From Richard.Adams at ed.ac.uk Fri Oct 1 06:08:13 2004 From: Richard.Adams at ed.ac.uk (Richard Adams) Date: Fri Oct 1 06:07:43 2004 Subject: [Bioperl-l] argument checking Message-ID: <415D2C8D.2090809@ed.ac.uk> I was wondering what developers thought about a generic argument checking method, say in Bio::Root::Root. Obviously the world has continued turning without it since BioPerl's inception but it might save quite few lines of code throughout the whole package. What I'm thinking of is e.g., in usage sub x { my ($self, $arg1, $arg2) = @_; $self->check_args('Bio::SeqI' => $arg1, 'array', => $arg2); ##.. rest of method } Apologies if there is this functionality lurking somewhere and I've not found it yet. Richard -- Dr Richard Adams Psychiatric Genetics Group, Medical Genetics, Molecular Medicine Centre, Western General Hospital, Crewe Rd West, Edinburgh UK EH4 2XU Tel: 44 131 651 1084 richard.adams@ed.ac.uk From amackey at pcbi.upenn.edu Fri Oct 1 08:09:18 2004 From: amackey at pcbi.upenn.edu (Aaron J. Mackey) Date: Fri Oct 1 08:08:44 2004 Subject: [Bioperl-l] argument checking In-Reply-To: <415D2C8D.2090809@ed.ac.uk> References: <415D2C8D.2090809@ed.ac.uk> Message-ID: This idea is an aspect of programming by contract; greatly useful while debugging, but needs a way to be turned off *completely* in production code (i.e. not just check_args immediately returning success, but check_args not even being a part of the call stack) to not make our speed problems even worse. Hmm, I guess you mean to replace existing code that already does the same and incurs the same penalty ... I'd argue that the "specification" should only be listed once, and the call to _rearrange is probably a good place for it to happen, i.e.: sub foobar { my $self = shift; my ($doodad, $entries) = $self->process_arguments( [qw(DOODAD ENTRIES)], # usual _rearrange argument [qw(Bio::Seq::Doodad ARRAY)], # variable "isa" specification # override default error messages, with keyword replacement: ["Come on, gimme a Doodad, not a [#REF#]!", undef], ); # ... } If we did something like this, then process_arguments() could turn into the more simpler _rearrange when in production (controlled via ?? - lots of options here). This could be done with source filter trickery or the "optimizer" module for maximum benefit. -Aaron On Oct 1, 2004, at 6:08 AM, Richard Adams wrote: > I was wondering what developers thought about a generic argument > checking method, say in Bio::Root::Root. > Obviously the world has continued turning without it since BioPerl's > inception but it might > save quite few lines of code throughout the whole package. > What I'm thinking of is > > e.g., in usage > sub x { > my ($self, $arg1, $arg2) = @_; > $self->check_args('Bio::SeqI' => $arg1, > 'array', => $arg2); > ##.. rest of method > } > > Apologies if there is this functionality lurking somewhere and I've > not found it yet. > > Richard > > -- > Dr Richard Adams > Psychiatric Genetics Group, > Medical Genetics, > Molecular Medicine Centre, > Western General Hospital, > Crewe Rd West, > Edinburgh UK > EH4 2XU > > Tel: 44 131 651 1084 > richard.adams@ed.ac.uk > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- Aaron J. Mackey, Ph.D. Dept. of Biology, Goddard 212 University of Pennsylvania email: amackey@pcbi.upenn.edu 415 S. University Avenue office: 215-898-1205 Philadelphia, PA 19104-6017 fax: 215-746-6697 From jason.stajich at duke.edu Fri Oct 1 10:00:53 2004 From: jason.stajich at duke.edu (Jason Stajich) Date: Fri Oct 1 10:00:21 2004 Subject: [Bioperl-l] Ask help for Bio::Tools::Run::Primer3 In-Reply-To: References: Message-ID: <4EEBF615-13B2-11D9-8883-000393C44276@duke.edu> In looking at the code some more, shouldn't we make the default 'primer3_core' instead? You can always override it with the program_name function. $primer3->program_name('my_superfast_primer3'); -jason On Sep 29, 2004, at 4:38 PM, Ewing, Adam D. wrote: > Yes, it does matter... simply change the name of primer3_core to > primer3, put it in your path, and you should be good to go! > > Adam > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org on behalf of Fengkai Zhang > (Tony) > Sent: Wed 9/29/2004 4:21 PM > To: bioperl-l@bioperl.org > Subject: [Bioperl-l] Ask help for Bio::Tools::Run::Primer3 > > Hi, I am a newbie for bioperl and met the below question. > > I was trying to use Bio::Tools::Run::Primer3. When I run the example > code in the documentation of this module, I got the following error > message: > -------------------------------- > $ perl -I ../primer3_1.0.0/src/ -w primer3run_test.pl > > Use of uninitialized value in concatenation (.) or string at > /usr/lib/perl5/site_perl/5.8.0/Bio/Tools/Run/Primer3.pm line 212, > line 1. > primer3 can not be found. Is it installed? > -------------------------------- > > I already installed Primer3 according its instruction and it works > well to run the test and example. I also noticed that the > primer_test.pl in primer3 package calls "primer3_core" rather than > "primer3". Does it matter for Bio::Tools::Run::Primer3 module? > > > Thanks ahead for your help. > > > > Tony > > VIPBG@VCU > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l -- Jason Stajich jason.stajich at duke.edu http://www.duke.edu/~jes12/ From cain at cshl.org Fri Oct 1 10:13:36 2004 From: cain at cshl.org (Scott Cain) Date: Fri Oct 1 10:13:12 2004 Subject: [Bioperl-l] Re: Bioperl-l Digest, Vol 18, Issue 1 In-Reply-To: <200410011402.i91E2XKs022813@portal.open-bio.org> References: <200410011402.i91E2XKs022813@portal.open-bio.org> Message-ID: <1096640016.1577.86.camel@localhost.localdomain> Allen, I apparently don't get mail addressed to scain@pub.open-bio.org, so I didn't get this message until this morning when I read the bioperl digest. So, why can't I handle it this way? It seems to work just fine for the bulk loader. Scott On Fri, 2004-10-01 at 10:02, bioperl-l-request@portal.open-bio.org wrote: > Date: Wed, 29 Sep 2004 13:52:39 -0700 (PDT) > From: Allen Day > Subject: [Bioperl-l] Re: [Bioperl-guts-l] bioperl commit > To: Scott Cain > Cc: Bioperl > Message-ID: > Content-Type: TEXT/PLAIN; charset=US-ASCII > > Scott, > > You can't handle Ontology_term as a SimpleValue, that's why I didn't > implement it that way. You need to rather create a > Bio::Annotation::OntologyTerm. > > -Allen > > On Sat, 25 Sep 2004, Scott Cain wrote: > > > > > scain > > Sat Sep 25 07:41:29 EDT 2004 > > Update of /home/repository/bioperl/bioperl-live/Bio/FeatureIO > > In directory pub.open-bio.org:/tmp/cvs-serv2444/Bio/FeatureIO > > > > Modified Files: > > gff.pm > > Log Message: > > two things: > > * adding SOFA as an available ontology to DocumentRegistry.pm > > * modifying FeatureIO::gff to use SOFA to validate, and to parse Ontology_term > > > > bioperl-live/Bio/FeatureIO gff.pm,1.9,1.10 > > =================================================================== > > RCS file: /home/repository/bioperl/bioperl-live/Bio/FeatureIO/gff.pm,v > > retrieving revision 1.9 > > retrieving revision 1.10 > > diff -u -r1.9 -r1.10 > > --- /home/repository/bioperl/bioperl-live/Bio/FeatureIO/gff.pm 2004/09/21 23:15:22 1.9 > > +++ /home/repository/bioperl/bioperl-live/Bio/FeatureIO/gff.pm 2004/09/25 11:41:29 1.10 > > @@ -91,8 +91,9 @@ > > } > > $self->_pushback($directive); > > > > + #need to validate against SOFA, no SO > > $self->so( > > - Bio::Ontology::OntologyStore->get_ontology('Sequence Ontology') > > + Bio::Ontology::OntologyStore->get_ontology('Sequence Ontology Feature Annotation') > > ); > > } > > > > @@ -315,9 +316,9 @@ > > } > > > > #Handle Ontology_term attributes > > - if($attr{Ontology_term}){ > > - $self->warn("Warning for line:\n$feature_string\nOntology_term attribute handling not yet implemented, skipping it"); > > - } > > +# if($attr{Ontology_term}){ > > +# $self->warn("Warning for line:\n$feature_string\nOntology_term attribute handling not yet implemented, skipping it"); > > +# } > > > > #Handle Gap attributes > > if($attr{Gap}){ > > @@ -351,7 +352,7 @@ > > $ac->add_Annotation('Name',$a); > > } > > > > - foreach my $other_canonical (qw(Alias Parent Note)){ > > + foreach my $other_canonical (qw(Alias Parent Note Ontology_term)){ > > if($attr{$other_canonical}){ > > foreach my $value (@{ $attr{$other_canonical} }){ > > my $a = Bio::Annotation::SimpleValue->new(); > > > > _______________________________________________ > > Bioperl-guts-l mailing list > > Bioperl-guts-l@portal.open-bio.org > > http://portal.open-bio.org/mailman/listinfo/bioperl-guts-l > > -- ------------------------------------------------------------------------ Scott Cain, Ph. D. cain@cshl.org GMOD Coordinator (http://www.gmod.org/) 216-392-3087 Cold Spring Harbor Laboratory From natg at shore.net Fri Oct 1 10:34:58 2004 From: natg at shore.net (Nathan (Nat) Goodman) Date: Fri Oct 1 10:34:22 2004 Subject: [Bioperl-l] argument checking Message-ID: <200410011434.i91EYJKr023183@portal.open-bio.org> > I was wondering what developers thought about a generic argument > checking method, say in Bio::Root::Root. There's a lot of CPAN code that plays in this space. Class::MakeMethods, Class::Meta::Type, Getargs::Long, Params::Check are a few of many. I saw a nice module that lets you specify types and default values in a very readbale syntax, but for the life of me can't find it again! Sigh... We're heading in this direction with our Class::AutoClass, also (no doubt based on one of these others). If anyone wants to collaborate on this, we'd be delighted. Best, Nat From amackey at pcbi.upenn.edu Fri Oct 1 10:36:58 2004 From: amackey at pcbi.upenn.edu (Aaron J. Mackey) Date: Fri Oct 1 10:36:24 2004 Subject: [Bioperl-l] argument checking In-Reply-To: <200410011434.i91EYvDp003850@snowball.pcbi.upenn.edu> References: <200410011434.i91EYvDp003850@snowball.pcbi.upenn.edu> Message-ID: <5961FD16-13B7-11D9-9C32-000A9577009E@pcbi.upenn.edu> I think Class::Contract is the best declarative-style approach, but would require significant architectural changes to use it in BioPerl (I expect; happy to have someone prove me wrong). -Aaron On Oct 1, 2004, at 10:34 AM, Nathan ((Nat)) Goodman wrote: >> I was wondering what developers thought about a generic argument >> checking method, say in Bio::Root::Root. > > There's a lot of CPAN code that plays in this space. > Class::MakeMethods, > Class::Meta::Type, Getargs::Long, Params::Check are a few of many. I > saw a > nice module that lets you specify types and default values in a very > readbale syntax, but for the life of me can't find it again! Sigh... > We're > heading in this direction with our Class::AutoClass, also (no doubt > based on > one of these others). > > If anyone wants to collaborate on this, we'd be delighted. > > Best, > Nat > > -- Aaron J. Mackey, Ph.D. Dept. of Biology, Goddard 212 University of Pennsylvania email: amackey@pcbi.upenn.edu 415 S. University Avenue office: 215-898-1205 Philadelphia, PA 19104-6017 fax: 215-746-6697 From nathan at hddrugworks.org Fri Oct 1 10:50:42 2004 From: nathan at hddrugworks.org (Nathan (Nat) Goodman) Date: Fri Oct 1 10:50:44 2004 Subject: [Bioperl-l] argument checking In-Reply-To: <5961FD16-13B7-11D9-9C32-000A9577009E@pcbi.upenn.edu> Message-ID: <200410011450.i91EoeKr023383@portal.open-bio.org> > I think Class::Contract is the best declarative-style > approach, Yeah, that's another good one. > but would require significant architectural changes > to use it in BioPerl (I expect; happy to have someone prove me wrong). I'm sure it would be a lot of work to retrofit existing code (and why bother -- the existing code already works, right :), but it might make sense to add this capability for people who are writing new code and want to use it. FYI, Class::AutoClass is designed to coexist nicely with BioPerl (although, the CPAN distro may not play well with BioPerl out of the box because we had to include some functionality already present in BioPerl's Root to avoid a CPAN-dependence on BioPerl). So, if people want to try out some argument checking methods, this may offer an easy venue to do so. Best, Nat From fzhang at vcu.edu Fri Oct 1 10:54:31 2004 From: fzhang at vcu.edu (Fengkai Zhang (Tony)) Date: Fri Oct 1 10:54:00 2004 Subject: [Bioperl-l] Ask help for Bio::Tools::Run::Primer3 In-Reply-To: <70A3249A-1258-11D9-A390-0003930405E2@ohsu.edu> Message-ID: <200410011454.KAA27280@despina.vcu.edu> Hi, Thomas, Thanks for your reply. I tried the way suggested by Jason, ans still had the problem. I also think the module(Bio::Tools::Run::Primer3) is buggy. I solved the problem in following way: The line 343: my $executable = $self->{program_dir}.$self->{program}; may be changed to: my $executable = $self->{program}; $self->{program_dir} has been called in $self->executable in new() constructor through the parent class WrapperBase and needn't call again here. Otherwise perl will give warning msg if PRIMER3 environment variable is not setup. Also, Primer3 itself seems not setup PRIMER3 variable automatically in Linux system. It may be setup manually. If following the instruction in Primer3 (downloaded in Sept 2004), the executable program is "primer3_core" instead of "primer3", which is defaut in Bio::Tools::Run::Primer3. Two ways to solve this problem. 