[Bioperl-l] build Align object from scratch?

[Scott Markel]

Fernan,

I did something like this recently.  I used Bio::SimpleAlign,
created Bio::LocatableSeq objects for each member sequence
and added them using $alignment->add_seq().  Worked fine.

Scott

Fernan Aguero wrote:
> Hi!
> 
> is it possible to build an alignment object without reading an
> alignment from a file, a filehandle etc?
> 
> I'm reading the pods for AlignIO, AlignI, SimpleAlign, etc
> and I don't see this as a possibility.
> 
> What I'm doing is reading gapped sequences from tables in
> a MySQL database (i.e. already aligned sequences). I need to
> recreate the alignment in my program to then take some
> portions of these sequences based on their overlappings.
> 
> Examples of the kind of sequences that I'll be reading are:
> 
> ATGGTATGGAGTGATGAGTGTGTGA
> ----TATGGAGTGATGAGT------
> ATGGTATGGAGTG------------
> --------------TGAGTGTGTGA
> 
> Essentially this looks like an aligned FASTA ... of course I
> could write an alignment in this format to a tmp file and
> then read it again using AlignIO ... but given that I
> already have this info available to my program, I just
> thought this was not the most elegant way to do it.
> 
> Is there another?
> 
> thanks in advance for any tip,
> 
> Fernan
> 

-- 
Scott Markel, Ph.D.
Principal Bioinformatics Architect  email:  smarkel at scitegic.com
SciTegic Inc.                       mobile: +1 858 205 3653
9665 Chesapeake Drive, Suite 401    voice:  +1 858 279 8800, ext. 253
San Diego, CA 92123                 fax:    +1 858 279 8804
USA                                 web:    http://www.scitegic.com