread-multi-2level/Bio/DB/GenBank.pm  
line 124.
BEGIN failed--compilation aborted at  
/System/Library/Perl/5.8.1/darwin-thread-multi-2level/Bio/DB/GenBank.pm  
line 124.
Compilation failed in require at genbank_parser.pl line 4.
BEGIN failed--compilation aborted at genbank_parser.pl line 4.

when i asked the author of the program about the error, he says,  
bioperl is not installed properly. can you please suggest me what could  
be the mistake that i'm making?
Thanking you,
With best regards,
Murali
Muralidhar Metta
Graduate Student
Institut f?r Tierzucht und Genetik
Veterin?rmedizinische Universit?t Wien
Josef Baumann Gasse 1
1210 Wien
Austria/Europe
-------------- next part --------------
A non-text attachment was scrubbed...
Name: not available
Type: text/enriched
Size: 1809 bytes
Desc: not available
Url : http://portal.open-bio.org/pipermail/bioperl-l/attachments/20051219/89a32e53/attachment.bin
From jason.stajich at duke.edu  Wed Dec 21 23:51:13 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Wed Dec 21 23:48:25 2005
Subject: [Bioperl-l] bioper installation
In-Reply-To: <c865b5f881621882b4b03014f413b82b@i122server.vu-wien.ac.at>
References: <c865b5f881621882b4b03014f413b82b@i122server.vu-wien.ac.at>
Message-ID: <8D143F4E-C6D7-4480-88F5-F829B0D71832@duke.edu>

you need to install LWP::UserAgent as the error message tells you.   
This is not part of Bioperl, but you can get it if you install  
Bundle::BioPerl from CPAN.

If you are on OSX you may want to try installing bioperl through fink  
which will fetch the necessary dependancies.


On Dec 19, 2005, at 10:16 AM, Muralidhar Metta wrote:

> Dear Dr. Steven Cannon,
> I have installed current version of bioperl in my system as per the  
> instruction given on your website. my OS is Mac OSX. when i'm  
> running a program which has implemented bioperl in it, i'm getting  
> the following error:
>
> Can't locate LWP/UserAgent.pm in @INC (@INC contains: /System/ 
> Library/Perl/5.8.1/darwin-thread-multi-2level /System/Library/Perl/ 
> 5.8.1 /Library/Perl/5.8.1/darwin-thread-multi-2level /Library/Perl/ 
> 5.8.1 /Library/Perl /Network/Library/Perl/5.8.1/darwin-thread- 
> multi-2level /Network/Library/Perl/5.8.1 /Network/Library/Perl .)  
> at /System/Library/Perl/5.8.1/darwin-thread-multi-2level/Bio/DB/ 
> WebDBSeqI.pm line 81.
> BEGIN failed--compilation aborted at /System/Library/Perl/5.8.1/ 
> darwin-thread-multi-2level/Bio/DB/WebDBSeqI.pm line 81.
> Compilation failed in require at /System/Library/Perl/5.8.1/darwin- 
> thread-multi-2level/Bio/DB/NCBIHelper.pm line 82.
> BEGIN failed--compilation aborted at /System/Library/Perl/5.8.1/ 
> darwin-thread-multi-2level/Bio/DB/NCBIHelper.pm line 82.
> Compilation failed in require at /System/Library/Perl/5.8.1/darwin- 
> thread-multi-2level/Bio/DB/GenBank.pm line 124.
> BEGIN failed--compilation aborted at /System/Library/Perl/5.8.1/ 
> darwin-thread-multi-2level/Bio/DB/GenBank.pm line 124.
> Compilation failed in require at genbank_parser.pl line 4.
> BEGIN failed--compilation aborted at genbank_parser.pl line 4.
>
> when i asked the author of the program about the error, he says,  
> bioperl is not installed properly. can you please suggest me what  
> could be the mistake that i'm making?
> Thanking you,
> With best regards,
> Murali
> Muralidhar Metta
> Graduate Student
> Institut f?r Tierzucht und Genetik
> Veterin?rmedizinische Universit?t Wien
> Josef Baumann Gasse 1
> 1210 Wien
> Austria/Europe
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12/



From taerwin at gmail.com  Wed Dec 21 23:54:46 2005
From: taerwin at gmail.com (Tim Erwin)
Date: Thu Dec 22 02:37:29 2005
Subject: [Bioperl-l] bioper installation
In-Reply-To: <c865b5f881621882b4b03014f413b82b@i122server.vu-wien.ac.at>
References: <c865b5f881621882b4b03014f413b82b@i122server.vu-wien.ac.at>
Message-ID: <c7d2b5330512212054h2e38f596gac1e84c03661ff65@mail.gmail.com>

> Can't locate LWP/UserAgent.pm in @INC (@INC contains:

LWP is not part of the bioperl package, you will need to install it.
You can get it from CPAN
http://search.cpan.org/~gaas/libwww-perl-5.805/ or use the cpan
installer.

Regards,

Tim


On 12/20/05, Muralidhar Metta <murali@i122server.vu-wien.ac.at> wrote:
> Dear Dr. Steven Cannon,
> I have installed current version of bioperl in my system as per the
> instruction given on your website. my OS is Mac OSX. when i'm running a
> program which has implemented bioperl in it, i'm getting the following
> error:
>
> Can't locate LWP/UserAgent.pm in @INC (@INC contains:
> /System/Library/Perl/5.8.1/darwin-thread-multi-2level
> /System/Library/Perl/5.8.1
> /Library/Perl/5.8.1/darwin-thread-multi-2level /Library/Perl/5.8.1
> /Library/Perl /Network/Library/Perl/5.8.1/darwin-thread-multi-2level
> /Network/Library/Perl/5.8.1 /Network/Library/Perl .) at
> /System/Library/Perl/5.8.1/darwin-thread-multi-2level/Bio/DB/
> WebDBSeqI.pm line 81.
> BEGIN failed--compilation aborted at
> /System/Library/Perl/5.8.1/darwin-thread-multi-2level/Bio/DB/
> WebDBSeqI.pm line 81.
> Compilation failed in require at
> /System/Library/Perl/5.8.1/darwin-thread-multi-2level/Bio/DB/
> NCBIHelper.pm line 82.
> BEGIN failed--compilation aborted at
> /System/Library/Perl/5.8.1/darwin-thread-multi-2level/Bio/DB/
> NCBIHelper.pm line 82.
> Compilation failed in require at
> /System/Library/Perl/5.8.1/darwin-thread-multi-2level/Bio/DB/GenBank.pm
> line 124.
> BEGIN failed--compilation aborted at
> /System/Library/Perl/5.8.1/darwin-thread-multi-2level/Bio/DB/GenBank.pm
> line 124.
> Compilation failed in require at genbank_parser.pl line 4.
> BEGIN failed--compilation aborted at genbank_parser.pl line 4.
>
> when i asked the author of the program about the error, he says,
> bioperl is not installed properly. can you please suggest me what could
> be the mistake that i'm making?
> Thanking you,
> With best regards,
> Murali
> Muralidhar Metta
> Graduate Student
> Institut f?r Tierzucht und Genetik
> Veterin?rmedizinische Universit?t Wien
> Josef Baumann Gasse 1
> 1210 Wien
> Austria/Europe
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>

From avilella at ub.edu  Thu Dec 22 05:55:27 2005
From: avilella at ub.edu (Albert Vilella)
Date: Thu Dec 22 06:12:34 2005
Subject: [Bioperl-l] half intergenic 5' and 3' regions of a genbank entry
Message-ID: <1135248927.19508.1.camel@localhost.localdomain>

Hi all,

I'm trying to obtain each of the genes of a genbank genome prokaryote
file with half of the 5' and 3' intergenic sequences with respect to
the corresponding bounding genes.

So if gene 1 has gene 0 at 1200bp 5' and gene2 at 444bp 3', the script
will output the fasta of gene1 with 600bp 5', the gene, and 222bp 3'.

Any script or stub I can reuse? Any suggestion on how to do that?

Thanks,

    Albert.

From hlapp at gmx.net  Thu Dec 22 12:26:11 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu Dec 22 12:23:15 2005
Subject: [Bioperl-l] extracting CDS portion of RefSeqs
In-Reply-To: <CED81D34E37D5043A1211565277A51E5045CEE50@exchkc02.stowers-institute.org>
References: <CED81D34E37D5043A1211565277A51E5045CEE50@exchkc02.stowers-institute.org>
Message-ID: <3066c4f7338f387cc0d4394031ad524e@gmx.net>


On Dec 21, 2005, at 9:59 AM, Cook, Malcolm wrote:

> FYI - using the $builder as above to read 46 GenBank mRNA RefSeq
> containing lots of REFERENCE data gave me ~ 33% speed up
> HOWEVER, I get %52 speed up if instead I pre-filtered the genbank
> flatfile using:
> 	perl -n -e "print if (m'^(LOCUS|ACCESSION)' ||
> (m'^FEATURES'...m'^//'))"
>

63% of the 'best possible' speedup isn't too bad I'd say :-) Seriously 
though.

Note that SeqBuilder isn't really the event-driven architecture that 
would allow an event handler full control over what gets parsed and 
what doesn't. Rather, it is up to the parser how much advantage it 
wants to take from the interface (by aborting/skipping certain sections 
of an entry).

Note also that obviously none of these things will be as fast as the 
pure perl short-cut - you still have to create objects and go through 
quite a few more control structures.

	-hilmar
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From jason.stajich at duke.edu  Thu Dec 22 11:21:52 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Thu Dec 22 13:16:19 2005
Subject: [Bioperl-l] BOSC pics
Message-ID: <A18AE322-BF3D-4E47-B869-DBCCBBC2E2A3@duke.edu>

Sorry for the cross-posting, but did anyone have pictures from  
BOSC2005 they wanted to share?  Or BOSC 2004?

Please send them to me so we can upload to the gallery site
http://gallery.open-bio.org/


Thanks,
-jason

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12/


From bmoore at genetics.utah.edu  Thu Dec 22 14:57:42 2005
From: bmoore at genetics.utah.edu (Barry Moore)
Date: Thu Dec 22 14:53:43 2005
Subject: [Bioperl-l] Perlcast Interview
Message-ID: <CFE1DF3BA20F424689DA0881A14055BECF2F52@m.hg.genetics.utah.edu>

Catch the latest celebrity interview on http://www.perlcast.com/.  Jason
does a great job of describing the BioPerl project, it's history, and
giving inspiration for slackers like myself to get more involved.
Nicely done Jason.

Barry

From osborne1 at optonline.net  Fri Dec 23 16:12:57 2005
From: osborne1 at optonline.net (Brian Osborne)
Date: Fri Dec 23 16:16:16 2005
Subject: [Bioperl-l] Re: [Bug 1837] Bio::Ext::Align
In-Reply-To: <BFD048DF.6896%osborne1@optonline.net>
Message-ID: <BFD1D289.68BD%osborne1@optonline.net>

Jouni,

I've been playing a bit with bioperl-ext on Mac OS X, I found that the 'make
install' of SeqIO/staden/* was not working unless I performed the 'make' and
'make install' from within the bioperl-ext/Bio/SeqIO/staden directory.
Perhaps you're seeing the same thing - can you try 'make clean', 'perl
Makefile.PL', 'make', 'make test', and then the 'make install' from within
bioperl-ext/Bio/Ext/Align and see what happens?

Brian O.


On 12/22/05 12:13 PM, "Brian Osborne" <osborne1@optonline.net> wrote:

> Jouni,
> 
> I suggest you show this error to bioperl-l, I'm unable to debug this package
> because of problems with "make", unrelated to the problems that you've seen.
> 
> Brian O.
> 
> 
> On 12/19/05 10:30 AM, "Jouni Valiaho" <Jouni.Valiaho@uta.fi> wrote:
> 
>> Brian,
>> 
>> Thanks, again!
>> 
>> Now the make goes through (prompt attached the end of email).
>> I run "make test" (as a normal user) and got an error at the end of
>> test (see prompt attached the end of email).
>> Despite of that, I run "make install" (as root, prompt attached the end
>> of email).
>> After it i run simple test:
>> $ perl -e 'use Bio::Ext::Align;'
>> Can't locate Bio/Ext/Align.pm in @INC (@INC contains:
>> /usr/lib/perl5/site_perl/5.8.6/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/site_perl/5.8.6 /usr/lib/perl5/site_perl/5.8.5
>> /usr/lib/perl5/site_perl/5.8.4 /usr/lib/perl5/site_perl/5.8.3
>> /usr/lib/perl5/site_perl
>> /usr/lib/perl5/vendor_perl/5.8.6/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.5/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.4/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
>> /usr/lib/perl5/vendor_perl/5.8.6 /usr/lib/perl5/vendor_perl/5.8.5
>> /usr/lib/perl5/vendor_perl/5.8.4 /usr/lib/perl5/vendor_perl/5.8.3
>> /usr/lib/perl5/vendor_perl /usr/lib/perl5/5.8.6/i386-linux-thread-multi
>> /usr/lib/perl5/5.8.6 .) at -e line 1.
>> BEGIN failed--compilation aborted at -e line 1.
>> 
>> As you see the INC contains the path /usr/lib/perl5/site_perl/5.8.6,
>> where the ext modules were installed.
>> Do you have any suggestions what can I do?
>> 
>> Jouni
>> 
>> Quoting Brian Osborne <osborne1@optonline.net>:
>> 
>>> Jouni,
>>> 
>>> Hmm. What happens when you change:
>>> 
>>> use vars qw(@ISA $VERSION $HAS_INLINE);
>>>                    VERSION => '0.01',
>>> 
>>> To
>>> 
>>> use vars qw(@ISA $VERSION $HAS_INLINE);
>>>                    VERSION => '1.51',
>>> 
>>> As well?
>>> 
>>> You probably want to start from the beginning with "make clean" etc.
>>> 
>>> BIO
>>> 
>>> 
>>> On 12/19/05 3:30 AM, "Jouni Valiaho" <Jouni.Valiaho@uta.fi> wrote:
>>> 
>>>> Brian,
>>>> 
>>>> Thanks, I changed "1.5.1" to "1.51" in Bio/SeqIO/staden/read.pm.
>>>> It fixed the problem. Here is the command prompt.
>>>> 
>>>> $ perl Makefile.PL
>>>> Writing Makefile for Bio::Ext::Align
>>>> Found Staden io_lib "libread" in /usr/local/lib ...
>>>> Automatically using the Read.h found in /usr/local/include/io_lib ...
>>>> Writing Makefile for Bio::SeqIO::staden::read
>>>> Writing Makefile for Bio
>>>> One or more DATA sections were not processed by Inline.
>>>> 
>>>> Then I perform the make command (as a normal user, not as super user).
>>>> 
>> 
>> #################################
>> $ make
>> #################################
>> $ make
>> cp Bio/Ext/Align/libs/hscore.h blib/lib/Bio/Ext/Align/libs/hscore.h
>> cp Bio/Ext/Align/libs/probability.c blib/lib/Bio/Ext/Align/libs/probability.c
>> cp Bio/Ext/Align/libs/linesubs.h blib/lib/Bio/Ext/Align/libs/linesubs.h
>> cp Bio/Ext/Align/test.pl blib/lib/Bio/Ext/Align/test.pl
>> cp Bio/Ext/Align/libs/wiseoverlay.h blib/lib/Bio/Ext/Align/libs/wiseoverlay.h
>> cp Bio/Ext/Align/libs/proteinsw.h blib/lib/Bio/Ext/Align/libs/proteinsw.h
>> cp Bio/Ext/Align/libs/wisebase.h blib/lib/Bio/Ext/Align/libs/wisebase.h
>> cp Bio/Ext/Align/libs/seqaligndisplay.h
>> blib/lib/Bio/Ext/Align/libs/seqaligndisplay.h
>> cp Bio/Ext/Align/libs/dyna.h blib/lib/Bio/Ext/Align/libs/dyna.h
>> cp Bio/Ext/Align/libs/wiseerror.c blib/lib/Bio/Ext/Align/libs/wiseerror.c
>> cp Bio/Ext/Align/libs/commandline.h blib/lib/Bio/Ext/Align/libs/commandline.h
>> cp Bio/Ext/Align/libs/aln.c blib/lib/Bio/Ext/Align/libs/aln.c
>> cp Bio/Ext/Align/libs/packaln.c blib/lib/Bio/Ext/Align/libs/packaln.c
>> cp Bio/Ext/Align/libs/dpenvelope.c blib/lib/Bio/Ext/Align/libs/dpenvelope.c
>> cp Bio/Ext/Align/libs/complexsequence.c
>> blib/lib/Bio/Ext/Align/libs/complexsequence.c
>> cp Bio/Ext/HMM/hmm.h blib/lib/Bio/Ext/HMM/hmm.h
>> cp Bio/Ext/Align/libs/wisestring.h blib/lib/Bio/Ext/Align/libs/wisestring.h
>> cp Bio/Ext/Align/libs/codon.c blib/lib/Bio/Ext/Align/libs/codon.c
>> cp Bio/Ext/Align/libs/linspc.c blib/lib/Bio/Ext/Align/libs/linspc.c
>> cp Bio/SeqIO/staden/read.pm.ori blib/lib/Bio/SeqIO/staden/read.pm.ori
>> cp Bio/Ext/Align/libs/probability.h blib/lib/Bio/Ext/Align/libs/probability.h
>> cp Bio/Ext/Align/Align.xs blib/lib/Bio/Ext/Align/Align.xs
>> cp Bio/Ext/Align/libs/packaln.h blib/lib/Bio/Ext/Align/libs/packaln.h
>> cp Bio/Ext/Align/blosum45.mat blib/lib/Bio/Ext/Align/blosum45.mat
>> cp Bio/Ext/Align/libs/dynlibcross.c blib/lib/Bio/Ext/Align/libs/dynlibcross.c
>> cp Bio/Ext/Align/libs/sequencedb.c blib/lib/Bio/Ext/Align/libs/sequencedb.c
>> cp Bio/Ext/Align/libs/sw_wrap.c blib/lib/Bio/Ext/Align/libs/sw_wrap.c
>> cp Bio/Ext/HMM/Makefile.PL blib/lib/Bio/Ext/HMM/Makefile.PL
>> cp Bio/Ext/Align/libs/wiseerror.h blib/lib/Bio/Ext/Align/libs/wiseerror.h
>> cp Bio/Ext/Align/Makefile.PL blib/lib/Bio/Ext/Align/Makefile.PL
>> cp Bio/Ext/Align/libs/complexsequence.h
>> blib/lib/Bio/Ext/Align/libs/complexsequence.h
>> cp Bio/Ext/Align/libs/wiseconfig.h blib/lib/Bio/Ext/Align/libs/wiseconfig.h
>> cp Bio/Ext/Align/libs/dynlibcross.h blib/lib/Bio/Ext/Align/libs/dynlibcross.h
>> cp Bio/Ext/Align/libs/complexevalset.c
>> blib/lib/Bio/Ext/Align/libs/complexevalset.c
>> cp Bio/Ext/Align/libs/complexevalset.h
>> blib/lib/Bio/Ext/Align/libs/complexevalset.h
>> cp Bio/Ext/Align/libs/wisefile.c blib/lib/Bio/Ext/Align/libs/wisefile.c
>> cp Bio/Ext/Align/libs/wiseconfig.c blib/lib/Bio/Ext/Align/libs/wiseconfig.c
>> cp Bio/Ext/Align/libs/alnconvert.c blib/lib/Bio/Ext/Align/libs/alnconvert.c
>> cp Bio/Ext/HMM/typemap blib/lib/Bio/Ext/HMM/typemap
>> cp Bio/Ext/Align/libs/histogram.h blib/lib/Bio/Ext/Align/libs/histogram.h
>> cp Bio/Ext/Align/libs/makefile blib/lib/Bio/Ext/Align/libs/makefile
>> cp Bio/Ext/Align/typemap blib/lib/Bio/Ext/Align/typemap
>> cp Bio/Ext/Align/libs/proteindb.h blib/lib/Bio/Ext/Align/libs/proteindb.h
>> cp Bio/Ext/Align/libs/btcanvas.c blib/lib/Bio/Ext/Align/libs/btcanvas.c
>> cp Bio/Ext/Align/libs/complexconsensi.c
>> blib/lib/Bio/Ext/Align/libs/complexconsensi.c
>> cp Bio/Ext/Align/libs/hscore.c blib/lib/Bio/Ext/Align/libs/hscore.c
>> cp Bio/Ext/Align/libs/alnrange.c blib/lib/Bio/Ext/Align/libs/alnrange.c
>> cp Bio/Ext/Align/libs/dpenvelope.h blib/lib/Bio/Ext/Align/libs/dpenvelope.h
>> cp Bio/Ext/Align/blosum62.mat blib/lib/Bio/Ext/Align/blosum62.mat
>> cp Bio/Ext/Align/libs/sequence.h blib/lib/Bio/Ext/Align/libs/sequence.h
>> cp Bio/Ext/Align/libs/asciibtcanvas.h
>> blib/lib/Bio/Ext/Align/libs/asciibtcanvas.h
>> cp Bio/Ext/Align/blosum50.mat blib/lib/Bio/Ext/Align/blosum50.mat
>> cp Bio/SeqIO/staden/read.pm blib/lib/Bio/SeqIO/staden/read.pm
>> cp Bio/Ext/Align/blosum62.bla blib/lib/Bio/Ext/Align/blosum62.bla
>> cp Bio/Ext/Align/libs/protein.h blib/lib/Bio/Ext/Align/libs/protein.h
>> cp Bio/Ext/Align/libs/sequencedb.h blib/lib/Bio/Ext/Align/libs/sequencedb.h
>> cp Bio/Ext/Align/libs/complexconsensi.h
>> blib/lib/Bio/Ext/Align/libs/complexconsensi.h
>> cp Bio/Ext/Align/Align.pm blib/lib/Bio/Ext/Align/Align.pm
>> cp Bio/Ext/Align/libs/dna.c blib/lib/Bio/Ext/Align/libs/dna.c
>> cp Bio/Ext/HMM/hmmlib.c blib/lib/Bio/Ext/HMM/hmmlib.c
>> cp Bio/Ext/Align/libs/sw.h blib/lib/Bio/Ext/Align/libs/sw.h
>> cp Bio/SeqIO/staden/test.pl blib/lib/Bio/SeqIO/staden/test.pl
>> cp Bio/SeqIO/staden/Makefile.PL blib/lib/Bio/SeqIO/staden/Makefile.PL
>> cp Bio/Ext/Align/libs/wisestring.c blib/lib/Bio/Ext/Align/libs/wisestring.c
>> cp Bio/Ext/Align/libs/sw_wrap.h blib/lib/Bio/Ext/Align/libs/sw_wrap.h
>> cp Bio/Ext/Align/libs/alnrange.h blib/lib/Bio/Ext/Align/libs/alnrange.h
>> cp Bio/Ext/Align/libs/dpalign.c blib/lib/Bio/Ext/Align/libs/dpalign.c
>> cp Bio/Ext/Align/libs/database.h blib/lib/Bio/Ext/Align/libs/database.h
>> cp Bio/Ext/Align/libs/dpalign.h blib/lib/Bio/Ext/Align/libs/dpalign.h
>> cp Bio/Ext/Align/libs/proteinsw.c blib/lib/Bio/Ext/Align/libs/proteinsw.c
>> cp Bio/Ext/Align/libs/wisetime.c blib/lib/Bio/Ext/Align/libs/wisetime.c
>> cp Bio/Ext/HMM/test.pl blib/lib/Bio/Ext/HMM/test.pl
>> cp Bio/Ext/Align/libs/wiserandom.c blib/lib/Bio/Ext/Align/libs/wiserandom.c
>> cp Bio/Ext/Align/libs/btcanvas.h blib/lib/Bio/Ext/Align/libs/btcanvas.h
>> cp Bio/Ext/Align/libs/linesubs.c blib/lib/Bio/Ext/Align/libs/linesubs.c
>> cp Bio/Ext/Align/libs/compmat.c blib/lib/Bio/Ext/Align/libs/compmat.c
>> cp Bio/Ext/Align/libs/proteindb.c blib/lib/Bio/Ext/Align/libs/proteindb.c
>> cp Bio/Ext/Align/libs/codon.h blib/lib/Bio/Ext/Align/libs/codon.h
>> cp Bio/Ext/Align/libs/basematrix.h blib/lib/Bio/Ext/Align/libs/basematrix.h
>> cp Bio/Ext/Align/libs/histogram.c blib/lib/Bio/Ext/Align/libs/histogram.c
>> cp Bio/Ext/Align/libs/wiserandom.h blib/lib/Bio/Ext/Align/libs/wiserandom.h
>> cp Bio/Ext/Align/libs/dnamatrix.h blib/lib/Bio/Ext/Align/libs/dnamatrix.h
>> cp Bio/Ext/Align/libs/wisememman.c blib/lib/Bio/Ext/Align/libs/wisememman.c
>> cp Bio/Ext/Align/libs/seqaligndisplay.c
>> blib/lib/Bio/Ext/Align/libs/seqaligndisplay.c
>> cp Bio/Ext/Align/libs/commandline.c blib/lib/Bio/Ext/Align/libs/commandline.c
>> cp Bio/Ext/Align/libs/alnconvert.h blib/lib/Bio/Ext/Align/libs/alnconvert.h
>> cp Bio/Ext/HMM/HMM.pm blib/lib/Bio/Ext/HMM/HMM.pm
>> cp Bio/Ext/HMM/HMM.xs blib/lib/Bio/Ext/HMM/HMM.xs
>> cp Bio/Ext/Align/libs/compmat.h blib/lib/Bio/Ext/Align/libs/compmat.h
>> cp Bio/Ext/Align/libs/dna.h blib/lib/Bio/Ext/Align/libs/dna.h
>> cp Bio/Ext/Align/md_20.mat blib/lib/Bio/Ext/Align/md_20.mat
>> cp Bio/Ext/Align/libs/basematrix.c blib/lib/Bio/Ext/Align/libs/basematrix.c
>> cp Bio/Ext/Align/libs/aln.h blib/lib/Bio/Ext/Align/libs/aln.h
>> cp Bio/Ext/Align/libs/sequence.c blib/lib/Bio/Ext/Align/libs/sequence.c
>> cp Bio/Ext/Align/libs/wisememman.h blib/lib/Bio/Ext/Align/libs/wisememman.h
>> cp Bio/Ext/Align/libs/wisetime.h blib/lib/Bio/Ext/Align/libs/wisetime.h
>> cp Bio/Ext/Align/libs/protein.c blib/lib/Bio/Ext/Align/libs/protein.c
>> cp Bio/Ext/Align/libs/wiseoverlay.c blib/lib/Bio/Ext/Align/libs/wiseoverlay.c
>> cp Bio/Ext/Align/libs/wisefile.h blib/lib/Bio/Ext/Align/libs/wisefile.h
>> cp Bio/Ext/Align/libs/asciibtcanvas.c
>> blib/lib/Bio/Ext/Align/libs/asciibtcanvas.c
>> cp Bio/Ext/Align/libs/dnamatrix.c blib/lib/Bio/Ext/Align/libs/dnamatrix.c
>> make[1]: Entering directory
>> `/home/java/perl_code/bioperl-ext-1.5.1/Bio/Ext/Align'
>> cp Align.pm ../blib/lib/Bio/Ext/Align.pm
>> DEFINE='-DPOSIX -DNOERROR'; CC='gcc'; CFLAGS='-D_REENTRANT
>> -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm'; export DEFINE INC CC CFLAGS; \
>> cd libs && make CC='gcc' CFLAGS='-D_REENTRANT -D_GNU_SOURCE -DDEBUGGING
>> -fno-strict-aliasing -pipe -I/usr/local/include -D_LARGEFILE_SOURCE
>> -D_FILE_OFFSET_BITS=64 -I/usr/include/gdbm -DPOSIX -DNOERROR'
>> DEFINE='-DPOSIX -DNOERROR' libsw.a -e
>> make[2]: Entering directory
>> `/home/java/perl_code/bioperl-ext-1.5.1/Bio/Ext/Align/libs'
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o aln.o aln.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o alnconvert.o alnconvert.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o alnrange.o alnrange.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o asciibtcanvas.o
>> asciibtcanvas.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o basematrix.o basematrix.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o btcanvas.o btcanvas.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o commandline.o
>> commandline.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o complexconsensi.o
>> complexconsensi.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o complexevalset.o
>> complexevalset.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o complexsequence.o
>> complexsequence.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o compmat.o compmat.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o codon.o codon.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o dna.o dna.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o dnamatrix.o dnamatrix.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o dpenvelope.o dpenvelope.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o dynlibcross.o
>> dynlibcross.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o histogram.o histogram.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o hscore.o hscore.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o linesubs.o linesubs.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o packaln.o packaln.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o probability.o
>> probability.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o protein.o protein.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o proteindb.o proteindb.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o proteinsw.o proteinsw.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o seqaligndisplay.o
>> seqaligndisplay.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o sequence.o sequence.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o sequencedb.o sequencedb.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o sw_wrap.o sw_wrap.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o wiseerror.o wiseerror.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o wisefile.o wisefile.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o wisememman.o wisememman.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o wiseoverlay.o
>> wiseoverlay.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o wiserandom.o wiserandom.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o wisestring.o wisestring.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o wisetime.o wisetime.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o dpalign.o dpalign.c
>> gcc -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING -fno-strict-aliasing -pipe
>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64
>> -I/usr/include/gdbm -DPOSIX -DNOERROR   -c -o linspc.o linspc.c
>> ar ru libsw.a aln.o alnconvert.o alnrange.o asciibtcanvas.o
>> basematrix.o btcanvas.o commandline.o complexconsensi.o
>> complexevalset.o complexsequence.o compmat.o codon.o dna.o dnamatrix.o
>> dpenvelope.o dynlibcross.o histogram.o hscore.o linesubs.o packaln.o
>> probability.o protein.o proteindb.o proteinsw.o seqaligndisplay.o
>> sequence.o sequencedb.o sw_wrap.o wiseerror.o wisefile.o wisememman.o
>> wiseoverlay.o wiserandom.o wisestring.o wisetime.o dpalign.o linspc.o
>> ar: creating libsw.a
>> make[2]: Leaving directory
>> `/home/java/perl_code/bioperl-ext-1.5.1/Bio/Ext/Align/libs'
>> /usr/bin/perl /usr/lib/perl5/5.8.6/ExtUtils/xsubpp  -typemap
>> /usr/lib/perl5/5.8.6/ExtUtils/typemap -typemap typemap  Align.xs >
>> Align.xsc && mv Align.xsc Align.c
>> gcc -c  -I./libs -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING
>> -fno-strict-aliasing -pipe -I/usr/local/include -D_LARGEFILE_SOURCE
>> -D_FILE_OFFSET_BITS=64 -I/usr/include/gdbm -O2 -g -pipe
>> -Wp,-D_FORTIFY_SOURCE=2 -fexceptions -m32 -march=i386 -mtune=pentium4
>> -fasynchronous-unwind-tables   -DVERSION=\"1.5.1\"
>> -DXS_VERSION=\"1.5.1\" -fPIC
>> "-I/usr/lib/perl5/5.8.6/i386-linux-thread-multi/CORE"  -DPOSIX
>> -DNOERROR Align.c
>> Running Mkbootstrap for Bio::Ext::Align ()
>> chmod 644 Align.bs
>> rm -f ../blib/arch/auto/Bio/Ext/Align/Align.so
>> gcc  -shared -L/usr/local/lib Align.o  -o
>> ../blib/arch/auto/Bio/Ext/Align/Align.so libs/libsw.a  -lm
>> chmod 755 ../blib/arch/auto/Bio/Ext/Align/Align.so
>> cp Align.bs ../blib/arch/auto/Bio/Ext/Align/Align.bs
>> chmod 644 ../blib/arch/auto/Bio/Ext/Align/Align.bs
>> make[1]: Leaving directory
>> `/home/java/perl_code/bioperl-ext-1.5.1/Bio/Ext/Align'
>> make[1]: Entering directory
>> `/home/java/perl_code/bioperl-ext-1.5.1/Bio/SeqIO/staden'
>> cp read.pm ../blib/lib/Bio/SeqIO/staden/read.pm
>> /usr/bin/perl -Mblib -MInline=NOISY,_INSTALL_
>> -MBio::SeqIO::staden::read -e1 1.51 ../blib/arch
>> Starting Build Prepocess Stage
>> Finished Build Prepocess Stage
>> 
>> Starting Build Parse Stage
>> Finished Build Parse Stage
>> 
>> Starting Build Glue 1 Stage
>> Finished Build Glue 1 Stage
>> 
>> Starting Build Glue 2 Stage
>> Finished Build Glue 2 Stage
>> 
>> Starting Build Glue 3 Stage
>> Finished Build Glue 3 Stage
>> 
>> Starting Build Compile Stage
>>   Starting "perl Makefile.PL" Stage
>> Writing Makefile for Bio::SeqIO::staden::read
>>   Finished "perl Makefile.PL" Stage
>> 
>>   Starting "make" Stage
>> make[2]: Entering directory
>> 
`/home/java/perl_code/bioperl-ext-1.5.1/Bio/SeqIO/staden/_Inline/build/Bio/Se>>
q
>> IO/staden/read'
>> /usr/bin/perl /usr/lib/perl5/5.8.6/ExtUtils/xsubpp  -typemap
>> /usr/lib/perl5/5.8.6/ExtUtils/typemap   read.xs > read.xsc && mv
>> read.xsc read.c
>> gcc -c  -I/home/java/perl_code/bioperl-ext-1.5.1/Bio/SeqIO/staden
>> -I/usr/local/include/io_lib -D_REENTRANT -D_GNU_SOURCE -DDEBUGGING
>> -fno-strict-aliasing -pipe -I/usr/local/include -D_LARGEFILE_SOURCE
>> -D_FILE_OFFSET_BITS=64 -I/usr/include/gdbm -O2 -g -pipe
>> -Wp,-D_FORTIFY_SOURCE=2 -fexceptions -m32 -march=i386 -mtune=pentium4
>> -fasynchronous-unwind-tables   -DVERSION=\"1.51\" -DXS_VERSION=\"1.51\"
>> -fPIC "-I/usr/lib/perl5/5.8.6/i386-linux-thread-multi/CORE"   read.c
>> In file included from /usr/local/include/io_lib/os.h:4,
>>                  from /usr/local/include/io_lib/Read.h:43,
>>                  from read.xs:5:
>> /usr/local/include/io_lib/config.h:45:1: warning: "VERSION" redefined
>> <command line>:1:1: warning: this is the location of the previous definition
>> Running Mkbootstrap for Bio::SeqIO::staden::read ()
>> chmod 644 read.bs
>> rm -f blib/arch/auto/Bio/SeqIO/staden/read/read.so
>> gcc  -shared -L/usr/local/lib read.o  -o
>> blib/arch/auto/Bio/SeqIO/staden/read/read.so   -L/usr/local/lib -lread
>> -lz
>> chmod 755 blib/arch/auto/Bio/SeqIO/staden/read/read.so
>> cp read.bs blib/arch/auto/Bio/SeqIO/staden/read/read.bs
>> chmod 644 blib/arch/auto/Bio/SeqIO/staden/read/read.bs
>> make[2]: Leaving directory
>> 
`/home/java/perl_code/bioperl-ext-1.5.1/Bio/SeqIO/staden/_Inline/build/Bio/Se>>
q
>> IO/staden/read'
>>   Finished "make" Stage
>> 
>>   Starting "make install" Stage
>> make[2]: Entering directory
>> 
`/home/java/perl_code/bioperl-ext-1.5.1/Bio/SeqIO/staden/_Inline/build/Bio/Se>>
q
>> IO/staden/read'
>> Installing
>> 
/home/java/perl_code/bioperl-ext-1.5.1/Bio/SeqIO/staden/../blib/arch/auto/Bio>>
/
>> SeqIO/staden/read/read.so
>> Installing
>> 
/home/java/perl_code/bioperl-ext-1.5.1/Bio/SeqIO/staden/../blib/arch/auto/Bio>>
/
>> SeqIO/staden/read/read.bs
>> Files found in blib/arch: installing files in blib/lib into
>> architecture dependent library tree
>> Writing
>> 
/home/java/perl_code/bioperl-ext-1.5.1/Bio/SeqIO/staden/../blib/arch/auto/Bio>>
/
>> SeqIO/staden/read/.packlist
>> make[2]: Leaving directory
>> 
`/home/java/perl_code/bioperl-ext-1.5.1/Bio/SeqIO/staden/_Inline/build/Bio/Se>>
q
>> IO/staden/read'
>>   Finished "make install" Stage
>> 
>>   Starting Cleaning Up Stage
>>   Finished Cleaning Up Stage
>> 
>> Finished Build Compile Stage
>> 
>> Manifying ../blib/man3/Bio::SeqIO::staden::read.3pm
>> make[1]: Leaving directory
>> `/home/java/perl_code/bioperl-ext-1.5.1/Bio/SeqIO/staden'
>> Manifying blib/man3/Bio::SeqIO::staden::read.3pm
>> 
>> 
>> ###########################################
>> $make test
>> ###########################################
>> $ make test
>> make[1]: Entering directory
>> `/home/java/perl_code/bioperl-ext-1.5.1/Bio/Ext/Align'
>> make[1]: Leaving directory
>> `/home/java/perl_code/bioperl-ext-1.5.1/Bio/Ext/Align'
>> make[1]: Entering directory
>> `/home/java/perl_code/bioperl-ext-1.5.1/Bio/SeqIO/staden'
>> make[1]: Leaving directory
>> `/home/java/perl_code/bioperl-ext-1.5.1/Bio/SeqIO/staden'
>> PERL_DL_NONLAZY=1 /usr/bin/perl "-MExtUtils::Command::MM" "-e"
>> "test_harness(0, 'blib/lib', 'blib/arch')" t/*.t
>> t/basic....ok
>> All tests successful.
>> Files=1, Tests=1,  0 wallclock secs ( 0.03 cusr +  0.01 csys =  0.04 CPU)
>> make[1]: Entering directory
>> `/home/java/perl_code/bioperl-ext-1.5.1/Bio/Ext/Align'
>> PERL_DL_NONLAZY=1 /usr/bin/perl "-I../blib/lib" "-I../blib/arch" test.pl
>> 1..9
>> # Running under perl version 5.008006 for linux
>> # Current time local: Mon Dec 19 16:56:07 2005
>> # Current time GMT:   Mon Dec 19 14:56:07 2005
>> # Using Test.pm version 1.25
>> ok 1
>> ok 2
>> ok 3
>> ok 4
>> ProteinSW Matrix calculation: [      0] Cells  0%
>> ok 5
>> ok 6
>> ok 7
>> ok 8
>> ok 9
>> *** glibc detected *** /usr/bin/perl: double free or corruption (top):
>> 0x08f2add0 ***
>> ======= Backtrace: =========
>> /lib/libc.so.6[0x385124]
>> /lib/libc.so.6(__libc_free+0x77)[0x38565f]
>> 
../blib/arch/auto/Bio/Ext/Align/Align.so(XS_Bio__Ext__Align__SequenceProfile_>>
D
>> ESTROY+0xfc)[0xef08d6]
>> 
/usr/lib/perl5/5.8.6/i386-linux-thread-multi/CORE/libperl.so(Perl_pp_entersub>>
+
>> 0x3a5)[0x9d7bcc]
>> /usr/lib/perl5/5.8.6/i386-linux-thread-multi/CORE/libperl.so[0x967bbe]
>> 
/usr/lib/perl5/5.8.6/i386-linux-thread-multi/CORE/libperl.so(Perl_call_sv+0x7>>
3
>> 6)[0x96c251]
>> 
/usr/lib/perl5/5.8.6/i386-linux-thread-multi/CORE/libperl.so(Perl_sv_clear+0x>>
1
>> 19)[0x9dcc3b]
>> 
/usr/lib/perl5/5.8.6/i386-linux-thread-multi/CORE/libperl.so(Perl_sv_free+0x1>>
0
>> c)[0x9dd5e2]
>> /usr/lib/perl5/5.8.6/i386-linux-thread-multi/CORE/libperl.so[0x9ddb98]
>> /usr/lib/perl5/5.8.6/i386-linux-thread-multi/CORE/libperl.so[0x9dabbe]
>> 
/usr/lib/perl5/5.8.6/i386-linux-thread-multi/CORE/libperl.so(Perl_sv_clean_ob>>
j
>> s+0x36)[0x9dac88]
>> 
/usr/lib/perl5/5.8.6/i386-linux-thread-multi/CORE/libperl.so(perl_destruct+0x>>
1
>> 2f3)[0x96e367]
>> /usr/bin/perl(main+0xda)[0x804939e]
>> /lib/libc.so.6(__libc_start_main+0xdf)[0x336d5f]
>> /usr/bin/perl[0x8049241]
>> ======= Memory map: ========
>> 00111000-0012f000 r-xp 00000000 03:03 737502
>> /usr/lib/perl5/5.8.6/i386-linux-thread-multi/auto/POSIX/POSIX.so
>> 0012f000-00130000 rwxp 0001d000 03:03 737502
>> /usr/lib/perl5/5.8.6/i386-linux-thread-multi/auto/POSIX/POSIX.so
>> 00281000-00285000 r-xp 00000000 03:03 737497
>> /usr/lib/perl5/5.8.6/i386-linux-thread-multi/auto/IO/IO.so
>> 00285000-00286000 rwxp 00003000 03:03 737497
>> /usr/lib/perl5/5.8.6/i386-linux-thread-multi/auto/IO/IO.so
>> 002ec000-002ee000 r-xp 00000000 03:03 7242199    /lib/libutil-2.3.5.so
>> 002ee000-002ef000 r-xp 00001000 03:03 7242199    /lib/libutil-2.3.5.so
>> 002ef000-002f0000 rwxp 00002000 03:03 7242199    /lib/libutil-2.3.5.so
>> 00304000-0031e000 r-xp 00000000 03:03 7241779    /lib/ld-2.3.5.so
>> 0031e000-0031f000 r-xp 00019000 03:03 7241779    /lib/ld-2.3.5.so
>> 0031f000-00320000 rwxp 0001a000 03:03 7241779    /lib/ld-2.3.5.so
>> 00322000-00445000 r-xp 00000000 03:03 7242154    /lib/libc-2.3.5.so
>> 00445000-00447000 r-xp 00123000 03:03 7242154    /lib/libc-2.3.5.so
>> 00447000-00449000 rwxp 00125000 03:03 7242154    /lib/libc-2.3.5.so
>> 00449000-0044b000 rwxp 00449000 00:00 0
>> 0044d000-00470000 r-xp 00000000 03:03 7242168    /lib/libm-2.3.5.so
>> 00470000-00471000 r-xp 00022000 03:03 7242168    /lib/libm-2.3.5.so
>> 00471000-00472000 rwxp 00023000 03:03 7242168    /lib/libm-2.3.5.so
>> 00474000-00476000 r-xp 00000000 03:03 7242162    /lib/libdl-2.3.5.so
>> 00476000-00477000 r-xp 00001000 03:03 7242162    /lib/libdl-2.3.5.so
>> 00477000-00478000 rwxp 00002000 03:03 7242162    /lib/libdl-2.3.5.so
>> 00576000-00584000 r-xp 00000000 03:03 6914064    /lib/libpthread-2.3.5.so
>> 00584000-00585000 r-xp 0000d000 03:03 6914064    /lib/libpthread-2.3.5.so
>> 00585000-00586000 rwxp 0000e000 03:03 6914064    /lib/libpthread-2.3.5.so
>> 00586000-00588000 rwxp 00586000 00:00 0
>> 0076c000-00775000 r-xp 00000000 03:03 3833859
>> /lib/libgcc_s-4.0.2-20051126.so.1
>> 00775000-00776000 rwxp 00009000 03:03 3833859
>> /lib/libgcc_s-4.0.2-20051126.so.1
>> 007ff000-00804000 r-xp 00000000 03:03 737890
>> /usr/lib/perl5/5.8.6/i386-linux-thread-multi/auto/Socket/Socket.so
>> 00804000-00805000 rwxp 00004000 03:03 737890
>> /usr/lib/perl5/5.8.6/i386-linux-thread-multi/auto/Socket/Socket.so
>> 00946000-00a84000 r-xp 00000000 03:03 737470
>> /usr/lib/perl5/5.8.6/i386-linux-thread-multi/CORE/libperl.so
>> 00a84000-00a8f000 rwxp 0013d000 03:03 737470
>> /usr/lib/perl5/5.8.6/i386-linux-thread-multi/CORE/libperl.so
>> 00a8f000-00a91000 rwxp 00a8f000 00:00 0
>> 00aa9000-00aac000 r-xp 00000000 03:03 737492
>> /usr/lib/perl5/5.8.6/i386-linux-thread-multi/auto/Fcntl/Fcntl.so
>> 00aac000-00aad000 rwxp 00002000 03:03 737492
>> /usr/lib/perl5/5.8.6/i386-linux-thread-multi/auto/Fcntl/Fcntl.so
>> 00bf1000-00c00000 r-xp 00000000 03:03 7242170    /lib/libresolv-2.3.5.so
>> 00c00000-00c01000 r-xp 0000e000 03:03 7242170    /lib/libresolv-2.3.5.so
>> 00c01000-00c02000 rwxp 0000f000 03:03 7242170    /lib/libresolv-2.3.5.so
>> 00c02000-00c04000 rwxp 00c02000 00:00 0
>> 00c95000-00c96000 r-xp 00c95000 00:00 0          [vdso]
>> 00dd1000-00de3000 r-xp 00000000 03:03 7242158    /lib/libnsl-2.3.5.so
>> 00de3000-00de4000 r-xp 00011000 03:03 7242158    /lib/libnsl-2.3.5.so
>> 00de4000-00de5000 rwxp 00012000 03:03 7242158    /lib/libnsl-2.3.5.so
>> 00de5000-00de7000 rwxp 00de5000 00:00 0
>> 00e99000-00f30000 r-xp 00000000 03:03 1736935
>> 
/home/java/perl_code/bioperl-ext-1.5.1/Bio/Ext/blib/arch/auto/Bio/Ext/Align/A>>
l
>> ign.so
>> 00f30000-00f32000 rwxp 00096000 03:03 1736935
>> 
/home/java/perl_code/bioperl-ext-1.5.1/Bio/Ext/blib/arch/auto/Bio/Ext/Align/A>>
l
>> ign.so
>> 075e1000-075e6000 r-xp 00000000 03:03 7242164    /lib/libcrypt-2.3.5.so
>> 075e6000-075e7000 r-xp 00004000 03:03 7242164    /lib/libcrypt-2.3.5.so
>> 075e7000-075e8000 rwxp 00005000 03:03 7242164    /lib/libcrypt-2.3.5.so
>> 075e8000-0760f000 rwxp 075e8000 00:00 0
>> 08048000-0804b000 r-xp 00000000 03:03 41930      /usr/bin/perl
>> 0804b000-0804d000 rw-p 00002000 03:03 41930      /usr/bin/perl
>> 08913000-08f47000 rw-p 08913000 00:00 0          [heap]
>> b7b00000-b7b21000 rw-p b7b00000 00:00 0
>> b7b21000-b7c00000 ---p b7b21000 00:00 0
>> b7cfe000-b7d1f000 rw-p b7cfe000 00:00 0
>> b7d1f000-b7f1f000 r--p 00000000 03:03 48867
>> /usr/lib/locale/locale-archive
>> b7f1f000-b7f22000 rw-p b7f1f000 00:00 0
>> b7f3a000-b7f3b000 rw-p b7f3a000 00:00 0
>> bff25000-bff3b000 rw-p bff25000 00:00 0          [stack]
>> make[1]: *** [test_dynamic] Aborted
>> make[1]: Leaving directory
>> `/home/java/perl_code/bioperl-ext-1.5.1/Bio/Ext/Align'
>> make: *** [test] Error 2
>> 
>> 
>> ################################################
>> $make install
>> ################################################
>> make install
>> make[1]: Entering directory
>> `/home/java/perl_code/bioperl-ext-1.5.1/Bio/Ext/Align'
>> make[1]: Leaving directory
>> `/home/java/perl_code/bioperl-ext-1.5.1/Bio/Ext/Align'
>> make[1]: Entering directory
>> `/home/java/perl_code/bioperl-ext-1.5.1/Bio/SeqIO/staden'
>> make[1]: Leaving directory
>> `/home/java/perl_code/bioperl-ext-1.5.1/Bio/SeqIO/staden'
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/blosum62.mat
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/test.pl
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/blosum50.mat
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/blosum45.mat
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/blosum62.bla
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/typemap
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/md_20.mat
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/Makefile.PL
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/Align.pm
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/Align.xs
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/aln.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/wisetime.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/wiserandom.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/dpenvelope.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/codon.c
>> Installing 
>> /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/complexsequence.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/dynlibcross.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/asciibtcanvas.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/proteindb.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/protein.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/wiserandom.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/dyna.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/wisestring.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/histogram.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/wiseerror.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/dna.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/wiseconfig.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/sequencedb.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/proteinsw.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/basematrix.c
>> Installing 
>> /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/seqaligndisplay.c
>> Installing 
>> /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/seqaligndisplay.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/sequence.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/sequencedb.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/complexevalset.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/dpenvelope.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/wiseoverlay.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/probability.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/wiseoverlay.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/sw_wrap.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/dpalign.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/alnconvert.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/histogram.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/dynlibcross.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/sw.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/protein.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/wisefile.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/probability.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/commandline.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/wisememman.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/alnrange.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/basematrix.h
>> Installing 
>> /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/complexconsensi.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/dpalign.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/wisememman.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/btcanvas.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/wisebase.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/compmat.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/wisefile.c
>> Installing 
>> /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/complexsequence.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/hscore.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/linesubs.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/wiseerror.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/wiseconfig.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/hscore.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/packaln.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/aln.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/alnconvert.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/dna.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/proteindb.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/proteinsw.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/wisestring.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/alnrange.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/sw_wrap.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/dnamatrix.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/wisetime.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/makefile
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/btcanvas.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/dnamatrix.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/codon.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/complexevalset.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/asciibtcanvas.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/compmat.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/linspc.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/linesubs.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/packaln.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/commandline.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/sequence.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/database.h
>> Installing 
>> /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/Align/libs/complexconsensi.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/HMM/hmmlib.c
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/HMM/test.pl
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/HMM/HMM.pm
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/HMM/HMM.xs
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/HMM/typemap
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/HMM/hmm.h
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/Ext/HMM/Makefile.PL
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/SeqIO/staden/test.pl
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/SeqIO/staden/read.pm
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/SeqIO/staden/read.pm.ori
>> Installing /usr/lib/perl5/site_perl/5.8.6/Bio/SeqIO/staden/Makefile.PL
>> Installing /usr/share/man/man3/Bio::SeqIO::staden::read.3pm
>> Writing
>> /usr/lib/perl5/site_perl/5.8.6/i386-linux-thread-multi/auto/Bio/.packlist
>> Appending installation info to
>> /usr/lib/perl5/5.8.6/i386-linux-thread-multi/perllocal.pod
>> 
>> 
>> 
>> --------------------------------------------------------------------
>> Jouni V?liaho, Research scientist       Phone: +358-3-215 8916
>> Institute of Medical Technology         Fax: +358-3-215 7710
>> FI-33014 University of Tampere          E-mail: jouni.valiaho@uta.fi
>> Finland                                 http://bioinf.uta.fi/
>> --------------------------------------------------------------------
>> 