1. Simply change name of "primer3_core" to "primer3" as suggested by Adam. 2. Use "-program" in new() constructor when initializing a Primer3 object. I think it should be included in the document of Bio::Tools::Run::Primer3. The hash value of "-program" can be either absolute path or relative path of primer3 program to your perl program. It is not necessary to change the name of primer3 program here. Tony ------------------- > Hi Tony, > Jason answered this question not too long ago. I happened to have saved > his answer (pasted below). Note that he gave the path to primer3_core > > >> Hello Bioperlers > >> I have been trying to use the BioPerl-run Primer3.pm module to run > >> primer3. In doing so I think I have found 2 bugs that prevent it from > >> working properly (I hope this is the right place to ask this). > > > > This is exactly the right place to ask this question > > > >> > >> The line > >> my $executable = $self->{'program_dir'}.$self->{'program'}; > >> I think should be > >> my $executable = $self->{'program_dir'}.$self->{'program_name'}; > >> otherwise the primer3 executable is never found using the -path option > >> in a call to the constructor > >> my $primer3 = > >> Bio::Tools::Run::Primer3->new(-path=>'/usr/mbin/primer3_core',- > >> seq=>$seq, > >> -outfile=>"temp.out"); > > and rob - I think you want to call $self->program_dir and $self->program > so they can overriden as well - that's why I set up the Base Class to > have > these methods. > > > On Sep 29, 2004, at 1:21 PM, Fengkai Zhang (Tony) wrote: > > > Hi, I am a newbie for bioperl and met the below question. > > > > I was trying to use Bio::Tools::Run::Primer3. When I run the example > > code in the documentation of this module, I got the following error > > message: > > -------------------------------- > > $ perl -I ../primer3_1.0.0/src/ -w primer3run_test.pl > > > > Use of uninitialized value in concatenation (.) or string at > > /usr/lib/perl5/site_perl/5.8.0/Bio/Tools/Run/Primer3.pm line 212, > > line 1. > > primer3 can not be found. Is it installed? > > -------------------------------- > > > > I already installed Primer3 according its instruction and it works > > well to run the test and example. I also noticed that the > > primer_test.pl in primer3 package calls "primer3_core" rather than > > "primer3". Does it matter for Bio::Tools::Run::Primer3 module? > > > > > > Thanks ahead for your help. > > > > > > > > Tony > > > > VIPBG@VCU > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l@portal.open-bio.org > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > ------------------------------------------------------ Fengkai Zhang (Tony) MD, MMath(Bioinformatics), BS(CS) Postdoc Research Associate Virginia Institute for Psychiatric and Behavioral Genetics Virginia Commonwealth University 800 E. Leigh St. PO.Box 980126 Richmond, VA 23298-0126 Tel: 804-828-9710 ------------------------------------------------------ From fzhang at vcu.edu Fri Oct 1 10:54:49 2004 From: fzhang at vcu.edu (Fengkai Zhang (Tony)) Date: Fri Oct 1 10:54:15 2004 Subject: [Bioperl-l] Ask help for Bio::Tools::Run::Primer3 In-Reply-To: <70A3249A-1258-11D9-A390-0003930405E2@ohsu.edu> Message-ID: <200410011454.KAA27293@despina.vcu.edu> Thanks for your reply. It still has problem after changing the file name. I figured it out and you may see my reply. Tony ------------------- > Yes, it does matter... simply change the name of primer3_core to primer3, put it in your path, and you should be good to go! > > Adam > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org on behalf of Fengkai Zhang (Tony) > Sent: Wed 9/29/2004 4:21 PM > To: bioperl-l@bioperl.org > Subject: [Bioperl-l] Ask help for Bio::Tools::Run::Primer3 > > Hi, I am a newbie for bioperl and met the below question. > > I was trying to use Bio::Tools::Run::Primer3. When I run the example > code in the documentation of this module, I got the following error > message: > -------------------------------- > $ perl -I ../primer3_1.0.0/src/ -w primer3run_test.pl > > Use of uninitialized value in concatenation (.) or string at > /usr/lib/perl5/site_perl/5.8.0/Bio/Tools/Run/Primer3.pm line 212, > line 1. > primer3 can not be found. Is it installed? > -------------------------------- > > I already installed Primer3 according its instruction and it works > well to run the test and example. I also noticed that the > primer_test.pl in primer3 package calls "primer3_core" rather than > "primer3". Does it matter for Bio::Tools::Run::Primer3 module? > > > Thanks ahead for your help. > > > > Tony > > VIPBG@VCU > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > From jason.stajich at duke.edu Fri Oct 1 13:45:08 2004 From: jason.stajich at duke.edu (Jason Stajich) Date: Fri Oct 1 13:44:34 2004 Subject: [Bioperl-l] Attention: upcoming BioPerl 1.5 developer's release In-Reply-To: References: Message-ID: On Sep 30, 2004, at 8:32 PM, James Thompson wrote: > I've run the a "make test" on my CVS version of bioperl-live on a Sun > E450 > running Solaris 8 and Perl 5.8.5, here's the summary output: > > Failed Test Stat Wstat Total Fail Failed List of Failed > ----------------------------------------------------------------------- > -------- > t/CodonTable.t 40 4 10.00% 41-44 > t/DB.t 78 2 2.56% 34 39 > t/ProtMatrix.t 15 4 26.67% 12-15 > Hey James - isn't this your module - you need to implement get_string() in ProtMatrix. > t/Registry.t 255 65280 6 3 50.00% 5-6 > t/RootStorable.t 2 512 34 56 164.71% 7-34 > t/SeqIO.t 2 512 270 386 142.96% 78-270 > t/SeqStats.t 28 9 32.14% 10-12 21-24 26 28 fixed, needed to round > t/SimpleAlign.t 255 65280 61 16 26.23% 54-61 > t/splicedseq.t 9 4 44.44% 3 5-6 9 fixed > 111 subtests skipped. > > I have more detailed output if anyone wants it. > > Cheers, > > James > > On Thu, 30 Sep 2004, Aaron J. Mackey wrote: > >> >> With much-appreciated help from Steve Chervitz and Allen Day, there's >> about to be a real push towards a 1.5 developer's release; as such, I >> highly encourage all module authors/maintainers to get in those >> documentation updates and finish any functionalities you've only >> "stubbed" in place. I'm not yet declaring a freeze, but don't be >> surprised if I do so soon ... >> >> I have a pretty good idea of the new things that have gone in since >> 1.4, but it wouldn't hurt you to drop me a private line about any >> significant new functionality, changed API or bug fixes you've done >> since the 1.4 releases. You should also check the AUTHORS file and >> make sure your contact and attribution information is listed as you so >> desire. >> >> Now is also the time for you with "odd" systems (for me that means >> Sun, >> SGI, and any Windows) to give the bioperl-live CVS checkout a full >> make >> test, and to post your results (preferably only the stuff that didn't >> work). If you can provide a patch, even better! >> >> I hope to have a release candidate available by the end of next week, >> with the real thing following very shortly thereafter (unless there >> are >> show-stoppers, of course) >> >> Thanks, >> >> -Aaron >> >> -- >> Aaron J. Mackey, Ph.D. >> Dept. of Biology, Goddard 212 >> University of Pennsylvania email: amackey@pcbi.upenn.edu >> 415 S. University Avenue office: 215-898-1205 >> Philadelphia, PA 19104-6017 fax: 215-746-6697 >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l@portal.open-bio.org >> http://portal.open-bio.org/mailman/listinfo/bioperl-l >> > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- Jason Stajich jason.stajich at duke.edu http://www.duke.edu/~jes12/ From brian_osborne at cognia.com Fri Oct 1 13:51:36 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Fri Oct 1 13:51:06 2004 Subject: [Bioperl-l] Ask help for Bio::Tools::Run::Primer3 In-Reply-To: <4EEBF615-13B2-11D9-8883-000393C44276@duke.edu> Message-ID: Jason, And, as you know, one can also do: my $primer3 = Bio::Tools::Run::Primer3->new(-seq=>$seq, -outfile=>"temp.out", -path=>"/usr/bin/primer3_core" ); Tested in Cygwin, not Windows. Brian O. -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jason Stajich Sent: Friday, October 01, 2004 10:01 AM To: Bioperl Mailing List Subject: Re: [Bioperl-l] Ask help for Bio::Tools::Run::Primer3 In looking at the code some more, shouldn't we make the default 'primer3_core' instead? You can always override it with the program_name function. $primer3->program_name('my_superfast_primer3'); -jason On Sep 29, 2004, at 4:38 PM, Ewing, Adam D. wrote: > Yes, it does matter... simply change the name of primer3_core to > primer3, put it in your path, and you should be good to go! > > Adam > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org on behalf of Fengkai Zhang > (Tony) > Sent: Wed 9/29/2004 4:21 PM > To: bioperl-l@bioperl.org > Subject: [Bioperl-l] Ask help for Bio::Tools::Run::Primer3 > > Hi, I am a newbie for bioperl and met the below question. > > I was trying to use Bio::Tools::Run::Primer3. When I run the example > code in the documentation of this module, I got the following error > message: > -------------------------------- > $ perl -I ../primer3_1.0.0/src/ -w primer3run_test.pl > > Use of uninitialized value in concatenation (.) or string at > /usr/lib/perl5/site_perl/5.8.0/Bio/Tools/Run/Primer3.pm line 212, > line 1. > primer3 can not be found. Is it installed? > -------------------------------- > > I already installed Primer3 according its instruction and it works > well to run the test and example. I also noticed that the > primer_test.pl in primer3 package calls "primer3_core" rather than > "primer3". Does it matter for Bio::Tools::Run::Primer3 module? > > > Thanks ahead for your help. > > > > Tony > > VIPBG@VCU > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l -- Jason Stajich jason.stajich at duke.edu http://www.duke.edu/~jes12/ _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l From jason.stajich at duke.edu Fri Oct 1 13:53:12 2004 From: jason.stajich at duke.edu (Jason Stajich) Date: Fri Oct 1 13:52:36 2004 Subject: [Bioperl-l] Ask help for Bio::Tools::Run::Primer3 In-Reply-To: References: Message-ID: yes of course - the question is what the default should be. I've left it as 'primer3' but if people compile it and it produces 'primer3_core'.... I've updated the Primer3.t test to figure it out and test both possiblities. -jason On Oct 1, 2004, at 1:51 PM, Brian Osborne wrote: > Jason, > > And, as you know, one can also do: > > my $primer3 = Bio::Tools::Run::Primer3->new(-seq=>$seq, > -outfile=>"temp.out", > > -path=>"/usr/bin/primer3_core" > ); > > Tested in Cygwin, not Windows. > > Brian O. > > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jason > Stajich > Sent: Friday, October 01, 2004 10:01 AM > To: Bioperl Mailing List > Subject: Re: [Bioperl-l] Ask help for Bio::Tools::Run::Primer3 > > In looking at the code some more, shouldn't we make the default > 'primer3_core' instead? > > You can always override it with the program_name function. > $primer3->program_name('my_superfast_primer3'); > > -jason > On Sep 29, 2004, at 4:38 PM, Ewing, Adam D. wrote: > >> Yes, it does matter... simply change the name of primer3_core to >> primer3, put it in your path, and you should be good to go! >> >> Adam >> >> -----Original Message----- >> From: bioperl-l-bounces@portal.open-bio.org on behalf of Fengkai Zhang >> (Tony) >> Sent: Wed 9/29/2004 4:21 PM >> To: bioperl-l@bioperl.org >> Subject: [Bioperl-l] Ask help for Bio::Tools::Run::Primer3 >> >> Hi, I am a newbie for bioperl and met the below question. >> >> I was trying to use Bio::Tools::Run::Primer3. When I run the example >> code in the documentation of this module, I got the following error >> message: >> -------------------------------- >> $ perl -I ../primer3_1.0.0/src/ -w primer3run_test.pl >> >> Use of uninitialized value in concatenation (.) or string at >> /usr/lib/perl5/site_perl/5.8.0/Bio/Tools/Run/Primer3.pm line 212, >> line 1. >> primer3 can not be found. Is it installed? >> -------------------------------- >> >> I already installed Primer3 according its instruction and it works >> well to run the test and example. I also noticed that the >> primer_test.pl in primer3 package calls "primer3_core" rather than >> "primer3". Does it matter for Bio::Tools::Run::Primer3 module? >> >> >> Thanks ahead for your help. >> >> >> >> Tony >> >> VIPBG@VCU >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l@portal.open-bio.org >> http://portal.open-bio.org/mailman/listinfo/bioperl-l >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l@portal.open-bio.org >> http://portal.open-bio.org/mailman/listinfo/bioperl-l > -- > Jason Stajich > jason.stajich at duke.edu > http://www.duke.edu/~jes12/ > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > -- Jason Stajich jason.stajich at duke.edu http://www.duke.edu/~jes12/ From allenday at ucla.edu Fri Oct 1 13:53:57 2004 From: allenday at ucla.edu (Allen Day) Date: Fri Oct 1 13:53:25 2004 Subject: [Bioperl-l] typed sequence features