From anst at kvl.dk  Sun Dec 25 03:58:00 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Sun Dec 25 03:55:43 2005
Subject: [Bioperl-l] blasting two identical seq yields only 88% identity
Message-ID: <s3ae6d37.025@gwia.kvl.dk>

Merry christmas BioPerl!

I obtained some odd result blasting a protein sequence against
a chromosome I new encoded the protein using tblastn. 
So I tested the problem by blasting the protein against a database only containing the exact same protein sequence using blastp (both files were fasta formated).
I obtained an identity of only 88% instead of 100%? A lot of X'ses were incorporated in the query sequence.

I figured that it had something to do with the database formatting so I tried several possibilities with no luck
(First I tried: formatdb -i SSD1pDB.txt -p T -o F).

I have had this problem before blasting nucleotides.
What can I do about it?

Regards Anders.


From anst at kvl.dk  Sun Dec 25 04:07:46 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Sun Dec 25 04:07:23 2005
Subject: [Bioperl-l] tblastn blastreport
Message-ID: <s3ae6f99.026@gwia.kvl.dk>

Merry christmas BioPerl!

Can it be that you can't make a tblastn blast report i.e. similar to a blastp report?

Regars Anders.

Anders Stegmann
Ph.d. student
Royal Veterinary and Agricultural University
Institute of Food Science 
Section of Food Microbiology
Rolighedsvej 30
Building 2-74
Room R074
DK-1958 Frederiksberg C
Tlf. +45 35 28 31 58


From anst at kvl.dk  Sun Dec 25 06:36:37 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Sun Dec 25 06:34:05 2005
Subject: [Bioperl-l] retrieve entry name using searchIO
Message-ID: <s3ae926b.076@gwia.kvl.dk>

Marry christmas BioPerl!

By using SearchIO I can retrieve the number of entries in my database file, but can I also retrieve each entry's header/identifier?

The thing is that I have a file containing a whole genome.That is, all chromosomes are gathered in one file. I would like to know which chromosome my query seq is hitting with when I am blasting.

Regards Anders.

From wlhsiao at yahoo.ca  Sun Dec 25 11:15:15 2005
From: wlhsiao at yahoo.ca (William Hsiao)
Date: Sun Dec 25 11:19:18 2005
Subject: [Bioperl-l] blasting two identical seq yields only 88% identity
In-Reply-To: <s3ae6d37.025@gwia.kvl.dk>
Message-ID: <20051225161515.90224.qmail@web32412.mail.mud.yahoo.com>

Hi Anders,
   This is due to BLAST's low complexity filter
(http://www.ncbi.nlm.nih.gov/blast/blast_FAQs.shtml#LCR)
which masks low complexity regions as X's.  These X's
are taken into consideration when calculating %
identity resulting in less than 100% identity for two
identical sequences.  You can turn the filter off then
you should see 100% identity.

Cheers,

Will

--- Anders Stegmann <anst@kvl.dk> wrote:

> Merry christmas BioPerl!
> 
> I obtained some odd result blasting a protein
> sequence against
> a chromosome I new encoded the protein using
> tblastn. 
> So I tested the problem by blasting the protein
> against a database only containing the exact same
> protein sequence using blastp (both files were fasta
> formated).
> I obtained an identity of only 88% instead of 100%?
> A lot of X'ses were incorporated in the query
> sequence.
> 
> I figured that it had something to do with the
> database formatting so I tried several possibilities
> with no luck
> (First I tried: formatdb -i SSD1pDB.txt -p T -o F).
> 
> I have had this problem before blasting nucleotides.
> What can I do about it?
> 
> Regards Anders.
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
>
http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 



	

	
		
__________________________________________________________ 
Find your next car at http://autos.yahoo.ca
From wlhsiao at yahoo.ca  Sun Dec 25 11:15:16 2005
From: wlhsiao at yahoo.ca (William Hsiao)
Date: Sun Dec 25 11:19:44 2005
Subject: [Bioperl-l] blasting two identical seq yields only 88% identity
In-Reply-To: <s3ae6d37.025@gwia.kvl.dk>
Message-ID: <20051225161516.46940.qmail@web32408.mail.mud.yahoo.com>

Hi Anders,
   This is due to BLAST's low complexity filter
(http://www.ncbi.nlm.nih.gov/blast/blast_FAQs.shtml#LCR)
which masks low complexity regions as X's.  These X's
are taken into consideration when calculating %
identity resulting in less than 100% identity for two
identical sequences.  You can turn the filter off then
you should see 100% identity.

Cheers,

Will

--- Anders Stegmann <anst@kvl.dk> wrote:

> Merry christmas BioPerl!
> 
> I obtained some odd result blasting a protein
> sequence against
> a chromosome I new encoded the protein using
> tblastn. 
> So I tested the problem by blasting the protein
> against a database only containing the exact same
> protein sequence using blastp (both files were fasta
> formated).
> I obtained an identity of only 88% instead of 100%?
> A lot of X'ses were incorporated in the query
> sequence.
> 
> I figured that it had something to do with the
> database formatting so I tried several possibilities
> with no luck
> (First I tried: formatdb -i SSD1pDB.txt -p T -o F).
> 
> I have had this problem before blasting nucleotides.
> What can I do about it?
> 
> Regards Anders.
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
>
http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 



	

	
		
__________________________________________________________ 
Find your next car at http://autos.yahoo.ca
From jbedell at oriongenomics.com  Sun Dec 25 11:12:42 2005
From: jbedell at oriongenomics.com (Joseph Bedell)
Date: Sun Dec 25 11:23:39 2005
Subject: [Bioperl-l] blasting two identical seq yields only 88% identity
Message-ID: <434AF352F9D03C4C896782B8CC78BC76A23DC3@VADER.oriongenomics.com>

Hi Anders,

What you are seeing is probably low complexity filtering. By default,
NCBI-BLAST filters for low complexity sequence (the X's that you see in
the alignments). To turn it off, you need to specify -F F on the command
line.

Joey


>-----Original Message-----
>From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-
>bounces@portal.open-bio.org] On Behalf Of Anders Stegmann
>Sent: Sunday, December 25, 2005 2:58 AM
>To: bioperl-l@bioperl.org
>Subject: [Bioperl-l] blasting two identical seq yields only 88%
identity
>
>Merry christmas BioPerl!
>
>I obtained some odd result blasting a protein sequence against
>a chromosome I new encoded the protein using tblastn.
>So I tested the problem by blasting the protein against a database only
>containing the exact same protein sequence using blastp (both files
were
>fasta formated).
>I obtained an identity of only 88% instead of 100%? A lot of X'ses were
>incorporated in the query sequence.
>
>I figured that it had something to do with the database formatting so I
>tried several possibilities with no luck
>(First I tried: formatdb -i SSD1pDB.txt -p T -o F).
>
>I have had this problem before blasting nucleotides.
>What can I do about it?
>
>Regards Anders.
>
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l

From anst at kvl.dk  Sun Dec 25 14:41:04 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Sun Dec 25 14:38:49 2005
Subject: Svar: RE: [Bioperl-l] blasting two identical seq yields only
	88% identity
Message-ID: <s3af0406.011@gwia.kvl.dk>

All of you thanks for replying!

Because I am using Bio::Tools::Run::StandAloneBlast inside a script (I mised this in my mail) I can't change -F by going -F F. I found out that in order to change -F->F I just had to give the @params an extra F=>'F' argument. -F=>'F' won't work inside the @params though, but you got me on the right track.

Anders.

>>> "Joseph Bedell" <jbedell@oriongenomics.com> 25-12-05 17:12 >>>
Hi Anders,

What you are seeing is probably low complexity filtering. By default,
NCBI-BLAST filters for low complexity sequence (the X's that you see in
the alignments). To turn it off, you need to specify -F F on the command
line.

Joey


>-----Original Message-----
>From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-
>bounces@portal.open-bio.org] On Behalf Of Anders Stegmann
>Sent: Sunday, December 25, 2005 2:58 AM
>To: bioperl-l@bioperl.org
>Subject: [Bioperl-l] blasting two identical seq yields only 88%
identity
>
>Merry christmas BioPerl!
>
>I obtained some odd result blasting a protein sequence against
>a chromosome I new encoded the protein using tblastn.
>So I tested the problem by blasting the protein against a database only
>containing the exact same protein sequence using blastp (both files
were
>fasta formated).
>I obtained an identity of only 88% instead of 100%? A lot of X'ses were
>incorporated in the query sequence.
>
>I figured that it had something to do with the database formatting so I
>tried several possibilities with no luck
>(First I tried: formatdb -i SSD1pDB.txt -p T -o F).
>
>I have had this problem before blasting nucleotides.
>What can I do about it?
>
>Regards Anders.
>
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l

_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l



From osborne1 at optonline.net  Sun Dec 25 15:07:22 2005
From: osborne1 at optonline.net (Brian Osborne)
Date: Sun Dec 25 15:09:17 2005
Subject: [Bioperl-l] retrieve entry name using searchIO
In-Reply-To: <s3ae926b.076@gwia.kvl.dk>
Message-ID: <BFD4662A.68D6%osborne1@optonline.net>

Anders, 

It sounds like you want Hit's description() method. See the
Feature-Annotation HOWTO:

http://bioperl.org/HOWTOs/html/SearchIO.html


Brian O.


On 12/25/05 6:36 AM, "Anders Stegmann" <anst@kvl.dk> wrote:

> Marry christmas BioPerl!
> 
> By using SearchIO I can retrieve the number of entries in my database file,
> but can I also retrieve each entry's header/identifier?
> 
> The thing is that I have a file containing a whole genome.That is, all
> chromosomes are gathered in one file. I would like to know which chromosome my
> query seq is hitting with when I am blasting.
> 
> Regards Anders.
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From anst at kvl.dk  Sun Dec 25 18:32:11 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Sun Dec 25 18:30:37 2005
Subject: Svar: Re: [Bioperl-l] retrieve entry name using searchIO
Message-ID: <s3af3a33.000@gwia.kvl.dk>

Brian,

Exactly, thanks!

Anders.

Anders Stegmann
Ph.d. student
Royal Veterinary and Agricultural University
Institute of Food Science 
Section of Food Microbiology
Rolighedsvej 30
Building 2-74
Room R074
DK-1958 Frederiksberg C
Tlf. +45 35 28 31 58

>>> Brian Osborne <osborne1@optonline.net> 25-12-05 21:07 >>>
Anders, 

It sounds like you want Hit's description() method. See the
Feature-Annotation HOWTO:

http://bioperl.org/HOWTOs/html/SearchIO.html


Brian O.


On 12/25/05 6:36 AM, "Anders Stegmann" <anst@kvl.dk> wrote:

> Marry christmas BioPerl!
> 
> By using SearchIO I can retrieve the number of entries in my database file,
> but can I also retrieve each entry's header/identifier?
> 
> The thing is that I have a file containing a whole genome.That is, all
> chromosomes are gathered in one file. I would like to know which chromosome my
> query seq is hitting with when I am blasting.
> 
> Regards Anders.
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l



From anst at kvl.dk  Mon Dec 26 04:19:03 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Mon Dec 26 04:16:58 2005
Subject: [Bioperl-l] seq_inds with the conserved argument prints all residues
Message-ID: <s3afc3c2.095@gwia.kvl.dk>

Bioperl,

I am trying to print out the positions of the residues that are conserved between the two proteins I am blasting against each other.

This subrutine prints out all residue positions in the query seq that are conserved and identical?? between the compared seq's:


sub query_seq_alignment_conserved_residues {		

	my ($hsp_obj) = @_;
	
	my @query_string = split "", $$hsp_obj->query_string;

	print "protein conserved positions in query sequence are:","\n";

	foreach ($$hsp_obj->seq_inds('query', 'conserved')) {

		print $_, "\n";

		#push my @conserved, $query_string[$_ -1];

	}

}	


According to Bio::Search HOWTO, it should only print out i.e. a S->A substitution position.

As the following subrutine works, it should not be the subrutine code that is wrong:

sub query_seq_alignment_nomatch_residues {		

	my ($hsp_obj) = @_;
	
	my @query_string = split "", $$hsp_obj->query_string;

	print "protein mismatch positions i query seq are:","\n";

	foreach ($$hsp_obj->seq_inds('query', 'nomatch')) {

		print $_, "\n";

		#push my @nomatch, $query_string[$_ -1];

	}

}	

It prints out the one nomatch position I have made in the seq. As you can see, the query_seq_alignment_conserved_residues subrutine is a copy of the query_seq_alignment_nomatch_residues with a few modifications. 

What's wrong?

Regards Anders.

From Marc.Logghe at DEVGEN.com  Mon Dec 26 05:40:32 2005
From: Marc.Logghe at DEVGEN.com (Marc Logghe)
Date: Mon Dec 26 05:41:36 2005
Subject: [Bioperl-l] blasting two identical seq yields only 88% identity
Message-ID: <0C528E3670D8CE4B8E013F6749231AA607D956@ANTARESIA.be.devgen.com>

Hi Anders,
This has to do with filtering of low complexity regions (see http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/more3.html#Filtering). This is done by default so you have explicitely to turn it off using the blastall option -FF.
HTH,
Marc


-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org on behalf of Anders Stegmann
Sent: Sun 12/25/2005 9:58 AM
To: bioperl-l@bioperl.org
Subject: [Bioperl-l] blasting two identical seq yields only 88% identity
 
Merry christmas BioPerl!

I obtained some odd result blasting a protein sequence against
a chromosome I new encoded the protein using tblastn. 
So I tested the problem by blasting the protein against a database only containing the exact same protein sequence using blastp (both files were fasta formated).
I obtained an identity of only 88% instead of 100%? A lot of X'ses were incorporated in the query sequence.

I figured that it had something to do with the database formatting so I tried several possibilities with no luck
(First I tried: formatdb -i SSD1pDB.txt -p T -o F).

I have had this problem before blasting nucleotides.
What can I do about it?

Regards Anders.


_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From anst at kvl.dk  Tue Dec 27 17:15:52 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Tue Dec 27 17:13:03 2005
Subject: [Bioperl-l] tblastn, retrieving no match Aa from subject string 
Message-ID: <s3b1cb37.073@gwia.kvl.dk>

Hi!

I am blasting a protein seq against a chromosome by using tblastn in a bioperl script.

my protein seq is 1250 Aa corresponding to 3750 nt.
by doing:

 $hsp->start('hit')     I get 1045637
 $hsp->end('hit')       I get 1049386

which is okay.


by doing: 

 foreach ($hsp_obj->seq_inds('query', 'nomatch')) {

		print $_, "\n";

 }

I get 2, which okay because I made a Aa substitution in the query seq at position two.

but when I go:

 foreach ($hsp_obj->seq_inds('hit', 'nomatch')) {

		print $_, "\n";

 }

I get 349793 which I can't explain.
what is this number telling me?
According to the Bio::SearchIO HOWTO I should get the position of the not matching Aa the subject DNA seq. I guess that because I am using tblastn I get the position of a nucleotide in the codon of the not matching Aa, but that doesn't correspond to start and end positions written above.

The easiest way out of this would be if I somehow could retrieve the not matching Aa position from the translated protein hit string. As I can when two proteins are blasted agsinst each other.
does anybody know how? 
(note: as the script works when two proteins are blasted against each other the code should be okay)

Regards Anders.

From valiente at lsi.upc.edu  Wed Dec 28 07:27:13 2005
From: valiente at lsi.upc.edu (Gabriel Valiente)
Date: Wed Dec 28 07:31:08 2005
Subject: [Bioperl-l] Re: Test writing
In-Reply-To: <200512211211.jBLCBE8U012524@portal.open-bio.org>
References: <200512211211.jBLCBE8U012524@portal.open-bio.org>
Message-ID: <43B284A1.1000708@lsi.upc.edu>

Sorry about the delay, I've promised to write test files for 
Bio::Tree::Draw::Cladogram and Bio::Tree::Compatible much earlier.

I've just submitted t/Compatible.t, a test file for 
Bio::Tree::Compatible. There are five simple tests, two of which are 
commented out because they need an equality test for Bio::Tree::Tree 
objects, which is missing. Any volunteer for writing a tree equality 
test? Jason?

Regarding the test file for Bio::Tree::Draw::Cladogram, I just don't 
know what to include in the test. The only thing this module does is to 
produce a EPS file, and the only thing that comes to my mind is to test 
equality of a precomputed EPS file and one produced on the fly for the 
same input tree. Any suggestions are welcome.

By the way, can anybody briefly explain why is it necessary to include 
prefixes like

my $common = $t1->Bio::Tree::Compatible::common_labels($t2);

in t/Compatible.t, which already uses Bio::Tree::Compatible, instead of just

my $common = $t1->common_labels($t2);

???

Thanks,

Gabriel Valiente

>This message is for module authors and for anyone looking for something to do 
>for BioPerl. 
>
>
>I've modified the 'maintenance/modules.pl --untested' code so that it reads in 
>all test files, extracts 'use'd or 'required' Bio classes, now *recursively* 
>marks all super classes and 'use'd classes as tested. In addition, I manually 
>ignore all Bio::Search and Bio::SearchIO classes. That is because although 
>there are extensive tests for modules in these name spaces, new classes are 
>instantiated based on attributes to the constructor. This might be true to 
>other classes, too. If this is the case, I can see two possible actions: 
>
>
>1. Add them to the list of ignored class names at the end of function 
>'untested' in the script. 
>
>
>2. If the classes are never called directly, rename them to start with lower 
>case letter which by convention means that they are "component classes" like 
>Bio::SeqIO::genbank. 
>
>
>
>All other classes should have tests written for them or - ultimately - removed 
>from the repository. 
>
>
>The aim of this exercise is to come up with a first pass list of BioPerl 
>classes that do not have any tests written for them and get them written. The 
>next pass will be to find untested methods within classes. 
>
>
>
>When writing tests, please follow conventions in existing files and remember 
>to test all public methods. If you do not have a cvs login, post the new 
>tests to bugzilla.bioperl.org, not to the list. We are more than happy to 
>give cvs access to anyone committing more than a couple new tests. 
>
>
>       -Heikki
>
>
>List of BioPerl classes needing tests:
>
>Bio::Align::Utilities
>Bio::Annotation::AnnotationFactory
>Bio::Annotation::Target
>Bio::DB::Ace
>Bio::DB::Expression
>Bio::DB::Fasta::Stream
>Bio::DB::Flat::BDB
>Bio::DB::Flat::BinarySearch
>Bio::DB::GFF::ID_Iterator
>Bio::DB::Universal
>Bio::DB::XEMBLService
>Bio::Expression::Contact
>Bio::Expression::DataSet
>Bio::Expression::FeatureGroup
>Bio::Expression::FeatureGroup::FeatureGroupMas50
>Bio::Expression::FeatureSet::FeatureSetMas50
>Bio::Expression::Platform
>Bio::Expression::Sample
>Bio::FeatureIO
>Bio::Graphics::FeatureFile::Iterator
>Bio::Graphics::Glyph
>Bio::Graphics::Util
>Bio::Index::Fastq
>Bio::Index::Hmmer
>Bio::LiveSeq::IO::SRS
>Bio::Location::AvWithinCoordPolicy
>Bio::Location::NarrowestCoordPolicy
>Bio::Map::Clone
>Bio::Map::Contig
>Bio::Map::FPCMarker
>Bio::Map::OrderedPositionWithDistance
>Bio::Map::Physical
>Bio::Matrix::PSM::Psm
>Bio::Matrix::PSM::PsmHeader
>Bio::Matrix::Scoring
>Bio::Ontology::InterProTerm
>Bio::Ontology::Path
>Bio::Ontology::SimpleGOEngine
>Bio::OntologyIO::Handlers::InterProHandler
>Bio::OntologyIO::Handlers::InterPro_BioSQL_Handler
>Bio::OntologyIO::InterProParser
>Bio::PrimarySeq::Fasta
>Bio::Root::Err
>Bio::Root::Global
>Bio::Root::IOManager
>Bio::Root::Utilities
>Bio::Root::Vector
>Bio::Root::Xref
>Bio::SeqFeature::Gene::Promoter
>Bio::SeqFeature::PositionProxy
>Bio::SeqFeature::Tools::FeatureNamer
>Bio::SeqFeature::Tools::IDHandler
>Bio::SeqFeature::Tools::TypeMapper
>Bio::SeqIO::FTHelper
>Bio::Structure::SecStr::DSSP::Res
>Bio::Structure::SecStr::STRIDE::Res
>Bio::Taxonomy
>Bio::Taxonomy::Taxon
>Bio::Taxonomy::Tree
>Bio::Tools::AlignFactory
>Bio::Tools::Blast::HSP
>Bio::Tools::Blast::HTML
>Bio::Tools::Blast::Sbjct
>Bio::Tools::Blat
>Bio::Tools::Coil
>Bio::Tools::ESTScan
>Bio::Tools::Eponine
>Bio::Tools::Fgenesh
>Bio::Tools::Gel
>Bio::Tools::Grail
>Bio::Tools::HMM
>Bio::Tools::Hmmpfam
>Bio::Tools::Primer::Feature
>Bio::Tools::Primer::Pair
>Bio::Tools::Prints
>Bio::Tools::Profile
>Bio::Tools::PrositeScan
>Bio::Tools::Run::GenericParameters
>Bio::Tools::Seg
>Bio::Tools::Signalp
>Bio::Tools::Tmhmm
>Bio::Tools::WWW
>Bio::Tools::WebBlat
>Bio::Tree::Compatible
>Bio::Tree::Draw::Cladogram
>Bio::Tree::NodeNHX
>FeatureStore  # in Bio::DB::GFF::Adaptor::berkeleydb.pm
>interpro   # class defined in Bio::SeqIO::interpro, mistake?
>
From hlapp at gmx.net  Wed Dec 28 12:39:15 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Wed Dec 28 12:36:21 2005
Subject: [Bioperl-l] Re: Test writing
In-Reply-To: <43B284A1.1000708@lsi.upc.edu>
References: <200512211211.jBLCBE8U012524@portal.open-bio.org>
	<43B284A1.1000708@lsi.upc.edu>
Message-ID: <b46794fb8d54028ff8dba80153aff1e7@gmx.net>


On Dec 28, 2005, at 4:27 AM, Gabriel Valiente wrote:

> Regarding the test file for Bio::Tree::Draw::Cladogram, I just don't 
> know what to include in the test. The only thing this module does is 
> to produce a EPS file, and the only thing that comes to my mind is to 
> test equality of a precomputed EPS file and one produced on the fly 
> for the same input tree. Any suggestions are welcome.

If you can't read that file back in then yes I suppose all you can do 
is test for equality with a precomputed file. If the EPS is essentially 
an image though (as opposed to a vector graphics) then note the 
troubles that Lincoln had to go through for testing Bio::Graphics 
output because many systems (depending primarily on GD library version 
I guess) lead to correct but binary-wise slightly different image 
files. If you're in a similar situation then be prepared for asking 
people who see the test fail on their platform to send to you the file 
that's produced on their system so that you can adjust the test.

>
> By the way, can anybody briefly explain why is it necessary to include 
> prefixes like
>
> my $common = $t1->Bio::Tree::Compatible::common_labels($t2);

I don't know why you would want to do that if $t1 is already a 
Bio::Tree::Compatible instance (or the module name as a string will do 
fine too).

	-hilmar

>
> in t/Compatible.t, which already uses Bio::Tree::Compatible, instead 
> of just
>
> my $common = $t1->common_labels($t2);
>
> ???
>
> Thanks,
>
> Gabriel Valiente
>
>> This message is for module authors and for anyone looking for 
>> something to do for BioPerl.
>>
>> I've modified the 'maintenance/modules.pl --untested' code so that it 
>> reads in all test files, extracts 'use'd or 'required' Bio classes, 
>> now *recursively* marks all super classes and 'use'd classes as 
>> tested. In addition, I manually ignore all Bio::Search and 
>> Bio::SearchIO classes. That is because although there are extensive 
>> tests for modules in these name spaces, new classes are instantiated 
>> based on attributes to the constructor. This might be true to other 
>> classes, too. If this is the case, I can see two possible actions:
>>
>> 1. Add them to the list of ignored class names at the end of function 
>> 'untested' in the script.
>>
>> 2. If the classes are never called directly, rename them to start 
>> with lower case letter which by convention means that they are 
>> "component classes" like Bio::SeqIO::genbank.
>>
>>
>> All other classes should have tests written for them or - ultimately 
>> - removed from the repository.
>>
>> The aim of this exercise is to come up with a first pass list of 
>> BioPerl classes that do not have any tests written for them and get 
>> them written. The next pass will be to find untested methods within 
>> classes.
>>
>>
>> When writing tests, please follow conventions in existing files and 
>> remember to test all public methods. If you do not have a cvs login, 
>> post the new tests to bugzilla.bioperl.org, not to the list. We are 
>> more than happy to give cvs access to anyone committing more than a 
>> couple new tests.
>>
>>       -Heikki
>>
>>
>> List of BioPerl classes needing tests:
>>
>> Bio::Align::Utilities
>> Bio::Annotation::AnnotationFactory
>> Bio::Annotation::Target
>> Bio::DB::Ace
>> Bio::DB::Expression
>> Bio::DB::Fasta::Stream
>> Bio::DB::Flat::BDB
>> Bio::DB::Flat::BinarySearch
>> Bio::DB::GFF::ID_Iterator
>> Bio::DB::Universal
>> Bio::DB::XEMBLService
>> Bio::Expression::Contact
>> Bio::Expression::DataSet
>> Bio::Expression::FeatureGroup
>> Bio::Expression::FeatureGroup::FeatureGroupMas50
>> Bio::Expression::FeatureSet::FeatureSetMas50
>> Bio::Expression::Platform
>> Bio::Expression::Sample
>> Bio::FeatureIO
>> Bio::Graphics::FeatureFile::Iterator
>> Bio::Graphics::Glyph
>> Bio::Graphics::Util
>> Bio::Index::Fastq
>> Bio::Index::Hmmer
>> Bio::LiveSeq::IO::SRS
>> Bio::Location::AvWithinCoordPolicy
>> Bio::Location::NarrowestCoordPolicy
>> Bio::Map::Clone
>> Bio::Map::Contig
>> Bio::Map::FPCMarker
>> Bio::Map::OrderedPositionWithDistance
>> Bio::Map::Physical
>> Bio::Matrix::PSM::Psm
>> Bio::Matrix::PSM::PsmHeader
>> Bio::Matrix::Scoring
>> Bio::Ontology::InterProTerm
>> Bio::Ontology::Path
>> Bio::Ontology::SimpleGOEngine
>> Bio::OntologyIO::Handlers::InterProHandler
>> Bio::OntologyIO::Handlers::InterPro_BioSQL_Handler
>> Bio::OntologyIO::InterProParser
>> Bio::PrimarySeq::Fasta
>> Bio::Root::Err
>> Bio::Root::Global
>> Bio::Root::IOManager
>> Bio::Root::Utilities
>> Bio::Root::Vector
>> Bio::Root::Xref
>> Bio::SeqFeature::Gene::Promoter
>> Bio::SeqFeature::PositionProxy
>> Bio::SeqFeature::Tools::FeatureNamer
>> Bio::SeqFeature::Tools::IDHandler
>> Bio::SeqFeature::Tools::TypeMapper
>> Bio::SeqIO::FTHelper
>> Bio::Structure::SecStr::DSSP::Res
>> Bio::Structure::SecStr::STRIDE::Res
>> Bio::Taxonomy
>> Bio::Taxonomy::Taxon
>> Bio::Taxonomy::Tree
>> Bio::Tools::AlignFactory
>> Bio::Tools::Blast::HSP
>> Bio::Tools::Blast::HTML
>> Bio::Tools::Blast::Sbjct
>> Bio::Tools::Blat
>> Bio::Tools::Coil
>> Bio::Tools::ESTScan
>> Bio::Tools::Eponine
>> Bio::Tools::Fgenesh
>> Bio::Tools::Gel
>> Bio::Tools::Grail
>> Bio::Tools::HMM
>> Bio::Tools::Hmmpfam
>> Bio::Tools::Primer::Feature
>> Bio::Tools::Primer::Pair
>> Bio::Tools::Prints
>> Bio::Tools::Profile
>> Bio::Tools::PrositeScan
>> Bio::Tools::Run::GenericParameters
>> Bio::Tools::Seg
>> Bio::Tools::Signalp
>> Bio::Tools::Tmhmm
>> Bio::Tools::WWW
>> Bio::Tools::WebBlat
>> Bio::Tree::Compatible
>> Bio::Tree::Draw::Cladogram
>> Bio::Tree::NodeNHX
>> FeatureStore  # in Bio::DB::GFF::Adaptor::berkeleydb.pm
>> interpro   # class defined in Bio::SeqIO::interpro, mistake?
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From anst at kvl.dk  Wed Dec 28 13:08:32 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Wed Dec 28 13:05:44 2005
Subject: Svar: Re: [Bioperl-l] tblastn, retrieving no match Aa from
	subject string
Message-ID: <s3b2e2c1.035@gwia.kvl.dk>

Thanks again, it helped!

I have two related questions:

1) how can I tell if my translated protein is a reverse complement derived from a gene on the opposite chromosome strand? 

2) why do I get the position and type of the substituted Aa when I blast the protein against its own gene seq, when I only get a position when it is blasted against a chromosome seq? (just out of curiousity)

Anders.


>>> Brian Osborne <osborne1@optonline.net> 27-12-05 23:52 >>>
Anders,

First, think about 3 * 349793...


Brian O.


On 12/27/05 5:15 PM, "Anders Stegmann" <anst@kvl.dk> wrote:

> I get 349793 which I can't explain.
> what is this number telling me?





From jason.stajich at duke.edu  Wed Dec 28 13:17:15 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Wed Dec 28 13:14:07 2005
Subject: Svar: Re: [Bioperl-l] tblastn,
	retrieving no match Aa from subject string
In-Reply-To: <s3b2e2c1.035@gwia.kvl.dk>
References: <s3b2e2c1.035@gwia.kvl.dk>
Message-ID: <A9383B46-35B7-4F27-9BC7-9029C11CD2CD@duke.edu>


On Dec 28, 2005, at 1:08 PM, Anders Stegmann wrote:

> Thanks again, it helped!
>
> I have two related questions:
>
> 1) how can I tell if my translated protein is a reverse complement  
> derived from a gene on the opposite chromosome strand?
>
$hsp->hit->strand  or $hsp->strand('hit)
> 2) why do I get the position and type of the substituted Aa when I  
> blast the protein against its own gene seq, when I only get a  
> position when it is blasted against a chromosome seq? (just out of  
> curiousity)
>
I don't understand what you mean at all, concrete data example would  
be more helpful.
> Anders.
>
>
>>>> Brian Osborne <osborne1@optonline.net> 27-12-05 23:52 >>>
> Anders,
>
> First, think about 3 * 349793...
>
>
> Brian O.
>
>
> On 12/27/05 5:15 PM, "Anders Stegmann" <anst@kvl.dk> wrote:
>
>> I get 349793 which I can't explain.
>> what is this number telling me?
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12/


From anst at kvl.dk  Wed Dec 28 15:01:55 2005
From: anst at kvl.dk (Anders Stegmann)
Date: Wed Dec 28 14:58:55 2005
Subject: Svar: Re: Svar: Re: [Bioperl-l] tblastn, retrieving no match
	Aa from subject string
Message-ID: <s3b2fd4e.012@gwia.kvl.dk>

Thanks for replying Jason!

I simply tblastn a protein seq against a chromosome and parse the blast result. the program I am making is supposed to tell me if there is a mutation or not that results in an Aa substitution.

When testing the program I tblastn an orf translated protein seq (which gene is found on chr4) against a downloaded and formated chr4 seq with standaloneblast. the program then tells me that there is a 100% identity between the protein seq and chromosome encoding protein seq.

then I made a Aa substitution (E->Y) at position 2 in the protein seq.
when I tblastn this protein seq against the chr4 seq I get a number like: 349793
because of the: 

foreach ($hsp_obj->seq_inds('hit', 'nomatch')) {

		print $_, "\n";

}

code.

by 3*349793 I get the position on chr4 that (nearly) corresponds to the start of the codon that encodes the substituted Aa. 

BUT, when I download and format only the gene seq (3750 nt) of the protein (1250 Aa) and use it as a database to which the protein is tblastn against, the scipt gives me the number 2.
Thus, now the scipt gives the Aa position of the substitution instead of the nucleotide codon position.
(it also returns the right Aa (E)that corresponds to the position in the protein)

this is strange!
howcome? 

Anders.

Anders Stegmann
Ph.d. student
Royal Veterinary and Agricultural University
Institute of Food Science 
Section of Food Microbiology
Rolighedsvej 30
Building 2-74
Room R074
DK-1958 Frederiksberg C
Tlf. +45 35 28 31 58

>>> Jason Stajich <jason.stajich@duke.edu> 28-12-05 19:17 >>>

On Dec 28, 2005, at 1:08 PM, Anders Stegmann wrote:

> Thanks again, it helped!
>
> I have two related questions:
>
> 1) how can I tell if my translated protein is a reverse complement  
> derived from a gene on the opposite chromosome strand?
>
$hsp->hit->strand  or $hsp->strand('hit)
> 2) why do I get the position and type of the substituted Aa when I  
> blast the protein against its own gene seq, when I only get a  
> position when it is blasted against a chromosome seq? (just out of  
> curiousity)
>
I don't understand what you mean at all, concrete data example would  
be more helpful.
> Anders.
>
>
>>>> Brian Osborne <osborne1@optonline.net> 27-12-05 23:52 >>>
> Anders,
>
> First, think about 3 * 349793...
>
>
> Brian O.
>
>
> On 12/27/05 5:15 PM, "Anders Stegmann" <anst@kvl.dk> wrote:
>
>> I get 349793 which I can't explain.
>> what is this number telling me?
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12/


_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l



From akarger at CGR.Harvard.edu  Fri Dec 23 11:24:17 2005
From: akarger at CGR.Harvard.edu (Amir Karger)
Date: Wed Dec 28 16:58:18 2005
Subject: [Bioperl-l] blast output -> blast -m8 output
Message-ID: <339D68B133EAD311971E009027DC479703DB3B5A@montecarlo.cgr.harvard.edu>

I'm writing a script that will take regular blast output and translate it to
blast -m8 tabular form. (The reverse transform won't work without re-doing
the alignments.)
I've attached the blast output for running 3 sequences against month.aa.
Below are the script, the script output, and the blast -m8 output. (Output
is the same for bioperl-1.4 and 1.5-RC1.)

So there are two questions:

1) To get the number of openings, I count /-+/g in $hsp->query_string .
$hsp->hit_string. Is this really the best way to do it? (A $hsp->ngaps
method would be nicer :) 
2) Why does blast -m8 use longer IDs than regular blast? (See second column)
I guess this is an NCBI question, really. Other than the difference in IDs
and a couple space characters, the two outputs are the same.
3) Do you think this will work on all blast outputs, or will something
break?

Thanks,
-Amir Karger
---------
Here's the script:
#!/usr/local/bin/perl -w

use strict;

use Bio::SearchIO;

my $in = new Bio::SearchIO(-format => 'blast', -file => $ARGV[0]);
while (my $result = $in->next_result ) {
    while (my $hit = $result->next_hit ) {
        while (my $hsp = $hit->next_hsp ) {
            my $pcid = $hsp->percent_identity;
            my $len = $hsp->length('total');
            my $mismatches = $len - $hsp->num_identical -
$hsp->gaps('total');
            # Find runs of '-' in query, hit strings
            my @gap_list = (($hsp->query_string . $hsp->hit_string) =~
/-+/g);
            my $ngaps = @gap_list;
            my @fields = (
                $result->query_name, $hit->name, sprintf("%.2f",$pcid),
                $len, $mismatches, $ngaps,
                $hsp->start('query'), $hsp->end('query'),
                $hsp->start('hit'), $hsp->end('hit'),
                $hsp->evalue, $hsp->bits
            );
            print join("\t", @fields), "\n";
        }
    }
}

----------
Here's the output from running perl change_blast_to_tab.pl seqs.blp

Bacteriophage_1[M19348] ref|NP_037061.1|        40.32   62      33      1
28      89      1050    1107    6e-05   46.6
Bacteriophage_1[M19348] ref|XP_193814.5|        48.89   45      17      1
57      95      320     364     0.001   42.7
Bacteriophage_1[M19348] ref|XP_912463.1|        48.89   45      17      1
57      95      866     910     0.001   42.7
Bacteriophage_1[M19348] ref|XP_619329.2|        48.89   45      17      1
57      95      676     720     0.001   42.7
C.elegans_1_[Z49071]    ref|XP_917828.1|        29.61   412     242     9
40      410     52      456     6e-43   173
C.elegans_1_[Z49071]    gb|AAI10184.1|  31.99   347     213     11      40
373     53      389     6e-42   169

-----------
Here's the -m8 output.

Bacteriophage_1[M19348] gi|6978677|ref|NP_037061.1|     40.32   62      33
1       28      89      1050    1107    6e-05   46.6
Bacteriophage_1[M19348] gi|82958039|ref|XP_193814.5|    48.89   45      17
1       57      95      320     364     0.001   42.7
Bacteriophage_1[M19348] gi|82958037|ref|XP_912463.1|    48.89   45      17
1       57      95      866     910     0.001   42.7
Bacteriophage_1[M19348] gi|82957449|ref|XP_619329.2|    48.89   45      17
1       57      95      676     720     0.001   42.7
C.elegans_1_[Z49071]    gi|82802536|ref|XP_917828.1|    29.61   412     242
9       40      410     52      456     6e-43    173
C.elegans_1_[Z49071]    gi|82571607|gb|AAI10184.1|      31.99   347     213
11      40      373     53      389     6e-42    169

-------------- next part --------------
A non-text attachment was scrubbed...
Name: seqs.blp
Type: application/octet-stream
Size: 10400 bytes
Desc: not available
Url : http://portal.open-bio.org/pipermail/bioperl-l/attachments/20051223/a95c381f/seqs-0001.obj
From hlapp at gmx.net  Thu Dec 29 12:48:43 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu Dec 29 12:45:59 2005
Subject: [Bioperl-l] Re: Test writing
In-Reply-To: <43B3DC72.4070405@lsi.upc.edu>
References: <200512211211.jBLCBE8U012524@portal.open-bio.org>
	<43B284A1.1000708@lsi.upc.edu>
	<b46794fb8d54028ff8dba80153aff1e7@gmx.net>
	<43B3DC72.4070405@lsi.upc.edu>
Message-ID: <a43625305d9f8333e9bdefbbebf38006@gmx.net>


On Dec 29, 2005, at 4:54 AM, Gabriel Valiente wrote:

> Thanks a lot.
>
>>> By the way, can anybody briefly explain why is it necessary to 
>>> include prefixes like
>>>
>>> my $common = $t1->Bio::Tree::Compatible::common_labels($t2);
>>
>> I don't know why you would want to do that if $t1 is already a 
>> Bio::Tree::Compatible instance (or the module name as a string will 
>> do fine too).
>
> I see. The problem is that $t1 is not a Bio::Tree::Compatible instance 
> but a Bio::Tree::Tree instance.

Then why do you use the $t1-> notation to start with? You'd instead 
write

	my $common = Bio::Tree::Compatible->common_labels($t2);

>
> Perhaps the usual workaround in these situations is to add a dummy 
> Bio::Tree::Compatible->new method, that falls back on the 
> Bio::Tree::Tree->new method. The advantage would be to allow for a 
> more concise use of the Bio::Tree::Compatible methods.

If Bio::Tree::Compatible inherits from Bio::Tree::Tree then you don't 
need to implement new() unless you have some special setup to do during 
initialization. If you don't inherit from it, then do not fall back on 
some other class' new() method() either - otherwise at best you'll 
confuse perl or yourself about the inheritance structure.

Hth,

	-hilmar

BTW Please keep threads on the list. There are hundreds of people who 
might be able to help you.

>
> Please let me know what you think.
>
> Gabriel
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From angshu96 at gmail.com  Thu Dec 29 17:50:29 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Thu Dec 29 18:13:36 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
Message-ID: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>

Hi,

I'm getting the following error while trying to run :

./load_seqdatabase.pl -host localhost -dbname USBA -dbuser postgres -format
genbank NC_003076.gbk

Loading NC_003076.gbk ...

------------- EXCEPTION  -------------
MSG: failed to open connection: Can't connect to local MySQL server through
socket '/var/lib/mysql/mysql.sock' (2)
STACK Bio::DB::DBI::base::new_connection /home/akar/local/perl/Bio/DB/D
BI/base.pm:255
STACK Bio::DB::DBI::base::get_connection /home/akar/local/perl/Bio/DB/D
BI/base.pm:215
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::dbh
/home/akar/local/perl/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:1477
STACK Bio::DB::BioSQL::BasePersistenceAdaptor::rollback
/home/akar/local/perl/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:1396
STACK toplevel ./load_seqdatabase.pl:627

But I've a postgreSQL db and not a MySQL one...could anyone please guide me
troubleshoot this?

Thanks,
Angshu

From torsten.seemann at infotech.monash.edu.au  Thu Dec 29 20:26:48 2005
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Thu Dec 29 20:23:44 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
Message-ID: <43B48CD8.5090402@infotech.monash.edu.au>

> I'm getting the following error while trying to run :
> ./load_seqdatabase.pl -host localhost -dbname USBA -dbuser postgres -format
> genbank NC_003076.gbk
> MSG: failed to open connection: Can't connect to local MySQL server through
> socket '/var/lib/mysql/mysql.sock' (2)
> But I've a postgreSQL db and not a MySQL one...could anyone please guide me
> troubleshoot this?

Did you read the documentation for the load_seqdatabase.pl script?

It's in the script itself!

    =item --driver $driver
    the DBI driver name for the RDBMS e.g., mysql, Pg, or Oracle [mysql]

The default DBI driver is [mysql].

I think you want the option "-driver Pg".

-- 
Torsten Seemann
Victorian Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/
From torsten.seemann at infotech.monash.edu.au  Thu Dec 29 20:30:32 2005
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Thu Dec 29 20:27:24 2005
Subject: [Bioperl-l] blast output -> blast -m8 output
In-Reply-To: <339D68B133EAD311971E009027DC479703DB3B5A@montecarlo.cgr.harvard.edu>
References: <339D68B133EAD311971E009027DC479703DB3B5A@montecarlo.cgr.harvard.edu>
Message-ID: <43B48DB8.3060201@infotech.monash.edu.au>

Amir Karger wrote:
> I'm writing a script that will take regular blast output and translate it to
> blast -m8 tabular form. (The reverse transform won't work without re-doing
> the alignments.)
> I've attached the blast output for running 3 sequences against month.aa.
> Below are the script, the script output, and the blast -m8 output. (Output
> is the same for bioperl-1.4 and 1.5-RC1.)

I can't verify that your code is correct, but I have two comments anyway 
which other BioPerl developers may be able to help us with:

1. Can this be done already using any of the Writer modules?

http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/SearchIO/Writer/toc.html

2. If not should probably turn the code into a blasttableWriter.pm class?

-- 
Torsten Seemann
Victorian Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/
From hlapp at gmx.net  Thu Dec 29 20:51:40 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu Dec 29 20:55:21 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <43B48CD8.5090402@infotech.monash.edu.au>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<43B48CD8.5090402@infotech.monash.edu.au>
Message-ID: <578591aeb4fe31ec50fcc24b8dcb7046@gmx.net>

BTW since Sep 1 there is no default for the driver anymore in the 
script nor in Bio::DB::BioDB->new() (which you'd use to instantiate a 
$db handle in your own script). Deeper inside there is still an 
implementation module (Bio::DB::SimpleDBContext) that sets mysql as the 
default driver if neither driver nor dsn are provided.

I.e., what I'm saying is don't rely anymore on mysql being the default 
driver as this behavior may go away at any time - always specify it 
explicitly.

On another note, if you're always connecting to the same biosql 
instance, you may want to put a file .bioperldb in your home directory 
and use option --initrc. See the POD.

	-hilmar

On Dec 29, 2005, at 5:26 PM, Torsten Seemann wrote:

>> I'm getting the following error while trying to run :
>> ./load_seqdatabase.pl -host localhost -dbname USBA -dbuser postgres 
>> -format
>> genbank NC_003076.gbk
>> MSG: failed to open connection: Can't connect to local MySQL server 
>> through
>> socket '/var/lib/mysql/mysql.sock' (2)
>> But I've a postgreSQL db and not a MySQL one...could anyone please 
>> guide me
>> troubleshoot this?
>
> Did you read the documentation for the load_seqdatabase.pl script?
>
> It's in the script itself!
>
>    =item --driver $driver
>    the DBI driver name for the RDBMS e.g., mysql, Pg, or Oracle [mysql]
>
> The default DBI driver is [mysql].
>
> I think you want the option "-driver Pg".
>
> -- 
> Torsten Seemann
> Victorian Bioinformatics Consortium, Monash University, Australia
> http://www.vicbioinformatics.com/
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From angshu96 at gmail.com  Thu Dec 29 21:00:23 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec 30 01:58:32 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <43B48CD8.5090402@infotech.monash.edu.au>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<43B48CD8.5090402@infotech.monash.edu.au>
Message-ID: <df8328740512291800q23a756f5w8b5282c68f5d01a7@mail.gmail.com>

I'm sorry that I missed it! Thanks for pointing it out.
Also thanks Hilmar for the update.

Angshu

On 12/29/05, Torsten Seemann <torsten.seemann@infotech.monash.edu.au >
wrote:
>
> > I'm getting the following error while trying to run :
> > ./load_seqdatabase.pl -host localhost -dbname USBA -dbuser postgres
> -format
> > genbank NC_003076.gbk
> > MSG: failed to open connection: Can't connect to local MySQL server
> through
> > socket '/var/lib/mysql/mysql.sock' (2)
> > But I've a postgreSQL db and not a MySQL one...could anyone please guide
> me
> > troubleshoot this?
>
> Did you read the documentation for the load_seqdatabase.pl script?
>
> It's in the script itself!
>
>     =item --driver $driver
>     the DBI driver name for the RDBMS e.g., mysql, Pg, or Oracle [mysql]
>
> The default DBI driver is [mysql].
>
> I think you want the option "-driver Pg".
>
> --
> Torsten Seemann
> Victorian Bioinformatics Consortium, Monash University, Australia
> http://www.vicbioinformatics.com/
>

From angshu96 at gmail.com  Fri Dec 30 17:29:13 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec 30 17:33:02 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <df8328740512291800q23a756f5w8b5282c68f5d01a7@mail.gmail.com>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<43B48CD8.5090402@infotech.monash.edu.au>
	<df8328740512291800q23a756f5w8b5282c68f5d01a7@mail.gmail.com>
Message-ID: <df8328740512301429k51ebb690jeef6fc1b47705635@mail.gmail.com>

Any clues why my load_seqdatabase.pl (./load_seqdatabase.pl --dbname=USBA
--dbuser=postgres --format=genbank  --driver=Pg --debug  NC_003076.gbk)
 is getting killed after the follwoing step?

Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as driver peer for
Bio::DB::BioSQL::BiosequenceAdaptor
preparing SELECT statement: SELECT bioentry_id FROM biosequence WHERE
bioentry_id = ?

Killed

I'm using a linux box. This didn't happen for a different i/p file!

Thanks,
Angshu


On 12/29/05, Angshu Kar <angshu96@gmail.com> wrote:
>
> I'm sorry that I missed it! Thanks for pointing it out.
> Also thanks Hilmar for the update.
>
> Angshu
>
> On 12/29/05, Torsten Seemann < torsten.seemann@infotech.monash.edu.au >
> wrote:
> >
> > > I'm getting the following error while trying to run :
> > > ./load_seqdatabase.pl -host localhost -dbname USBA -dbuser postgres
> > -format
> > > genbank NC_003076.gbk
> > > MSG: failed to open connection: Can't connect to local MySQL server
> > through
> > > socket '/var/lib/mysql/mysql.sock' (2)
> > > But I've a postgreSQL db and not a MySQL one...could anyone please
> > guide me
> > > troubleshoot this?
> >
> > Did you read the documentation for the load_seqdatabase.pl script?
> >
> > It's in the script itself!
> >
> >     =item --driver $driver
> >     the DBI driver name for the RDBMS e.g., mysql, Pg, or Oracle [mysql]
> >
> >
> > The default DBI driver is [mysql].
> >
> > I think you want the option "-driver Pg".
> >
> > --
> > Torsten Seemann
> > Victorian Bioinformatics Consortium, Monash University, Australia
> > http://www.vicbioinformatics.com/
> >
>
>

From hlapp at gmx.net  Fri Dec 30 17:41:18 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri Dec 30 17:38:12 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <df8328740512301429k51ebb690jeef6fc1b47705635@mail.gmail.com>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<43B48CD8.5090402@infotech.monash.edu.au>
	<df8328740512291800q23a756f5w8b5282c68f5d01a7@mail.gmail.com>
	<df8328740512301429k51ebb690jeef6fc1b47705635@mail.gmail.com>
Message-ID: <33f89146e1b14860a2f76475214a0c32@gmx.net>

If it didn't happen for a different input file, can you tell what is 
special about this one? The file name lets me guess the input is a 
contig or even a full chromosome? Is the input on which the process 
wasn't killed of the same nature? Are the sequences of comparable or 
vastly different lengths? Is there only a single contig in the 
offending input? Can you reproduce the problem on an empty database 
with input containing a single entry? If so, let me know where I can 
get that file from and I'll try to reproduce it locally.