In-Reply-To: <1096640016.1577.86.camel@localhost.localdomain> References: <200410011402.i91E2XKs022813@portal.open-bio.org> <1096640016.1577.86.camel@localhost.localdomain> Message-ID: you can't do this because an ontology term is an ontology term, it is not a simple value. even though you can parse the text and make a simple value from it, the intent behind giving the value as an Ontology_term attribute in GFF3 is clear: this is an identifier for an ontology term. If the document author had wanted you to use it as just a text value, he would have given it as a Note/Name/Alias/whatever. the point of the Bio::SeqFeature::Annotated object is that it is annotated as well as possible by using Bio::AnnotationCollection -- it doesn't (only) store attributes as simple strings. -allen On Fri, 1 Oct 2004, Scott Cain wrote: > Allen, > > I apparently don't get mail addressed to scain@pub.open-bio.org, so I > didn't get this message until this morning when I read the bioperl > digest. > > So, why can't I handle it this way? It seems to work just fine for the > bulk loader. > > Scott > > On Fri, 2004-10-01 at 10:02, bioperl-l-request@portal.open-bio.org > wrote: > > Date: Wed, 29 Sep 2004 13:52:39 -0700 (PDT) > > From: Allen Day > > Subject: [Bioperl-l] Re: [Bioperl-guts-l] bioperl commit > > To: Scott Cain > > Cc: Bioperl > > Message-ID: > > Content-Type: TEXT/PLAIN; charset=US-ASCII > > > > Scott, > > > > You can't handle Ontology_term as a SimpleValue, that's why I didn't > > implement it that way. You need to rather create a > > Bio::Annotation::OntologyTerm. > > > > -Allen > > > > On Sat, 25 Sep 2004, Scott Cain wrote: > > > > > > > > scain > > > Sat Sep 25 07:41:29 EDT 2004 > > > Update of /home/repository/bioperl/bioperl-live/Bio/FeatureIO > > > In directory pub.open-bio.org:/tmp/cvs-serv2444/Bio/FeatureIO > > > > > > Modified Files: > > > gff.pm > > > Log Message: > > > two things: > > > * adding SOFA as an available ontology to DocumentRegistry.pm > > > * modifying FeatureIO::gff to use SOFA to validate, and to parse Ontology_term > > > > > > bioperl-live/Bio/FeatureIO gff.pm,1.9,1.10 > > > =================================================================== > > > RCS file: /home/repository/bioperl/bioperl-live/Bio/FeatureIO/gff.pm,v > > > retrieving revision 1.9 > > > retrieving revision 1.10 > > > diff -u -r1.9 -r1.10 > > > --- /home/repository/bioperl/bioperl-live/Bio/FeatureIO/gff.pm 2004/09/21 23:15:22 1.9 > > > +++ /home/repository/bioperl/bioperl-live/Bio/FeatureIO/gff.pm 2004/09/25 11:41:29 1.10 > > > @@ -91,8 +91,9 @@ > > > } > > > $self->_pushback($directive); > > > > > > + #need to validate against SOFA, no SO > > > $self->so( > > > - Bio::Ontology::OntologyStore->get_ontology('Sequence Ontology') > > > + Bio::Ontology::OntologyStore->get_ontology('Sequence Ontology Feature Annotation') > > > ); > > > } > > > > > > @@ -315,9 +316,9 @@ > > > } > > > > > > #Handle Ontology_term attributes > > > - if($attr{Ontology_term}){ > > > - $self->warn("Warning for line:\n$feature_string\nOntology_term attribute handling not yet implemented, skipping it"); > > > - } > > > +# if($attr{Ontology_term}){ > > > +# $self->warn("Warning for line:\n$feature_string\nOntology_term attribute handling not yet implemented, skipping it"); > > > +# } > > > > > > #Handle Gap attributes > > > if($attr{Gap}){ > > > @@ -351,7 +352,7 @@ > > > $ac->add_Annotation('Name',$a); > > > } > > > > > > - foreach my $other_canonical (qw(Alias Parent Note)){ > > > + foreach my $other_canonical (qw(Alias Parent Note Ontology_term)){ > > > if($attr{$other_canonical}){ > > > foreach my $value (@{ $attr{$other_canonical} }){ > > > my $a = Bio::Annotation::SimpleValue->new(); > > > > > > _______________________________________________ > > > Bioperl-guts-l mailing list > > > Bioperl-guts-l@portal.open-bio.org > > > http://portal.open-bio.org/mailman/listinfo/bioperl-guts-l > > > > > From ajm226 at cam.ac.uk Fri Oct 1 07:16:42 2004 From: ajm226 at cam.ac.uk (Andrew McArdle) Date: Fri Oct 1 14:05:25 2004 Subject: [Bioperl-l] Installation under Mac OS X Message-ID: Hello, I have been using the standard BioPerl installation documentation and the documentation which you have written to try and install BioPerl on Mac OS X (10.2.4). Unfortuantely I am hampered by an unfamiliarity with Macs, a general inability to use Linux (though I do have it installed on my home computer) and once it's installed will probably be hampered by my inability to use Perl (though I hope my knowledge of PHP will help me a little). If my question is foolish or answered in the documentation then I apologise and thank you for pointing me in the right direction! I have done nothing other than use CPAN in console mode to do "install Bundle::BioPerl". CPAN first forced me to do some configuration, for which I just guessed. The downloads of the bundle seemed to go fine, but I am sure lots of errors were encountered. Towards the end it complained: "Error: Unable to locate installed Perl libraries or Perl source code. It is recommended that you install perl in a standard location before building extensions. Some precompiled versions of perl do not contain these header files, so you cannot build extensions. In such a case, please build and install your perl from a fresh perl distribution. It usually solves this kind of problem." It also said that make test and make install had problems. I tried a simple sample BioPerl program and it couldn't find the BioPerl libraries. Next step, I followed the instructions to do "d /bioperl/" and install the latest version. This ended in the same errors as before. With this information are you able to point me in the right direction, or is this insufficient. Any help you could give would be much appreciated. Thanks, Andrew From cain at cshl.org Fri Oct 1 15:51:52 2004 From: cain at cshl.org (Scott Cain) Date: Fri Oct 1 15:51:37 2004 Subject: [Bioperl-l] Re: typed sequence features In-Reply-To: References: <200410011402.i91E2XKs022813@portal.open-bio.org> <1096640016.1577.86.camel@localhost.localdomain> Message-ID: <1096660312.1577.141.camel@localhost.localdomain> Fair enough; nevertheless, it works for me the way it is--so if it is "upgraded" to work the way you want, I obviously still want it to work for me. As it is, I would say the functioning is impaired but no completely wrong. Scott On Fri, 2004-10-01 at 13:53, Allen Day wrote: > you can't do this because an ontology term is an ontology term, it is not > a simple value. even though you can parse the text and make a simple > value from it, the intent behind giving the value as an Ontology_term > attribute in GFF3 is clear: this is an identifier for an ontology term. > If the document author had wanted you to use it as just a text value, he > would have given it as a Note/Name/Alias/whatever. > > the point of the Bio::SeqFeature::Annotated object is that it is annotated > as well as possible by using Bio::AnnotationCollection -- it doesn't > (only) store attributes as simple strings. > > -allen > > > On Fri, 1 Oct 2004, Scott Cain wrote: > > > Allen, > > > > I apparently don't get mail addressed to scain@pub.open-bio.org, so I > > didn't get this message until this morning when I read the bioperl > > digest. > > > > So, why can't I handle it this way? It seems to work just fine for the > > bulk loader. > > > > Scott > > > > On Fri, 2004-10-01 at 10:02, bioperl-l-request@portal.open-bio.org > > wrote: > > > Date: Wed, 29 Sep 2004 13:52:39 -0700 (PDT) > > > From: Allen Day > > > Subject: [Bioperl-l] Re: [Bioperl-guts-l] bioperl commit > > > To: Scott Cain > > > Cc: Bioperl > > > Message-ID: > > > Content-Type: TEXT/PLAIN; charset=US-ASCII > > > > > > Scott, > > > > > > You can't handle Ontology_term as a SimpleValue, that's why I didn't > > > implement it that way. You need to rather create a > > > Bio::Annotation::OntologyTerm. > > > > > > -Allen > > > > > > On Sat, 25 Sep 2004, Scott Cain wrote: > > > > > > > > > > > scain > > > > Sat Sep 25 07:41:29 EDT 2004 > > > > Update of /home/repository/bioperl/bioperl-live/Bio/FeatureIO > > > > In directory pub.open-bio.org:/tmp/cvs-serv2444/Bio/FeatureIO > > > > > > > > Modified Files: > > > > gff.pm > > > > Log Message: > > > > two things: > > > > * adding SOFA as an available ontology to DocumentRegistry.pm > > > > * modifying FeatureIO::gff to use SOFA to validate, and to parse Ontology_term > > > > > > > > bioperl-live/Bio/FeatureIO gff.pm,1.9,1.10 > > > > =================================================================== > > > > RCS file: /home/repository/bioperl/bioperl-live/Bio/FeatureIO/gff.pm,v > > > > retrieving revision 1.9 > > > > retrieving revision 1.10 > > > > diff -u -r1.9 -r1.10 > > > > --- /home/repository/bioperl/bioperl-live/Bio/FeatureIO/gff.pm 2004/09/21 23:15:22 1.9 > > > > +++ /home/repository/bioperl/bioperl-live/Bio/FeatureIO/gff.pm 2004/09/25 11:41:29 1.10 > > > > @@ -91,8 +91,9 @@ > > > > } > > > > $self->_pushback($directive); > > > > > > > > + #need to validate against SOFA, no SO > > > > $self->so( > > > > - Bio::Ontology::OntologyStore->get_ontology('Sequence Ontology') > > > > + Bio::Ontology::OntologyStore->get_ontology('Sequence Ontology Feature Annotation') > > > > ); > > > > } > > > > > > > > @@ -315,9 +316,9 @@ > > > > } > > > > > > > > #Handle Ontology_term attributes > > > > - if($attr{Ontology_term}){ > > > > - $self->warn("Warning for line:\n$feature_string\nOntology_term attribute handling not yet implemented, skipping it"); > > > > - } > > > > +# if($attr{Ontology_term}){ > > > > +# $self->warn("Warning for line:\n$feature_string\nOntology_term attribute handling not yet implemented, skipping it"); > > > > +# } > > > > > > > > #Handle Gap attributes > > > > if($attr{Gap}){ > > > > @@ -351,7 +352,7 @@ > > > > $ac->add_Annotation('Name',$a); > > > > } > > > > > > > > - foreach my $other_canonical (qw(Alias Parent Note)){ > > > > + foreach my $other_canonical (qw(Alias Parent Note Ontology_term)){ > > > > if($attr{$other_canonical}){ > > > > foreach my $value (@{ $attr{$other_canonical} }){ > > > > my $a = Bio::Annotation::SimpleValue->new(); > > > > > > > > _______________________________________________ > > > > Bioperl-guts-l mailing list > > > > Bioperl-guts-l@portal.open-bio.org > > > > http://portal.open-bio.org/mailman/listinfo/bioperl-guts-l > > > > > > > > -- ------------------------------------------------------------------------ Scott Cain, Ph. D. cain@cshl.org GMOD Coordinator (http://www.gmod.org/) 216-392-3087 Cold Spring Harbor Laboratory From amackey at pcbi.upenn.edu Fri Oct 1 16:04:29 2004 From: amackey at pcbi.upenn.edu (Aaron J. Mackey) Date: Fri Oct 1 16:03:55 2004 Subject: [Bioperl-l] Questions on Representing Protein Ambiguity In-Reply-To: References: Message-ID: <1A9DEF4E-13E5-11D9-9557-000A9577009E@pcbi.upenn.edu> On Sep 30, 2004, at 10:49 PM, James Thompson wrote: > An alternative would be to borrow an idea from Perl's regex character > classes > and represent multiple residues at a position inside of a set of > brackets, like > this: > > M[ES]N[IAP]S In general, you're always going to lose information moving from a profile to a flat pattern. This option prevents losing all the information that flattening to "MENIS" would (although MENIS is a reasonable "consensus" in this case), but there's still information loss. So in that sense it isn't really a better solution than "just take the most probable residue, unless it's less than some threshold, in which case X". I think the whole idea of a consensus sequence from a profile is a bit worthless, to be honest. What are you supposed to be able to do with the consensus, search with it? That's what the profile is for in the first place ... [ speaking of which, I'd love to see Bio::Tools::dpAlign make use of these protein profiles ]. -Aaron -- Aaron J. Mackey, Ph.D. Dept. of Biology, Goddard 212 University of Pennsylvania email: amackey@pcbi.upenn.edu 415 S. University Avenue office: 215-898-1205 Philadelphia, PA 19104-6017 fax: 215-746-6697 From kvddrift at earthlink.net Fri Oct 1 17:26:17 2004 From: kvddrift at earthlink.net (Koen van der Drift) Date: Fri Oct 1 17:24:48 2004 Subject: [Bioperl-l] Installation under Mac OS X In-Reply-To: References: Message-ID: <879AB662-13F0-11D9-BA70-003065A5FDCC@earthlink.net> > With this information are you able to point me in the right direction, > or is this insufficient. Any help you could give would be much > appreciated. > > Andrew, Bioperl can also be installed on Mac OS X using the fink package manager, see http://fink.sf.net. - Koen. From kvddrift at earthlink.net Fri Oct 1 17:43:23 2004 From: kvddrift at earthlink.net (Koen van der Drift) Date: Fri Oct 1 17:41:45 2004 Subject: [Bioperl-l] bioperl-run on Mac OS X Message-ID: Hi, I am the maintainer for the bioperl and bioperl-run packages for fink. When trying to install bioperl-run using the fink package, a user reported the following error: /usr/bin/sudo /sw/bin/fink update bioperl-pm581 Information about 3842 packages read in 2 seconds. The following package will be installed or updated: bioperl-pm581 dpkg -i /sw/fink/dists/unstable/main/binary-darwin-powerpc/libs/perlmods/ bioperl-pm581_1.4-4_darwin-powerpc.deb (Reading database ... 