	-hilmar

On Dec 30, 2005, at 2:29 PM, Angshu Kar wrote:

> Any clues why my load_seqdatabase.pl (./load_seqdatabase.pl 
> --dbname=USBA --dbuser=postgres --format=genbank? --driver=Pg --debug? 
> NC_003076.gbk)
> ?is getting killed after the follwoing step?
>
>  Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as driver peer 
> for Bio::DB::BioSQL::BiosequenceAdaptor
> preparing SELECT statement: SELECT bioentry_id FROM biosequence WHERE 
> bioentry_id = ?
>
> Killed
>
> I'm using a linux box. This didn't happen for a different i/p file!
>
> Thanks,
> Angshu
>
>
> On 12/29/05, Angshu Kar <angshu96@gmail.com> wrote: I'm sorry that I 
> missed it! Thanks for pointing it out.
>> Also thanks Hilmar for the update.
>>
>> Angshu
>>
>>
>> On 12/29/05, Torsten Seemann < torsten.seemann@infotech.monash.edu.au 
>> > wrote:> I'm getting the following error while trying to run :
>>> > ./load_seqdatabase.pl -host localhost -dbname USBA -dbuser 
>>> postgres -format
>>> > genbank NC_003076.gbk
>>> > MSG: failed to open connection: Can't connect to local MySQL 
>>> server through
>>> > socket '/var/lib/mysql/mysql.sock' (2)
>>> > But I've a postgreSQL db and not a MySQL one...could anyone please 
>>> guide me
>>> > troubleshoot this?
>>>
>>> Did you read the documentation for the load_seqdatabase.pl script?
>>>
>>> It's in the script itself!
>>>
>>> ????=item --driver $driver
>>> ????the DBI driver name for the RDBMS e.g., mysql, Pg, or Oracle 
>>> [mysql]
>>>
>>> The default DBI driver is [mysql].
>>>
>>> I think you want the option "-driver Pg".
>>>
>>> --
>>> Torsten Seemann
>>> Victorian Bioinformatics Consortium, Monash University, Australia
>>>  http://www.vicbioinformatics.com/
>>
>>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------



From hlapp at gmx.net  Fri Dec 30 17:44:22 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri Dec 30 17:41:11 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <df8328740512301436p15e65ff6l7705d95052bf0e3@mail.gmail.com>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<43B48CD8.5090402@infotech.monash.edu.au>
	<df8328740512291800q23a756f5w8b5282c68f5d01a7@mail.gmail.com>
	<df8328740512301429k51ebb690jeef6fc1b47705635@mail.gmail.com>
	<df8328740512301436p15e65ff6l7705d95052bf0e3@mail.gmail.com>
Message-ID: <78f759221067c112711eeadeb177e0ec@gmx.net>

No. Just in the base directory of your unpacked bioperl-db download 
type 'make test' (obviously without the quotes).

If you installed bioperl in a non-standard place make sure you set the 
PERL5LIB environment appropriately before doing this.

	-hilmar

On Dec 30, 2005, at 2:36 PM, Angshu Kar wrote:

> Also how to run the bioperl-db test ? I mean do I have to reinstall it 
> to run the make test command?
>
>
>
> On 12/30/05, Angshu Kar < angshu96@gmail.com> wrote:Any clues why my 
> load_seqdatabase.pl (./load_seqdatabase.pl --dbname=USBA 
> --dbuser=postgres --format=genbank? --driver=Pg --debug? 
> NC_003076.gbk)
>> ?is getting killed after the follwoing step?
>>
>>  Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as driver peer 
>> for Bio::DB::BioSQL::BiosequenceAdaptor
>> preparing SELECT statement: SELECT bioentry_id FROM biosequence WHERE 
>> bioentry_id = ?
>>
>> Killed
>>
>> I'm using a linux box. This didn't happen for a different i/p file!
>>
>> Thanks,
>> Angshu
>>
>>
>> On 12/29/05, Angshu Kar < angshu96@gmail.com> wrote: I'm sorry that I 
>> missed it! Thanks for pointing it out.
>>> Also thanks Hilmar for the update.
>>>
>>> Angshu
>>>
>>>
>>> On 12/29/05, Torsten Seemann < 
>>> torsten.seemann@infotech.monash.edu.au > wrote:> I'm getting the 
>>> following error while trying to run :
>>>> > ./load_seqdatabase.pl -host localhost -dbname USBA -dbuser 
>>>> postgres -format
>>>> > genbank NC_003076.gbk
>>>> > MSG: failed to open connection: Can't connect to local MySQL 
>>>> server through
>>>> > socket '/var/lib/mysql/mysql.sock' (2)
>>>> > But I've a postgreSQL db and not a MySQL one...could anyone 
>>>> please guide me
>>>> > troubleshoot this?
>>>>
>>>> Did you read the documentation for the load_seqdatabase.pl script?
>>>>
>>>> It's in the script itself!
>>>>
>>>> ????=item --driver $driver
>>>> ????the DBI driver name for the RDBMS e.g., mysql, Pg, or Oracle 
>>>> [mysql]
>>>>
>>>> The default DBI driver is [mysql].
>>>>
>>>> I think you want the option "-driver Pg".
>>>>
>>>> --
>>>> Torsten Seemann
>>>> Victorian Bioinformatics Consortium, Monash University, Australia
>>>>  http://www.vicbioinformatics.com/
>>>
>>
>>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------



From angshu96 at gmail.com  Fri Dec 30 18:01:07 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec 30 17:57:55 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <33f89146e1b14860a2f76475214a0c32@gmx.net>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<43B48CD8.5090402@infotech.monash.edu.au>
	<df8328740512291800q23a756f5w8b5282c68f5d01a7@mail.gmail.com>
	<df8328740512301429k51ebb690jeef6fc1b47705635@mail.gmail.com>
	<33f89146e1b14860a2f76475214a0c32@gmx.net>
Message-ID: <df8328740512301501sc7c00f6r80da5ee7ef9d1b3a@mail.gmail.com>

Yes Hilmar its indeed a full sequence of chromosome. I got it from
ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V/
I tried with the .faa and .fna files and they ran successfully.
Also I missed a line (may be relevant) in the debug o/p:
no adaptor found for class Bio::Annotation::TypeManager

Thanks,
Angshu


On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
> If it didn't happen for a different input file, can you tell what is
> special about this one? The file name lets me guess the input is a
> contig or even a full chromosome? Is the input on which the process
> wasn't killed of the same nature? Are the sequences of comparable or
> vastly different lengths? Is there only a single contig in the
> offending input? Can you reproduce the problem on an empty database
> with input containing a single entry? If so, let me know where I can
> get that file from and I'll try to reproduce it locally.
>
>         -hilmar
>
> On Dec 30, 2005, at 2:29 PM, Angshu Kar wrote:
>
> > Any clues why my load_seqdatabase.pl (./load_seqdatabase.pl
> > --dbname=USBA --dbuser=postgres --format=genbank --driver=Pg --debug
> > NC_003076.gbk)
> > is getting killed after the follwoing step?
> >
> >  Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as driver peer
> > for Bio::DB::BioSQL::BiosequenceAdaptor
> > preparing SELECT statement: SELECT bioentry_id FROM biosequence WHERE
> > bioentry_id = ?
> >
> > Killed
> >
> > I'm using a linux box. This didn't happen for a different i/p file!
> >
> > Thanks,
> > Angshu
> >
> >
> > On 12/29/05, Angshu Kar < angshu96@gmail.com> wrote: I'm sorry that I
> > missed it! Thanks for pointing it out.
> >> Also thanks Hilmar for the update.
> >>
> >> Angshu
> >>
> >>
> >> On 12/29/05, Torsten Seemann < torsten.seemann@infotech.monash.edu.au
> >> > wrote:> I'm getting the following error while trying to run :
> >>> > ./load_seqdatabase.pl -host localhost -dbname USBA -dbuser
> >>> postgres -format
> >>> > genbank NC_003076.gbk
> >>> > MSG: failed to open connection: Can't connect to local MySQL
> >>> server through
> >>> > socket '/var/lib/mysql/mysql.sock' (2)
> >>> > But I've a postgreSQL db and not a MySQL one...could anyone please
> >>> guide me
> >>> > troubleshoot this?
> >>>
> >>> Did you read the documentation for the load_seqdatabase.pl script?
> >>>
> >>> It's in the script itself!
> >>>
> >>> =item --driver $driver
> >>> the DBI driver name for the RDBMS e.g., mysql, Pg, or Oracle
> >>> [mysql]
> >>>
> >>> The default DBI driver is [mysql].
> >>>
> >>> I think you want the option "-driver Pg".
> >>>
> >>> --
> >>> Torsten Seemann
> >>> Victorian Bioinformatics Consortium, Monash University, Australia
> >>>  http://www.vicbioinformatics.com/
> >>
> >>
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From angshu96 at gmail.com  Fri Dec 30 17:36:14 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec 30 17:59:13 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <df8328740512301429k51ebb690jeef6fc1b47705635@mail.gmail.com>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<43B48CD8.5090402@infotech.monash.edu.au>
	<df8328740512291800q23a756f5w8b5282c68f5d01a7@mail.gmail.com>
	<df8328740512301429k51ebb690jeef6fc1b47705635@mail.gmail.com>
Message-ID: <df8328740512301436p15e65ff6l7705d95052bf0e3@mail.gmail.com>

Also how to run the bioperl-db test ? I mean do I have to reinstall it to
run the make test command?



On 12/30/05, Angshu Kar <angshu96@gmail.com> wrote:
>
> Any clues why my load_seqdatabase.pl (./load_seqdatabase.pl --dbname=USBA
> --dbuser=postgres --format=genbank  --driver=Pg --debug  NC_003076.gbk)
>  is getting killed after the follwoing step?
>
> Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as driver peer for
> Bio::DB::BioSQL::BiosequenceAdaptor
> preparing SELECT statement: SELECT bioentry_id FROM biosequence WHERE
> bioentry_id = ?
>
> Killed
>
> I'm using a linux box. This didn't happen for a different i/p file!
>
> Thanks,
> Angshu
>
>
> On 12/29/05, Angshu Kar <angshu96@gmail.com> wrote:
> >
> > I'm sorry that I missed it! Thanks for pointing it out.
> > Also thanks Hilmar for the update.
> >
> > Angshu
> >
> > On 12/29/05, Torsten Seemann < torsten.seemann@infotech.monash.edu.au >
> > wrote:
> > >
> > > > I'm getting the following error while trying to run :
> > > > ./load_seqdatabase.pl -host localhost -dbname USBA -dbuser postgres
> > > -format
> > > > genbank NC_003076.gbk
> > > > MSG: failed to open connection: Can't connect to local MySQL server
> > > through
> > > > socket '/var/lib/mysql/mysql.sock' (2)
> > > > But I've a postgreSQL db and not a MySQL one...could anyone please
> > > guide me
> > > > troubleshoot this?
> > >
> > > Did you read the documentation for the load_seqdatabase.pl script?
> > >
> > > It's in the script itself!
> > >
> > >     =item --driver $driver
> > >     the DBI driver name for the RDBMS e.g., mysql, Pg, or Oracle
> > > [mysql]
> > >
> > > The default DBI driver is [mysql].
> > >
> > > I think you want the option "-driver Pg".
> > >
> > > --
> > > Torsten Seemann
> > > Victorian Bioinformatics Consortium, Monash University, Australia
> > > http://www.vicbioinformatics.com/
> > >
> >
> >
>

From hlapp at gmx.net  Fri Dec 30 18:12:29 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri Dec 30 18:09:22 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <df8328740512301501sc7c00f6r80da5ee7ef9d1b3a@mail.gmail.com>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<43B48CD8.5090402@infotech.monash.edu.au>
	<df8328740512291800q23a756f5w8b5282c68f5d01a7@mail.gmail.com>
	<df8328740512301429k51ebb690jeef6fc1b47705635@mail.gmail.com>
	<33f89146e1b14860a2f76475214a0c32@gmx.net>
	<df8328740512301501sc7c00f6r80da5ee7ef9d1b3a@mail.gmail.com>
Message-ID: <84c80704820ab7d6ee3f474ff39338dd@gmx.net>

Did you empty the database after the previous runs?

Also, you haven't reported your hw setup. In particular, how much 
memory and swap do you have, is Pg running locally (your command line 
suggests it does), and how much memory have you allocated to Pg?

	-hilmar

On Dec 30, 2005, at 3:01 PM, Angshu Kar wrote:

> Yes Hilmar its indeed a full sequence of chromosome. I got it from 
> ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V/
> I tried with the .faa and .fna files and they ran successfully.
> Also I missed a line (may be relevant) in the debug o/p:
> no adaptor found for class Bio::Annotation::TypeManager
>
> Thanks,
> Angshu
>
>
> On 12/30/05, Hilmar Lapp < hlapp@gmx.net> wrote:
>> special about this one? The file name lets me guess the input is a
>> contig or even a full chromosome? Is the input on which the process
>> wasn't killed of the same nature? Are the sequences of comparable or
>> vastly different lengths? Is there only a single contig in the
>> offending input? Can you reproduce the problem on an empty database
>> with input containing a single entry? If so, let me know where I can
>> get that file from and I'll try to reproduce it locally.
>>
>> ????????-hilmar
>>
>> On Dec 30, 2005, at 2:29 PM, Angshu Kar wrote:
>>
>> > Any clues why my load_seqdatabase.pl (./load_seqdatabase.pl
>> > --dbname=USBA --dbuser=postgres --format=genbank --driver=Pg --debug
>> > NC_003076.gbk)
>> > is getting killed after the follwoing step?
>> >
>> >??Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as driver peer
>> > for Bio::DB::BioSQL::BiosequenceAdaptor
>> > preparing SELECT statement: SELECT bioentry_id FROM biosequence 
>> WHERE
>> > bioentry_id = ?
>> >
>> > Killed
>> >
>> > I'm using a linux box. This didn't happen for a different i/p file!
>> >
>> > Thanks,
>> > Angshu
>> >
>> >
>> > On 12/29/05, Angshu Kar < angshu96@gmail.com> wrote: I'm sorry that 
>> I
>> > missed it! Thanks for pointing it out.
>> >> Also thanks Hilmar for the update.
>> >>
>> >> Angshu
>> >>
>> >>
>> >> On 12/29/05, Torsten Seemann < 
>> torsten.seemann@infotech.monash.edu.au
>> >> > wrote:> I'm getting the following error while trying to run :
>> >>> > ./load_seqdatabase.pl -host localhost -dbname USBA -dbuser
>> >>> postgres -format
>> >>> > genbank NC_003076.gbk
>> >>> > MSG: failed to open connection: Can't connect to local MySQL
>> >>> server through
>> >>> > socket '/var/lib/mysql/mysql.sock' (2)
>> >>> > But I've a postgreSQL db and not a MySQL one...could anyone 
>> please
>> >>> guide me
>> >>> > troubleshoot this?
>> >>>
>> >>> Did you read the documentation for the load_seqdatabase.pl script?
>> >>>
>> >>> It's in the script itself!
>> >>>
>> >>> =item --driver $driver
>> >>> the DBI driver name for the RDBMS e.g., mysql, Pg, or Oracle
>> >>> [mysql]
>> >>>
>> >>> The default DBI driver is [mysql].
>> >>>
>> >>> I think you want the option "-driver Pg".
>> >>>
>>  >>> --
>> >>> Torsten Seemann
>> >>> Victorian Bioinformatics Consortium, Monash University, Australia
>> >>>?? http://www.vicbioinformatics.com/
>> >>
>> >>
>> --
>> -------------------------------------------------------------
>> Hilmar Lapp????????????????????????????email: lapp at gnf.org
>> GNF, San Diego, Ca. 92121??????????????phone: +1-858-812-1757
>> -------------------------------------------------------------
>>
>>
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------



From angshu96 at gmail.com  Fri Dec 30 18:15:59 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec 30 18:12:44 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <84c80704820ab7d6ee3f474ff39338dd@gmx.net>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<43B48CD8.5090402@infotech.monash.edu.au>
	<df8328740512291800q23a756f5w8b5282c68f5d01a7@mail.gmail.com>
	<df8328740512301429k51ebb690jeef6fc1b47705635@mail.gmail.com>
	<33f89146e1b14860a2f76475214a0c32@gmx.net>
	<df8328740512301501sc7c00f6r80da5ee7ef9d1b3a@mail.gmail.com>
	<84c80704820ab7d6ee3f474ff39338dd@gmx.net>
Message-ID: <df8328740512301515g1227ab01g23cb57c9d8b9ccce@mail.gmail.com>

I've no clue about my Pg setup! It has been done by the sysadmin! :(
Could you please tell me the commands and I can run and let you know the
reports?

thanks,
angshu

On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
> Did you empty the database after the previous runs?
>
> Also, you haven't reported your hw setup. In particular, how much
> memory and swap do you have, is Pg running locally (your command line
> suggests it does), and how much memory have you allocated to Pg?
>
>         -hilmar
>
> On Dec 30, 2005, at 3:01 PM, Angshu Kar wrote:
>
> > Yes Hilmar its indeed a full sequence of chromosome. I got it from
> > ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V/
> > I tried with the .faa and .fna files and they ran successfully.
> > Also I missed a line (may be relevant) in the debug o/p:
> > no adaptor found for class Bio::Annotation::TypeManager
> >
> > Thanks,
> > Angshu
> >
> >
> > On 12/30/05, Hilmar Lapp < hlapp@gmx.net> wrote:
> >> special about this one? The file name lets me guess the input is a
> >> contig or even a full chromosome? Is the input on which the process
> >> wasn't killed of the same nature? Are the sequences of comparable or
> >> vastly different lengths? Is there only a single contig in the
> >> offending input? Can you reproduce the problem on an empty database
> >> with input containing a single entry? If so, let me know where I can
> >> get that file from and I'll try to reproduce it locally.
> >>
> >> -hilmar
> >>
> >> On Dec 30, 2005, at 2:29 PM, Angshu Kar wrote:
> >>
> >> > Any clues why my load_seqdatabase.pl (./load_seqdatabase.pl
> >> > --dbname=USBA --dbuser=postgres --format=genbank --driver=Pg --debug
> >> > NC_003076.gbk)
> >> > is getting killed after the follwoing step?
> >> >
> >> >Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as driver peer
> >> > for Bio::DB::BioSQL::BiosequenceAdaptor
> >> > preparing SELECT statement: SELECT bioentry_id FROM biosequence
> >> WHERE
> >> > bioentry_id = ?
> >> >
> >> > Killed
> >> >
> >> > I'm using a linux box. This didn't happen for a different i/p file!
> >> >
> >> > Thanks,
> >> > Angshu
> >> >
> >> >
> >> > On 12/29/05, Angshu Kar < angshu96@gmail.com> wrote: I'm sorry that
> >> I
> >> > missed it! Thanks for pointing it out.
> >> >> Also thanks Hilmar for the update.
> >> >>
> >> >> Angshu
> >> >>
> >> >>
> >> >> On 12/29/05, Torsten Seemann <
> >> torsten.seemann@infotech.monash.edu.au
> >> >> > wrote:> I'm getting the following error while trying to run :
> >> >>> > ./load_seqdatabase.pl -host localhost -dbname USBA -dbuser
> >> >>> postgres -format
> >> >>> > genbank NC_003076.gbk
> >> >>> > MSG: failed to open connection: Can't connect to local MySQL
> >> >>> server through
> >> >>> > socket '/var/lib/mysql/mysql.sock' (2)
> >> >>> > But I've a postgreSQL db and not a MySQL one...could anyone
> >> please
> >> >>> guide me
> >> >>> > troubleshoot this?
> >> >>>
> >> >>> Did you read the documentation for the load_seqdatabase.pl script?
> >> >>>
> >> >>> It's in the script itself!
> >> >>>
> >> >>> =item --driver $driver
> >> >>> the DBI driver name for the RDBMS e.g., mysql, Pg, or Oracle
> >> >>> [mysql]
> >> >>>
> >> >>> The default DBI driver is [mysql].
> >> >>>
> >> >>> I think you want the option "-driver Pg".
> >> >>>
> >>  >>> --
> >> >>> Torsten Seemann
> >> >>> Victorian Bioinformatics Consortium, Monash University, Australia
> >> >>> http://www.vicbioinformatics.com/
> >> >>
> >> >>
> >> --
> >> -------------------------------------------------------------
> >> Hilmar Lappemail: lapp at gnf.org
> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> -------------------------------------------------------------
> >>
> >>
> >
> >
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From hlapp at gmx.net  Fri Dec 30 19:06:15 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri Dec 30 19:03:34 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <df8328740512301515g1227ab01g23cb57c9d8b9ccce@mail.gmail.com>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<43B48CD8.5090402@infotech.monash.edu.au>
	<df8328740512291800q23a756f5w8b5282c68f5d01a7@mail.gmail.com>
	<df8328740512301429k51ebb690jeef6fc1b47705635@mail.gmail.com>
	<33f89146e1b14860a2f76475214a0c32@gmx.net>
	<df8328740512301501sc7c00f6r80da5ee7ef9d1b3a@mail.gmail.com>
	<84c80704820ab7d6ee3f474ff39338dd@gmx.net>
	<df8328740512301515g1227ab01g23cb57c9d8b9ccce@mail.gmail.com>
Message-ID: <5e182836514be51503a73d5c998b1bb6@gmx.net>

Why don't you just ask your sysadmin - he'll know where to look. It's 
actually in a config file, and the default installation of Postgres 
makes this config file unreadable for every one except the pg-admin 
user chosen at installation time.

	-hilmar

On Dec 30, 2005, at 3:15 PM, Angshu Kar wrote:

> I've no clue about my Pg setup! It has been done by the sysadmin! :(
> Could you please tell me the commands and I can run and let you know 
> the reports?
>
> thanks,
> angshu
>
> On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>>
>> Also, you haven't reported your hw setup. In particular, how much
>> memory and swap do you have, is Pg running locally (your command line
>> suggests it does), and how much memory have you allocated to Pg?
>>
>> ????????-hilmar
>>
>> On Dec 30, 2005, at 3:01 PM, Angshu Kar wrote:
>>
>> > Yes Hilmar its indeed a full sequence of chromosome. I got it from
>> > ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V/
>> > I tried with the .faa and .fna files and they ran successfully.
>> > Also I missed a line (may be relevant) in the debug o/p:
>> > no adaptor found for class Bio::Annotation::TypeManager
>> >
>> > Thanks,
>> > Angshu
>> >
>> >
>> > On 12/30/05, Hilmar Lapp < hlapp@gmx.net> wrote:
>> >> special about this one? The file name lets me guess the input is a
>> >> contig or even a full chromosome? Is the input on which the process
>> >> wasn't killed of the same nature? Are the sequences of comparable 
>> or
>> >> vastly different lengths? Is there only a single contig in the
>> >> offending input? Can you reproduce the problem on an empty database
>> >> with input containing a single entry? If so, let me know where I 
>> can
>> >> get that file from and I'll try to reproduce it locally.
>> >>
>> >> -hilmar
>> >>
>> >> On Dec 30, 2005, at 2:29 PM, Angshu Kar wrote:
>> >>
>> >> > Any clues why my load_seqdatabase.pl (./load_seqdatabase.pl
>> >> > --dbname=USBA --dbuser=postgres --format=genbank --driver=Pg 
>> --debug
>> >> > NC_003076.gbk)
>> >> > is getting killed after the follwoing step?
>> >> >
>> >> >Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as driver peer
>> >> > for Bio::DB::BioSQL::BiosequenceAdaptor
>> >> > preparing SELECT statement: SELECT bioentry_id FROM biosequence
>> >> WHERE
>> >> > bioentry_id = ?
>> >> >
>> >> > Killed
>> >> >
>> >> > I'm using a linux box. This didn't happen for a different i/p 
>> file!
>> >> >
>> >> > Thanks,
>> >> > Angshu
>> >> >
>> >> >
>> >> > On 12/29/05, Angshu Kar < angshu96@gmail.com> wrote: I'm sorry 
>> that
>> >> I
>> >> > missed it! Thanks for pointing it out.
>> >> >> Also thanks Hilmar for the update.
>> >> >>
>> >> >> Angshu
>> >> >>
>> >> >>
>>  >> >> On 12/29/05, Torsten Seemann <
>> >> torsten.seemann@infotech.monash.edu.au
>> >> >> > wrote:> I'm getting the following error while trying to run :
>> >> >>> > ./load_seqdatabase.pl -host localhost -dbname USBA -dbuser
>> >> >>> postgres -format
>> >> >>> > genbank NC_003076.gbk
>> >> >>> > MSG: failed to open connection: Can't connect to local MySQL
>> >> >>> server through
>> >> >>> > socket '/var/lib/mysql/mysql.sock' (2)
>> >> >>> > But I've a postgreSQL db and not a MySQL one...could anyone
>> >> please
>>  >> >>> guide me
>> >> >>> > troubleshoot this?
>> >> >>>
>> >> >>> Did you read the documentation for the load_seqdatabase.pl 
>> script?
>> >> >>>
>> >> >>> It's in the script itself!
>> >> >>>
>> >> >>> =item --driver $driver
>> >> >>> the DBI driver name for the RDBMS e.g., mysql, Pg, or Oracle
>> >> >>> [mysql]
>> >> >>>
>> >> >>> The default DBI driver is [mysql].
>> >> >>>
>> >> >>> I think you want the option "-driver Pg".
>> >> >>>
>> >>??>>> --
>> >> >>> Torsten Seemann
>> >> >>> Victorian Bioinformatics Consortium, Monash University, 
>> Australia
>> >> >>> http://www.vicbioinformatics.com/
>> >> >>
>> >> >>
>> >> --
>> >> -------------------------------------------------------------
>> >> Hilmar Lappemail: lapp at gnf.org
>> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> -------------------------------------------------------------
>> >>
>> >>
>> >
>> >
>> --
>> -------------------------------------------------------------
>> Hilmar Lapp????????????????????????????email: lapp at gnf.org
>> GNF, San Diego, Ca. 92121??????????????phone: +1-858-812-1757
>> -------------------------------------------------------------
>>
>>
>>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------



From angshu96 at gmail.com  Fri Dec 30 19:13:03 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec 30 19:09:49 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <5e182836514be51503a73d5c998b1bb6@gmx.net>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<43B48CD8.5090402@infotech.monash.edu.au>
	<df8328740512291800q23a756f5w8b5282c68f5d01a7@mail.gmail.com>
	<df8328740512301429k51ebb690jeef6fc1b47705635@mail.gmail.com>
	<33f89146e1b14860a2f76475214a0c32@gmx.net>
	<df8328740512301501sc7c00f6r80da5ee7ef9d1b3a@mail.gmail.com>
	<84c80704820ab7d6ee3f474ff39338dd@gmx.net>
	<df8328740512301515g1227ab01g23cb57c9d8b9ccce@mail.gmail.com>
	<5e182836514be51503a73d5c998b1bb6@gmx.net>
Message-ID: <df8328740512301613o377336bay95bca8b6d5cb9f44@mail.gmail.com>

oops! he is not present now!
anyways, if you have some time could you please if there are any reasons for
the script to get killed with the .gbk file?

Thanks,
Angshu

On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
> Why don't you just ask your sysadmin - he'll know where to look. It's
> actually in a config file, and the default installation of Postgres
> makes this config file unreadable for every one except the pg-admin
> user chosen at installation time.
>
>         -hilmar
>
> On Dec 30, 2005, at 3:15 PM, Angshu Kar wrote:
>
> > I've no clue about my Pg setup! It has been done by the sysadmin! :(
> > Could you please tell me the commands and I can run and let you know
> > the reports?
> >
> > thanks,
> > angshu
> >
> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
> >>
> >> Also, you haven't reported your hw setup. In particular, how much
> >> memory and swap do you have, is Pg running locally (your command line
> >> suggests it does), and how much memory have you allocated to Pg?
> >>
> >> -hilmar
> >>
> >> On Dec 30, 2005, at 3:01 PM, Angshu Kar wrote:
> >>
> >> > Yes Hilmar its indeed a full sequence of chromosome. I got it from
> >> > ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V/
> >> > I tried with the .faa and .fna files and they ran successfully.
> >> > Also I missed a line (may be relevant) in the debug o/p:
> >> > no adaptor found for class Bio::Annotation::TypeManager
> >> >
> >> > Thanks,
> >> > Angshu
> >> >
> >> >
> >> > On 12/30/05, Hilmar Lapp < hlapp@gmx.net> wrote:
> >> >> special about this one? The file name lets me guess the input is a
> >> >> contig or even a full chromosome? Is the input on which the process
> >> >> wasn't killed of the same nature? Are the sequences of comparable
> >> or
> >> >> vastly different lengths? Is there only a single contig in the
> >> >> offending input? Can you reproduce the problem on an empty database
> >> >> with input containing a single entry? If so, let me know where I
> >> can
> >> >> get that file from and I'll try to reproduce it locally.
> >> >>
> >> >> -hilmar
> >> >>
> >> >> On Dec 30, 2005, at 2:29 PM, Angshu Kar wrote:
> >> >>
> >> >> > Any clues why my load_seqdatabase.pl (./load_seqdatabase.pl
> >> >> > --dbname=USBA --dbuser=postgres --format=genbank --driver=Pg
> >> --debug
> >> >> > NC_003076.gbk)
> >> >> > is getting killed after the follwoing step?
> >> >> >
> >> >> >Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as driver peer
> >> >> > for Bio::DB::BioSQL::BiosequenceAdaptor
> >> >> > preparing SELECT statement: SELECT bioentry_id FROM biosequence
> >> >> WHERE
> >> >> > bioentry_id = ?
> >> >> >
> >> >> > Killed
> >> >> >
> >> >> > I'm using a linux box. This didn't happen for a different i/p
> >> file!
> >> >> >
> >> >> > Thanks,
> >> >> > Angshu
> >> >> >
> >> >> >
> >> >> > On 12/29/05, Angshu Kar < angshu96@gmail.com> wrote: I'm sorry
> >> that
> >> >> I
> >> >> > missed it! Thanks for pointing it out.
> >> >> >> Also thanks Hilmar for the update.
> >> >> >>
> >> >> >> Angshu
> >> >> >>
> >> >> >>
> >>  >> >> On 12/29/05, Torsten Seemann <
> >> >> torsten.seemann@infotech.monash.edu.au
> >> >> >> > wrote:> I'm getting the following error while trying to run :
> >> >> >>> > ./load_seqdatabase.pl -host localhost -dbname USBA -dbuser
> >> >> >>> postgres -format
> >> >> >>> > genbank NC_003076.gbk
> >> >> >>> > MSG: failed to open connection: Can't connect to local MySQL
> >> >> >>> server through
> >> >> >>> > socket '/var/lib/mysql/mysql.sock' (2)
> >> >> >>> > But I've a postgreSQL db and not a MySQL one...could anyone
> >> >> please
> >>  >> >>> guide me
> >> >> >>> > troubleshoot this?
> >> >> >>>
> >> >> >>> Did you read the documentation for the load_seqdatabase.pl
> >> script?
> >> >> >>>
> >> >> >>> It's in the script itself!
> >> >> >>>
> >> >> >>> =item --driver $driver
> >> >> >>> the DBI driver name for the RDBMS e.g., mysql, Pg, or Oracle
> >> >> >>> [mysql]
> >> >> >>>
> >> >> >>> The default DBI driver is [mysql].
> >> >> >>>
> >> >> >>> I think you want the option "-driver Pg".
> >> >> >>>
> >> >>>>> --
> >> >> >>> Torsten Seemann
> >> >> >>> Victorian Bioinformatics Consortium, Monash University,
> >> Australia
> >> >> >>> http://www.vicbioinformatics.com/
> >> >> >>
> >> >> >>
> >> >> --
> >> >> -------------------------------------------------------------
> >> >> Hilmar Lappemail: lapp at gnf.org
> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> >> -------------------------------------------------------------
> >> >>
> >> >>
> >> >
> >> >
> >> --
> >> -------------------------------------------------------------
> >> Hilmar Lappemail: lapp at gnf.org
> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> -------------------------------------------------------------
> >>
> >>
> >>
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From hlapp at gmx.net  Fri Dec 30 19:33:19 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri Dec 30 19:30:17 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <df8328740512301613o377336bay95bca8b6d5cb9f44@mail.gmail.com>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<43B48CD8.5090402@infotech.monash.edu.au>
	<df8328740512291800q23a756f5w8b5282c68f5d01a7@mail.gmail.com>
	<df8328740512301429k51ebb690jeef6fc1b47705635@mail.gmail.com>
	<33f89146e1b14860a2f76475214a0c32@gmx.net>
	<df8328740512301501sc7c00f6r80da5ee7ef9d1b3a@mail.gmail.com>
	<84c80704820ab7d6ee3f474ff39338dd@gmx.net>
	<df8328740512301515g1227ab01g23cb57c9d8b9ccce@mail.gmail.com>
	<5e182836514be51503a73d5c998b1bb6@gmx.net>
	<df8328740512301613o377336bay95bca8b6d5cb9f44@mail.gmail.com>
Message-ID: <6a1461589de1c31b88ebbfa1d6e94d44@gmx.net>

I suspect it's either a (out-of-)memory error or a binary 
incompatibility.

You haven't yet run the bioperl-db test suite, have you? Please don't 
ask for more help before you haven't done that.

Also, you do remember my earlier answer to a similar report from you, 
right?
http://portal.open-bio.org/pipermail/bioperl-l/2005-December/020389.html

The two first things to do is to check whether you run out of shared 
memory and to run the tests and see whether the location where the 
process gets killed can be narrowed down. If it's not a bug (which it 
is unlikely to be - but the tests will provide more evidence) then the 
next step would be to recompile your own perl, DBI and DBD::Pg, and 
PostgreSQL, in that order.

	-hilmar

On Dec 30, 2005, at 4:13 PM, Angshu Kar wrote:

> oops! he is not present now!
> anyways, if you have some time could you please if there are any 
> reasons for the script to get killed with the .gbk file?
>
> Thanks,
> Angshu
>
> On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>> actually in a config file, and the default installation of Postgres
>> makes this config file unreadable for every one except the pg-admin
>> user chosen at installation time.
>>
>> ????????-hilmar
>>
>> On Dec 30, 2005, at 3:15 PM, Angshu Kar wrote:
>>
>> > I've no clue about my Pg setup! It has been done by the sysadmin! :(
>> > Could you please tell me the commands and I can run and let you know
>> > the reports?
>> >
>> > thanks,
>> > angshu
>> >
>> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>> >>
>> >> Also, you haven't reported your hw setup. In particular, how much
>> >> memory and swap do you have, is Pg running locally (your command 
>> line
>> >> suggests it does), and how much memory have you allocated to Pg?
>> >>
>> >> -hilmar
>> >>
>> >> On Dec 30, 2005, at 3:01 PM, Angshu Kar wrote:
>> >>
>> >> > Yes Hilmar its indeed a full sequence of chromosome. I got it 
>> from
>> >> > ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V/
>> >> > I tried with the .faa and .fna files and they ran successfully.
>> >> > Also I missed a line (may be relevant) in the debug o/p:
>> >> > no adaptor found for class Bio::Annotation::TypeManager
>> >> >
>> >> > Thanks,
>> >> > Angshu
>> >> >
>> >> >
>> >> > On 12/30/05, Hilmar Lapp < hlapp@gmx.net> wrote:
>> >> >> special about this one? The file name lets me guess the input 
>> is a
>> >> >> contig or even a full chromosome? Is the input on which the 
>> process
>> >> >> wasn't killed of the same nature? Are the sequences of 
>> comparable
>> >> or
>> >> >> vastly different lengths? Is there only a single contig in the
>> >> >> offending input? Can you reproduce the problem on an empty 
>> database
>> >> >> with input containing a single entry? If so, let me know where I
>> >> can
>> >> >> get that file from and I'll try to reproduce it locally.
>> >> >>
>> >> >> -hilmar
>> >> >>
>> >> >> On Dec 30, 2005, at 2:29 PM, Angshu Kar wrote:
>> >> >>
>> >> >> > Any clues why my load_seqdatabase.pl (./load_seqdatabase.pl
>> >> >> > --dbname=USBA --dbuser=postgres --format=genbank --driver=Pg
>> >> --debug
>> >> >> > NC_003076.gbk)
>> >> >> > is getting killed after the follwoing step?
>>  >> >> >
>> >> >> >Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as driver 
>> peer
>> >> >> > for Bio::DB::BioSQL::BiosequenceAdaptor
>> >> >> > preparing SELECT statement: SELECT bioentry_id FROM 
>> biosequence
>> >> >> WHERE
>> >> >> > bioentry_id = ?
>> >> >> >
>> >> >> > Killed
>> >> >> >
>> >> >> > I'm using a linux box. This didn't happen for a different i/p
>> >> file!
>> >> >> >
>> >> >> > Thanks,
>> >> >> > Angshu
>> >> >> >
>> >> >> >
>> >> >> > On 12/29/05, Angshu Kar < angshu96@gmail.com> wrote: I'm sorry
>> >> that
>> >> >> I
>> >> >> > missed it! Thanks for pointing it out.
>> >> >> >> Also thanks Hilmar for the update.
>> >> >> >>
>> >> >> >> Angshu
>> >> >> >>
>> >> >> >>
>> >>??>> >> On 12/29/05, Torsten Seemann <
>> >> >> torsten.seemann@infotech.monash.edu.au
>> >> >> >> > wrote:> I'm getting the following error while trying to 
>> run :
>> >> >> >>> > ./load_seqdatabase.pl -host localhost -dbname USBA -dbuser
>> >> >> >>> postgres -format
>> >> >> >>> > genbank NC_003076.gbk
>> >> >> >>> > MSG: failed to open connection: Can't connect to local 
>> MySQL
>> >> >> >>> server through
>> >> >> >>> > socket '/var/lib/mysql/mysql.sock' (2)
>> >> >> >>> > But I've a postgreSQL db and not a MySQL one...could 
>> anyone
>> >> >> please
>> >>??>> >>> guide me
>> >> >> >>> > troubleshoot this?
>> >> >> >>>
>> >> >> >>> Did you read the documentation for the load_seqdatabase.pl
>> >> script?
>> >> >> >>>
>> >> >> >>> It's in the script itself!
>> >> >> >>>
>> >> >> >>> =item --driver $driver
>> >> >> >>> the DBI driver name for the RDBMS e.g., mysql, Pg, or Oracle
>> >> >> >>> [mysql]
>> >> >> >>>
>> >> >> >>> The default DBI driver is [mysql].
>> >> >> >>>
>> >> >> >>> I think you want the option "-driver Pg".
>> >> >> >>>
>> >> >>>>> --
>> >> >> >>> Torsten Seemann
>> >> >> >>> Victorian Bioinformatics Consortium, Monash University,
>> >> Australia
>> >> >> >>> http://www.vicbioinformatics.com/
>> >> >> >>
>> >> >> >>
>> >> >> --
>> >> >> -------------------------------------------------------------
>> >> >> Hilmar Lappemail: lapp at gnf.org
>> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> >> -------------------------------------------------------------
>> >> >>
>> >> >>
>> >> >
>> >> >
>> >> --
>> >> -------------------------------------------------------------
>> >> Hilmar Lappemail: lapp at gnf.org
>> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> -------------------------------------------------------------
>> >>
>> >>
>> >>
>> --
>> -------------------------------------------------------------
>> Hilmar Lapp????????????????????????????email: lapp at gnf.org
>> GNF, San Diego, Ca. 92121??????????????phone: +1-858-812-1757
>> -------------------------------------------------------------
>>
>>
>>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------



From angshu96 at gmail.com  Fri Dec 30 20:28:47 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec 30 20:25:34 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <6a1461589de1c31b88ebbfa1d6e94d44@gmx.net>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<df8328740512291800q23a756f5w8b5282c68f5d01a7@mail.gmail.com>
	<df8328740512301429k51ebb690jeef6fc1b47705635@mail.gmail.com>
	<33f89146e1b14860a2f76475214a0c32@gmx.net>
	<df8328740512301501sc7c00f6r80da5ee7ef9d1b3a@mail.gmail.com>
	<84c80704820ab7d6ee3f474ff39338dd@gmx.net>
	<df8328740512301515g1227ab01g23cb57c9d8b9ccce@mail.gmail.com>
	<5e182836514be51503a73d5c998b1bb6@gmx.net>
	<df8328740512301613o377336bay95bca8b6d5cb9f44@mail.gmail.com>
	<6a1461589de1c31b88ebbfa1d6e94d44@gmx.net>
Message-ID: <df8328740512301728p7dc9b416m3c08c084b3201aaf@mail.gmail.com>

A new error:

I installed bioperl-db in my own WinXP m/c following instructions in CVS by
Chris Fields. I'm trying to run the same command from this m/c (the postgres
db resides in the linux box) and getting the error:

Loading NC_003076.gbk ...
Undefined subroutine &Bio::Root::Root::debug called at
C:/Perl/site/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm line 1537, <GEN0>
line 766536.

Any inputs on this?



On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
> I suspect it's either a (out-of-)memory error or a binary
> incompatibility.
>
> You haven't yet run the bioperl-db test suite, have you? Please don't
> ask for more help before you haven't done that.
>
> Also, you do remember my earlier answer to a similar report from you,
> right?
> http://portal.open-bio.org/pipermail/bioperl-l/2005-December/020389.html
>
> The two first things to do is to check whether you run out of shared
> memory and to run the tests and see whether the location where the
> process gets killed can be narrowed down. If it's not a bug (which it
> is unlikely to be - but the tests will provide more evidence) then the
> next step would be to recompile your own perl, DBI and DBD::Pg, and
> PostgreSQL, in that order.
>
>         -hilmar
>
> On Dec 30, 2005, at 4:13 PM, Angshu Kar wrote:
>
> > oops! he is not present now!
> > anyways, if you have some time could you please if there are any
> > reasons for the script to get killed with the .gbk file?
> >
> > Thanks,
> > Angshu
> >
> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
> >> actually in a config file, and the default installation of Postgres
> >> makes this config file unreadable for every one except the pg-admin
> >> user chosen at installation time.
> >>
> >> -hilmar
> >>
> >> On Dec 30, 2005, at 3:15 PM, Angshu Kar wrote:
> >>
> >> > I've no clue about my Pg setup! It has been done by the sysadmin! :(
> >> > Could you please tell me the commands and I can run and let you know
> >> > the reports?
> >> >
> >> > thanks,
> >> > angshu
> >> >
> >> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
> >> >>
> >> >> Also, you haven't reported your hw setup. In particular, how much
> >> >> memory and swap do you have, is Pg running locally (your command
> >> line
> >> >> suggests it does), and how much memory have you allocated to Pg?
> >> >>
> >> >> -hilmar
> >> >>
> >> >> On Dec 30, 2005, at 3:01 PM, Angshu Kar wrote:
> >> >>
> >> >> > Yes Hilmar its indeed a full sequence of chromosome. I got it
> >> from
> >> >> > ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V/
> >> >> > I tried with the .faa and .fna files and they ran successfully.
> >> >> > Also I missed a line (may be relevant) in the debug o/p:
> >> >> > no adaptor found for class Bio::Annotation::TypeManager
> >> >> >
> >> >> > Thanks,
> >> >> > Angshu
> >> >> >
> >> >> >
> >> >> > On 12/30/05, Hilmar Lapp < hlapp@gmx.net> wrote:
> >> >> >> special about this one? The file name lets me guess the input
> >> is a
> >> >> >> contig or even a full chromosome? Is the input on which the
> >> process
> >> >> >> wasn't killed of the same nature? Are the sequences of
> >> comparable
> >> >> or
> >> >> >> vastly different lengths? Is there only a single contig in the
> >> >> >> offending input? Can you reproduce the problem on an empty
> >> database
> >> >> >> with input containing a single entry? If so, let me know where I
> >> >> can
> >> >> >> get that file from and I'll try to reproduce it locally.
> >> >> >>
> >> >> >> -hilmar
> >> >> >>
> >> >> >> On Dec 30, 2005, at 2:29 PM, Angshu Kar wrote:
> >> >> >>
> >> >> >> > Any clues why my load_seqdatabase.pl (./load_seqdatabase.pl
> >> >> >> > --dbname=USBA --dbuser=postgres --format=genbank --driver=Pg
> >> >> --debug
> >> >> >> > NC_003076.gbk)
> >> >> >> > is getting killed after the follwoing step?
> >>  >> >> >
> >> >> >> >Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as driver
> >> peer
> >> >> >> > for Bio::DB::BioSQL::BiosequenceAdaptor
> >> >> >> > preparing SELECT statement: SELECT bioentry_id FROM
> >> biosequence
> >> >> >> WHERE
> >> >> >> > bioentry_id = ?
> >> >> >> >
> >> >> >> > Killed
> >> >> >> >
> >> >> >> > I'm using a linux box. This didn't happen for a different i/p
> >> >> file!
> >> >> >> >
> >> >> >> > Thanks,
> >> >> >> > Angshu
> >> >> >> >
> >> >> >> >
> >> >> >> > On 12/29/05, Angshu Kar < angshu96@gmail.com> wrote: I'm sorry
> >> >> that
> >> >> >> I
> >> >> >> > missed it! Thanks for pointing it out.
> >> >> >> >> Also thanks Hilmar for the update.
> >> >> >> >>
> >> >> >> >> Angshu
> >> >> >> >>
> >> >> >> >>
> >> >>>> >> On 12/29/05, Torsten Seemann <
> >> >> >> torsten.seemann@infotech.monash.edu.au
> >> >> >> >> > wrote:> I'm getting the following error while trying to
> >> run :
> >> >> >> >>> > ./load_seqdatabase.pl -host localhost -dbname USBA -dbuser
> >> >> >> >>> postgres -format
> >> >> >> >>> > genbank NC_003076.gbk
> >> >> >> >>> > MSG: failed to open connection: Can't connect to local
> >> MySQL
> >> >> >> >>> server through
> >> >> >> >>> > socket '/var/lib/mysql/mysql.sock' (2)
> >> >> >> >>> > But I've a postgreSQL db and not a MySQL one...could
> >> anyone
> >> >> >> please
> >> >>>> >>> guide me
> >> >> >> >>> > troubleshoot this?
> >> >> >> >>>
> >> >> >> >>> Did you read the documentation for the load_seqdatabase.pl
> >> >> script?
> >> >> >> >>>
> >> >> >> >>> It's in the script itself!
> >> >> >> >>>
> >> >> >> >>> =item --driver $driver
> >> >> >> >>> the DBI driver name for the RDBMS e.g., mysql, Pg, or Oracle
> >> >> >> >>> [mysql]
> >> >> >> >>>
> >> >> >> >>> The default DBI driver is [mysql].
> >> >> >> >>>
> >> >> >> >>> I think you want the option "-driver Pg".
> >> >> >> >>>
> >> >> >>>>> --
> >> >> >> >>> Torsten Seemann
> >> >> >> >>> Victorian Bioinformatics Consortium, Monash University,
> >> >> Australia
> >> >> >> >>> http://www.vicbioinformatics.com/
> >> >> >> >>
> >> >> >> >>
> >> >> >> --
> >> >> >> -------------------------------------------------------------
> >> >> >> Hilmar Lappemail: lapp at gnf.org
> >> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> >> >> -------------------------------------------------------------
> >> >> >>
> >> >> >>
> >> >> >
> >> >> >
> >> >> --
> >> >> -------------------------------------------------------------
> >> >> Hilmar Lappemail: lapp at gnf.org
> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> >> -------------------------------------------------------------
> >> >>
> >> >>
> >> >>
> >> --
> >> -------------------------------------------------------------
> >> Hilmar Lappemail: lapp at gnf.org
> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> -------------------------------------------------------------
> >>
> >>
> >>
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From angshu96 at gmail.com  Fri Dec 30 20:59:03 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec 30 20:55:52 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <6a1461589de1c31b88ebbfa1d6e94d44@gmx.net>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<df8328740512291800q23a756f5w8b5282c68f5d01a7@mail.gmail.com>
	<df8328740512301429k51ebb690jeef6fc1b47705635@mail.gmail.com>
	<33f89146e1b14860a2f76475214a0c32@gmx.net>
	<df8328740512301501sc7c00f6r80da5ee7ef9d1b3a@mail.gmail.com>
	<84c80704820ab7d6ee3f474ff39338dd@gmx.net>
	<df8328740512301515g1227ab01g23cb57c9d8b9ccce@mail.gmail.com>
	<5e182836514be51503a73d5c998b1bb6@gmx.net>
	<df8328740512301613o377336bay95bca8b6d5cb9f44@mail.gmail.com>
	<6a1461589de1c31b88ebbfa1d6e94d44@gmx.net>
Message-ID: <df8328740512301759r22cb8ba3u1d1e48c7d6c33694@mail.gmail.com>

Hi Hilmar,

All my tests failed for my WInXP m/c!I'm really at a fix!:(
Do I need to uninstall bioperl-db, bioperl and even perl??? How to do that?
Please guide.
I'll be obliged if anyone with WinXp (not cygwin) provides his/her feedback
...

Thanks,
Angshu

Microsoft (R) Program Maintenance Utility   Version 1.50
Copyright (c) Microsoft Corp 1988-94. All rights reserved.

        C:\Perl\bin\perl.exe "-MExtUtils::Command::MM" "-e" "test_harness(0,
'bl
ib\lib', 'blib\arch')" t\01dbadaptor.t t\02species.t t\03simpleseq.t
t\04swiss.t
 t\05seqfeature.t t\06comment.t t\07dblink.t t\08genbank.t t\09fuzzy2.t
t\10ense
mbl.t t\11locuslink.t t\12ontology.t t\13remove.t t\14query.t t\15cluster.t
t\01dbadaptor.....driver not set at t/DBTestHarness.pm line 106
        DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called at
t/DBTest
Harness.pm line 204
        DBTestHarness::create_db('DBTestHarness=HASH(0x235278)') called at
t/DBT
estHarness.pm line 94
        DBTestHarness::new('DBTestHarness', 'biosql') called at
t\01dbadaptor.t
line 20
t\01dbadaptor.....dubious
        Test returned status 2 (wstat 512, 0x200)
DIED. FAILED tests 1-19
        Failed 19/19 tests, 0.00% okay
t\02species.......driver not set at t/DBTestHarness.pm line 106
        DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called at
t/DBTest
Harness.pm line 204
        DBTestHarness::create_db('DBTestHarness=HASH(0x235278)') called at
t/DBT
estHarness.pm line 94
        DBTestHarness::new('DBTestHarness', 'biosql') called at
t\02species.t li
ne 18
t\02species.......dubious
        Test returned status 2 (wstat 512, 0x200)
DIED. FAILED tests 1-65
        Failed 65/65 tests, 0.00% okay
t\03simpleseq.....driver not set at t/DBTestHarness.pm line 106
        DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called at
t/DBTest
Harness.pm line 204
        DBTestHarness::create_db('DBTestHarness=HASH(0x235278)') called at
t/DBT
estHarness.pm line 94
        DBTestHarness::new('DBTestHarness', 'biosql') called at
t\03simpleseq.t
line 19
t\03simpleseq.....dubious
        Test returned status 2 (wstat 512, 0x200)
DIED. FAILED tests 1-59
        Failed 59/59 tests, 0.00% okay
t\04swiss.........driver not set at t/DBTestHarness.pm line 106
        DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called at
t/DBTest
Harness.pm line 204
        DBTestHarness::create_db('DBTestHarness=HASH(0x235278)') called at
t/DBT
estHarness.pm line 94
        DBTestHarness::new('DBTestHarness', 'biosql') called at t\04swiss.t
line
 20
t\04swiss.........dubious
        Test returned status 2 (wstat 512, 0x200)
DIED. FAILED tests 1-52
        Failed 52/52 tests, 0.00% okay
t\05seqfeature....driver not set at t/DBTestHarness.pm line 106
        DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called at
t/DBTest
Harness.pm line 204
        DBTestHarness::create_db('DBTestHarness=HASH(0x235278)') called at
t/DBT
estHarness.pm line 94
        DBTestHarness::new('DBTestHarness', 'biosql') called at
t\05seqfeature.t
 line 19
t\05seqfeature....dubious
        Test returned status 2 (wstat 512, 0x200)
DIED. FAILED tests 1-48
        Failed 48/48 tests, 0.00% okay
t\06comment.......driver not set at t/DBTestHarness.pm line 106
        DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called at
t/DBTest
Harness.pm line 204
        DBTestHarness::create_db('DBTestHarness=HASH(0x235278)') called at
t/DBT
estHarness.pm line 94
        DBTestHarness::new('DBTestHarness', 'biosql') called at
t\06comment.t li
ne 20
t\06comment.......dubious
        Test returned status 2 (wstat 512, 0x200)
DIED. FAILED tests 1-11
        Failed 11/11 tests, 0.00% okay
t\07dblink........driver not set at t/DBTestHarness.pm line 106
        DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called at
t/DBTest
Harness.pm line 204
        DBTestHarness::create_db('DBTestHarness=HASH(0x235278)') called at
t/DBT
estHarness.pm line 94
        DBTestHarness::new('DBTestHarness', 'biosql') called at t\07dblink.t
lin
e 21
t\07dblink........dubious
        Test returned status 2 (wstat 512, 0x200)
DIED. FAILED tests 1-18
        Failed 18/18 tests, 0.00% okay
t\08genbank.......driver not set at t/DBTestHarness.pm line 106
        DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called at
t/DBTest
Harness.pm line 204
        DBTestHarness::create_db('DBTestHarness=HASH(0x235278)') called at
t/DBT
estHarness.pm line 94
        DBTestHarness::new('DBTestHarness', 'biosql') called at
t\08genbank.t li
ne 21
t\08genbank.......dubious
        Test returned status 2 (wstat 512, 0x200)
DIED. FAILED tests 1-18
        Failed 18/18 tests, 0.00% okay
t\09fuzzy2........driver not set at t/DBTestHarness.pm line 106
        DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called at
t/DBTest
Harness.pm line 204
        DBTestHarness::create_db('DBTestHarness=HASH(0x235278)') called at
t/DBT
estHarness.pm line 94
        DBTestHarness::new('DBTestHarness', 'biosql') called at t\09fuzzy2.t
lin
e 26
t\09fuzzy2........dubious
        Test returned status 2 (wstat 512, 0x200)
DIED. FAILED tests 1-21
        Failed 21/21 tests, 0.00% okay
t\10ensembl.......driver not set at t/DBTestHarness.pm line 106
        DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called at
t/DBTest
Harness.pm line 204
        DBTestHarness::create_db('DBTestHarness=HASH(0x235278)') called at
t/DBT
estHarness.pm line 94
        DBTestHarness::new('DBTestHarness', 'biosql') called at
t\10ensembl.t li
ne 21
t\10ensembl.......dubious
        Test returned status 2 (wstat 512, 0x200)
DIED. FAILED tests 1-15
        Failed 15/15 tests, 0.00% okay
t\11locuslink.....driver not set at t/DBTestHarness.pm line 106
        DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called at
t/DBTest
Harness.pm line 204
        DBTestHarness::create_db('DBTestHarness=HASH(0x235278)') called at
t/DBT
estHarness.pm line 94
        DBTestHarness::new('DBTestHarness', 'biosql') called at
t\11locuslink.t
line 21
t\11locuslink.....dubious
        Test returned status 2 (wstat 512, 0x200)
DIED. FAILED tests 1-110
        Failed 110/110 tests, 0.00% okay
t\12ontology......driver not set at t/DBTestHarness.pm line 106
        DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called at
t/DBTest
Harness.pm line 204
        DBTestHarness::create_db('DBTestHarness=HASH(0x235278)') called at
t/DBT
estHarness.pm line 94
        DBTestHarness::new('DBTestHarness', 'biosql') called at
t\12ontology.t l
ine 19
t\12ontology......dubious
        Test returned status 2 (wstat 512, 0x200)
DIED. FAILED tests 1-738
        Failed 738/738 tests, 0.00% okay
t\13remove........driver not set at t/DBTestHarness.pm line 106
        DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called at
t/DBTest
Harness.pm line 204
        DBTestHarness::create_db('DBTestHarness=HASH(0x235278)') called at
t/DBT
estHarness.pm line 94
        DBTestHarness::new('DBTestHarness', 'biosql') called at t\13remove.t
lin
e 19
t\13remove........dubious
        Test returned status 2 (wstat 512, 0x200)
DIED. FAILED tests 1-59
        Failed 59/59 tests, 0.00% okay
t\14query.........ok
t\15cluster.......driver not set at t/DBTestHarness.pm line 106
        DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called at
t/DBTest
Harness.pm line 204
        DBTestHarness::create_db('DBTestHarness=HASH(0x235278)') called at
t/DBT
estHarness.pm line 94
        DBTestHarness::new('DBTestHarness', 'biosql') called at
t\15cluster.t li
ne 19
t\15cluster.......dubious
        Test returned status 2 (wstat 512, 0x200)
DIED. FAILED tests 1-160
        Failed 160/160 tests, 0.00% okay
Failed Test      Stat Wstat Total Fail  Failed  List of Failed
-------------------------------------------------------------------------------
t\01dbadaptor.t     2   512    19   38 200.00%  1-19
t\02species.t       2   512    65  130 200.00%  1-65
t\03simpleseq.t     2   512    59  118 200.00%  1-59
t\04swiss.t         2   512    52  104 200.00%  1-52
t\05seqfeature.t    2   512    48   96 200.00%  1-48
t\06comment.t       2   512    11   22 200.00%  1-11
t\07dblink.t        2   512    18   36 200.00%  1-18
t\08genbank.t       2   512    18   36 200.00%  1-18
t\09fuzzy2.t        2   512    21   42 200.00%  1-21
t\10ensembl.t       2   512    15   30 200.00%  1-15
t\11locuslink.t     2   512   110  220 200.00%  1-110
t\12ontology.t      2   512   738 1476 200.00%  1-738
t\13remove.t        2   512    59  118 200.00%  1-59
t\15cluster.t       2   512   160  320 200.00%  1-160
Failed 14/15 test scripts, 6.67% okay. 1393/1411 subtests failed, 1.28%okay.
NMAKE : fatal error U1077: 'C:\WINDOWS\system32\cmd.exe' : return code '0x2'
Stop.

On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
> I suspect it's either a (out-of-)memory error or a binary
> incompatibility.
>
> You haven't yet run the bioperl-db test suite, have you? Please don't
> ask for more help before you haven't done that.
>
> Also, you do remember my earlier answer to a similar report from you,
> right?
> http://portal.open-bio.org/pipermail/bioperl-l/2005-December/020389.html
>
> The two first things to do is to check whether you run out of shared
> memory and to run the tests and see whether the location where the
> process gets killed can be narrowed down. If it's not a bug (which it
> is unlikely to be - but the tests will provide more evidence) then the
> next step would be to recompile your own perl, DBI and DBD::Pg, and
> PostgreSQL, in that order.
>
>         -hilmar
>
> On Dec 30, 2005, at 4:13 PM, Angshu Kar wrote:
>
> > oops! he is not present now!
> > anyways, if you have some time could you please if there are any
> > reasons for the script to get killed with the .gbk file?
> >
> > Thanks,
> > Angshu
> >
> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
> >> actually in a config file, and the default installation of Postgres
> >> makes this config file unreadable for every one except the pg-admin
> >> user chosen at installation time.
> >>
> >> -hilmar
> >>
> >> On Dec 30, 2005, at 3:15 PM, Angshu Kar wrote:
> >>
> >> > I've no clue about my Pg setup! It has been done by the sysadmin! :(
> >> > Could you please tell me the commands and I can run and let you know
> >> > the reports?
> >> >
> >> > thanks,
> >> > angshu
> >> >
> >> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
> >> >>
> >> >> Also, you haven't reported your hw setup. In particular, how much
> >> >> memory and swap do you have, is Pg running locally (your command
> >> line
> >> >> suggests it does), and how much memory have you allocated to Pg?
> >> >>
> >> >> -hilmar
> >> >>
> >> >> On Dec 30, 2005, at 3:01 PM, Angshu Kar wrote:
> >> >>
> >> >> > Yes Hilmar its indeed a full sequence of chromosome. I got it
> >> from
> >> >> > ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V/
> >> >> > I tried with the .faa and .fna files and they ran successfully.
> >> >> > Also I missed a line (may be relevant) in the debug o/p:
> >> >> > no adaptor found for class Bio::Annotation::TypeManager
> >> >> >
> >> >> > Thanks,
> >> >> > Angshu
> >> >> >
> >> >> >
> >> >> > On 12/30/05, Hilmar Lapp < hlapp@gmx.net> wrote:
> >> >> >> special about this one? The file name lets me guess the input
> >> is a
> >> >> >> contig or even a full chromosome? Is the input on which the
> >> process
> >> >> >> wasn't killed of the same nature? Are the sequences of
> >> comparable
> >> >> or
> >> >> >> vastly different lengths? Is there only a single contig in the
> >> >> >> offending input? Can you reproduce the problem on an empty
> >> database
> >> >> >> with input containing a single entry? If so, let me know where I
> >> >> can
> >> >> >> get that file from and I'll try to reproduce it locally.
> >> >> >>
> >> >> >> -hilmar
> >> >> >>
> >> >> >> On Dec 30, 2005, at 2:29 PM, Angshu Kar wrote:
> >> >> >>
> >> >> >> > Any clues why my load_seqdatabase.pl (./load_seqdatabase.pl
> >> >> >> > --dbname=USBA --dbuser=postgres --format=genbank --driver=Pg
> >> >> --debug
> >> >> >> > NC_003076.gbk)
> >> >> >> > is getting killed after the follwoing step?
> >>  >> >> >
> >> >> >> >Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as driver
> >> peer
> >> >> >> > for Bio::DB::BioSQL::BiosequenceAdaptor
> >> >> >> > preparing SELECT statement: SELECT bioentry_id FROM
> >> biosequence
> >> >> >> WHERE
> >> >> >> > bioentry_id = ?
> >> >> >> >
> >> >> >> > Killed
> >> >> >> >
> >> >> >> > I'm using a linux box. This didn't happen for a different i/p
> >> >> file!
> >> >> >> >
> >> >> >> > Thanks,
> >> >> >> > Angshu
> >> >> >> >
> >> >> >> >
> >> >> >> > On 12/29/05, Angshu Kar < angshu96@gmail.com> wrote: I'm sorry
> >> >> that
> >> >> >> I
> >> >> >> > missed it! Thanks for pointing it out.
> >> >> >> >> Also thanks Hilmar for the update.
> >> >> >> >>
> >> >> >> >> Angshu
> >> >> >> >>
> >> >> >> >>
> >> >>>> >> On 12/29/05, Torsten Seemann <
> >> >> >> torsten.seemann@infotech.monash.edu.au
> >> >> >> >> > wrote:> I'm getting the following error while trying to
> >> run :
> >> >> >> >>> > ./load_seqdatabase.pl -host localhost -dbname USBA -dbuser
> >> >> >> >>> postgres -format
> >> >> >> >>> > genbank NC_003076.gbk
> >> >> >> >>> > MSG: failed to open connection: Can't connect to local
> >> MySQL
> >> >> >> >>> server through
> >> >> >> >>> > socket '/var/lib/mysql/mysql.sock' (2)
> >> >> >> >>> > But I've a postgreSQL db and not a MySQL one...could
> >> anyone
> >> >> >> please
> >> >>>> >>> guide me
> >> >> >> >>> > troubleshoot this?
> >> >> >> >>>
> >> >> >> >>> Did you read the documentation for the load_seqdatabase.pl
> >> >> script?
> >> >> >> >>>
> >> >> >> >>> It's in the script itself!
> >> >> >> >>>
> >> >> >> >>> =item --driver $driver
> >> >> >> >>> the DBI driver name for the RDBMS e.g., mysql, Pg, or Oracle
> >> >> >> >>> [mysql]
> >> >> >> >>>
> >> >> >> >>> The default DBI driver is [mysql].
> >> >> >> >>>
> >> >> >> >>> I think you want the option "-driver Pg".
> >> >> >> >>>
> >> >> >>>>> --
> >> >> >> >>> Torsten Seemann
> >> >> >> >>> Victorian Bioinformatics Consortium, Monash University,
> >> >> Australia
> >> >> >> >>> http://www.vicbioinformatics.com/
> >> >> >> >>
> >> >> >> >>
> >> >> >> --
> >> >> >> -------------------------------------------------------------
> >> >> >> Hilmar Lappemail: lapp at gnf.org
> >> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> >> >> -------------------------------------------------------------
> >> >> >>
> >> >> >>
> >> >> >
> >> >> >
> >> >> --
> >> >> -------------------------------------------------------------
> >> >> Hilmar Lappemail: lapp at gnf.org
> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> >> -------------------------------------------------------------
> >> >>
> >> >>
> >> >>
> >> --
> >> -------------------------------------------------------------
> >> Hilmar Lappemail: lapp at gnf.org
> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> -------------------------------------------------------------
> >>
> >>
> >>
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From hlapp at gmx.net  Fri Dec 30 22:58:00 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri Dec 30 22:55:41 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <df8328740512301759r22cb8ba3u1d1e48c7d6c33694@mail.gmail.com>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<df8328740512291800q23a756f5w8b5282c68f5d01a7@mail.gmail.com>
	<df8328740512301429k51ebb690jeef6fc1b47705635@mail.gmail.com>
	<33f89146e1b14860a2f76475214a0c32@gmx.net>
	<df8328740512301501sc7c00f6r80da5ee7ef9d1b3a@mail.gmail.com>
	<84c80704820ab7d6ee3f474ff39338dd@gmx.net>
	<df8328740512301515g1227ab01g23cb57c9d8b9ccce@mail.gmail.com>
	<5e182836514be51503a73d5c998b1bb6@gmx.net>
	<df8328740512301613o377336bay95bca8b6d5cb9f44@mail.gmail.com>
	<6a1461589de1c31b88ebbfa1d6e94d44@gmx.net>
	<df8328740512301759r22cb8ba3u1d1e48c7d6c33694@mail.gmail.com>
Message-ID: <5b321da72f66dc31312cb30deb6269a5@gmx.net>

Angshu, next time you feel the urge to write such an email restrain  
yourself, hold off, sit back, and, most importantly, think.

The error message clearly says 'driver not set'. Did you do anything  
that assures you that you *have* set the driver?

I suppose you forgot to follow the instructions for running the tests,  
namely to copy
t/DBHarness.conf.example to t/DBHarness.biosql.conf, and edit to suit  
your setup. This is documented, and I told you about this step earlier.