12877 files and directories currently installed.) Preparing to replace bioperl-pm581 1.4-1 (using .../bioperl-pm581_1.4-4_darwin-powerpc.deb) ... Unpacking replacement bioperl-pm581 ... dpkg: error processing /sw/fink/dists/unstable/main/binary-darwin-powerpc/libs/perlmods/ bioperl-pm581_1.4-4_darwin-powerpc.deb (--install): trying to overwrite `/sw/lib/perl5/5.8.1/darwin-thread-multi-2level/auto/Bio/.packlist', which is also in package bioperl-run-pm581 dpkg-deb: subprocess paste killed by signal (Broken pipe) Errors were encountered while processing: /sw/fink/dists/unstable/main/binary-darwin-powerpc/libs/perlmods/ bioperl-pm581_1.4-4_darwin-powerpc.deb ### execution of dpkg failed, exit code 1 Failed: can't install package bioperl-pm581-1.4-4 So what happens is that the file .packlist gets installed both by bioperl and bioperl-run in the same location. Is it safe to not install .packlist to avoid this conflict? If not, is there another way around this to fix this? many thanks, - Koen. From dlyzxl at yahoo.com Sun Oct 3 12:33:04 2004 From: dlyzxl at yahoo.com (Xiangli Zhang) Date: Sun Oct 3 21:48:28 2004 Subject: [Bioperl-l] How to volunteer for bioperl project? Message-ID: <20041003163304.95343.qmail@web51109.mail.yahoo.com> Can anybody tell me how to contact bioperl project if I want to do some volunteer work? Thanks, Justin Xiangli Zhang (Justin) 306-310 Decaire Street, Coquitlam BC, Canada, V3K 6X1 phone: 604-9399181 --------------------------------- Do you Yahoo!? Yahoo! Mail Address AutoComplete - You start. We finish. From tex at biosysadmin.com Sun Oct 3 06:15:04 2004 From: tex at biosysadmin.com (James Thompson) Date: Sun Oct 3 22:26:53 2004 Subject: [Bioperl-l] Questions on Representing Protein Ambiguity In-Reply-To: <1A9DEF4E-13E5-11D9-9557-000A9577009E@pcbi.upenn.edu> Message-ID: Aaron, Thanks for the feedback. You're definitely right about consensus sequences being relatively worthless when compared to the information contained in the whole profile. Friday afternoon I committed some to ProtMatrix.pm that will allow the regexp method to take a threshold as an argument, and it's not too hard to change. The Bio::Tools::dpAlign idea looks interesting, I'd never seen it before myself. Sometime down the road I'll look into making it use matrices from the Bio::Matrix::PSM family. Right now I'll work on making sure all of my code is release-worthy. :) James Thompson On Fri, 1 Oct 2004, Aaron J. Mackey wrote: > > On Sep 30, 2004, at 10:49 PM, James Thompson wrote: > > > An alternative would be to borrow an idea from Perl's regex character > > classes > > and represent multiple residues at a position inside of a set of > > brackets, like > > this: > > > > M[ES]N[IAP]S > > In general, you're always going to lose information moving from a > profile to a flat pattern. This option prevents losing all the > information that flattening to "MENIS" would (although MENIS is a > reasonable "consensus" in this case), but there's still information > loss. So in that sense it isn't really a better solution than "just > take the most probable residue, unless it's less than some threshold, > in which case X". > > I think the whole idea of a consensus sequence from a profile is a bit > worthless, to be honest. What are you supposed to be able to do with > the consensus, search with it? That's what the profile is for in the > first place ... [ speaking of which, I'd love to see > Bio::Tools::dpAlign make use of these protein profiles ]. > > -Aaron > > -- > Aaron J. Mackey, Ph.D. > Dept. of Biology, Goddard 212 > University of Pennsylvania email: amackey@pcbi.upenn.edu > 415 S. University Avenue office: 215-898-1205 > Philadelphia, PA 19104-6017 fax: 215-746-6697 > > From d.gatherer at vir.gla.ac.uk Mon Oct 4 03:39:52 2004 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Mon Oct 4 03:40:18 2004 Subject: [Bioperl-l] Bioperl core 1.4 make error: line too long In-Reply-To: References: <1A9DEF4E-13E5-11D9-9557-000A9577009E@pcbi.upenn.edu> Message-ID: <6.1.2.0.1.20041004082922.024d01d0@ucdf.gla.ac.uk> Hi Just upgrading from 1.2.2 to 1.4. unpacked the core distrib, then: # perl -w Makefile.PL ....... [usual list of CPAN modules I don't have] Enjoy the rest of bioperl, which you can use after going 'make install' Writing Makefile for Bio # make Make: line too long. Stop. Never seen this before. I'm running Tru64 5.1B. I suspected it might be something to do with the Makefile including a line that is longer than the permitted max line length under Tru64. The line beginning EXE_FILES => [q[./scripts_temp/b ... seemed an obvious candidate, but choosing n at the: ........ *** Script Install Section **** Bioperl comes with a number of useful scripts which you may wish to install. Install [a]ll Bioperl scripts, [n]one, or choose groups [i]nteractively? [a] ....... removed that line in the Makefile but not the problem. Any ideas? I can't even make clean, as it gives the same error. Thanks Derek From amackey at pcbi.upenn.edu Sun Oct 3 22:57:37 2004 From: amackey at pcbi.upenn.edu (Aaron J. Mackey) Date: Mon Oct 4 09:00:28 2004 Subject: [Bioperl-l] How to volunteer for bioperl project? In-Reply-To: <20041003163304.95343.qmail@web51109.mail.yahoo.com> References: <20041003163304.95343.qmail@web51109.mail.yahoo.com> Message-ID: <25BC0006-15B1-11D9-AA90-000A9577009E@pcbi.upenn.edu> You already did, welcome aboard! What would you like to work on? -Aaron On Oct 3, 2004, at 12:33 PM, Xiangli Zhang wrote: > Can anybody tell me how to contact bioperl project if I want to do > some volunteer work? > > Thanks, > > Justin > > > Xiangli Zhang (Justin) > 306-310 Decaire Street, Coquitlam > BC, Canada, V3K 6X1 > phone: 604-9399181 > > --------------------------------- > Do you Yahoo!? > Yahoo! Mail Address AutoComplete - You start. We > finish._______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l -- Aaron J. Mackey, Ph.D. Dept. of Biology, Goddard 212 University of Pennsylvania email: amackey@pcbi.upenn.edu 415 S. University Avenue office: 215-898-1205 Philadelphia, PA 19104-6017 fax: 215-746-6697 From tan10 at psu.edu Mon Oct 4 15:30:50 2004 From: tan10 at psu.edu (Todd Naumann) Date: Mon Oct 4 15:28:40 2004 Subject: [Bioperl-l] Re:Installation under Mac OSX Message-ID: Andrew, I have recently had to migrate from a linux system to MacOSX and I am no computer expert. Under linux I installed bioperl using CPAN and it made a system-wide install and everything worked. Under MacOSX I had the same results that you describe when using CPAN. Despite the warnings, bioperl does install in my case. It is a local copy that you can locate under ~/.cpan/build/bioperl-1.4. I assume that the warning for your test script simply says that it can't find module Bio::SeqIO (or whatever) in directories in @INC. If you add the following line to your code: use lib "/Users/todd/.cpan/build/bioperl-1.4; it will add the directory to @INC and your script should run. Two things that I have noticed do not work by default are: 1) Bio::Graphics does not work for me. I think that there is some problem in communication between GD.pm and the GD libraries. 2) While web retrieval does work I can no longer use the GET alias from the command line (I think that GET comes from bioperl installation but I am not sure??). Hope this helps. -Todd Todd Naumann Post-Doc, Stephen Benkovic lab Department of Chemistry Penn State University University Park, PA 16802 From amackey at pcbi.upenn.edu Mon Oct 4 15:47:00 2004 From: amackey at pcbi.upenn.edu (Aaron J. Mackey) Date: Mon Oct 4 15:46:20 2004 Subject: [Bioperl-l] Will Spooner, where are you? Message-ID: <28694E08-163E-11D9-A5B3-000A9577009E@pcbi.upenn.edu> whs@sanger.ac.uk bounced for me; Will, if you're still listening, we'd appreciate help with this: amackey% perl t/RootStorable.t 1..34 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ------------- EXCEPTION ------------- MSG: Token /tmp/kzC4I9dJ returned no data STACK Bio::Root::Storable::retrieve Bio/Root/Storable.pm:497 STACK toplevel t/RootStorable.t:55 -------------------------------------- -Aaron From djkojeti at unity.ncsu.edu Mon Oct 4 15:49:12 2004 From: djkojeti at unity.ncsu.edu (Douglas Kojetin) Date: Mon Oct 4 15:48:34 2004 Subject: [Bioperl-l] pdb files/structure system In-Reply-To: References: Message-ID: <77037900-163E-11D9-8DDB-000A9597278C@unity.ncsu.edu> Sorry for the delayed response on this, but many thanks for sending this example. I am seeing an error I believe is associated with the 'format' of my PDB. It was created using CNS (format similar to XPLOR). When I try to run the below script, I get an error as follows: % ./read_pdb.pl > out ------------- EXCEPTION ------------- MSG: PDB stream with no HEADER. Not pdb in my book STACK Bio::Structure::IO::pdb::next_structure /sw/lib/perl5/Bio/Structure/IO/pdb.pm:138 STACK toplevel ./read_pdb.pl:6 -------------------------------------- 1. Are CNS or XPLOR formats supported? 2. Is there an easy way of quickly converting to a 'PDB' authentic format? It looks like it just wants some header information. Thanks, Doug On Jul 28, 2004, at 6:15 PM, Jurgen Pletinckx wrote: > | Can anyone point me towards a tutorial dealing with using Bioperl's > | Structure system? I'm able to read in a PDB file and print out a > | sequence, but I cannot figure out how to extract atoms or coordinates > | from the one line examples given here: > | > | http://bioperl.org/Core/Latest/ > | > bptutorial.html#iii.9.1_using_3d_structure_objects_and_reading_pdb_file > s > | _(structurei,_structure::io) > | Using that example, I've tried setting $res to a number of things (1, > | MET1, MET-1, MET, etc.), but I think it's look for something more > | sophisticated (i.e. input from another system module)? > > Yes. That example is pretty unenlightening. $res is a > Bio::Structure::Residue > object in that line. Here's one way to get at these objects: > > #!/usr/bin/perl -w > use Bio::Structure::IO; > use strict; > > my $structio = Bio::Structure::IO->new(-file => "/PDB/ca/pdb1cam.ent"); > my $struc = $structio->next_structure; > > for my $chain ($struc->get_chains) > { > my $chainid = $chain->id; > # one-letter chaincode if present, 'default' otherwise > > for my $res ($struc->get_residues($chain)) > { > my $resid = $res->id; > # format is 3-lettercode - dash - residue number, e.g. > PHE-20 > > my $atoms = $struc->get_atoms($res); > # actually a list of atom objects, used here to get a > count > > print join "\t", $chainid,$resid,$atoms,"\n"; > } > } > > That kind of loop over all objects is often sufficient for me. When I > do > need direct access, I first construct an index: > > my %resindex; > my %atindex; > > for my $chain ($struc->get_chains) > { > for my $res ($struc->get_residues($chain)) > { > $resindex{$chain->id}{$res->id} = $res; > for my $atom ($struc->get_atoms($res)) > { > $atindex{$chain->id}{$res->id}{$atom->id} = > $atom; > } > > } > } > > print join "\t", $atindex{'default'}{'PHE-20'}{'CA'}->xyz,"\n"; > > and then use that for lookups. Yet another tool I would like to > include into > the Bio::Structure modules. (as get_res_by_name?) > > | Is there a HOWTO under development (or in the near future) for the > | Structure system? > > There wasn't, actually. Perhaps there should be. I find myself rather > reticent > to enshrine the current sad state of affairs by describing the > workarounds > :/ > > -- > Jurgen Pletinckx AlgoNomics NV > jurgen.pletinckx@algonomics.com > > From jason.stajich at duke.edu Mon Oct 4 16:02:44 2004 From: jason.stajich at duke.edu (Jason Stajich) Date: Mon Oct 4 16:02:17 2004 Subject: [Bioperl-l] Re:Installation under Mac OSX In-Reply-To: References: Message-ID: <5B290F5A-1640-11D9-AAA4-000393C44276@duke.edu> err this is just the stub directory leftover from a CPAN build - eventually it will be removed so that's not really if you don't want to rely on CPAN for the install just download the tar file,untar it and point your @INC to that (or just set your PERL5LIB). Lots of examples in the INSTALL document like installing bioperl in your home directory which show how to do this. GET comes from LWP so depends on if you have updated it. I'd really suggest fink and fink commander (GUI for fink) if you are not a computer expert and want to easily install OSX applications. -jason On Oct 4, 2004, at 3:30 PM, Todd Naumann wrote: > Andrew, > > I have recently had to migrate from a linux system to MacOSX and I am > no computer expert. Under linux I installed bioperl using CPAN and it > made a system-wide install and everything worked. Under MacOSX I had > the same results that you describe when using CPAN. Despite the > warnings, bioperl does install in my case. It is a local copy that you > can locate under ~/.cpan/build/bioperl-1.4. I assume that the warning > for your test script simply says that it can't find module Bio::SeqIO > (or whatever) in directories in @INC. If you add the following line to > your code: > > use lib "/Users/todd/.cpan/build/bioperl-1.4; > > it will add the directory to @INC and your script should run. Two > things that I have noticed do not work by default are: > > 1) Bio::Graphics does not work for me. I think that there is some > problem in communication between GD.pm and the GD libraries. > 2) While web retrieval does work I can no longer use the GET alias > from the command line (I think that GET comes from bioperl > installation but I am not sure??). > > Hope this helps. > > -Todd > > Todd Naumann > Post-Doc, Stephen Benkovic lab > Department of Chemistry > Penn State University > University Park, PA 16802 > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- Jason Stajich jason.stajich at duke.edu http://www.duke.edu/~jes12/ From schuh at farmdale.com Mon Oct 4 16:15:06 2004 From: schuh at farmdale.com (Mike Schuh) Date: Mon Oct 4 16:15:12 2004 Subject: [Bioperl-l] Bioperl core 1.4 make error: line too long In-Reply-To: <6.1.2.0.1.20041004082922.024d01d0@ucdf.gla.ac.uk> Message-ID: Hi Derek, On Mon, 4 Oct 2004, Derek Gatherer wrote: >Just upgrading from 1.2.2 to 1.4. > >unpacked the core distrib, then: > ># perl -w Makefile.PL > >....... [usual list of CPAN modules I don't have] > > Enjoy the rest of bioperl, which you can use after going 'make install' > >Writing Makefile for Bio ># make >Make: line too long. Stop. This is a guess, having not seen your output, etc., but perhaps make is expanding your various environment variables and whatnot ($PATH, $LIB, @INC) and generating a rather huge line. If this is the case, then reducing these variables might help. -- Mike Schuh -- Seattle, Washington USA http://www.farmdale.com From jason.stajich at duke.edu Mon Oct 4 16:20:46 2004 From: jason.stajich at duke.edu (Jason Stajich) Date: Mon Oct 4 16:20:07 2004 Subject: [Bioperl-l] Bioperl core 1.4 make error: line too long In-Reply-To: References: Message-ID: Also check that you have the latest ExtUtils::MakeMaker which is culprit module creating the makefile in the first place and which didn't account for the possibility that there would be packages with as many modules. Other suggestions have been posted on this topic several times on the mailing list. -jason On Oct 4, 2004, at 4:15 PM, Mike Schuh wrote: > Hi Derek, > > On Mon, 4 Oct 2004, Derek Gatherer wrote: > >> Just upgrading from 1.2.2 to 1.4. >> >> unpacked the core distrib, then: >> >> # perl -w Makefile.PL >> >> ....... [usual list of CPAN modules I don't have] >> >> Enjoy the rest of bioperl, which you can use after going 'make >> install' >> >> Writing Makefile for Bio >> # make >> Make: line too long. Stop. > > This is a guess, having not seen your output, etc., but perhaps make is > expanding your various environment variables and whatnot ($PATH, $LIB, > @INC) and generating a rather huge line. If this is the case, then > reducing these variables might help. > > -- > Mike Schuh -- Seattle, Washington USA > http://www.farmdale.com > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- Jason Stajich jason.stajich at duke.edu http://www.duke.edu/~jes12/ From jason.stajich at duke.edu Mon Oct 4 20:08:45 2004 From: jason.stajich at duke.edu (Jason Stajich) Date: Mon Oct 4 20:08:10 2004 Subject: [Bioperl-l] Bioperl core 1.4 make error: line too long In-Reply-To: References: Message-ID: Yeah I guess this can be a problem and why most people use PPM - I don't really know what to do wrt windows/dos. I guess people also suggest using cygwin. Windows users can speak up and say more I hope how they have coped. -jason On Oct 4, 2004, at 5:35 PM, Nathan Haigh wrote: > Apologies for my earlier e-mail, I did not research the error number > before my reply. > > It appears that because dos can only accept a maximum of 128 chars on > the > command line and thus throws the error reported earlier when a "make > test" > command is issued. For further info see: > http://msdn.microsoft.com/library/default.asp?url=/library/en-us/ > vccore/ht > ml/U1095.asp > > I also get a similar error when running "nmake install". > > If you need any further info, I can let you know the exact messages > received. > > Nathan > > > >> -----Original Message----- >> From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l- >> bounces@portal.open-bio.org] On Behalf Of Jason Stajich >> Sent: 04 October 2004 21:21 >> To: Mike Schuh >> Cc: Derek Gatherer; bioperl-l@bioperl.org >> Subject: Re: [Bioperl-l] Bioperl core 1.4 make error: line too long >> >> Also check that you have the latest ExtUtils::MakeMaker which is >> culprit module creating the makefile in the first place and which >> didn't account for the possibility that there would be packages with >> as >> many modules. >> >> Other suggestions have been posted on this topic several times on the >> mailing list. >> >> -jason >> On Oct 4, 2004, at 4:15 PM, Mike Schuh wrote: >> >>> Hi Derek, >>> >>> On Mon, 4 Oct 2004, Derek Gatherer wrote: >>> >>>> Just upgrading from 1.2.2 to 1.4. >>>> >>>> unpacked the core distrib, then: >>>> >>>> # perl -w Makefile.PL >>>> >>>> ....... [usual list of CPAN modules I don't have] >>>> >>>> Enjoy the rest of bioperl, which you can use after going 'make >>>> install' >>>> >>>> Writing Makefile for Bio >>>> # make >>>> Make: line too long. Stop. >>> >>> This is a guess, having not seen your output, etc., but perhaps make > is >>> expanding your various environment variables and whatnot ($PATH, >>> $LIB, >>> @INC) and generating a rather huge line. If this is the case, then >>> reducing these variables might help. >>> >>> -- >>> Mike Schuh -- Seattle, Washington USA >>> http://www.farmdale.com >>> >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l@portal.open-bio.org >>> http://portal.open-bio.org/mailman/listinfo/bioperl-l >>> >>> >> -- >> Jason Stajich >> jason.stajich at duke.edu >> http://www.duke.edu/~jes12/ >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l@portal.open-bio.org >> http://portal.open-bio.org/mailman/listinfo/bioperl-l >> --- >> avast! Antivirus: Inbound message clean. >> Virus Database (VPS): 0441-0, 04/10/2004 >> Tested on: 04/10/2004 22:04:52 >> avast! is copyright (c) 2000-2003 ALWIL Software. >> http://www.avast.com >> >> > > -- Jason Stajich jason.stajich at duke.edu http://www.duke.edu/~jes12/ From whs at ebi.ac.uk Tue Oct 5 04:04:09 2004 From: whs at ebi.ac.uk (Will Spooner) Date: Tue Oct 5 04:04:12 2004 Subject: [Bioperl-l] Will Spooner, where are you? In-Reply-To: <28694E08-163E-11D9-A5B3-000A9577009E@pcbi.upenn.edu> Message-ID: Hi Aaron, I'm here! On which branch are the tests failing? Will On Mon, 4 Oct 2004, Aaron J. Mackey wrote: > > whs@sanger.ac.uk bounced for me; Will, if you're still listening, we'd > appreciate help with this: > > amackey% perl t/RootStorable.t > 1..34 > ok 1 > ok 2 > ok 3 > ok 4 > ok 5 > ok 6 > > ------------- EXCEPTION ------------- > MSG: Token /tmp/kzC4I9dJ returned no data > STACK Bio::Root::Storable::retrieve Bio/Root/Storable.pm:497 > STACK toplevel t/RootStorable.t:55 > -------------------------------------- > > -Aaron > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > From tex at biosysadmin.com Mon Oct 4 19:55:56 2004 From: tex at biosysadmin.com (James Thompson) Date: Tue Oct 5 12:07:51 2004 Subject: [Bioperl-l] Attention: upcoming BioPerl 1.5 developer's release In-Reply-To: Message-ID: Here's an updated list of the various tests that fail on my CVS copy of Bioperl. I'm running on Perl 5.8.5 on Solaris 8. Here are the results of a make test: Failed Test Stat Wstat Total Fail Failed List of Failed ------------------------------------------------------------------------------- t/Registry.t 255 65280 6 3 50.00% 5-6 t/RootStorable.t 2 512 34 56 164.71% 7-34 113 subtests skipped. Failed 2/192 test scripts, 98.96% okay. 30/8766 subtests failed, 99.66% okay. Here's a make test with BIOPERLDEBUG set: Failed Test Stat Wstat Total Fail Failed List of Failed ------------------------------------------------------------------------------- t/GOR4.t 11 2 18.18% 7 10 t/HNN.t 13 2 15.38% 7 12 t/Registry.t 255 65280 6 3 50.00% 5-6 t/RootStorable.t 2 512 34 56 164.71% 7-34 t/Scansite.t 12 1 8.33% 10 2 subtests skipped. These are the results as of this morning around 10am ET. I'll update these with the latest working CVS copy and e-mail the results out again tonight. James Thompson RIT Bioinformatics From amackey at pcbi.upenn.edu Tue Oct 5 12:11:36 2004 From: amackey at pcbi.upenn.edu (Aaron J. Mackey) Date: Tue Oct 5 12:10:58 2004 Subject: [Bioperl-l] Attention: upcoming BioPerl 1.5 developer's release In-Reply-To: References: Message-ID: <3BBB6556-16E9-11D9-B879-000A9577009E@pcbi.upenn.edu> > t/Registry.t 255 65280 6 3 50.00% 5-6 > t/RootStorable.t 2 512 34 56 164.71% 7-34 RootStorable should be fixed. Some of these should also be fixed now; did you cvs update? > t/GOR4.t 11 2 18.18% 7 10 > t/HNN.t 13 2 15.38% 7 12 > t/Registry.t 255 65280 6 3 50.00% 5-6 > t/RootStorable.t 2 512 34 56 164.71% 7-34 > t/Scansite.t 12 1 8.33% 10 -- Aaron J. Mackey, Ph.D. Dept. of Biology, Goddard 212 University of Pennsylvania email: amackey@pcbi.upenn.edu 415 S. University Avenue office: 215-898-1205 Philadelphia, PA 19104-6017 fax: 215-746-6697 From guoya_li at merck.com Tue Oct 5 15:02:00 2004 From: guoya_li at merck.com (Li, Guoya) Date: Tue Oct 5 15:47:45 2004 Subject: [Bioperl-l] Phylogenetic tree Message-ID: <176FF955CCA3D5118F6800508BB23CB304E82210@ussemx01.merck.com> Hi, all: I wonder if there is a module which I can draw a phylogenetic tree a Newick format input file or any other format input file? Thanks for your help guoya ------------------------------------------------------------------------------ Notice: This e-mail message, together with any attachments, contains information of Merck & Co., Inc. (One Merck Drive, Whitehouse Station, New Jersey, USA 08889), and/or its affiliates (which may be known outside the United States as Merck Frosst, Merck Sharp & Dohme or MSD and in Japan, as Banyu) that may be confidential, proprietary copyrighted and/or legally privileged. It is intended solely for the use of the individual or entity named on this message. If you are not the intended recipient, and have received this message in error, please notify us immediately by reply e-mail and then delete it from your system. ------------------------------------------------------------------------------ From brian_osborne at cognia.com Tue Oct 5 17:34:43 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Tue Oct 5 17:34:27 2004 Subject: [Bioperl-l] Attention: upcoming BioPerl 1.5 developer's release In-Reply-To: <3BBB6556-16E9-11D9-B879-000A9577009E@pcbi.upenn.edu> Message-ID: Aaron, > t/Registry.t 255 65280 6 3 50.00% 5-6 This one works for me without warnings now, with or without BerkeleyDB (Cygwin). Please use the latest bioperl-live. Brian O. -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Aaron J. Mackey Sent: Tuesday, October 05, 2004 12:12 PM To: James Thompson Cc: bioperl-l@bioperl.org Subject: Re: [Bioperl-l] Attention: upcoming BioPerl 1.5 developer's release > t/Registry.t 255 65280 6 3 50.00% 5-6 > t/RootStorable.t 2 512 34 56 164.71% 7-34 RootStorable should be fixed. Some of these should also be fixed now; did you cvs update? > t/GOR4.t 11 2 18.18% 7 10 > t/HNN.t 13 2 15.38% 7 12 > t/Registry.t 255 65280 6 3 50.00% 5-6 > t/RootStorable.t 2 512 34 56 164.71% 7-34 > t/Scansite.t 12 1 8.33% 10 -- Aaron J. Mackey, Ph.D. Dept. of Biology, Goddard 212 University of Pennsylvania email: amackey@pcbi.upenn.edu 415 S. University Avenue office: 215-898-1205 Philadelphia, PA 19104-6017 fax: 215-746-6697 _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l From tex at biosysadmin.com Tue Oct 5 04:11:19 2004 From: tex at biosysadmin.com (James Thompson) Date: Tue Oct 5 20:22:50 2004 Subject: [Bioperl-l] Attention: upcoming BioPerl 1.5 developer's release In-Reply-To: <3BBB6556-16E9-11D9-B879-000A9577009E@pcbi.upenn.edu> Message-ID: Aaron, Just did a cvs update, all of the tests pass now both with and without BIOPERLDEBUG enabled. Cheers, James Thompson On Tue, 5 Oct 2004, Aaron J. Mackey wrote: > > > t/Registry.t 255 65280 6 3 50.00% 5-6 > > t/RootStorable.t 2 512 34 56 164.71% 7-34 > > RootStorable should be fixed. > > Some of these should also be fixed now; did you cvs update? > > > t/GOR4.t 11 2 18.18% 7 10 > > t/HNN.t 13 2 15.38% 7 12 > > t/Registry.t 255 65280 6 3 50.00% 5-6 > > t/RootStorable.t 2 512 34 56 164.71% 7-34 > > t/Scansite.t 12 1 8.33% 10 > > > -- > Aaron J. Mackey, Ph.D. > Dept. of Biology, Goddard 212 > University of Pennsylvania email: amackey@pcbi.upenn.edu > 415 S. University Avenue office: 215-898-1205 > Philadelphia, PA 19104-6017 fax: 215-746-6697 > > From jason.stajich at duke.edu Tue Oct 5 23:18:40 2004 From: jason.stajich at duke.edu (Jason Stajich) Date: Tue Oct 5 23:17:59 2004 Subject: [Bioperl-l] t/RestrictionIO.t failing on perl 5.6.0 Message-ID: <6BB71828-1746-11D9-A564-000393C44276@duke.edu> % perl -v This is perl, v5.6.0 built for darwin % perl -I. -w t/RestrictionIO.t not ok 10 # Test 10 got: '9' (t/RestrictionIO.t at line 63) # Expected: '11' I