	-hilmar

On Dec 30, 2005, at 5:59 PM, Angshu Kar wrote:

> Hi Hilmar,
>
> All my tests failed for my WInXP m/c!I'm really at a fix!:(
> Do I need to uninstall bioperl-db, bioperl and even perl??? How to do  
> that?
> Please guide.
> I'll be obliged if anyone with WinXp (not cygwin) provides his/her  
> feedback ...
>
> Thanks,
> Angshu
>
> Microsoft (R) Program Maintenance Utility?? Version 1.50
> Copyright (c) Microsoft Corp 1988-94. All rights reserved.
>
> ??????? C:\Perl\bin\perl.exe "-MExtUtils::Command::MM" "-e"  
> "test_harness(0, 'bl
> ib\lib', 'blib\arch')" t\01dbadaptor.t t\02species.t t\03simpleseq.t  
> t\04swiss.t
> ?t\05seqfeature.t t\06comment.t t\07dblink.t t\08genbank.t  
> t\09fuzzy2.t t\10ense
> mbl.t t\11locuslink.t t\12ontology.t t\13remove.t t\14query.t  
> t\15cluster.t
>  t\01dbadaptor.....driver not set at t/DBTestHarness.pm line 106
> ??????? DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called  
> at t/DBTest
> Harness.pm line 204
> ??????? DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')  
> called at t/DBT
> estHarness.pm line 94
> ??????? DBTestHarness::new('DBTestHarness', 'biosql') called at  
> t\01dbadaptor.t
> line 20
> t\01dbadaptor.....dubious
>  ??????? Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-19
> ??????? Failed 19/19 tests, 0.00% okay
> t\02species.......driver not set at t/DBTestHarness.pm line 106
> ??????? DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called  
> at t/DBTest
> Harness.pm line 204
> ??????? DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')  
> called at t/DBT
> estHarness.pm line 94
> ??????? DBTestHarness::new('DBTestHarness', 'biosql') called at  
> t\02species.t li
> ne 18
> t\02species.......dubious
>  ??????? Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-65
> ??????? Failed 65/65 tests, 0.00% okay
> t\03simpleseq.....driver not set at t/DBTestHarness.pm line 106
> ??????? DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called  
> at t/DBTest
> Harness.pm line 204
> ??????? DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')  
> called at t/DBT
> estHarness.pm line 94
> ??????? DBTestHarness::new('DBTestHarness', 'biosql') called at  
> t\03simpleseq.t
> line 19
> t\03simpleseq.....dubious
>  ??????? Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-59
> ??????? Failed 59/59 tests, 0.00% okay
> t\04swiss.........driver not set at t/DBTestHarness.pm line 106
> ??????? DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called  
> at t/DBTest
> Harness.pm line 204
> ??????? DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')  
> called at t/DBT
> estHarness.pm line 94
> ??????? DBTestHarness::new('DBTestHarness', 'biosql') called at  
> t\04swiss.t line
> ?20
> t\04swiss.........dubious
>  ??????? Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-52
> ??????? Failed 52/52 tests, 0.00% okay
> t\05seqfeature....driver not set at t/DBTestHarness.pm line 106
> ??????? DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called  
> at t/DBTest
> Harness.pm line 204
> ??????? DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')  
> called at t/DBT
> estHarness.pm line 94
> ??????? DBTestHarness::new('DBTestHarness', 'biosql') called at  
> t\05seqfeature.t
> ?line 19
> t\05seqfeature....dubious
>  ??????? Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-48
> ??????? Failed 48/48 tests, 0.00% okay
> t\06comment.......driver not set at t/DBTestHarness.pm line 106
> ??????? DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called  
> at t/DBTest
> Harness.pm line 204
> ??????? DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')  
> called at t/DBT
> estHarness.pm line 94
> ??????? DBTestHarness::new('DBTestHarness', 'biosql') called at  
> t\06comment.t li
> ne 20
> t\06comment.......dubious
>  ??????? Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-11
> ??????? Failed 11/11 tests, 0.00% okay
> t\07dblink........driver not set at t/DBTestHarness.pm line 106
> ??????? DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called  
> at t/DBTest
> Harness.pm line 204
> ??????? DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')  
> called at t/DBT
> estHarness.pm line 94
> ??????? DBTestHarness::new('DBTestHarness', 'biosql') called at  
> t\07dblink.t lin
> e 21
> t\07dblink........dubious
>  ??????? Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-18
> ??????? Failed 18/18 tests, 0.00% okay
> t\08genbank.......driver not set at t/DBTestHarness.pm line 106
> ??????? DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called  
> at t/DBTest
> Harness.pm line 204
> ??????? DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')  
> called at t/DBT
> estHarness.pm line 94
> ??????? DBTestHarness::new('DBTestHarness', 'biosql') called at  
> t\08genbank.t li
> ne 21
> t\08genbank.......dubious
>  ??????? Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-18
> ??????? Failed 18/18 tests, 0.00% okay
> t\09fuzzy2........driver not set at t/DBTestHarness.pm line 106
> ??????? DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called  
> at t/DBTest
> Harness.pm line 204
> ??????? DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')  
> called at t/DBT
> estHarness.pm line 94
> ??????? DBTestHarness::new('DBTestHarness', 'biosql') called at  
> t\09fuzzy2.t lin
> e 26
> t\09fuzzy2........dubious
>  ??????? Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-21
> ??????? Failed 21/21 tests, 0.00% okay
> t\10ensembl.......driver not set at t/DBTestHarness.pm line 106
> ??????? DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called  
> at t/DBTest
> Harness.pm line 204
> ??????? DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')  
> called at t/DBT
> estHarness.pm line 94
> ??????? DBTestHarness::new('DBTestHarness', 'biosql') called at  
> t\10ensembl.t li
> ne 21
> t\10ensembl.......dubious
>  ??????? Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-15
> ??????? Failed 15/15 tests, 0.00% okay
> t\11locuslink.....driver not set at t/DBTestHarness.pm line 106
> ??????? DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called  
> at t/DBTest
> Harness.pm line 204
> ??????? DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')  
> called at t/DBT
> estHarness.pm line 94
> ??????? DBTestHarness::new('DBTestHarness', 'biosql') called at  
> t\11locuslink.t
> line 21
> t\11locuslink.....dubious
>  ??????? Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-110
> ??????? Failed 110/110 tests, 0.00% okay
> t\12ontology......driver not set at t/DBTestHarness.pm line 106
> ??????? DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called  
> at t/DBTest
> Harness.pm line 204
> ??????? DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')  
> called at t/DBT
> estHarness.pm line 94
> ??????? DBTestHarness::new('DBTestHarness', 'biosql') called at  
> t\12ontology.t l
> ine 19
> t\12ontology......dubious
>  ??????? Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-738
> ??????? Failed 738/738 tests, 0.00% okay
> t\13remove........driver not set at t/DBTestHarness.pm line 106
> ??????? DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called  
> at t/DBTest
> Harness.pm line 204
> ??????? DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')  
> called at t/DBT
> estHarness.pm line 94
> ??????? DBTestHarness::new('DBTestHarness', 'biosql') called at  
> t\13remove.t lin
> e 19
> t\13remove........dubious
>  ??????? Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-59
> ??????? Failed 59/59 tests, 0.00% okay
> t\14query.........ok
> t\15cluster.......driver not set at t/DBTestHarness.pm line 106
> ??????? DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called  
> at t/DBTest
> Harness.pm line 204
> ??????? DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')  
> called at t/DBT
> estHarness.pm line 94
> ??????? DBTestHarness::new('DBTestHarness', 'biosql') called at  
> t\15cluster.t li
> ne 19
> t\15cluster.......dubious
> ??????? Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-160
> ??????? Failed 160/160 tests, 0.00% okay
> Failed Test????? Stat Wstat Total Fail? Failed? List of Failed
> ----------------------------------------------------------------------- 
> --------
> t\01dbadaptor.t???? 2?? 512??? 19?? 38 200.00%? 1-19
> t\02species.t?????? 2?? 512??? 65? 130 200.00%? 1-65
> t\03simpleseq.t???? 2?? 512??? 59? 118 200.00%? 1-59
> t\04swiss.t???????? 2?? 512??? 52? 104 200.00%? 1-52
> t\05seqfeature.t??? 2?? 512??? 48?? 96 200.00%? 1-48
> t\06comment.t?????? 2?? 512??? 11?? 22 200.00%? 1-11
> t\07dblink.t??????? 2?? 512??? 18?? 36 200.00%? 1-18
> t\08genbank.t?????? 2?? 512??? 18?? 36 200.00%? 1-18
> t\09fuzzy2.t??????? 2?? 512??? 21?? 42 200.00%? 1-21
> t\10ensembl.t?????? 2?? 512??? 15?? 30 200.00%? 1-15
> t\11locuslink.t???? 2?? 512?? 110? 220 200.00%? 1-110
> t\12ontology.t????? 2?? 512?? 738 1476 200.00%? 1-738
> t\13remove.t??????? 2?? 512??? 59? 118 200.00%? 1-59
> t\15cluster.t?????? 2?? 512?? 160? 320 200.00%? 1-160
> Failed 14/15 test scripts, 6.67% okay. 1393/1411 subtests failed,  
> 1.28% okay.
>  NMAKE : fatal error U1077: 'C:\WINDOWS\system32\cmd.exe' : return  
> code '0x2'
> Stop.
>
> On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:I suspect it's either a  
> (out-of-)memory error or a binary
>> incompatibility.
>>
>> You haven't yet run the bioperl-db test suite, have you? Please don't
>> ask for more help before you haven't done that.
>>
>> Also, you do remember my earlier answer to a similar report from you,
>> right?
>> http://portal.open-bio.org/pipermail/bioperl-l/2005-December/ 
>> 020389.html
>>
>> The two first things to do is to check whether you run out of shared
>> memory and to run the tests and see whether the location where the
>> process gets killed can be narrowed down. If it's not a bug (which it
>> is unlikely to be - but the tests will provide more evidence) then the
>>  next step would be to recompile your own perl, DBI and DBD::Pg, and
>> PostgreSQL, in that order.
>>
>> ????????-hilmar
>>
>> On Dec 30, 2005, at 4:13 PM, Angshu Kar wrote:
>>
>> > oops! he is not present now!
>> > anyways, if you have some time could you please if there are any
>> > reasons for the script to get killed with the .gbk file?
>> >
>> > Thanks,
>> > Angshu
>> >
>> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>> >> actually in a config file, and the default installation of Postgres
>> >> makes this config file unreadable for every one except the pg-admin
>> >> user chosen at installation time.
>> >>
>> >> -hilmar
>> >>
>> >> On Dec 30, 2005, at 3:15 PM, Angshu Kar wrote:
>> >>
>> >> > I've no clue about my Pg setup! It has been done by the  
>> sysadmin! :(
>> >> > Could you please tell me the commands and I can run and let you  
>> know
>> >> > the reports?
>> >> >
>> >> > thanks,
>> >> > angshu
>> >> >
>> >> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>> >> >>
>> >> >> Also, you haven't reported your hw setup. In particular, how  
>> much
>> >> >> memory and swap do you have, is Pg running locally (your command
>> >> line
>> >> >> suggests it does), and how much memory have you allocated to Pg?
>> >> >>
>> >> >> -hilmar
>> >> >>
>> >> >> On Dec 30, 2005, at 3:01 PM, Angshu Kar wrote:
>> >> >>
>> >> >> > Yes Hilmar its indeed a full sequence of chromosome. I got it
>> >> from
>> >> >> > ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V/
>> >> >> > I tried with the .faa and .fna files and they ran  
>> successfully.
>> >> >> > Also I missed a line (may be relevant) in the debug o/p:
>> >> >> > no adaptor found for class Bio::Annotation::TypeManager
>> >> >> >
>> >> >> > Thanks,
>> >> >> > Angshu
>> >> >> >
>> >> >> >
>> >> >> > On 12/30/05, Hilmar Lapp < hlapp@gmx.net> wrote:
>> >> >> >> special about this one? The file name lets me guess the input
>> >> is a
>> >> >> >> contig or even a full chromosome? Is the input on which the
>> >> process
>> >> >> >> wasn't killed of the same nature? Are the sequences of
>> >> comparable
>> >> >> or
>> >> >> >> vastly different lengths? Is there only a single contig in  
>> the
>> >> >> >> offending input? Can you reproduce the problem on an empty
>> >> database
>> >> >> >> with input containing a single entry? If so, let me know  
>> where I
>> >> >> can
>> >> >> >> get that file from and I'll try to reproduce it locally.
>> >> >> >>
>> >> >> >> -hilmar
>> >> >> >>
>> >> >> >> On Dec 30, 2005, at 2:29 PM, Angshu Kar wrote:
>> >> >> >>
>> >> >> >> > Any clues why my load_seqdatabase.pl (./load_seqdatabase.pl
>> >> >> >> > --dbname=USBA --dbuser=postgres --format=genbank  
>> --driver=Pg
>> >> >> --debug
>> >> >> >> > NC_003076.gbk)
>> >> >> >> > is getting killed after the follwoing step?
>> >>??>> >> >
>> >> >> >> >Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as  
>> driver
>> >> peer
>> >> >> >> > for Bio::DB::BioSQL::BiosequenceAdaptor
>> >> >> >> > preparing SELECT statement: SELECT bioentry_id FROM
>> >> biosequence
>> >> >> >> WHERE
>> >> >> >> > bioentry_id = ?
>> >> >> >> >
>> >> >> >> > Killed
>> >> >> >> >
>> >> >> >> > I'm using a linux box. This didn't happen for a different  
>> i/p
>> >> >> file!
>> >> >> >> >
>> >> >> >> > Thanks,
>> >> >> >> > Angshu
>> >> >> >> >
>> >> >> >> >
>> >> >> >> > On 12/29/05, Angshu Kar < angshu96@gmail.com> wrote: I'm  
>> sorry
>> >> >> that
>> >> >> >> I
>> >> >> >> > missed it! Thanks for pointing it out.
>> >> >> >> >> Also thanks Hilmar for the update.
>> >> >> >> >>
>> >> >> >> >> Angshu
>> >> >> >> >>
>> >> >> >> >>
>> >> >>>> >> On 12/29/05, Torsten Seemann <
>> >> >> >> torsten.seemann@infotech.monash.edu.au
>> >> >> >> >> > wrote:> I'm getting the following error while trying to
>> >> run :
>> >> >> >> >>> > ./load_seqdatabase.pl -host localhost -dbname USBA  
>> -dbuser
>> >> >> >> >>> postgres -format
>> >> >> >> >>> > genbank NC_003076.gbk
>> >> >> >> >>> > MSG: failed to open connection: Can't connect to local
>> >> MySQL
>> >> >> >> >>> server through
>> >> >> >> >>> > socket '/var/lib/mysql/mysql.sock' (2)
>> >> >> >> >>> > But I've a postgreSQL db and not a MySQL one...could
>> >> anyone
>> >> >> >> please
>> >> >>>> >>> guide me
>> >> >> >> >>> > troubleshoot this?
>> >> >> >> >>>
>> >> >> >> >>> Did you read the documentation for the  
>> load_seqdatabase.pl
>> >> >> script?
>> >> >> >> >>>
>>  >> >> >> >>> It's in the script itself!
>> >> >> >> >>>
>> >> >> >> >>> =item --driver $driver
>> >> >> >> >>> the DBI driver name for the RDBMS e.g., mysql, Pg, or  
>> Oracle
>> >> >> >> >>> [mysql]
>> >> >> >> >>>
>> >> >> >> >>> The default DBI driver is [mysql].
>> >> >> >> >>>
>> >> >> >> >>> I think you want the option "-driver Pg".
>> >> >> >> >>>
>> >> >> >>>>> --
>> >> >> >> >>> Torsten Seemann
>> >> >> >> >>> Victorian Bioinformatics Consortium, Monash University,
>> >> >> Australia
>> >> >> >> >>> http://www.vicbioinformatics.com/
>> >> >> >> >>
>> >> >> >> >>
>> >> >> >> --
>> >> >> >> -------------------------------------------------------------
>> >> >> >> Hilmar Lappemail: lapp at gnf.org
>> >> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> >> >> -------------------------------------------------------------
>> >> >> >>
>> >> >> >>
>> >> >> >
>> >> >> >
>> >> >> --
>> >> >> -------------------------------------------------------------
>> >> >> Hilmar Lappemail: lapp at gnf.org
>> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> >> -------------------------------------------------------------
>> >> >>
>> >> >>
>> >> >>
>> >> --
>> >> -------------------------------------------------------------
>> >> Hilmar Lappemail: lapp at gnf.org
>> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> -------------------------------------------------------------
>> >>
>> >>
>> >>
>> --
>> -------------------------------------------------------------
>> Hilmar Lapp????????????????????????????email: lapp at gnf.org
>> GNF, San Diego, Ca. 92121??????????????phone: +1-858-812-1757
>> -------------------------------------------------------------
>>
>>
>>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------



From hlapp at gmx.net  Fri Dec 30 23:00:19 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri Dec 30 22:57:13 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <df8328740512301728p7dc9b416m3c08c084b3201aaf@mail.gmail.com>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<df8328740512291800q23a756f5w8b5282c68f5d01a7@mail.gmail.com>
	<df8328740512301429k51ebb690jeef6fc1b47705635@mail.gmail.com>
	<33f89146e1b14860a2f76475214a0c32@gmx.net>
	<df8328740512301501sc7c00f6r80da5ee7ef9d1b3a@mail.gmail.com>
	<84c80704820ab7d6ee3f474ff39338dd@gmx.net>
	<df8328740512301515g1227ab01g23cb57c9d8b9ccce@mail.gmail.com>
	<5e182836514be51503a73d5c998b1bb6@gmx.net>
	<df8328740512301613o377336bay95bca8b6d5cb9f44@mail.gmail.com>
	<6a1461589de1c31b88ebbfa1d6e94d44@gmx.net>
	<df8328740512301728p7dc9b416m3c08c084b3201aaf@mail.gmail.com>
Message-ID: <4a7ab2b336f4310fc67b9eed0824a4a0@gmx.net>

Did you set your PERL5LIB appropriately?

On some Windows platforms there are known problems with dynamically  
loaded perl modules. The module quoted below does 'use  
Bio::Root::Root;', so the absence of that is not the problem.

	-hilmar

On Dec 30, 2005, at 5:28 PM, Angshu Kar wrote:

> A new error:
>
> I installed bioperl-db in my own WinXP m/c following instructions in  
> CVS by Chris Fields. I'm trying to run the same command from this m/c  
> (the postgres db resides in the linux box) and getting the error:
>
> Loading NC_003076.gbk ...
> Undefined subroutine &Bio::Root::Root::debug called at  
> C:/Perl/site/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm line 1537,  
> <GEN0> line 766536.
>
> Any inputs on this?
>
>
>
> On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>> incompatibility.
>>
>> You haven't yet run the bioperl-db test suite, have you? Please don't
>> ask for more help before you haven't done that.
>>
>> Also, you do remember my earlier answer to a similar report from you,
>> right?
>> http://portal.open-bio.org/pipermail/bioperl-l/2005-December/ 
>> 020389.html
>>
>> The two first things to do is to check whether you run out of shared
>> memory and to run the tests and see whether the location where the
>> process gets killed can be narrowed down. If it's not a bug (which it
>> is unlikely to be - but the tests will provide more evidence) then the
>>  next step would be to recompile your own perl, DBI and DBD::Pg, and
>> PostgreSQL, in that order.
>>
>> ????????-hilmar
>>
>> On Dec 30, 2005, at 4:13 PM, Angshu Kar wrote:
>>
>> > oops! he is not present now!
>> > anyways, if you have some time could you please if there are any
>> > reasons for the script to get killed with the .gbk file?
>> >
>> > Thanks,
>> > Angshu
>> >
>> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>> >> actually in a config file, and the default installation of Postgres
>> >> makes this config file unreadable for every one except the pg-admin
>> >> user chosen at installation time.
>> >>
>> >> -hilmar
>> >>
>> >> On Dec 30, 2005, at 3:15 PM, Angshu Kar wrote:
>> >>
>> >> > I've no clue about my Pg setup! It has been done by the  
>> sysadmin! :(
>> >> > Could you please tell me the commands and I can run and let you  
>> know
>> >> > the reports?
>> >> >
>> >> > thanks,
>> >> > angshu
>> >> >
>> >> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>> >> >>
>> >> >> Also, you haven't reported your hw setup. In particular, how  
>> much
>> >> >> memory and swap do you have, is Pg running locally (your command
>> >> line
>> >> >> suggests it does), and how much memory have you allocated to Pg?
>> >> >>
>> >> >> -hilmar
>> >> >>
>> >> >> On Dec 30, 2005, at 3:01 PM, Angshu Kar wrote:
>> >> >>
>> >> >> > Yes Hilmar its indeed a full sequence of chromosome. I got it
>> >> from
>> >> >> > ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V/
>> >> >> > I tried with the .faa and .fna files and they ran  
>> successfully.
>> >> >> > Also I missed a line (may be relevant) in the debug o/p:
>> >> >> > no adaptor found for class Bio::Annotation::TypeManager
>> >> >> >
>> >> >> > Thanks,
>> >> >> > Angshu
>> >> >> >
>> >> >> >
>> >> >> > On 12/30/05, Hilmar Lapp < hlapp@gmx.net> wrote:
>> >> >> >> special about this one? The file name lets me guess the input
>> >> is a
>> >> >> >> contig or even a full chromosome? Is the input on which the
>> >> process
>> >> >> >> wasn't killed of the same nature? Are the sequences of
>> >> comparable
>> >> >> or
>> >> >> >> vastly different lengths? Is there only a single contig in  
>> the
>> >> >> >> offending input? Can you reproduce the problem on an empty
>> >> database
>> >> >> >> with input containing a single entry? If so, let me know  
>> where I
>> >> >> can
>> >> >> >> get that file from and I'll try to reproduce it locally.
>> >> >> >>
>> >> >> >> -hilmar
>> >> >> >>
>> >> >> >> On Dec 30, 2005, at 2:29 PM, Angshu Kar wrote:
>> >> >> >>
>> >> >> >> > Any clues why my load_seqdatabase.pl (./load_seqdatabase.pl
>> >> >> >> > --dbname=USBA --dbuser=postgres --format=genbank  
>> --driver=Pg
>> >> >> --debug
>> >> >> >> > NC_003076.gbk)
>> >> >> >> > is getting killed after the follwoing step?
>> >>??>> >> >
>> >> >> >> >Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as  
>> driver
>> >> peer
>> >> >> >> > for Bio::DB::BioSQL::BiosequenceAdaptor
>> >> >> >> > preparing SELECT statement: SELECT bioentry_id FROM
>> >> biosequence
>> >> >> >> WHERE
>> >> >> >> > bioentry_id = ?
>> >> >> >> >
>> >> >> >> > Killed
>> >> >> >> >
>> >> >> >> > I'm using a linux box. This didn't happen for a different  
>> i/p
>> >> >> file!
>> >> >> >> >
>> >> >> >> > Thanks,
>> >> >> >> > Angshu
>> >> >> >> >
>> >> >> >> >
>> >> >> >> > On 12/29/05, Angshu Kar < angshu96@gmail.com> wrote: I'm  
>> sorry
>> >> >> that
>> >> >> >> I
>> >> >> >> > missed it! Thanks for pointing it out.
>> >> >> >> >> Also thanks Hilmar for the update.
>> >> >> >> >>
>> >> >> >> >> Angshu
>> >> >> >> >>
>> >> >> >> >>
>> >> >>>> >> On 12/29/05, Torsten Seemann <
>> >> >> >> torsten.seemann@infotech.monash.edu.au
>> >> >> >> >> > wrote:> I'm getting the following error while trying to
>> >> run :
>> >> >> >> >>> > ./load_seqdatabase.pl -host localhost -dbname USBA  
>> -dbuser
>> >> >> >> >>> postgres -format
>> >> >> >> >>> > genbank NC_003076.gbk
>> >> >> >> >>> > MSG: failed to open connection: Can't connect to local
>> >> MySQL
>> >> >> >> >>> server through
>> >> >> >> >>> > socket '/var/lib/mysql/mysql.sock' (2)
>> >> >> >> >>> > But I've a postgreSQL db and not a MySQL one...could
>> >> anyone
>> >> >> >> please
>> >> >>>> >>> guide me
>> >> >> >> >>> > troubleshoot this?
>> >> >> >> >>>
>> >> >> >> >>> Did you read the documentation for the  
>> load_seqdatabase.pl
>> >> >> script?
>> >> >> >> >>>
>>  >> >> >> >>> It's in the script itself!
>> >> >> >> >>>
>> >> >> >> >>> =item --driver $driver
>> >> >> >> >>> the DBI driver name for the RDBMS e.g., mysql, Pg, or  
>> Oracle
>> >> >> >> >>> [mysql]
>> >> >> >> >>>
>> >> >> >> >>> The default DBI driver is [mysql].
>> >> >> >> >>>
>> >> >> >> >>> I think you want the option "-driver Pg".
>> >> >> >> >>>
>> >> >> >>>>> --
>> >> >> >> >>> Torsten Seemann
>> >> >> >> >>> Victorian Bioinformatics Consortium, Monash University,
>> >> >> Australia
>> >> >> >> >>> http://www.vicbioinformatics.com/
>> >> >> >> >>
>> >> >> >> >>
>> >> >> >> --
>> >> >> >> -------------------------------------------------------------
>> >> >> >> Hilmar Lappemail: lapp at gnf.org
>> >> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> >> >> -------------------------------------------------------------
>> >> >> >>
>> >> >> >>
>> >> >> >
>> >> >> >
>> >> >> --
>> >> >> -------------------------------------------------------------
>> >> >> Hilmar Lappemail: lapp at gnf.org
>> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> >> -------------------------------------------------------------
>> >> >>
>> >> >>
>> >> >>
>> >> --
>> >> -------------------------------------------------------------
>> >> Hilmar Lappemail: lapp at gnf.org
>> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> -------------------------------------------------------------
>> >>
>> >>
>> >>
>> --
>> -------------------------------------------------------------
>> Hilmar Lapp????????????????????????????email: lapp at gnf.org
>> GNF, San Diego, Ca. 92121??????????????phone: +1-858-812-1757
>> -------------------------------------------------------------
>>
>>
>>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------



From angshu96 at gmail.com  Fri Dec 30 23:13:57 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec 30 23:10:54 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <5b321da72f66dc31312cb30deb6269a5@gmx.net>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<33f89146e1b14860a2f76475214a0c32@gmx.net>
	<df8328740512301501sc7c00f6r80da5ee7ef9d1b3a@mail.gmail.com>
	<84c80704820ab7d6ee3f474ff39338dd@gmx.net>
	<df8328740512301515g1227ab01g23cb57c9d8b9ccce@mail.gmail.com>
	<5e182836514be51503a73d5c998b1bb6@gmx.net>
	<df8328740512301613o377336bay95bca8b6d5cb9f44@mail.gmail.com>
	<6a1461589de1c31b88ebbfa1d6e94d44@gmx.net>
	<df8328740512301759r22cb8ba3u1d1e48c7d6c33694@mail.gmail.com>
	<5b321da72f66dc31312cb30deb6269a5@gmx.net>
Message-ID: <df8328740512302013n17d580dcp71a9aa9a52fef0b5@mail.gmail.com>

:) I'm sorry again.
After setting the DBHarness I get the following from nmake test:

        Test returned status 255 (wstat 65280, 0xff00)
DIED. FAILED tests 3-160
        Failed 158/160 tests, 1.25% okay
Failed Test      Stat Wstat Total Fail  Failed  List of Failed
-----------------------------------------------------------------------------
t\01dbadaptor.t     5  1280    19   30 157.89%  5-19
t\02species.t     255 65280    65  126 193.85%  3-65
t\03simpleseq.t     5  1280    59  108 183.05%  6-59
t\04swiss.t       255 65280    52  100 192.31%  3-52
t\05seqfeature.t  255 65280    48   92 191.67%  3-48
t\06comment.t     255 65280    11   18 163.64%  3-11
t\07dblink.t      255 65280    18   32 177.78%  3-18
t\08genbank.t     255 65280    18   32 177.78%  3-18
t\09fuzzy2.t      255 65280    21   38 180.95%  3-21
t\10ensembl.t     255 65280    15   26 173.33%  3-15
t\11locuslink.t   255 65280   110  214 194.55%  4-110
t\12ontology.t      9  2304   738 1470 199.19%  4-738
t\13remove.t      255 65280    59  116 196.61%  2-59
t\15cluster.t     255 65280   160  316 197.50%  3-160
Failed 14/15 test scripts, 6.67% okay. 1359/1411 subtests failed, 3.69%okay.
NMAKE : fatal error U1077: 'C:\WINDOWS\system32\cmd.exe' : return code
'0xff'
Stop.

On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
> Angshu, next time you feel the urge to write such an email restrain
> yourself, hold off, sit back, and, most importantly, think.
>
> The error message clearly says 'driver not set'. Did you do anything
> that assures you that you *have* set the driver?
>
> I suppose you forgot to follow the instructions for running the tests,
> namely to copy
> t/DBHarness.conf.example to t/DBHarness.biosql.conf, and edit to suit
> your setup. This is documented, and I told you about this step earlier.
>
>         -hilmar
>
> On Dec 30, 2005, at 5:59 PM, Angshu Kar wrote:
>
> > Hi Hilmar,
> >
> > All my tests failed for my WInXP m/c!I'm really at a fix!:(
> > Do I need to uninstall bioperl-db, bioperl and even perl??? How to do
> > that?
> > Please guide.
> > I'll be obliged if anyone with WinXp (not cygwin) provides his/her
> > feedback ...
> >
> > Thanks,
> > Angshu
> >
> > Microsoft (R) Program Maintenance Utility Version 1.50
> > Copyright (c) Microsoft Corp 1988-94. All rights reserved.
> >
> > C:\Perl\bin\perl.exe "-MExtUtils::Command::MM" "-e"
> > "test_harness(0, 'bl
> > ib\lib', 'blib\arch')" t\01dbadaptor.t t\02species.t t\03simpleseq.t
> > t\04swiss.t
> > t\05seqfeature.t t\06comment.t t\07dblink.t t\08genbank.t
> > t\09fuzzy2.t t\10ense
> > mbl.t t\11locuslink.t t\12ontology.t t\13remove.t t\14query.t
> > t\15cluster.t
> >  t\01dbadaptor.....driver not set at t/DBTestHarness.pm line 106
> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
> > at t/DBTest
> > Harness.pm line 204
> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at t/DBT
> > estHarness.pm line 94
> > DBTestHarness::new('DBTestHarness', 'biosql') called at
> > t\01dbadaptor.t
> > line 20
> > t\01dbadaptor.....dubious
> >   Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-19
> > Failed 19/19 tests, 0.00% okay
> > t\02species.......driver not set at t/DBTestHarness.pm line 106
> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
> > at t/DBTest
> > Harness.pm line 204
> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at t/DBT
> > estHarness.pm line 94
> > DBTestHarness::new('DBTestHarness', 'biosql') called at
> > t\02species.t li
> > ne 18
> > t\02species.......dubious
> >   Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-65
> > Failed 65/65 tests, 0.00% okay
> > t\03simpleseq.....driver not set at t/DBTestHarness.pm line 106
> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
> > at t/DBTest
> > Harness.pm line 204
> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at t/DBT
> > estHarness.pm line 94
> > DBTestHarness::new('DBTestHarness', 'biosql') called at
> > t\03simpleseq.t
> > line 19
> > t\03simpleseq.....dubious
> >   Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-59
> > Failed 59/59 tests, 0.00% okay
> > t\04swiss.........driver not set at t/DBTestHarness.pm line 106
> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
> > at t/DBTest
> > Harness.pm line 204
> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at t/DBT
> > estHarness.pm line 94
> > DBTestHarness::new('DBTestHarness', 'biosql') called at
> > t\04swiss.t line
> > 20
> > t\04swiss.........dubious
> >   Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-52
> > Failed 52/52 tests, 0.00% okay
> > t\05seqfeature....driver not set at t/DBTestHarness.pm line 106
> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
> > at t/DBTest
> > Harness.pm line 204
> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at t/DBT
> > estHarness.pm line 94
> > DBTestHarness::new('DBTestHarness', 'biosql') called at
> > t\05seqfeature.t
> > line 19
> > t\05seqfeature....dubious
> >   Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-48
> > Failed 48/48 tests, 0.00% okay
> > t\06comment.......driver not set at t/DBTestHarness.pm line 106
> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
> > at t/DBTest
> > Harness.pm line 204
> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at t/DBT
> > estHarness.pm line 94
> > DBTestHarness::new('DBTestHarness', 'biosql') called at
> > t\06comment.t li
> > ne 20
> > t\06comment.......dubious
> >   Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-11
> > Failed 11/11 tests, 0.00% okay
> > t\07dblink........driver not set at t/DBTestHarness.pm line 106
> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
> > at t/DBTest
> > Harness.pm line 204
> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at t/DBT
> > estHarness.pm line 94
> > DBTestHarness::new('DBTestHarness', 'biosql') called at
> > t\07dblink.t lin
> > e 21
> > t\07dblink........dubious
> >   Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-18
> > Failed 18/18 tests, 0.00% okay
> > t\08genbank.......driver not set at t/DBTestHarness.pm line 106
> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
> > at t/DBTest
> > Harness.pm line 204
> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at t/DBT
> > estHarness.pm line 94
> > DBTestHarness::new('DBTestHarness', 'biosql') called at
> > t\08genbank.t li
> > ne 21
> > t\08genbank.......dubious
> >   Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-18
> > Failed 18/18 tests, 0.00% okay
> > t\09fuzzy2........driver not set at t/DBTestHarness.pm line 106
> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
> > at t/DBTest
> > Harness.pm line 204
> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at t/DBT
> > estHarness.pm line 94
> > DBTestHarness::new('DBTestHarness', 'biosql') called at
> > t\09fuzzy2.t lin
> > e 26
> > t\09fuzzy2........dubious
> >   Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-21
> > Failed 21/21 tests, 0.00% okay
> > t\10ensembl.......driver not set at t/DBTestHarness.pm line 106
> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
> > at t/DBTest
> > Harness.pm line 204
> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at t/DBT
> > estHarness.pm line 94
> > DBTestHarness::new('DBTestHarness', 'biosql') called at
> > t\10ensembl.t li
> > ne 21
> > t\10ensembl.......dubious
> >   Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-15
> > Failed 15/15 tests, 0.00% okay
> > t\11locuslink.....driver not set at t/DBTestHarness.pm line 106
> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
> > at t/DBTest
> > Harness.pm line 204
> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at t/DBT
> > estHarness.pm line 94
> > DBTestHarness::new('DBTestHarness', 'biosql') called at
> > t\11locuslink.t
> > line 21
> > t\11locuslink.....dubious
> >   Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-110
> > Failed 110/110 tests, 0.00% okay
> > t\12ontology......driver not set at t/DBTestHarness.pm line 106
> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
> > at t/DBTest
> > Harness.pm line 204
> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at t/DBT
> > estHarness.pm line 94
> > DBTestHarness::new('DBTestHarness', 'biosql') called at
> > t\12ontology.t l
> > ine 19
> > t\12ontology......dubious
> >   Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-738
> > Failed 738/738 tests, 0.00% okay
> > t\13remove........driver not set at t/DBTestHarness.pm line 106
> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
> > at t/DBTest
> > Harness.pm line 204
> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at t/DBT
> > estHarness.pm line 94
> > DBTestHarness::new('DBTestHarness', 'biosql') called at
> > t\13remove.t lin
> > e 19
> > t\13remove........dubious
> >   Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-59
> > Failed 59/59 tests, 0.00% okay
> > t\14query.........ok
> > t\15cluster.......driver not set at t/DBTestHarness.pm line 106
> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
> > at t/DBTest
> > Harness.pm line 204
> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at t/DBT
> > estHarness.pm line 94
> > DBTestHarness::new('DBTestHarness', 'biosql') called at
> > t\15cluster.t li
> > ne 19
> > t\15cluster.......dubious
> > Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-160
> > Failed 160/160 tests, 0.00% okay
> > Failed Test Stat Wstat Total Fail Failed List of Failed
> > -----------------------------------------------------------------------
> > --------
> > t\01dbadaptor.t 2 512 19 38 200.00% 1-19
> > t\02species.t 2 512 65 130 200.00% 1-65
> > t\03simpleseq.t 2 512 59 118 200.00% 1-59
> > t\04swiss.t 2 512 52 104 200.00% 1-52
> > t\05seqfeature.t 2 512 48 96 200.00% 1-48
> > t\06comment.t 2 512 11 22 200.00% 1-11
> > t\07dblink.t 2 512 18 36 200.00% 1-18
> > t\08genbank.t 2 512 18 36 200.00% 1-18
> > t\09fuzzy2.t 2 512 21 42 200.00% 1-21
> > t\10ensembl.t 2 512 15 30 200.00% 1-15
> > t\11locuslink.t 2 512 110 220 200.00% 1-110
> > t\12ontology.t 2 512 738 1476 200.00% 1-738
> > t\13remove.t 2 512 59 118 200.00% 1-59
> > t\15cluster.t 2 512 160 320 200.00% 1-160
> > Failed 14/15 test scripts, 6.67% okay. 1393/1411 subtests failed,
> > 1.28% okay.
> >  NMAKE : fatal error U1077: 'C:\WINDOWS\system32\cmd.exe' : return
> > code '0x2'
> > Stop.
> >
> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:I suspect it's either a
> > (out-of-)memory error or a binary
> >> incompatibility.
> >>
> >> You haven't yet run the bioperl-db test suite, have you? Please don't
> >> ask for more help before you haven't done that.
> >>
> >> Also, you do remember my earlier answer to a similar report from you,
> >> right?
> >> http://portal.open-bio.org/pipermail/bioperl-l/2005-December/
> >> 020389.html
> >>
> >> The two first things to do is to check whether you run out of shared
> >> memory and to run the tests and see whether the location where the
> >> process gets killed can be narrowed down. If it's not a bug (which it
> >> is unlikely to be - but the tests will provide more evidence) then the
> >>  next step would be to recompile your own perl, DBI and DBD::Pg, and
> >> PostgreSQL, in that order.
> >>
> >> -hilmar
> >>
> >> On Dec 30, 2005, at 4:13 PM, Angshu Kar wrote:
> >>
> >> > oops! he is not present now!
> >> > anyways, if you have some time could you please if there are any
> >> > reasons for the script to get killed with the .gbk file?
> >> >
> >> > Thanks,
> >> > Angshu
> >> >
> >> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
> >> >> actually in a config file, and the default installation of Postgres
> >> >> makes this config file unreadable for every one except the pg-admin
> >> >> user chosen at installation time.
> >> >>
> >> >> -hilmar
> >> >>
> >> >> On Dec 30, 2005, at 3:15 PM, Angshu Kar wrote:
> >> >>
> >> >> > I've no clue about my Pg setup! It has been done by the
> >> sysadmin! :(
> >> >> > Could you please tell me the commands and I can run and let you
> >> know
> >> >> > the reports?
> >> >> >
> >> >> > thanks,
> >> >> > angshu
> >> >> >
> >> >> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
> >> >> >>
> >> >> >> Also, you haven't reported your hw setup. In particular, how
> >> much
> >> >> >> memory and swap do you have, is Pg running locally (your command
> >> >> line
> >> >> >> suggests it does), and how much memory have you allocated to Pg?
> >> >> >>
> >> >> >> -hilmar
> >> >> >>
> >> >> >> On Dec 30, 2005, at 3:01 PM, Angshu Kar wrote:
> >> >> >>
> >> >> >> > Yes Hilmar its indeed a full sequence of chromosome. I got it
> >> >> from
> >> >> >> > ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V/
> >> >> >> > I tried with the .faa and .fna files and they ran
> >> successfully.
> >> >> >> > Also I missed a line (may be relevant) in the debug o/p:
> >> >> >> > no adaptor found for class Bio::Annotation::TypeManager
> >> >> >> >
> >> >> >> > Thanks,
> >> >> >> > Angshu
> >> >> >> >
> >> >> >> >
> >> >> >> > On 12/30/05, Hilmar Lapp < hlapp@gmx.net> wrote:
> >> >> >> >> special about this one? The file name lets me guess the input
> >> >> is a
> >> >> >> >> contig or even a full chromosome? Is the input on which the
> >> >> process
> >> >> >> >> wasn't killed of the same nature? Are the sequences of
> >> >> comparable
> >> >> >> or
> >> >> >> >> vastly different lengths? Is there only a single contig in
> >> the
> >> >> >> >> offending input? Can you reproduce the problem on an empty
> >> >> database
> >> >> >> >> with input containing a single entry? If so, let me know
> >> where I
> >> >> >> can
> >> >> >> >> get that file from and I'll try to reproduce it locally.
> >> >> >> >>
> >> >> >> >> -hilmar
> >> >> >> >>
> >> >> >> >> On Dec 30, 2005, at 2:29 PM, Angshu Kar wrote:
> >> >> >> >>
> >> >> >> >> > Any clues why my load_seqdatabase.pl (./load_seqdatabase.pl
> >> >> >> >> > --dbname=USBA --dbuser=postgres --format=genbank
> >> --driver=Pg
> >> >> >> --debug
> >> >> >> >> > NC_003076.gbk)
> >> >> >> >> > is getting killed after the follwoing step?
> >> >>>> >> >
> >> >> >> >> >Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as
> >> driver
> >> >> peer
> >> >> >> >> > for Bio::DB::BioSQL::BiosequenceAdaptor
> >> >> >> >> > preparing SELECT statement: SELECT bioentry_id FROM
> >> >> biosequence
> >> >> >> >> WHERE
> >> >> >> >> > bioentry_id = ?
> >> >> >> >> >
> >> >> >> >> > Killed
> >> >> >> >> >
> >> >> >> >> > I'm using a linux box. This didn't happen for a different
> >> i/p
> >> >> >> file!
> >> >> >> >> >
> >> >> >> >> > Thanks,
> >> >> >> >> > Angshu
> >> >> >> >> >
> >> >> >> >> >
> >> >> >> >> > On 12/29/05, Angshu Kar < angshu96@gmail.com> wrote: I'm
> >> sorry
> >> >> >> that
> >> >> >> >> I
> >> >> >> >> > missed it! Thanks for pointing it out.
> >> >> >> >> >> Also thanks Hilmar for the update.
> >> >> >> >> >>
> >> >> >> >> >> Angshu
> >> >> >> >> >>
> >> >> >> >> >>
> >> >> >>>> >> On 12/29/05, Torsten Seemann <
> >> >> >> >> torsten.seemann@infotech.monash.edu.au
> >> >> >> >> >> > wrote:> I'm getting the following error while trying to
> >> >> run :
> >> >> >> >> >>> > ./load_seqdatabase.pl -host localhost -dbname USBA
> >> -dbuser
> >> >> >> >> >>> postgres -format
> >> >> >> >> >>> > genbank NC_003076.gbk
> >> >> >> >> >>> > MSG: failed to open connection: Can't connect to local
> >> >> MySQL
> >> >> >> >> >>> server through
> >> >> >> >> >>> > socket '/var/lib/mysql/mysql.sock' (2)
> >> >> >> >> >>> > But I've a postgreSQL db and not a MySQL one...could
> >> >> anyone
> >> >> >> >> please
> >> >> >>>> >>> guide me
> >> >> >> >> >>> > troubleshoot this?
> >> >> >> >> >>>
> >> >> >> >> >>> Did you read the documentation for the
> >> load_seqdatabase.pl
> >> >> >> script?
> >> >> >> >> >>>
> >>  >> >> >> >>> It's in the script itself!
> >> >> >> >> >>>
> >> >> >> >> >>> =item --driver $driver
> >> >> >> >> >>> the DBI driver name for the RDBMS e.g., mysql, Pg, or
> >> Oracle
> >> >> >> >> >>> [mysql]
> >> >> >> >> >>>
> >> >> >> >> >>> The default DBI driver is [mysql].
> >> >> >> >> >>>
> >> >> >> >> >>> I think you want the option "-driver Pg".
> >> >> >> >> >>>
> >> >> >> >>>>> --
> >> >> >> >> >>> Torsten Seemann
> >> >> >> >> >>> Victorian Bioinformatics Consortium, Monash University,
> >> >> >> Australia
> >> >> >> >> >>> http://www.vicbioinformatics.com/
> >> >> >> >> >>
> >> >> >> >> >>
> >> >> >> >> --
> >> >> >> >> -------------------------------------------------------------
> >> >> >> >> Hilmar Lappemail: lapp at gnf.org
> >> >> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> >> >> >> -------------------------------------------------------------
> >> >> >> >>
> >> >> >> >>
> >> >> >> >
> >> >> >> >
> >> >> >> --
> >> >> >> -------------------------------------------------------------
> >> >> >> Hilmar Lappemail: lapp at gnf.org
> >> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> >> >> -------------------------------------------------------------
> >> >> >>
> >> >> >>
> >> >> >>
> >> >> --
> >> >> -------------------------------------------------------------
> >> >> Hilmar Lappemail: lapp at gnf.org
> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> >> -------------------------------------------------------------
> >> >>
> >> >>
> >> >>
> >> --
> >> -------------------------------------------------------------
> >> Hilmar Lappemail: lapp at gnf.org
> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> -------------------------------------------------------------
> >>
> >>
> >>
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From chen_li3 at yahoo.com  Fri Dec 30 23:10:37 2005
From: chen_li3 at yahoo.com (chen li)
Date: Fri Dec 30 23:14:03 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <df8328740512301759r22cb8ba3u1d1e48c7d6c33694@mail.gmail.com>
Message-ID: <20051231041037.67026.qmail@web36809.mail.mud.yahoo.com>

Based  on my limited experience perl/bioperl works
PERFECTLY under linux system but not under window XP.
I suggest you install another linux system on your
computer (dual OS) so that you don't  have to do so
many troubleshooting.  

Li  

--- Angshu Kar <angshu96@gmail.com> wrote:

> Hi Hilmar,
> 
> All my tests failed for my WInXP m/c!I'm really at a
> fix!:(
> Do I need to uninstall bioperl-db, bioperl and even
> perl??? How to do that?
> Please guide.
> I'll be obliged if anyone with WinXp (not cygwin)
> provides his/her feedback
> ...
> 
> Thanks,
> Angshu
> 
> Microsoft (R) Program Maintenance Utility   Version
> 1.50
> Copyright (c) Microsoft Corp 1988-94. All rights
> reserved.
> 
>         C:\Perl\bin\perl.exe
> "-MExtUtils::Command::MM" "-e" "test_harness(0,
> 'bl
> ib\lib', 'blib\arch')" t\01dbadaptor.t t\02species.t
> t\03simpleseq.t
> t\04swiss.t
>  t\05seqfeature.t t\06comment.t t\07dblink.t
> t\08genbank.t t\09fuzzy2.t
> t\10ense
> mbl.t t\11locuslink.t t\12ontology.t t\13remove.t
> t\14query.t t\15cluster.t
> t\01dbadaptor.....driver not set at
> t/DBTestHarness.pm line 106
>        
>
DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> called at
> t/DBTest
> Harness.pm line 204
>        
>
DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> called at
> t/DBT
> estHarness.pm line 94
>         DBTestHarness::new('DBTestHarness',
> 'biosql') called at
> t\01dbadaptor.t
> line 20
> t\01dbadaptor.....dubious
>         Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-19
>         Failed 19/19 tests, 0.00% okay
> t\02species.......driver not set at
> t/DBTestHarness.pm line 106
>        
>
DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> called at
> t/DBTest
> Harness.pm line 204
>        
>
DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> called at
> t/DBT
> estHarness.pm line 94
>         DBTestHarness::new('DBTestHarness',
> 'biosql') called at
> t\02species.t li
> ne 18
> t\02species.......dubious
>         Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-65
>         Failed 65/65 tests, 0.00% okay
> t\03simpleseq.....driver not set at
> t/DBTestHarness.pm line 106
>        
>
DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> called at
> t/DBTest
> Harness.pm line 204
>        
>
DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> called at
> t/DBT
> estHarness.pm line 94
>         DBTestHarness::new('DBTestHarness',
> 'biosql') called at
> t\03simpleseq.t
> line 19
> t\03simpleseq.....dubious
>         Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-59
>         Failed 59/59 tests, 0.00% okay
> t\04swiss.........driver not set at
> t/DBTestHarness.pm line 106
>        
>
DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> called at
> t/DBTest
> Harness.pm line 204
>        
>
DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> called at
> t/DBT
> estHarness.pm line 94
>         DBTestHarness::new('DBTestHarness',
> 'biosql') called at t\04swiss.t
> line
>  20
> t\04swiss.........dubious
>         Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-52
>         Failed 52/52 tests, 0.00% okay
> t\05seqfeature....driver not set at
> t/DBTestHarness.pm line 106
>        
>
DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> called at
> t/DBTest
> Harness.pm line 204
>        
>
DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> called at
> t/DBT
> estHarness.pm line 94
>         DBTestHarness::new('DBTestHarness',
> 'biosql') called at
> t\05seqfeature.t
>  line 19
> t\05seqfeature....dubious
>         Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-48
>         Failed 48/48 tests, 0.00% okay
> t\06comment.......driver not set at
> t/DBTestHarness.pm line 106
>        
>
DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> called at
> t/DBTest
> Harness.pm line 204
>        
>
DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> called at
> t/DBT
> estHarness.pm line 94
>         DBTestHarness::new('DBTestHarness',
> 'biosql') called at
> t\06comment.t li
> ne 20
> t\06comment.......dubious
>         Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-11
>         Failed 11/11 tests, 0.00% okay
> t\07dblink........driver not set at
> t/DBTestHarness.pm line 106
>        
>
DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> called at
> t/DBTest
> Harness.pm line 204
>        
>
DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> called at
> t/DBT
> estHarness.pm line 94
>         DBTestHarness::new('DBTestHarness',
> 'biosql') called at t\07dblink.t
> lin
> e 21
> t\07dblink........dubious
>         Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-18
>         Failed 18/18 tests, 0.00% okay
> t\08genbank.......driver not set at
> t/DBTestHarness.pm line 106
>        
>
DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> called at
> t/DBTest
> Harness.pm line 204
>        
>
DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> called at
> t/DBT
> estHarness.pm line 94
>         DBTestHarness::new('DBTestHarness',
> 'biosql') called at
> t\08genbank.t li
> ne 21
> t\08genbank.......dubious
>         Test returned status 2 (wstat 512, 0x200)
> DIED. FAILED tests 1-18
>         Failed 18/18 tests, 0.00% okay
> t\09fuzzy2........driver not set at
> t/DBTestHarness.pm line 106
>        
>
DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> called at
> t/DBTest
> Harness.pm line 204
>        
>
DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> called at
> t/DBT
> 
=== message truncated ===



	
		
__________________________________ 
Yahoo! for Good - Make a difference this year. 
http://brand.yahoo.com/cybergivingweek2005/
From angshu96 at gmail.com  Fri Dec 30 23:20:52 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec 30 23:17:45 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <4a7ab2b336f4310fc67b9eed0824a4a0@gmx.net>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<33f89146e1b14860a2f76475214a0c32@gmx.net>
	<df8328740512301501sc7c00f6r80da5ee7ef9d1b3a@mail.gmail.com>
	<84c80704820ab7d6ee3f474ff39338dd@gmx.net>
	<df8328740512301515g1227ab01g23cb57c9d8b9ccce@mail.gmail.com>
	<5e182836514be51503a73d5c998b1bb6@gmx.net>
	<df8328740512301613o377336bay95bca8b6d5cb9f44@mail.gmail.com>
	<6a1461589de1c31b88ebbfa1d6e94d44@gmx.net>
	<df8328740512301728p7dc9b416m3c08c084b3201aaf@mail.gmail.com>
	<4a7ab2b336f4310fc67b9eed0824a4a0@gmx.net>
Message-ID: <df8328740512302020n4fab6eb4h99f74b2072636288@mail.gmail.com>

You mean the ' use lib ' in my perl script to point to the .pm folder?
Yes I've done that! Else how it should have failed at the first step.Isn't
it?


On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>
> Did you set your PERL5LIB appropriately?
>
> On some Windows platforms there are known problems with dynamically
> loaded perl modules. The module quoted below does 'use
> Bio::Root::Root;', so the absence of that is not the problem.
>
>         -hilmar
>
> On Dec 30, 2005, at 5:28 PM, Angshu Kar wrote:
>
> > A new error:
> >
> > I installed bioperl-db in my own WinXP m/c following instructions in
> > CVS by Chris Fields. I'm trying to run the same command from this m/c
> > (the postgres db resides in the linux box) and getting the error:
> >
> > Loading NC_003076.gbk ...
> > Undefined subroutine &Bio::Root::Root::debug called at
> > C:/Perl/site/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm line 1537,
> > <GEN0> line 766536.
> >
> > Any inputs on this?
> >
> >
> >
> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
> >> incompatibility.
> >>
> >> You haven't yet run the bioperl-db test suite, have you? Please don't
> >> ask for more help before you haven't done that.
> >>
> >> Also, you do remember my earlier answer to a similar report from you,
> >> right?
> >> http://portal.open-bio.org/pipermail/bioperl-l/2005-December/
> >> 020389.html
> >>
> >> The two first things to do is to check whether you run out of shared
> >> memory and to run the tests and see whether the location where the
> >> process gets killed can be narrowed down. If it's not a bug (which it
> >> is unlikely to be - but the tests will provide more evidence) then the
> >>  next step would be to recompile your own perl, DBI and DBD::Pg, and
> >> PostgreSQL, in that order.
> >>
> >> -hilmar
> >>
> >> On Dec 30, 2005, at 4:13 PM, Angshu Kar wrote:
> >>
> >> > oops! he is not present now!
> >> > anyways, if you have some time could you please if there are any
> >> > reasons for the script to get killed with the .gbk file?
> >> >
> >> > Thanks,
> >> > Angshu
> >> >
> >> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
> >> >> actually in a config file, and the default installation of Postgres
> >> >> makes this config file unreadable for every one except the pg-admin
> >> >> user chosen at installation time.
> >> >>
> >> >> -hilmar
> >> >>
> >> >> On Dec 30, 2005, at 3:15 PM, Angshu Kar wrote:
> >> >>
> >> >> > I've no clue about my Pg setup! It has been done by the
> >> sysadmin! :(
> >> >> > Could you please tell me the commands and I can run and let you
> >> know
> >> >> > the reports?
> >> >> >
> >> >> > thanks,
> >> >> > angshu
> >> >> >
> >> >> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
> >> >> >>
> >> >> >> Also, you haven't reported your hw setup. In particular, how
> >> much
> >> >> >> memory and swap do you have, is Pg running locally (your command
> >> >> line
> >> >> >> suggests it does), and how much memory have you allocated to Pg?
> >> >> >>
> >> >> >> -hilmar
> >> >> >>
> >> >> >> On Dec 30, 2005, at 3:01 PM, Angshu Kar wrote:
> >> >> >>
> >> >> >> > Yes Hilmar its indeed a full sequence of chromosome. I got it
> >> >> from
> >> >> >> > ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V/
> >> >> >> > I tried with the .faa and .fna files and they ran
> >> successfully.
> >> >> >> > Also I missed a line (may be relevant) in the debug o/p:
> >> >> >> > no adaptor found for class Bio::Annotation::TypeManager
> >> >> >> >
> >> >> >> > Thanks,
> >> >> >> > Angshu
> >> >> >> >
> >> >> >> >
> >> >> >> > On 12/30/05, Hilmar Lapp < hlapp@gmx.net> wrote:
> >> >> >> >> special about this one? The file name lets me guess the input
> >> >> is a
> >> >> >> >> contig or even a full chromosome? Is the input on which the
> >> >> process
> >> >> >> >> wasn't killed of the same nature? Are the sequences of
> >> >> comparable
> >> >> >> or
> >> >> >> >> vastly different lengths? Is there only a single contig in
> >> the
> >> >> >> >> offending input? Can you reproduce the problem on an empty
> >> >> database
> >> >> >> >> with input containing a single entry? If so, let me know
> >> where I
> >> >> >> can
> >> >> >> >> get that file from and I'll try to reproduce it locally.
> >> >> >> >>
> >> >> >> >> -hilmar
> >> >> >> >>
> >> >> >> >> On Dec 30, 2005, at 2:29 PM, Angshu Kar wrote:
> >> >> >> >>
> >> >> >> >> > Any clues why my load_seqdatabase.pl (./load_seqdatabase.pl
> >> >> >> >> > --dbname=USBA --dbuser=postgres --format=genbank
> >> --driver=Pg
> >> >> >> --debug
> >> >> >> >> > NC_003076.gbk)
> >> >> >> >> > is getting killed after the follwoing step?
> >> >>>> >> >
> >> >> >> >> >Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as
> >> driver
> >> >> peer
> >> >> >> >> > for Bio::DB::BioSQL::BiosequenceAdaptor
> >> >> >> >> > preparing SELECT statement: SELECT bioentry_id FROM
> >> >> biosequence
> >> >> >> >> WHERE
> >> >> >> >> > bioentry_id = ?
> >> >> >> >> >
> >> >> >> >> > Killed
> >> >> >> >> >
> >> >> >> >> > I'm using a linux box. This didn't happen for a different
> >> i/p
> >> >> >> file!
> >> >> >> >> >
> >> >> >> >> > Thanks,
> >> >> >> >> > Angshu
> >> >> >> >> >
> >> >> >> >> >
> >> >> >> >> > On 12/29/05, Angshu Kar < angshu96@gmail.com> wrote: I'm
> >> sorry
> >> >> >> that
> >> >> >> >> I
> >> >> >> >> > missed it! Thanks for pointing it out.
> >> >> >> >> >> Also thanks Hilmar for the update.
> >> >> >> >> >>
> >> >> >> >> >> Angshu
> >> >> >> >> >>
> >> >> >> >> >>
> >> >> >>>> >> On 12/29/05, Torsten Seemann <
> >> >> >> >> torsten.seemann@infotech.monash.edu.au
> >> >> >> >> >> > wrote:> I'm getting the following error while trying to
> >> >> run :
> >> >> >> >> >>> > ./load_seqdatabase.pl -host localhost -dbname USBA
> >> -dbuser
> >> >> >> >> >>> postgres -format
> >> >> >> >> >>> > genbank NC_003076.gbk
> >> >> >> >> >>> > MSG: failed to open connection: Can't connect to local
> >> >> MySQL
> >> >> >> >> >>> server through
> >> >> >> >> >>> > socket '/var/lib/mysql/mysql.sock' (2)
> >> >> >> >> >>> > But I've a postgreSQL db and not a MySQL one...could
> >> >> anyone
> >> >> >> >> please
> >> >> >>>> >>> guide me
> >> >> >> >> >>> > troubleshoot this?
> >> >> >> >> >>>
> >> >> >> >> >>> Did you read the documentation for the
> >> load_seqdatabase.pl
> >> >> >> script?
> >> >> >> >> >>>
> >>  >> >> >> >>> It's in the script itself!
> >> >> >> >> >>>
> >> >> >> >> >>> =item --driver $driver
> >> >> >> >> >>> the DBI driver name for the RDBMS e.g., mysql, Pg, or
> >> Oracle
> >> >> >> >> >>> [mysql]
> >> >> >> >> >>>
> >> >> >> >> >>> The default DBI driver is [mysql].
> >> >> >> >> >>>
> >> >> >> >> >>> I think you want the option "-driver Pg".
> >> >> >> >> >>>
> >> >> >> >>>>> --
> >> >> >> >> >>> Torsten Seemann
> >> >> >> >> >>> Victorian Bioinformatics Consortium, Monash University,
> >> >> >> Australia
> >> >> >> >> >>> http://www.vicbioinformatics.com/
> >> >> >> >> >>
> >> >> >> >> >>
> >> >> >> >> --
> >> >> >> >> -------------------------------------------------------------
> >> >> >> >> Hilmar Lappemail: lapp at gnf.org
> >> >> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> >> >> >> -------------------------------------------------------------
> >> >> >> >>
> >> >> >> >>
> >> >> >> >
> >> >> >> >
> >> >> >> --
> >> >> >> -------------------------------------------------------------
> >> >> >> Hilmar Lappemail: lapp at gnf.org
> >> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> >> >> -------------------------------------------------------------
> >> >> >>
> >> >> >>
> >> >> >>
> >> >> --
> >> >> -------------------------------------------------------------
> >> >> Hilmar Lappemail: lapp at gnf.org
> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> >> -------------------------------------------------------------
> >> >>
> >> >>
> >> >>
> >> --
> >> -------------------------------------------------------------
> >> Hilmar Lappemail: lapp at gnf.org
> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
> >> -------------------------------------------------------------
> >>
> >>
> >>
> --
> -------------------------------------------------------------
> Hilmar Lapp                            email: lapp at gnf.org
> GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
> -------------------------------------------------------------
>
>
>

From angshu96 at gmail.com  Fri Dec 30 23:15:06 2005
From: angshu96 at gmail.com (Angshu Kar)
Date: Fri Dec 30 23:19:10 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <20051231041037.67026.qmail@web36809.mail.mud.yahoo.com>
References: <df8328740512301759r22cb8ba3u1d1e48c7d6c33694@mail.gmail.com>
	<20051231041037.67026.qmail@web36809.mail.mud.yahoo.com>
Message-ID: <df8328740512302015l26a56336nd678824c77211243@mail.gmail.com>

Hi Chen,

What's your views on cygwin? Can that help?

Thanks,
Angshu

On 12/30/05, chen li <chen_li3@yahoo.com> wrote:
>
> Based  on my limited experience perl/bioperl works
> PERFECTLY under linux system but not under window XP.
> I suggest you install another linux system on your
> computer (dual OS) so that you don't  have to do so
> many troubleshooting.
>
> Li
>
> --- Angshu Kar <angshu96@gmail.com> wrote:
>
> > Hi Hilmar,
> >
> > All my tests failed for my WInXP m/c!I'm really at a
> > fix!:(
> > Do I need to uninstall bioperl-db, bioperl and even
> > perl??? How to do that?
> > Please guide.
> > I'll be obliged if anyone with WinXp (not cygwin)
> > provides his/her feedback
> > ...
> >
> > Thanks,
> > Angshu
> >
> > Microsoft (R) Program Maintenance Utility   Version
> > 1.50
> > Copyright (c) Microsoft Corp 1988-94. All rights
> > reserved.
> >
> >         C:\Perl\bin\perl.exe
> > "-MExtUtils::Command::MM" "-e" "test_harness(0,
> > 'bl
> > ib\lib', 'blib\arch')" t\01dbadaptor.t t\02species.t
> > t\03simpleseq.t
> > t\04swiss.t
> >  t\05seqfeature.t t\06comment.t t\07dblink.t
> > t\08genbank.t t\09fuzzy2.t
> > t\10ense
> > mbl.t t\11locuslink.t t\12ontology.t t\13remove.t
> > t\14query.t t\15cluster.t
> > t\01dbadaptor.....driver not set at
> > t/DBTestHarness.pm line 106
> >
> >
> DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBTest
> > Harness.pm line 204
> >
> >
> DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBT
> > estHarness.pm line 94
> >         DBTestHarness::new('DBTestHarness',
> > 'biosql') called at
> > t\01dbadaptor.t
> > line 20
> > t\01dbadaptor.....dubious
> >         Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-19
> >         Failed 19/19 tests, 0.00% okay
> > t\02species.......driver not set at
> > t/DBTestHarness.pm line 106
> >
> >
> DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBTest
> > Harness.pm line 204
> >
> >
> DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBT
> > estHarness.pm line 94
> >         DBTestHarness::new('DBTestHarness',
> > 'biosql') called at
> > t\02species.t li
> > ne 18
> > t\02species.......dubious
> >         Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-65
> >         Failed 65/65 tests, 0.00% okay
> > t\03simpleseq.....driver not set at
> > t/DBTestHarness.pm line 106
> >
> >
> DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBTest
> > Harness.pm line 204
> >
> >
> DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBT
> > estHarness.pm line 94
> >         DBTestHarness::new('DBTestHarness',
> > 'biosql') called at
> > t\03simpleseq.t
> > line 19
> > t\03simpleseq.....dubious
> >         Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-59
> >         Failed 59/59 tests, 0.00% okay
> > t\04swiss.........driver not set at
> > t/DBTestHarness.pm line 106
> >
> >
> DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBTest
> > Harness.pm line 204
> >
> >
> DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBT
> > estHarness.pm line 94
> >         DBTestHarness::new('DBTestHarness',
> > 'biosql') called at t\04swiss.t
> > line
> >  20
> > t\04swiss.........dubious
> >         Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-52
> >         Failed 52/52 tests, 0.00% okay
> > t\05seqfeature....driver not set at
> > t/DBTestHarness.pm line 106
> >
> >
> DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBTest
> > Harness.pm line 204
> >
> >
> DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBT
> > estHarness.pm line 94
> >         DBTestHarness::new('DBTestHarness',
> > 'biosql') called at
> > t\05seqfeature.t
> >  line 19
> > t\05seqfeature....dubious
> >         Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-48
> >         Failed 48/48 tests, 0.00% okay
> > t\06comment.......driver not set at
> > t/DBTestHarness.pm line 106
> >
> >
> DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBTest
> > Harness.pm line 204
> >
> >
> DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBT
> > estHarness.pm line 94
> >         DBTestHarness::new('DBTestHarness',
> > 'biosql') called at
> > t\06comment.t li
> > ne 20
> > t\06comment.......dubious
> >         Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-11
> >         Failed 11/11 tests, 0.00% okay
> > t\07dblink........driver not set at
> > t/DBTestHarness.pm line 106
> >
> >
> DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBTest
> > Harness.pm line 204
> >
> >
> DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBT
> > estHarness.pm line 94
> >         DBTestHarness::new('DBTestHarness',
> > 'biosql') called at t\07dblink.t
> > lin
> > e 21
> > t\07dblink........dubious
> >         Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-18
> >         Failed 18/18 tests, 0.00% okay
> > t\08genbank.......driver not set at
> > t/DBTestHarness.pm line 106
> >
> >
> DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBTest
> > Harness.pm line 204
> >
> >
> DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBT
> > estHarness.pm line 94
> >         DBTestHarness::new('DBTestHarness',
> > 'biosql') called at
> > t\08genbank.t li
> > ne 21
> > t\08genbank.......dubious
> >         Test returned status 2 (wstat 512, 0x200)
> > DIED. FAILED tests 1-18
> >         Failed 18/18 tests, 0.00% okay
> > t\09fuzzy2........driver not set at
> > t/DBTestHarness.pm line 106
> >
> >
> DBTestHarness::driver('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBTest
> > Harness.pm line 204
> >
> >
> DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
> > called at
> > t/DBT
> >
> === message truncated ===
>
>
>
>
>
> __________________________________
> Yahoo! for Good - Make a difference this year.
> http://brand.yahoo.com/cybergivingweek2005/
>

From avilella at gmail.com  Fri Dec 30 11:36:13 2005
From: avilella at gmail.com (Albert Vilella)
Date: Fri Dec 30 23:42:26 2005
Subject: [Bioperl-l] stop '*' symbol in Bio::AlignIO::fasta.pm
Message-ID: <1135960574.10203.17.camel@localhost.localdomain>

Hi all,

I just want to ask the bioperl community if it makes sense to have the
stop '*' symbol in Bio::AlignIO::fasta.pm module.

It makes sense to me when working on alignments of gene predictions that
happen to have stop codons in the middle of the sequences, it may not
for other cases.

For what I see, I needed to change this in line 58:

$MATCHPATTERN = '^A-Za-z\.\-\*';
#$MATCHPATTERN = '^A-Za-z\.\-';

Do you think this could be included in the module?

Bests,

    Albert.

From hlapp at gmx.net  Sat Dec 31 00:44:34 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Sat Dec 31 00:41:43 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <df8328740512302020n4fab6eb4h99f74b2072636288@mail.gmail.com>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<33f89146e1b14860a2f76475214a0c32@gmx.net>
	<df8328740512301501sc7c00f6r80da5ee7ef9d1b3a@mail.gmail.com>
	<84c80704820ab7d6ee3f474ff39338dd@gmx.net>
	<df8328740512301515g1227ab01g23cb57c9d8b9ccce@mail.gmail.com>
	<5e182836514be51503a73d5c998b1bb6@gmx.net>
	<df8328740512301613o377336bay95bca8b6d5cb9f44@mail.gmail.com>
	<6a1461589de1c31b88ebbfa1d6e94d44@gmx.net>
	<df8328740512301728p7dc9b416m3c08c084b3201aaf@mail.gmail.com>
	<4a7ab2b336f4310fc67b9eed0824a4a0@gmx.net>
	<df8328740512302020n4fab6eb4h99f74b2072636288@mail.gmail.com>
Message-ID: <ae4c50fc736122164be90a084f343a07@gmx.net>

PERL5LIB is an environment variable. 'use lib '/path/to/whatever';' 
should have the same effect though, apart from the fact that it 
requires you to modify the software.

The path should point to the directories where you installed your 
add-on packages.

You are correct, if the path is wrong then 'use Bio::Root::Root;' will 
fail - unless there is a system-default installed version of Bioperl 
older than 1.5.x.