can't quite figure it out, but it is skipping the last two RE entries - which are not skipped on 5.8.1. I've not tried many other perls/OSes yet to see what else breaks. Somehow I think the local $/ delimiter on <1> is not working for the last 2 entries but no idea why. -jason -- Jason Stajich jason.stajich at duke.edu http://www.duke.edu/~jes12/ From allenday at ucla.edu Wed Oct 6 01:46:05 2004 From: allenday at ucla.edu (Allen Day) Date: Wed Oct 6 01:45:26 2004 Subject: [Bioperl-l] Phylogenetic tree In-Reply-To: <176FF955CCA3D5118F6800508BB23CB304E82210@ussemx01.merck.com> References: <176FF955CCA3D5118F6800508BB23CB304E82210@ussemx01.merck.com> Message-ID: Bio::TreeIO::svggraph. maybe others. On Tue, 5 Oct 2004, Li, Guoya wrote: > Hi, all: > I wonder if there is a module which I can draw a phylogenetic tree a > Newick format input file or any other format input file? Thanks for your > help > guoya > > > ------------------------------------------------------------------------------ > Notice: This e-mail message, together with any attachments, contains information of Merck & Co., Inc. (One Merck Drive, Whitehouse Station, New Jersey, USA 08889), and/or its affiliates (which may be known outside the United States as Merck Frosst, Merck Sharp & Dohme or MSD and in Japan, as Banyu) that may be confidential, proprietary copyrighted and/or legally privileged. It is intended solely for the use of the individual or entity named on this message. If you are not the intended recipient, and have received this message in error, please notify us immediately by reply e-mail and then delete it from your system. > ------------------------------------------------------------------------------ > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > From tomas_marques at hotmail.com Wed Oct 6 05:59:05 2004 From: tomas_marques at hotmail.com (Marques Bonet) Date: Wed Oct 6 08:13:36 2004 Subject: [Bioperl-l] Bl2seq (cannot find path) Message-ID: An HTML attachment was scrubbed... URL: http://portal.open-bio.org/pipermail/bioperl-l/attachments/20041006/19896a7d/attachment.htm From brian_osborne at cognia.com Wed Oct 6 10:53:59 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Wed Oct 6 10:53:43 2004 Subject: [Bioperl-l] RE: Question: How do I run SwissPfam within Bioperl ? In-Reply-To: <20041006151724.BD22.MISAKI@sfc.keio.ac.jp> Message-ID: Misaki, What the error message is saying is that the Perl module DB_File isn't installed, you'll need to install it. This module serves as an interface to the Berkeley DB package, you'll need to install this as well. I've always downloaded Berkeley DB from www.sleepycat.com. Brian O. -----Original Message----- From: Misaki Sato [mailto:misaki@sfc.keio.ac.jp] Sent: Wednesday, October 06, 2004 2:37 AM To: jason@bioperl.org; brian_osborne@cognia.com; heikki@ebi.ac.uk Subject: Question: How do I run SwissPfam within Bioperl ? Dear all, I found a basic structure of SwissPfam like below on some web-sites, but still have some questions. 1, What file format does this recommend ? I tried using FASTA format file "test", but failed like below. Content of "swissPfam.pl" is at the bottom of this mail. % perl swissPfam.pl test ------------- EXCEPTION ------------- MSG: Can't open 'DB_File' dbm file 'test' : STACK Bio::Index::Abstract::open_dbm /usr/lib/perl5/site_perl/5.8.3/Bio/Index/Abstract.pm:389 STACK Bio::Index::Abstract::new /usr/lib/perl5/site_perl/5.8.3/Bio/Index/Abstract.pm:150 STACK toplevel swissPfam.pl:7 -------------------------------------- % 2, Are there any additional things for running this module ? 3, Could you show me an example to use this module? --------Content of swissPfam.pl----------------------- #!/usr/bin/perl -w use Bio::Index::SwissPfam; use strict; my $Index_File_Name = shift; my $inx = Bio::Index::SwissPfam->new('-filename' => $Index_File_Name, '-write_flag' => 'WRITE'); $inx->make_index(@ARGV); use Bio::Index::SwissPfam; use strict; my $Index_File_Name = shift; my $inx = Bio::Index::SwissPfam->new('-filename' => $Index_File_Name); foreach my $id (@ARGV) { my $seq = $inx->fetch($id); # Returns stream while( <$seq> ) { if(/^>/) { print; last; } } } ------------------------------------------- From: http://doc.bioperl.org/releases/bioperl-1.2/Bio/Index/SwissPfam.html Waiting for your reply. Thank you. Misaki Sato ------------------------------- Keio Univ. SFC Institute for Advanced Biosciences Misaki Sato misaki@sfc.keio.ac.jp ------------------------------- From jason.stajich at duke.edu Wed Oct 6 11:14:57 2004 From: jason.stajich at duke.edu (Jason Stajich) Date: Wed Oct 6 11:14:32 2004 Subject: [Bioperl-l] RE: Question: How do I run SwissPfam within Bioperl ? In-Reply-To: References: Message-ID: <7C27E9FC-17AA-11D9-AA7D-000393C44276@duke.edu> Actually I think the problem might be that 'test' is the name of the swisspfam data while you need to provide the idx file as the first argument. Hence the first 'shift' in the script followed later by the iterating through the @ARGV array. By providing 'test' as the name of the index the module is trying to call tie(%hash, 'DB_File', 'test'); and expecting that since 'test' already exists it must be a DBM file (which it isn't, hence the error). I think the module is written to be smart enough to fail over to SDBM instead of DB_File when the latter is not installed. Try running the script like this % perl swissPfam.pl test.idx test However, all this said, this is not really going to 'run SwissPfam' in the first place, it is an indexing system for being able to quickly jump to different SwissPfam results in a large output file.... Not sure if that is what you wanted to do Misaki? What does your 'test' file look like. -jason On Oct 6, 2004, at 10:53 AM, Brian Osborne wrote: > Misaki, > > What the error message is saying is that the Perl module DB_File isn't > installed, you'll need to install it. This module serves as an > interface to > the Berkeley DB package, you'll need to install this as well. I've > always > downloaded Berkeley DB from www.sleepycat.com. > > Brian O. > > > -----Original Message----- > From: Misaki Sato [mailto:misaki@sfc.keio.ac.jp] > Sent: Wednesday, October 06, 2004 2:37 AM > To: jason@bioperl.org; brian_osborne@cognia.com; heikki@ebi.ac.uk > Subject: Question: How do I run SwissPfam within Bioperl ? > > Dear all, > > I found a basic structure of SwissPfam like below on some web-sites, > but > still have some questions. > > 1, What file format does this recommend ? > I tried using FASTA format file "test", but failed like below. > Content of "swissPfam.pl" is at the bottom of this mail. > % perl swissPfam.pl test > ------------- EXCEPTION ------------- > MSG: Can't open 'DB_File' dbm file 'test' : > STACK Bio::Index::Abstract::open_dbm > /usr/lib/perl5/site_perl/5.8.3/Bio/Index/Abstract.pm:389 > STACK Bio::Index::Abstract::new > /usr/lib/perl5/site_perl/5.8.3/Bio/Index/Abstract.pm:150 > STACK toplevel swissPfam.pl:7 > -------------------------------------- > % > > 2, Are there any additional things for running this module ? > > 3, Could you show me an example to use this module? > > > --------Content of swissPfam.pl----------------------- > #!/usr/bin/perl -w > use Bio::Index::SwissPfam; > use strict; > my $Index_File_Name = shift; > my $inx = Bio::Index::SwissPfam->new('-filename' => > $Index_File_Name, > '-write_flag' => 'WRITE'); > $inx->make_index(@ARGV); > use Bio::Index::SwissPfam; > use strict; > my $Index_File_Name = shift; > my $inx = Bio::Index::SwissPfam->new('-filename' => > $Index_File_Name); > foreach my $id (@ARGV) { > my $seq = $inx->fetch($id); # Returns stream > while( <$seq> ) { > if(/^>/) { > print; last; > } > } > } > ------------------------------------------- > From: > http://doc.bioperl.org/releases/bioperl-1.2/Bio/Index/SwissPfam.html > > > Waiting for your reply. > Thank you. > > Misaki Sato > ------------------------------- > Keio Univ. SFC > Institute for Advanced Biosciences > Misaki Sato > misaki@sfc.keio.ac.jp > ------------------------------- > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- Jason Stajich jason.stajich at duke.edu http://www.duke.edu/~jes12/ From tomas_marques at hotmail.com Thu Oct 7 05:40:43 2004 From: tomas_marques at hotmail.com (Marques Bonet) Date: Thu Oct 7 05:40:18 2004 Subject: [Bioperl-l] Path to bl2seq Message-ID: hi, I'm working withWindows 2000 and Bioperl 1.4. The problem is that my script is unable to find bl2seq.exe that I have in a certain directory. I'm setting the environment variables BLASTDIR and PROGRAMDIR: $ENV{PROGRAMDIR} = 'C://blast//'; $ENV{BLASTDIR} = 'C://blast//'; but this seems not work. I'm also cheking the program_path() and program_dir and they are empty. Any ideas? Thanks. _________________________________________________________________ Acepta el reto MSN Premium: Correos m?s divertidos con fotos y textos incre?bles en MSN Premium. Desc?rgalo y pru?balo 2 meses gratis. http://join.msn.com?XAPID=1697&DI=1055&HL=Footer_mailsenviados_correosmasdivertidos From james.wasmuth at ed.ac.uk Thu Oct 7 05:52:09 2004 From: james.wasmuth at ed.ac.uk (James Wasmuth) Date: Thu Oct 7 05:57:00 2004 Subject: [Bioperl-l] Path to bl2seq In-Reply-To: References: Message-ID: <416511C9.7010102@ed.ac.uk> Hi Marques, I'm not sure but I thought in Windows the paths use '\' instead of '/' -james Marques Bonet wrote: > hi, > I'm working withWindows 2000 and Bioperl 1.4. The problem is that my > script is unable to find bl2seq.exe that I have in a certain directory. > > I'm setting the environment variables BLASTDIR and PROGRAMDIR: > $ENV{PROGRAMDIR} = 'C://blast//'; > $ENV{BLASTDIR} = 'C://blast//'; > > but this seems not work. > > I'm also cheking the program_path() and program_dir and they are empty. > > Any ideas? > > Thanks. > > _________________________________________________________________ > Acepta el reto MSN Premium: Correos m?s divertidos con fotos y textos > incre?bles en MSN Premium. Desc?rgalo y pru?balo 2 meses gratis. > http://join.msn.com?XAPID=1697&DI=1055&HL=Footer_mailsenviados_correosmasdivertidos > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l -- "Until man duplicates a blade of grass, nature can laugh at his so-called scientific knowledge...." --Thomas Edison Blaxter Nematode Genomics Group | School of Biological Sciences | Ashworth Laboratories | tel: +44 131 650 7403 University of Edinburgh | web: www.nematodes.org Edinburgh | EH9 3JT | UK | From d.gatherer at vir.gla.ac.uk Thu Oct 7 07:01:32 2004 From: d.gatherer at vir.gla.ac.uk (Derek Gatherer) Date: Thu Oct 7 09:24:32 2004 Subject: [Bioperl-l] Bioperl core 1.4 make error: line too long In-Reply-To: References: Message-ID: <6.1.2.0.1.20041007114852.0254e4c8@ucdf.gla.ac.uk> The answer appears to be to use gnumake instead of make, as previously suggested: http://bioperl.org/pipermail/bioperl-l/2002-August/009034.html. The gnumake I have is GNU Make version 3.75-gnupro-98r2 which seems to be adequate. Another suggestion, make -i, didn't work for me. ExtUtils::MakeMaker 6.21_03 is also apparently insufficient to correct the problem with make -i. However, I installed ExtUtils::MakeMaker before I tried gnumake so it is possible that this module is required for gnumake to work. Then it's gnumake check gnumake install and so on Cheers Derek At 21:20 04/10/2004, Jason Stajich wrote: >Also check that you have the latest ExtUtils::MakeMaker which is culprit >module creating the makefile in the first place and which didn't account >for the possibility that there would be packages with as many modules. > >Other suggestions have been posted on this topic several times on the >mailing list. > >-jason >On Oct 4, 2004, at 4:15 PM, Mike Schuh wrote: > >>Hi Derek, >> >>On Mon, 4 Oct 2004, Derek Gatherer wrote: >> >>>Just upgrading from 1.2.2 to 1.4. >>> >>>unpacked the core distrib, then: >>> >>># perl -w Makefile.PL >>> >>>....... [usual list of CPAN modules I don't have] >>> >>> Enjoy the rest of bioperl, which you can use after going 'make install' >>> >>>Writing Makefile for Bio >>># make >>>Make: line too long. Stop. >> >>This is a guess, having not seen your output, etc., but perhaps make is >>expanding your various environment variables and whatnot ($PATH, $LIB, >>@INC) and generating a rather huge line. If this is the case, then >>reducing these variables might help. >> >>-- >>Mike Schuh -- Seattle, Washington USA >>http://www.farmdale.com >> >>_______________________________________________ >>Bioperl-l mailing list >>Bioperl-l@portal.open-bio.org >>http://portal.open-bio.org/mailman/listinfo/bioperl-l >> >-- >Jason Stajich >jason.stajich at duke.edu >http://www.duke.edu/~jes12/ From dlyzxl at yahoo.com Sat Oct 9 15:16:13 2004 From: dlyzxl at yahoo.com (Xiangli Zhang) Date: Sat Oct 9 15:15:25 2004 Subject: [Bioperl-l] question about running lagan Message-ID: <20041009191613.91349.qmail@web51109.mail.yahoo.com> I got a error when i ran 'lagan' program as copied: chaos: fchaos.c:609: readSubstMatrix: Assertion `file' failed. Anybody can help me out? Thanks Justin ===== Xiangli Zhang (Justin) 306-310 Decaire Street, Coquitlam