	-hilmar

On Dec 30, 2005, at 8:20 PM, Angshu Kar wrote:

> You mean the ' use lib ' in my perl script to point to the .pm folder?
> Yes I've done that! Else how it should have failed at the first 
> step.Isn't it?
>
>
> On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:Did you set your 
> PERL5LIB appropriately?
>>
>> On some Windows platforms there are known problems with dynamically
>> loaded perl modules. The module quoted below does 'use
>> Bio::Root::Root;', so the absence of that is not the problem.
>>
>> ????????-hilmar
>>
>> On Dec 30, 2005, at 5:28 PM, Angshu Kar wrote:
>>
>> > A new error:
>> >
>> > I installed bioperl-db in my own WinXP m/c following instructions in
>> > CVS by Chris Fields. I'm trying to run the same command from this 
>> m/c
>> > (the postgres db resides in the linux box) and getting the error:
>> >
>> > Loading NC_003076.gbk ...
>> > Undefined subroutine &Bio::Root::Root::debug called at
>> > C:/Perl/site/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm line 1537,
>> > <GEN0> line 766536.
>> >
>> > Any inputs on this?
>> >
>> >
>> >
>> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>> >> incompatibility.
>>  >>
>> >> You haven't yet run the bioperl-db test suite, have you? Please 
>> don't
>> >> ask for more help before you haven't done that.
>> >>
>> >> Also, you do remember my earlier answer to a similar report from 
>> you,
>> >> right?
>> >> http://portal.open-bio.org/pipermail/bioperl-l/2005-December/
>> >> 020389.html
>> >>
>> >> The two first things to do is to check whether you run out of 
>> shared
>> >> memory and to run the tests and see whether the location where the
>> >> process gets killed can be narrowed down. If it's not a bug (which 
>> it
>> >> is unlikely to be - but the tests will provide more evidence) then 
>> the
>> >>??next step would be to recompile your own perl, DBI and DBD::Pg, 
>> and
>> >> PostgreSQL, in that order.
>> >>
>> >> -hilmar
>> >>
>> >> On Dec 30, 2005, at 4:13 PM, Angshu Kar wrote:
>> >>
>> >> > oops! he is not present now!
>> >> > anyways, if you have some time could you please if there are any
>> >> > reasons for the script to get killed with the .gbk file?
>> >> >
>> >> > Thanks,
>> >> > Angshu
>> >> >
>> >> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>> >> >> actually in a config file, and the default installation of 
>> Postgres
>> >> >> makes this config file unreadable for every one except the 
>> pg-admin
>> >> >> user chosen at installation time.
>> >> >>
>> >> >> -hilmar
>> >> >>
>> >> >> On Dec 30, 2005, at 3:15 PM, Angshu Kar wrote:
>> >> >>
>> >> >> > I've no clue about my Pg setup! It has been done by the
>> >> sysadmin! :(
>> >> >> > Could you please tell me the commands and I can run and let 
>> you
>>  >> know
>> >> >> > the reports?
>> >> >> >
>> >> >> > thanks,
>> >> >> > angshu
>> >> >> >
>> >> >> > On 12/30/05, Hilmar Lapp < hlapp@gmx.net> wrote:
>> >> >> >>
>> >> >> >> Also, you haven't reported your hw setup. In particular, how
>> >> much
>> >> >> >> memory and swap do you have, is Pg running locally (your 
>> command
>> >> >> line
>> >> >> >> suggests it does), and how much memory have you allocated to 
>> Pg?
>> >> >> >>
>> >> >> >> -hilmar
>> >> >> >>
>>  >> >> >> On Dec 30, 2005, at 3:01 PM, Angshu Kar wrote:
>> >> >> >>
>> >> >> >> > Yes Hilmar its indeed a full sequence of chromosome. I got 
>> it
>> >> >> from
>> >> >> >> > ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V/
>> >> >> >> > I tried with the .faa and .fna files and they ran
>> >> successfully.
>> >> >> >> > Also I missed a line (may be relevant) in the debug o/p:
>> >> >> >> > no adaptor found for class Bio::Annotation::TypeManager
>> >> >> >> >
>> >> >> >> > Thanks,
>> >> >> >> > Angshu
>> >> >> >> >
>> >> >> >> >
>> >> >> >> > On 12/30/05, Hilmar Lapp < hlapp@gmx.net> wrote:
>> >> >> >> >> special about this one? The file name lets me guess the 
>> input
>> >> >> is a
>> >> >> >> >> contig or even a full chromosome? Is the input on which 
>> the
>> >> >> process
>> >> >> >> >> wasn't killed of the same nature? Are the sequences of
>> >> >> comparable
>> >> >> >> or
>> >> >> >> >> vastly different lengths? Is there only a single contig in
>> >> the
>> >> >> >> >> offending input? Can you reproduce the problem on an empty
>> >> >> database
>> >> >> >> >> with input containing a single entry? If so, let me know
>> >> where I
>> >> >> >> can
>> >> >> >> >> get that file from and I'll try to reproduce it locally.
>> >> >> >> >>
>> >> >> >> >> -hilmar
>> >> >> >> >>
>> >> >> >> >> On Dec 30, 2005, at 2:29 PM, Angshu Kar wrote:
>> >> >> >> >>
>> >> >> >> >> > Any clues why my load_seqdatabase.pl 
>> (./load_seqdatabase.pl
>> >> >> >> >> > --dbname=USBA --dbuser=postgres --format=genbank
>> >> --driver=Pg
>> >> >> >> --debug
>> >> >> >> >> > NC_003076.gbk)
>> >> >> >> >> > is getting killed after the follwoing step?
>> >> >>>> >> >
>> >> >> >> >> >Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as
>> >> driver
>> >> >> peer
>> >> >> >> >> > for Bio::DB::BioSQL::BiosequenceAdaptor
>> >> >> >> >> > preparing SELECT statement: SELECT bioentry_id FROM
>> >> >> biosequence
>> >> >> >> >> WHERE
>> >> >> >> >> > bioentry_id = ?
>> >> >> >> >> >
>> >> >> >> >> > Killed
>> >> >> >> >> >
>> >> >> >> >> > I'm using a linux box. This didn't happen for a 
>> different
>> >> i/p
>> >> >> >> file!
>> >> >> >> >> >
>> >> >> >> >> > Thanks,
>> >> >> >> >> > Angshu
>> >> >> >> >> >
>> >> >> >> >> >
>> >> >> >> >> > On 12/29/05, Angshu Kar < angshu96@gmail.com> wrote: I'm
>> >> sorry
>> >> >> >> that
>> >> >> >> >> I
>> >> >> >> >> > missed it! Thanks for pointing it out.
>> >> >> >> >> >> Also thanks Hilmar for the update.
>> >> >> >> >> >>
>> >> >> >> >> >> Angshu
>> >> >> >> >> >>
>> >> >> >> >> >>
>> >> >> >>>> >> On 12/29/05, Torsten Seemann <
>> >> >> >> >> torsten.seemann@infotech.monash.edu.au
>> >> >> >> >> >> > wrote:> I'm getting the following error while trying 
>> to
>> >> >> run :
>> >> >> >> >> >>> > ./load_seqdatabase.pl -host localhost -dbname USBA
>> >> -dbuser
>> >> >> >> >> >>> postgres -format
>> >> >> >> >> >>> > genbank NC_003076.gbk
>> >> >> >> >> >>> > MSG: failed to open connection: Can't connect to 
>> local
>> >> >> MySQL
>>  >> >> >> >> >>> server through
>> >> >> >> >> >>> > socket '/var/lib/mysql/mysql.sock' (2)
>> >> >> >> >> >>> > But I've a postgreSQL db and not a MySQL one...could
>> >> >> anyone
>> >> >> >> >> please
>> >> >> >>>> >>> guide me
>> >> >> >> >> >>> > troubleshoot this?
>> >> >> >> >> >>>
>> >> >> >> >> >>> Did you read the documentation for the
>> >> load_seqdatabase.pl
>> >> >> >> script?
>> >> >> >> >> >>>
>> >>??>> >> >> >>> It's in the script itself!
>> >> >> >> >> >>>
>> >> >> >> >> >>> =item --driver $driver
>> >> >> >> >> >>> the DBI driver name for the RDBMS e.g., mysql, Pg, or
>> >> Oracle
>> >> >> >> >> >>> [mysql]
>> >> >> >> >> >>>
>> >> >> >> >> >>> The default DBI driver is [mysql].
>>  >> >> >> >> >>>
>> >> >> >> >> >>> I think you want the option "-driver Pg".
>> >> >> >> >> >>>
>> >> >> >> >>>>> --
>> >> >> >> >> >>> Torsten Seemann
>> >> >> >> >> >>> Victorian Bioinformatics Consortium, Monash 
>> University,
>> >> >> >> Australia
>> >> >> >> >> >>> http://www.vicbioinformatics.com/
>> >> >> >> >> >>
>> >> >> >> >> >>
>> >> >> >> >> --
>>  >> >> >> >> 
>> -------------------------------------------------------------
>> >> >> >> >> Hilmar Lappemail: lapp at gnf.org
>> >> >> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> >> >> >> 
>> -------------------------------------------------------------
>> >> >> >> >>
>> >> >> >> >>
>> >> >> >> >
>> >> >> >> >
>> >> >> >> --
>> >> >> >> -------------------------------------------------------------
>> >> >> >> Hilmar Lappemail: lapp at gnf.org
>>  >> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> >> >> -------------------------------------------------------------
>> >> >> >>
>> >> >> >>
>> >> >> >>
>> >> >> --
>> >> >> -------------------------------------------------------------
>> >> >> Hilmar Lappemail: lapp at gnf.org
>> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> >> -------------------------------------------------------------
>> >> >>
>> >> >>
>> >> >>
>> >> --
>> >> -------------------------------------------------------------
>> >> Hilmar Lappemail: lapp at gnf.org
>> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> -------------------------------------------------------------
>> >>
>> >>
>> >>
>> --
>> -------------------------------------------------------------
>> Hilmar Lapp????????????????????????????email: lapp at gnf.org
>> GNF, San Diego, Ca. 92121??????????????phone: +1-858-812-1757
>> -------------------------------------------------------------
>>
>>
>>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------



From hlapp at gmx.net  Sat Dec 31 00:46:50 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Sat Dec 31 00:43:42 2005
Subject: [Bioperl-l] error running load_seqdatabase.pl
In-Reply-To: <df8328740512302013n17d580dcp71a9aa9a52fef0b5@mail.gmail.com>
References: <df8328740512291450w44c3d9b9l366975a2264a83e2@mail.gmail.com>
	<33f89146e1b14860a2f76475214a0c32@gmx.net>
	<df8328740512301501sc7c00f6r80da5ee7ef9d1b3a@mail.gmail.com>
	<84c80704820ab7d6ee3f474ff39338dd@gmx.net>
	<df8328740512301515g1227ab01g23cb57c9d8b9ccce@mail.gmail.com>
	<5e182836514be51503a73d5c998b1bb6@gmx.net>
	<df8328740512301613o377336bay95bca8b6d5cb9f44@mail.gmail.com>
	<6a1461589de1c31b88ebbfa1d6e94d44@gmx.net>
	<df8328740512301759r22cb8ba3u1d1e48c7d6c33694@mail.gmail.com>
	<5b321da72f66dc31312cb30deb6269a5@gmx.net>
	<df8328740512302013n17d580dcp71a9aa9a52fef0b5@mail.gmail.com>
Message-ID: <9e82a9c28618c82ee8b03a41d0de942f@gmx.net>

That's only the statistics - lacking any error messages what do you  
expect me to glean from it?

On Dec 30, 2005, at 8:13 PM, Angshu Kar wrote:

> :) I'm sorry again.
> After setting the DBHarness I get the following from nmake test:
>
> ??????? Test returned status 255 (wstat 65280, 0xff00)
> DIED. FAILED tests 3-160
> ??????? Failed 158/160 tests, 1.25% okay
>  Failed Test????? Stat Wstat Total Fail? Failed? List of Failed
> ----------------------------------------------------------------------- 
> ------
> t\01dbadaptor.t???? 5? 1280??? 19?? 30 157.89%? 5-19
> t\02species.t???? 255 65280??? 65? 126 193.85%? 3-65
> t\03simpleseq.t???? 5? 1280??? 59? 108 183.05%? 6-59
> t\04swiss.t?????? 255 65280??? 52? 100 192.31%? 3-52
> t\05seqfeature.t? 255 65280??? 48?? 92 191.67%? 3-48
> t\06comment.t???? 255 65280??? 11?? 18 163.64%? 3-11
> t\07dblink.t????? 255 65280??? 18?? 32 177.78%? 3-18
> t\08genbank.t???? 255 65280??? 18?? 32 177.78%? 3-18
> t\09fuzzy2.t????? 255 65280??? 21?? 38 180.95%? 3-21
> t\10ensembl.t???? 255 65280??? 15?? 26 173.33%? 3-15
> t\11locuslink.t?? 255 65280?? 110? 214 194.55%? 4-110
> t\12ontology.t????? 9? 2304?? 738 1470 199.19%? 4-738
> t\13remove.t????? 255 65280??? 59? 116 196.61%? 2-59
> t\15cluster.t???? 255 65280?? 160? 316 197.50%? 3-160
> Failed 14/15 test scripts, 6.67% okay. 1359/1411 subtests failed,  
> 3.69% okay.
> NMAKE : fatal error U1077: 'C:\WINDOWS\system32\cmd.exe' : return code  
> '0xff'
> Stop.
>
> On 12/30/05, Hilmar Lapp <hlapp@gmx.net > wrote:Angshu, next time you  
> feel the urge to write such an email restrain
>>  yourself, hold off, sit back, and, most importantly, think.
>>
>> The error message clearly says 'driver not set'. Did you do anything
>> that assures you that you *have* set the driver?
>>
>> I suppose you forgot to follow the instructions for running the tests,
>> namely to copy
>> t/DBHarness.conf.example to t/DBHarness.biosql.conf, and edit to suit
>> your setup. This is documented, and I told you about this step  
>> earlier.
>>
>> ????????-hilmar
>>
>> On Dec 30, 2005, at 5:59 PM, Angshu Kar wrote:
>>
>> > Hi Hilmar,
>> >
>> > All my tests failed for my WInXP m/c!I'm really at a fix!:(
>> > Do I need to uninstall bioperl-db, bioperl and even perl??? How to  
>> do
>> > that?
>> > Please guide.
>> > I'll be obliged if anyone with WinXp (not cygwin) provides his/her
>> > feedback ...
>> >
>> > Thanks,
>> > Angshu
>> >
>> > Microsoft (R) Program Maintenance Utility Version 1.50
>> > Copyright (c) Microsoft Corp 1988-94. All rights reserved.
>> >
>> > C:\Perl\bin\perl.exe "-MExtUtils::Command::MM" "-e"
>> > "test_harness(0, 'bl
>> > ib\lib', 'blib\arch')" t\01dbadaptor.t t\02species.t t\03simpleseq.t
>> > t\04swiss.t
>> > t\05seqfeature.t t\06comment.t t\07dblink.t t\08genbank.t
>> > t\09fuzzy2.t t\10ense
>> > mbl.t t\11locuslink.t t\12ontology.t t\13remove.t t\14query.t
>> > t\15cluster.t
>> >??t\01dbadaptor.....driver not set at t/DBTestHarness.pm line 106
>> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
>> > at t/DBTest
>> > Harness.pm line 204
>> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
>> > called at t/DBT
>> > estHarness.pm line 94
>> > DBTestHarness::new('DBTestHarness', 'biosql') called at
>> > t\01dbadaptor.t
>> > line 20
>> > t\01dbadaptor.....dubious
>> >?? Test returned status 2 (wstat 512, 0x200)
>> > DIED. FAILED tests 1-19
>> > Failed 19/19 tests, 0.00% okay
>> > t\02species.......driver not set at t/DBTestHarness.pm line 106
>> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
>> > at t/DBTest
>> > Harness.pm line 204
>> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
>> > called at t/DBT
>> > estHarness.pm line 94
>> > DBTestHarness::new('DBTestHarness', 'biosql') called at
>> > t\02species.t li
>> > ne 18
>> > t\02species.......dubious
>> >?? Test returned status 2 (wstat 512, 0x200)
>>  > DIED. FAILED tests 1-65
>> > Failed 65/65 tests, 0.00% okay
>> > t\03simpleseq.....driver not set at t/DBTestHarness.pm line 106
>> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
>> > at t/DBTest
>> > Harness.pm line 204
>> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
>> > called at t/DBT
>> > estHarness.pm line 94
>> > DBTestHarness::new('DBTestHarness', 'biosql') called at
>> > t\03simpleseq.t
>> > line 19
>> > t\03simpleseq.....dubious
>> >?? Test returned status 2 (wstat 512, 0x200)
>> > DIED. FAILED tests 1-59
>> > Failed 59/59 tests, 0.00% okay
>> > t\04swiss.........driver not set at t/DBTestHarness.pm line 106
>> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
>> > at t/DBTest
>> > Harness.pm line 204
>> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
>> > called at t/DBT
>> > estHarness.pm line 94
>> > DBTestHarness::new('DBTestHarness', 'biosql') called at
>> > t\04swiss.t line
>> > 20
>> > t\04swiss.........dubious
>> >?? Test returned status 2 (wstat 512, 0x200)
>> > DIED. FAILED tests 1-52
>> > Failed 52/52 tests, 0.00% okay
>> > t\05seqfeature....driver not set at t/DBTestHarness.pm line 106
>> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
>> > at t/DBTest
>> > Harness.pm line 204
>> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
>> > called at t/DBT
>> > estHarness.pm line 94
>> > DBTestHarness::new('DBTestHarness', 'biosql') called at
>> > t\05seqfeature.t
>> > line 19
>> > t\05seqfeature....dubious
>> >?? Test returned status 2 (wstat 512, 0x200)
>> > DIED. FAILED tests 1-48
>> > Failed 48/48 tests, 0.00% okay
>> > t\06comment.......driver not set at t/DBTestHarness.pm line 106
>> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
>> > at t/DBTest
>> > Harness.pm line 204
>> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
>> > called at t/DBT
>> > estHarness.pm line 94
>> > DBTestHarness::new('DBTestHarness', 'biosql') called at
>> > t\06comment.t li
>> > ne 20
>> > t\06comment.......dubious
>> >?? Test returned status 2 (wstat 512, 0x200)
>>  > DIED. FAILED tests 1-11
>> > Failed 11/11 tests, 0.00% okay
>> > t\07dblink........driver not set at t/DBTestHarness.pm line 106
>> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
>> > at t/DBTest
>> > Harness.pm line 204
>> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
>> > called at t/DBT
>> > estHarness.pm line 94
>> > DBTestHarness::new('DBTestHarness', 'biosql') called at
>> > t\07dblink.t lin
>> > e 21
>> > t\07dblink........dubious
>> >?? Test returned status 2 (wstat 512, 0x200)
>> > DIED. FAILED tests 1-18
>> > Failed 18/18 tests, 0.00% okay
>> > t\08genbank.......driver not set at t/DBTestHarness.pm line 106
>> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
>> > at t/DBTest
>> > Harness.pm line 204
>> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
>> > called at t/DBT
>> > estHarness.pm line 94
>> > DBTestHarness::new('DBTestHarness', 'biosql') called at
>> > t\08genbank.t li
>> > ne 21
>> > t\08genbank.......dubious
>> >?? Test returned status 2 (wstat 512, 0x200)
>>  > DIED. FAILED tests 1-18
>> > Failed 18/18 tests, 0.00% okay
>> > t\09fuzzy2........driver not set at t/DBTestHarness.pm line 106
>> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
>> > at t/DBTest
>> > Harness.pm line 204
>> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
>> > called at t/DBT
>> > estHarness.pm line 94
>> > DBTestHarness::new('DBTestHarness', 'biosql') called at
>> > t\09fuzzy2.t lin
>> > e 26
>> > t\09fuzzy2........dubious
>> >?? Test returned status 2 (wstat 512, 0x200)
>> > DIED. FAILED tests 1-21
>> > Failed 21/21 tests, 0.00% okay
>> > t\10ensembl.......driver not set at t/DBTestHarness.pm line 106
>> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
>> > at t/DBTest
>> > Harness.pm line 204
>> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
>> > called at t/DBT
>> > estHarness.pm line 94
>> > DBTestHarness::new('DBTestHarness', 'biosql') called at
>> > t\10ensembl.t li
>> > ne 21
>> > t\10ensembl.......dubious
>> >?? Test returned status 2 (wstat 512, 0x200)
>>  > DIED. FAILED tests 1-15
>> > Failed 15/15 tests, 0.00% okay
>> > t\11locuslink.....driver not set at t/DBTestHarness.pm line 106
>> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
>> > at t/DBTest
>> > Harness.pm line 204
>> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
>> > called at t/DBT
>> > estHarness.pm line 94
>> > DBTestHarness::new('DBTestHarness', 'biosql') called at
>> > t\11locuslink.t
>> > line 21
>> > t\11locuslink.....dubious
>> >?? Test returned status 2 (wstat 512, 0x200)
>> > DIED. FAILED tests 1-110
>> > Failed 110/110 tests, 0.00% okay
>> > t\12ontology......driver not set at t/DBTestHarness.pm line 106
>> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
>> > at t/DBTest
>> > Harness.pm line 204
>> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
>> > called at t/DBT
>> > estHarness.pm line 94
>> > DBTestHarness::new('DBTestHarness', 'biosql') called at
>> > t\12ontology.t l
>> > ine 19
>> > t\12ontology......dubious
>> >?? Test returned status 2 (wstat 512, 0x200)
>>  > DIED. FAILED tests 1-738
>> > Failed 738/738 tests, 0.00% okay
>> > t\13remove........driver not set at t/DBTestHarness.pm line 106
>> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
>> > at t/DBTest
>> > Harness.pm line 204
>> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
>> > called at t/DBT
>> > estHarness.pm line 94
>> > DBTestHarness::new('DBTestHarness', 'biosql') called at
>> > t\13remove.t lin
>> > e 19
>> > t\13remove........dubious
>> >?? Test returned status 2 (wstat 512, 0x200)
>> > DIED. FAILED tests 1-59
>> > Failed 59/59 tests, 0.00% okay
>> > t\14query.........ok
>> > t\15cluster.......driver not set at t/DBTestHarness.pm line 106
>> > DBTestHarness::driver('DBTestHarness=HASH(0x235278)') called
>> > at t/DBTest
>> > Harness.pm line 204
>> > DBTestHarness::create_db('DBTestHarness=HASH(0x235278)')
>> > called at t/DBT
>> > estHarness.pm line 94
>> > DBTestHarness::new('DBTestHarness', 'biosql') called at
>> > t\15cluster.t li
>> > ne 19
>> > t\15cluster.......dubious
>> > Test returned status 2 (wstat 512, 0x200)
>> > DIED. FAILED tests 1-160
>> > Failed 160/160 tests, 0.00% okay
>> > Failed Test Stat Wstat Total Fail Failed List of Failed
>> >  
>> ---------------------------------------------------------------------- 
>> -
>> > --------
>> > t\01dbadaptor.t 2 512 19 38 200.00% 1-19
>> > t\02species.t 2 512 65 130 200.00% 1-65
>> > t\03simpleseq.t 2 512 59 118 200.00% 1-59
>> > t\04swiss.t 2 512 52 104 200.00% 1-52
>> > t\05seqfeature.t 2 512 48 96 200.00% 1-48
>> > t\06comment.t 2 512 11 22 200.00% 1-11
>> > t\07dblink.t 2 512 18 36 200.00% 1-18
>> > t\08genbank.t 2 512 18 36 200.00% 1-18
>> > t\09fuzzy2.t 2 512 21 42 200.00% 1-21
>> > t\10ensembl.t 2 512 15 30 200.00% 1-15
>> > t\11locuslink.t 2 512 110 220 200.00% 1-110
>> > t\12ontology.t 2 512 738 1476 200.00% 1-738
>> > t\13remove.t 2 512 59 118 200.00% 1-59
>> > t\15cluster.t 2 512 160 320 200.00% 1-160
>> > Failed 14/15 test scripts, 6.67% okay. 1393/1411 subtests failed,
>> > 1.28% okay.
>> >??NMAKE : fatal error U1077: 'C:\WINDOWS\system32\cmd.exe' : return
>> > code '0x2'
>> > Stop.
>> >
>> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:I suspect it's  
>> either a
>> > (out-of-)memory error or a binary
>> >> incompatibility.
>> >>
>> >> You haven't yet run the bioperl-db test suite, have you? Please  
>> don't
>> >> ask for more help before you haven't done that.
>> >>
>> >> Also, you do remember my earlier answer to a similar report from  
>> you,
>> >> right?
>> >> http://portal.open-bio.org/pipermail/bioperl-l/2005-December/
>> >> 020389.html
>> >>
>> >> The two first things to do is to check whether you run out of  
>> shared
>> >> memory and to run the tests and see whether the location where the
>> >> process gets killed can be narrowed down. If it's not a bug (which  
>> it
>> >> is unlikely to be - but the tests will provide more evidence) then  
>> the
>> >>??next step would be to recompile your own perl, DBI and DBD::Pg,  
>> and
>> >> PostgreSQL, in that order.
>> >>
>> >> -hilmar
>> >>
>> >> On Dec 30, 2005, at 4:13 PM, Angshu Kar wrote:
>> >>
>> >> > oops! he is not present now!
>> >> > anyways, if you have some time could you please if there are any
>> >> > reasons for the script to get killed with the .gbk file?
>> >> >
>> >> > Thanks,
>> >> > Angshu
>> >> >
>> >> > On 12/30/05, Hilmar Lapp <hlapp@gmx.net> wrote:
>> >> >> actually in a config file, and the default installation of  
>> Postgres
>> >> >> makes this config file unreadable for every one except the  
>> pg-admin
>> >> >> user chosen at installation time.
>> >> >>
>> >> >> -hilmar
>> >> >>
>> >> >> On Dec 30, 2005, at 3:15 PM, Angshu Kar wrote:
>> >> >>
>> >> >> > I've no clue about my Pg setup! It has been done by the
>> >> sysadmin! :(
>> >> >> > Could you please tell me the commands and I can run and let  
>> you
>>  >> know
>> >> >> > the reports?
>> >> >> >
>> >> >> > thanks,
>> >> >> > angshu
>> >> >> >
>> >> >> > On 12/30/05, Hilmar Lapp < hlapp@gmx.net> wrote:
>> >> >> >>
>> >> >> >> Also, you haven't reported your hw setup. In particular, how
>> >> much
>> >> >> >> memory and swap do you have, is Pg running locally (your  
>> command
>> >> >> line
>> >> >> >> suggests it does), and how much memory have you allocated to  
>> Pg?
>> >> >> >>
>> >> >> >> -hilmar
>> >> >> >>
>>  >> >> >> On Dec 30, 2005, at 3:01 PM, Angshu Kar wrote:
>> >> >> >>
>> >> >> >> > Yes Hilmar its indeed a full sequence of chromosome. I got  
>> it
>> >> >> from
>> >> >> >> > ftp://ftp.ncbi.nih.gov/genomes/Arabidopsis_thaliana/CHR_V/
>> >> >> >> > I tried with the .faa and .fna files and they ran
>> >> successfully.
>> >> >> >> > Also I missed a line (may be relevant) in the debug o/p:
>> >> >> >> > no adaptor found for class Bio::Annotation::TypeManager
>> >> >> >> >
>> >> >> >> > Thanks,
>> >> >> >> > Angshu
>> >> >> >> >
>> >> >> >> >
>> >> >> >> > On 12/30/05, Hilmar Lapp < hlapp@gmx.net> wrote:
>> >> >> >> >> special about this one? The file name lets me guess the  
>> input
>> >> >> is a
>> >> >> >> >> contig or even a full chromosome? Is the input on which  
>> the
>> >> >> process
>> >> >> >> >> wasn't killed of the same nature? Are the sequences of
>> >> >> comparable
>> >> >> >> or
>> >> >> >> >> vastly different lengths? Is there only a single contig in
>> >> the
>> >> >> >> >> offending input? Can you reproduce the problem on an empty
>> >> >> database
>> >> >> >> >> with input containing a single entry? If so, let me know
>> >> where I
>> >> >> >> can
>> >> >> >> >> get that file from and I'll try to reproduce it locally.
>> >> >> >> >>
>> >> >> >> >> -hilmar
>> >> >> >> >>
>> >> >> >> >> On Dec 30, 2005, at 2:29 PM, Angshu Kar wrote:
>> >> >> >> >>
>> >> >> >> >> > Any clues why my load_seqdatabase.pl  
>> (./load_seqdatabase.pl
>> >> >> >> >> > --dbname=USBA --dbuser=postgres --format=genbank
>> >> --driver=Pg
>> >> >> >> --debug
>> >> >> >> >> > NC_003076.gbk)
>> >> >> >> >> > is getting killed after the follwoing step?
>> >> >>>> >> >
>> >> >> >> >> >Using Bio::DB::BioSQL::Pg::BiosequenceAdaptorDriver as
>> >> driver
>> >> >> peer
>> >> >> >> >> > for Bio::DB::BioSQL::BiosequenceAdaptor
>> >> >> >> >> > preparing SELECT statement: SELECT bioentry_id FROM
>> >> >> biosequence
>> >> >> >> >> WHERE
>> >> >> >> >> > bioentry_id = ?
>> >> >> >> >> >
>> >> >> >> >> > Killed
>> >> >> >> >> >
>> >> >> >> >> > I'm using a linux box. This didn't happen for a  
>> different
>> >> i/p
>> >> >> >> file!
>> >> >> >> >> >
>> >> >> >> >> > Thanks,
>> >> >> >> >> > Angshu
>> >> >> >> >> >
>> >> >> >> >> >
>> >> >> >> >> > On 12/29/05, Angshu Kar < angshu96@gmail.com> wrote: I'm
>> >> sorry
>> >> >> >> that
>> >> >> >> >> I
>> >> >> >> >> > missed it! Thanks for pointing it out.
>> >> >> >> >> >> Also thanks Hilmar for the update.
>> >> >> >> >> >>
>> >> >> >> >> >> Angshu
>> >> >> >> >> >>
>> >> >> >> >> >>
>> >> >> >>>> >> On 12/29/05, Torsten Seemann <
>> >> >> >> >> torsten.seemann@infotech.monash.edu.au
>> >> >> >> >> >> > wrote:> I'm getting the following error while trying  
>> to
>> >> >> run :
>> >> >> >> >> >>> > ./load_seqdatabase.pl -host localhost -dbname USBA
>> >> -dbuser
>> >> >> >> >> >>> postgres -format
>> >> >> >> >> >>> > genbank NC_003076.gbk
>> >> >> >> >> >>> > MSG: failed to open connection: Can't connect to  
>> local
>> >> >> MySQL
>>  >> >> >> >> >>> server through
>> >> >> >> >> >>> > socket '/var/lib/mysql/mysql.sock' (2)
>> >> >> >> >> >>> > But I've a postgreSQL db and not a MySQL one...could
>> >> >> anyone
>> >> >> >> >> please
>> >> >> >>>> >>> guide me
>> >> >> >> >> >>> > troubleshoot this?
>> >> >> >> >> >>>
>> >> >> >> >> >>> Did you read the documentation for the
>> >> load_seqdatabase.pl
>> >> >> >> script?
>> >> >> >> >> >>>
>> >>??>> >> >> >>> It's in the script itself!
>> >> >> >> >> >>>
>> >> >> >> >> >>> =item --driver $driver
>> >> >> >> >> >>> the DBI driver name for the RDBMS e.g., mysql, Pg, or
>> >> Oracle
>> >> >> >> >> >>> [mysql]
>> >> >> >> >> >>>
>> >> >> >> >> >>> The default DBI driver is [mysql].
>>  >> >> >> >> >>>
>> >> >> >> >> >>> I think you want the option "-driver Pg".
>> >> >> >> >> >>>
>> >> >> >> >>>>> --
>> >> >> >> >> >>> Torsten Seemann
>> >> >> >> >> >>> Victorian Bioinformatics Consortium, Monash  
>> University,
>> >> >> >> Australia
>> >> >> >> >> >>> http://www.vicbioinformatics.com/
>> >> >> >> >> >>
>> >> >> >> >> >>
>> >> >> >> >> --
>>  >> >> >> >>  
>> -------------------------------------------------------------
>> >> >> >> >> Hilmar Lappemail: lapp at gnf.org
>> >> >> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> >> >> >>  
>> -------------------------------------------------------------
>> >> >> >> >>
>> >> >> >> >>
>> >> >> >> >
>> >> >> >> >
>> >> >> >> --
>> >> >> >> -------------------------------------------------------------
>> >> >> >> Hilmar Lappemail: lapp at gnf.org
>>  >> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> >> >> -------------------------------------------------------------
>> >> >> >>
>> >> >> >>
>> >> >> >>
>> >> >> --
>> >> >> -------------------------------------------------------------
>> >> >> Hilmar Lappemail: lapp at gnf.org
>> >> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> >> -------------------------------------------------------------
>> >> >>
>> >> >>
>> >> >>
>> >> --
>> >> -------------------------------------------------------------
>> >> Hilmar Lappemail: lapp at gnf.org
>> >> GNF, San Diego, Ca. 92121phone: +1-858-812-1757
>> >> -------------------------------------------------------------
>> >>
>> >>
>> >>
>> --
>> -------------------------------------------------------------
>> Hilmar Lapp????????????????????????????email: lapp at gnf.org
>> GNF, San Diego, Ca. 92121??????????????phone: +1-858-812-1757
>> -------------------------------------------------------------
>>
>>
>>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------



From jason.stajich at duke.edu  Sat Dec 31 12:22:36 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Sat Dec 31 13:35:26 2005
Subject: [Bioperl-l] stop '*' symbol in Bio::AlignIO::fasta.pm
In-Reply-To: <1135960574.10203.17.camel@localhost.localdomain>
References: <1135960574.10203.17.camel@localhost.localdomain>
Message-ID: <8B68EAE0-C3E4-4AF4-9D05-C8CBC70A60D1@duke.edu>

Yes it definitely makes sense.  They should be supported.

On Dec 30, 2005, at 11:36 AM, Albert Vilella wrote:

> Hi all,
>
> I just want to ask the bioperl community if it makes sense to have the
> stop '*' symbol in Bio::AlignIO::fasta.pm module.
>
> It makes sense to me when working on alignments of gene predictions  
> that
> happen to have stop codons in the middle of the sequences, it may not
> for other cases.
>
> For what I see, I needed to change this in line 58:
>
> $MATCHPATTERN = '^A-Za-z\.\-\*';
> #$MATCHPATTERN = '^A-Za-z\.\-';
>
> Do you think this could be included in the module?
>
> Bests,
>
>     Albert.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12