BC, Canada, V3K 6X1 phone: 604-9399181 __________________________________ Do you Yahoo!? Read only the mail you want - Yahoo! Mail SpamGuard. http://promotions.yahoo.com/new_mail From brian_osborne at cognia.com Sun Oct 10 10:17:23 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Sun Oct 10 10:17:52 2004 Subject: [Bioperl-l] Bio::Biblio question In-Reply-To: <53F94C5E-FDBF-11D8-B0B6-000A95D7BA10@mail.nih.gov> Message-ID: Sean, Do you have the same problem when you set the server to "eutils"? Something like: my $arr_ref = new Bio::Biblio(-access => "eutils")->find("Davis","authors")->get_all_ids; Brian O. -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Sean Davis Sent: Friday, September 03, 2004 11:39 AM To: Baranidharan P Cc: bioperl-l@portal.open-bio.org Subject: Re: [Bioperl-l] Bio::Biblio question Thanks for the reply. The problem isn't getting the IDs. It is that the get_all_ids method returns a list that is prohibitively long for the SOAP service, so an exception is thrown. I can easily check to see how big the list might be before issuing get_all_ids, but I am still stuck with trying to get some of the ids back. Looking at the protocol, it appears that there is no such functionality as get_more_ids(200). Am I correct on this? The specification suggests that there might be a "format" argument for limiting what is returned by get_next, but I don't see anything except pubmed vs. medline as formats. Thanks for any more guidance. Sean On Sep 2, 2004, at 11:15 PM, Baranidharan P wrote: > Dear Mr. Davis > > u can try > my @ids= @{ new Bio::Biblio->find ("$gene")->get_all_ids } ; > > foreach my $ids (@ids) > { > print $ids; > } > > > On Fri, 03 Sep 2004 Sean Davis wrote : >> Dear all, >> >> I have the following code (below) which works in most cases. However, > sometimes, I get. The failure is due to a very large result set and > fails at the get_all_ids stage. I only want the ids and I only want > the first 200 or so. Is there a way to QUICKLY (ie., without > retrieving the entire XML for each) get only the first 200 ids? >> >> >> my $biblio = Bio::Biblio->new(); >> my $new_biblio=$biblio->find([$gene,$mod]); >> my $results=$new_biblio->get_count; >> if ($results) { >> my @ids=map { $_=~ /([0-9]*$)/; $1; } > @{$new_biblio->get_all_ids}; >> >> >> ------------- EXCEPTION ------------- >> MSG: --- SOAP FAULT --- >> SOAP-ENV:Server Exception from service object: Limit exceeded. Use > iterator instead. >> STACK > Bio::DB::Biblio::soap::__ANON__[/Library/Perl/5.8.1/Bio/DB/Biblio/ > soap.pm:120] /Library/Perl/5.8.1/Bio/DB/Biblio/soap.pm:119 >> STACK SOAP::Lite::call /Library/Perl/SOAP/Lite.pm:2839 >> STACK SOAP::Lite::__ANON__[/Library/Perl/SOAP/Lite.pm:2806] > /Library/Perl/SOAP/Lite.pm:2802 >> STACK Bio::DB::Biblio::soap::get_all_ids > /Library/Perl/5.8.1/Bio/DB/Biblio/soap.pm:424 >> STACK toplevel pubsearch.pl:35 >> >> -------------------------------------- >> Bio::Root::Root::throw('Bio::DB::Biblio::soap','-text','--- > SOAP FAULT ---\x{a}SOAP-ENV:Server Exception from service obj...') > called at /Library/Perl/5.8.1/Bio/DB/Biblio/soap.pm line 119 >> > Bio::DB::Biblio::soap::__ANON__[/Library/Perl/5.8.1/Bio/DB/Biblio/ > soap.pm:120]('SOAP::Lite=HASH(0xb8ab08)','SOAP::SOM=HASH(0xd4616c)') > called at /Library/Perl/SOAP/Lite.pm line 2839 >> > SOAP::Lite::call('SOAP::Lite=HASH(0xb8ab08)','getAllIDs','SOAP:: > Data=HASH(0xd6af78)') called at /Library/Perl/SOAP/Lite.pm line 2802 >> SOAP::Lite::__ANON__[/Library/Perl/SOAP/Lite.pm:2806]('SOAP:: > Lite=HASH(0xb8ab08)','SOAP::Data=HASH(0xd6af78)') called at > /Library/Perl/5.8.1/Bio/DB/Biblio/soap.pm line 424 >> Bio::DB::Biblio::soap::get_all_ids('Bio::DB::Biblio:: > soap=HASH(0xd800d8)') called at pubsearch.pl line 35 >> Debugged program terminated. Use q to quit or R to restart, >> use O inhibit_exit to avoid stopping after program termination, >> h q, h R or h O to get additional info. >> >> >> >> my $biblio = Bio::Biblio->new(); >> my $new_biblio=$biblio->find([$gene,$mod]); >> my $results=$new_biblio->get_count; >> if ($results) { >> my @ids=map { $_=~ /([0-9]*$)/; $1; } > @{$new_biblio->get_all_ids}; >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l@portal.open-bio.org >> http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > =============================== > > Baranidharan P > > Senior Project Assistant > > Bioinformatics Sub DIC > > Dept of Biotechnology > > Indian Institute of Technology > > Kharagpur - 721302 > > West Bengal > > INDIA > > Ph. +91 3222 281365 > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l From chenn at cshl.edu Sun Oct 10 22:12:20 2004 From: chenn at cshl.edu (Jack Chen) Date: Mon Oct 11 08:32:34 2004 Subject: [Bioperl-l] Bio::Tools::Run::RemoteBlast hits limit Message-ID: Hi, I noticed that there is a limit (100) of hits retireved using the module. I need to retrieve more hits than this. I have tried a couple of ways: $Bio::Tools::Run::RemoteBlast::RETRIEVALHEADER{'DESCRIPTIONS'} = 500;] $factory->retrieve_parameter('DESCRIPTIONS' => 500); In both cases, I print "LIMIT: ", $factory->retrieve_parameter('DESCRIPTIONS'), "\n"; gives LIMIT: 500 But the module actually retrieved 100 hits. Modifying the code to 500 gave me 500 hits. My question is: what is the correct way to modify this default number? Thanks, Jack From dcsrkk at nus.edu.sg Sun Oct 10 23:02:09 2004 From: dcsrkk at nus.edu.sg (Ranasaria, Kamal Kishor) Date: Mon Oct 11 08:32:46 2004 Subject: [Bioperl-l] Problems running BLAST Tutorial Message-ID: Dear Sir/Madam, I had just installed Bioperl 1.4 and when I tried running blast tutorial I got the following error : Beginning run_remoteblast example... Cannot find Bio::Tools::Run::RemoteBlast Skipping run_remoteblast example: Could you help me sort out the problem. I am running it on a windows machine. Thanking you, Regards, Kamal Ranasaria From nathanhaigh at ukonline.co.uk Mon Oct 11 06:55:54 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Mon Oct 11 08:33:02 2004 Subject: [Bioperl-l] Bioperl core 1.4 make error: line too long In-Reply-To: Message-ID: Using ppm would be great if all the bioperl packages were available, but they are not. I don't know about Makefiles, but is it possible to save the long commandline arguments to file and pass this file to nmake, and have this only occur for windows OS's? This was the suggestion at http://msdn.microsoft.com/library/default.asp?url=/library/en-us/vccore/ht ml/U1095.asp I don't use cygwin, because most of the scripts I write I want non bioinformaticians to use who wouldn't have a clue what to do if they had to use cygwin to run their scripts. I'm not sure how many BioPerl windows users there are, but these are my thought on it. Nathan > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l- > bounces@portal.open-bio.org] On Behalf Of Jason Stajich > Sent: 05 October 2004 01:09 > To: nathanhaigh@ukonline.co.uk > Cc: Bioperl Mailing List > Subject: Re: [Bioperl-l] Bioperl core 1.4 make error: line too long > > Yeah I guess this can be a problem and why most people use PPM - I > don't really know what to do wrt windows/dos. I guess people also > suggest using cygwin. Windows users can speak up and say more I hope > how they have coped. > > -jason > On Oct 4, 2004, at 5:35 PM, Nathan Haigh wrote: > > > Apologies for my earlier e-mail, I did not research the error number > > before my reply. > > > > It appears that because dos can only accept a maximum of 128 chars on > > the > > command line and thus throws the error reported earlier when a "make > > test" > > command is issued. For further info see: > > http://msdn.microsoft.com/library/default.asp?url=/library/en-us/ > > vccore/ht > > ml/U1095.asp > > > > I also get a similar error when running "nmake install". > > > > If you need any further info, I can let you know the exact messages > > received. > > > > Nathan > > > > > > > >> -----Original Message----- > >> From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l- > >> bounces@portal.open-bio.org] On Behalf Of Jason Stajich > >> Sent: 04 October 2004 21:21 > >> To: Mike Schuh > >> Cc: Derek Gatherer; bioperl-l@bioperl.org > >> Subject: Re: [Bioperl-l] Bioperl core 1.4 make error: line too long > >> > >> Also check that you have the latest ExtUtils::MakeMaker which is > >> culprit module creating the makefile in the first place and which > >> didn't account for the possibility that there would be packages with > >> as > >> many modules. > >> > >> Other suggestions have been posted on this topic several times on the > >> mailing list. > >> > >> -jason > >> On Oct 4, 2004, at 4:15 PM, Mike Schuh wrote: > >> > >>> Hi Derek, > >>> > >>> On Mon, 4 Oct 2004, Derek Gatherer wrote: > >>> > >>>> Just upgrading from 1.2.2 to 1.4. > >>>> > >>>> unpacked the core distrib, then: > >>>> > >>>> # perl -w Makefile.PL > >>>> > >>>> ....... [usual list of CPAN modules I don't have] > >>>> > >>>> Enjoy the rest of bioperl, which you can use after going 'make > >>>> install' > >>>> > >>>> Writing Makefile for Bio > >>>> # make > >>>> Make: line too long. Stop. > >>> > >>> This is a guess, having not seen your output, etc., but perhaps make > > is > >>> expanding your various environment variables and whatnot ($PATH, > >>> $LIB, > >>> @INC) and generating a rather huge line. If this is the case, then > >>> reducing these variables might help. > >>> > >>> -- > >>> Mike Schuh -- Seattle, Washington USA > >>> http://www.farmdale.com > >>> > >>> _______________________________________________ > >>> Bioperl-l mailing list > >>> Bioperl-l@portal.open-bio.org > >>> http://portal.open-bio.org/mailman/listinfo/bioperl-l > >>> > >>> > >> -- > >> Jason Stajich > >> jason.stajich at duke.edu > >> http://www.duke.edu/~jes12/ > >> > >> _______________________________________________ > >> Bioperl-l mailing list > >> Bioperl-l@portal.open-bio.org > >> http://portal.open-bio.org/mailman/listinfo/bioperl-l > >> --- > >> avast! Antivirus: Inbound message clean. > >> Virus Database (VPS): 0441-0, 04/10/2004 > >> Tested on: 04/10/2004 22:04:52 > >> avast! is copyright (c) 2000-2003 ALWIL Software. > >> http://www.avast.com > >> > >> > > > > > -- > Jason Stajich > jason.stajich at duke.edu > http://www.duke.edu/~jes12/ > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0441-0, 04/10/2004 > Tested on: 05/10/2004 08:36:57 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > -------------- next part -------------- A non-text attachment was scrubbed... Name: smime.p7s Type: application/x-pkcs7-signature Size: 3095 bytes Desc: not available Url : http://portal.open-bio.org/pipermail/bioperl-l/attachments/20041011/a7874e7b/smime.bin From tomas_marques at hotmail.com Mon Oct 11 10:03:55 2004 From: tomas_marques at hotmail.com (Marques Bonet) Date: Mon Oct 11 10:25:09 2004 Subject: [Bioperl-l] Path to bl2seq Message-ID: Thanks for your suggestion, but I've cheked the path (either using '/' or '\'), and I think that in windows the path should be delimited by '/' (as I was using initially). Any other idea? _________________________________________________________________ Acepta el reto MSN Premium: Protecci?n para tus hijos en internet. Desc?rgalo y pru?balo 2 meses gratis. http://join.msn.com?XAPID=1697&DI=1055&HL=Footer_mailsenviados_proteccioninfantil From grossman at molgen.mpg.de Mon Oct 11 09:20:47 2004 From: grossman at molgen.mpg.de (Steffen Grossmann) Date: Mon Oct 11 13:32:55 2004 Subject: [Bioperl-l] GFF3 - Bioperl - SO Message-ID: <416A88AF.1020705@molgen.mpg.de> Dear all, I fancy very much the approach taken by SO(FA) (http://song.sourceforge.net/) to standardize the vocabulary used for sequence annotation. Also, the GFF3 format is a nice way to represent SO-compatible annotations and it would be a great thing to have this all working seamlessly with bioperl. A first step towards such a seamless integration into bioperl would be a parser which is able to read/write hierarchically nested feature collections from/to GFF3 files. Such a parser should make use of the GFF3 specific 'ID' and 'Parent' tags. Of course, I know about the 'Bio::Tools::GFF' and 'Bio::SeqFeature::Tools' modules, where some related stuff can be found. The problem is that the 'Bio::Tools::GFF' module doesn't respect the 'Parent' and 'ID' tag structure and grouping in the 'Unflattener' approach is also done conceptually different. Does anybody know about whether there is someone working on such a project? Or, if there is no such project, is someone interested in joining to start it? Thanks in advance for any response! Steffen -- %---------------------------------------------% % Steffen Grossmann % % % % Max Planck Institute for Molecular Genetics % % Computational Molecular Biology % %---------------------------------------------% % Ihnestrasse 73 % % 14195 Berlin % % Germany % %---------------------------------------------% % Tel: (++49 +30) 8413-1167 % % Fax: (++49 +30) 8413-1152 % %---------------------------------------------% From allenday at ucla.edu Mon Oct 11 13:51:26 2004 From: allenday at ucla.edu (Allen Day) Date: Mon Oct 11 13:50:33 2004 Subject: [Bioperl-l] Re: [SO-devel] GFF3 - Bioperl - SO In-Reply-To: <416A88AF.1020705@molgen.mpg.de> References: <416A88AF.1020705@molgen.mpg.de> Message-ID: Look at Bio::FeatureIO::gff in bioperl-live. It currently supports lookup/validation of ontology terms via Bio::Ontology::OntologyStore, but doesn't do and cardinality or type/relation enforcement which you seem to be alluding to below. I'd be very pleased if you want to work on this too. Or anyone else on these lists, for that matter :-). -Allen On Mon, 11 Oct 2004, Steffen Grossmann wrote: > Dear all, > > I fancy very much the approach taken by SO(FA) > (http://song.sourceforge.net/) to standardize the vocabulary used for > sequence annotation. Also, the GFF3 format is a nice way to represent > SO-compatible annotations and it would be a great thing to have this all > working seamlessly with bioperl. > > A first step towards such a seamless integration into bioperl would be a > parser which is able to read/write hierarchically nested feature > collections from/to GFF3 files. Such a parser should make use of the > GFF3 specific 'ID' and 'Parent' tags. > > Of course, I know about the 'Bio::Tools::GFF' and > 'Bio::SeqFeature::Tools' modules, where some related stuff can be found. > The problem is that the 'Bio::Tools::GFF' module doesn't respect the > 'Parent' and 'ID' tag structure and grouping in the 'Unflattener' > approach is also done conceptually different. > > Does anybody know about whether there is someone working on such a > project? Or, if there is no such project, is someone interested in > joining to start it? > > Thanks in advance for any response! > > Steffen > > From amackey at pcbi.upenn.edu Mon Oct 11 13:54:29 2004 From: amackey at pcbi.upenn.edu (Aaron J. Mackey) Date: Mon Oct 11 13:53:37 2004 Subject: [Bioperl-l] GFF3 - Bioperl - SO In-Reply-To: <416A88AF.1020705@molgen.mpg.de> References: <416A88AF.1020705@molgen.mpg.de> Message-ID: <9953FF56-1BAE-11D9-8B82-000D93392082@pcbi.upenn.edu> Bio::Feature::IO::GFF is maybe what you want; available now in CVS, and soon in BioPerl 1.5 -Aaron On Oct 11, 2004, at 9:20 AM, Steffen Grossmann wrote: > Dear all, > > I fancy very much the approach taken by SO(FA) > (http://song.sourceforge.net/) to standardize the vocabulary used for > sequence annotation. Also, the GFF3 format is a nice way to represent > SO-compatible annotations and it would be a great thing to have this > all working seamlessly with bioperl. > > A first step towards such a seamless integration into bioperl would be > a parser which is able to read/write hierarchically nested feature > collections from/to GFF3 files. Such a parser should make use of the > GFF3 specific 'ID' and 'Parent' tags. > > Of course, I know about the 'Bio::Tools::GFF' and > 'Bio::SeqFeature::Tools' modules, where some related stuff can be > found. The problem is that the 'Bio::Tools::GFF' module doesn't > respect the 'Parent' and 'ID' tag structure and grouping in the > 'Unflattener' approach is also done conceptually different. > > Does anybody know about whether there is someone working on such a > project? Or, if there is no such project, is someone interested in > joining to start it? > > Thanks in advance for any response! > > Steffen > > -- > %---------------------------------------------% > % Steffen Grossmann % > % % > % Max Planck Institute for Molecular Genetics % > % Computational Molecular Biology % > %---------------------------------------------% > % Ihnestrasse 73 % > % 14195 Berlin % > % Germany % > %---------------------------------------------% > % Tel: (++49 +30) 8413-1167 % > % Fax: (++49 +30) 8413-1152 % > %---------------------------------------------% > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- Aaron J. Mackey, Ph.D. Dept. of Biology, Goddard 212 University of Pennsylvania email: amackey@pcbi.upenn.edu 415 S. University Avenue office: 215-898-1205 Philadelphia, PA 19104-6017 fax: 215-746-6697 From basu at pharm.sunysb.edu Mon Oct 11 15:49:28 2004 From: basu at pharm.sunysb.edu (Siddhartha Basu) Date: Mon Oct 11 15:51:50 2004 Subject: [Bioperl-l] Error with swissprot flat file parsing Message-ID: <416AE3C8.3090405@pharm.sunysb.edu> Hi, I am trying to make a flat file index of swissprot/trembl files using Bio::DB::Flat module. However, i am getting the following consistent warnings during the indexing process. ====================================================================== Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18676877. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18676916. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18676956. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677002. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677045. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677091. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677136. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677178. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677209. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677249. ======================================================================== Though, the indexing get completed, i could'nt fetch any data from there as it does not return any seq obj. I also get the same warnings when i try to read the swissprot file using the Bio::SeqIO module. I am using bioperl-1.4 and understand it has something to do with the swissprot parser in Seq::IO module. So, does any fix or solution available for this problem. Thanks in advance. -siddhartha From Raymond.Auerbach at NAU.EDU Mon Oct 11 19:39:15 2004 From: Raymond.Auerbach at NAU.EDU (Raymond Auerbach) Date: Mon Oct 11 21:02:23 2004 Subject: [Bioperl-l] Translation Question Message-ID: <0I5G00JMR1J6MF@mailgate2.nau.edu> I am new to Bioperl and was wondering what is wrong with the following code: use strict; use Bio::Perl; my $seq_obj = new_sequence("--acg-uuu","test","A1234"); print translate_as_string($seq_obj); I expect to see XXF returned, but instead I get an exception: ------------- EXCEPTION ------------- MSG: Can't translate an amino acid sequence. STACK Bio::PrimarySeqI::translate C:/Perl/site/lib/Bio/PrimarySeqI.pm:527 STACK Bio::Perl::translate C:/Perl/site/lib/Bio/Perl.pm:559 STACK Bio::Perl::translate_as_string C:/Perl/site/lib/Bio/Perl.pm:580 STACK toplevel test2.pl:12 -------------------------------------- Any ideas? I need to be able to do a translation with gaps since a sequence alignment script feeds into this. Thanks! -Ray From birney at ebi.ac.uk Tue Oct 12 04:06:49 2004 From: birney at ebi.ac.uk (Ewan Birney) Date: Tue Oct 12 04:06:10 2004 Subject: [Bioperl-l] Re: Integrating caBIOperl with BIOperl In-Reply-To: <16A0583FB1644E4DB8C0A0265028B6FDFC9142@nihexchange13.nih.gov> Message-ID: On Mon, 11 Oct 2004, Jiang, Shan (NIH/NCI) wrote: > > Hi Ewan, > > I would like to introduce myself. I am a colleage of Gene Levinson at the > National Cancer Institue in the US. I am the original developer of > caBIOperl, which Gene presented at BOSC '04. I believe Gene talked to you > quite extensively during the meeting as well. (Gene asked me to say hi!) > > Currently, I am undertaking the task of integrating caBIOperl with > BIOperl.Gene indicated that you would be a great source to talk to. I am in > the process of learning BIOperl before deciding how to proceed. So I would > much appreciate your help in learning BIOperl as well as looking into > possible ways of integrating caBIOperl with BIOperl. > Great - I'm cc'ing this message to the main bioperl list to check I give you the best advice! > Let me start asking some questions to start the ball rolling. > > 1. Has similar kinds of integration work been done before? If so is there a > general recommended approach? The recommendation is definitely to have an caBIOperl "bridge" to Bioperl objects. The main ones you want to have are Bio::SeqI, Bio::DB::RandomAccessI and Bio::AnnotationCollectionI and Bio::SeqFeatureI The "I" means interface (a bit like Java) In each case you would have wrapper classes that has-a caBIOPerl object and is-a Bioperl object, for example, imagining the caBIOPerl sequence object has methods "human_readable_name" and "sequence_as_string" (of course, they might have something completely different...) package Bio::caBIOBridge::Seq; @ISA = qw( Bio::SeqI ); ... ... # Bio::SeqI isa Bio::PrimarySeqI, and needs to implement # display_id. this should give back the human readable name sub display_id { my $obj = shift; # the caBIOPerl method is "human_readable_name" return $obj->{'_cabioperl_object'}->human_readable_name() } # Bio::SeqI needs to implement seq sub seq { return $obj->{'_cabioperl_object'}->sequence_as_string() } etc etc This is, BTW, something I am planning to do with Ensembl as - make an Ensembl-Bioperl bridge. > 2. Do you have a repository where people can just "donate" their code into? I would suggest that the caBIO-Bioperl bridge was its own cvs module and donated into CPAN. You could run the cvs module at Bioperl.org or do it in your own shop - entirely up to you. > 3. caBIOperl has its own object model, if the end vision is to integrate > this model with BIOperl, how should I proceed? see above > 4. Can I get access to the CVS repository? > You shouldn't need access to the bioperl cvs repository to come up with some working code - if you want to have the caBio-Bioperl bridge repository hosted at bioperl.org that's feasible, but probably building some proof-of-concept classes first off would be great. A great first step would be if someone could write a script like: use Bio::caBIOBridge::DBAccess; use Bio::SeqIO; # default to well known caBio server $db = Bio::caBIOBridge::DBAccess->new(); $ca_wrapped_seq = $db->get_Seq_by_id('some_id'); # $ca_wrapped_seq is Bio::SeqI object but is actually a thin wrapper over # caBIO objects # Bio::SeqIO is a Bioperl object writer that works with Bio::SeqI # compliant objects $seqout = Bio::SeqIO->new( -format => 'EMBL'); # Here we see the bridge in action! $seqout->write_seq($ca_wrapped_seq); > I am not sure how familiar you are with caBIOperl. So if you have any > question, please do not hesistate to ask me. > > Regards, > Shan Jiang > (Contractor) > > From tomas_marques at hotmail.com Tue Oct 12 06:37:07 2004 From: tomas_marques at hotmail.com (Tomas Marques) Date: Tue Oct 12 09:46:16 2004 Subject: [Bioperl-l] Re:Path to bl2seq Message-ID: Hi, after some trials, I've been able to execute bl2seq in windows. The error was due to Bio::Tools::Run:StandAloneBlast.pm, which is written to work in Unix only. All the variables point to "bl2seq", and they should point to a win-executable ("bl2seq.exe"). So I've Hardcoded some of that variables defined in this module ($exe, $executable), and now it works perfectly.... I only wanted to let you know this modification in case some of you work with windows.... Maybe I should move to Linux... From goshng at naver.com Tue Oct 12 10:06:16 2004 From: goshng at naver.com (=?ks_c_5601-1987?B?IsPWu/PDtiI=?=) Date: Tue Oct 12 10:05:31 2004 Subject: [Bioperl-l] From PDB to get nucleotide sequences for all related genomes? Message-ID: <416BE4D8.000002.18535@nhn529> Dear Bioperl Guru: I'm Sang Chul Choi, a graduate student in the program of bioinformatics at NCSU. I'm interested in Protein Evolution Modeling and recently I should apply a model to all PDB entries. The problem is that I am stuck in getting nucleotide sequences of all related genomes for each PDB entry. There is "DBREF" section in PDB like this: ./pdb1t7s.ent DBREF 1T7S A 74 210 GB 17507755 NP_491893 74 210 DBREF 1T7S B 74 210 GB 17507755 NP_491893 74 210 ===================================================== ./pdb1t9f.ent DBREF 1T9F A 22 206 GB 17508635 NP_491320 22 206 ===================================================== ./pdb1tc3.ent DBREF 1TC3 A 1 21 PDB 1TC3 1TC3 1 21 DBREF 1TC3 B 101 120 PDB 1TC3 1TC3 101 120 DBREF 1TC3 C 202 252 GB 1086778 P34257 2 52 And, I know that there is the source orgarnism section. Using these two kinds of information, I have tried to get nucleotide sequences from Database: NCBI, SWISSPROT, ... Is there any good suggestion for this thing? Any comment will be helpful. Thanks, Sang Chul From goshng at naver.com Tue Oct 12 10:03:42 2004 From: goshng at naver.com (=?ks_c_5601-1987?B?IsPWu/PDtiI=?=) Date: Tue Oct 12 13:37:44 2004 Subject: [Bioperl-l] From PDB to get nucleotide sequences for all related genomes? Message-ID: <416BE43E.000001.18215@nhn529> Dear Bioperl Guru: I'm Sang Chul Choi, a graduate student in the program of bioinformatics at NCSU. I'm interested in Protein Evolution Modeling and recently I should apply a model to all PDB entries. The problem is that I am stuck in getting nucleotide sequences of all related genomes for each PDB entry. There is "DBREF" section in PDB like this: ./pdb1t7s.ent DBREF 1T7S A 74 210 GB 17507755 NP_491893 74 210 DBREF 1T7S B 74 210 GB 17507755 NP_491893 74 210 ===================================================== ./pdb1t9f.ent DBREF 1T9F A 22 206 GB 17508635 NP_491320 22 206 ===================================================== ./pdb1tc3.ent DBREF 1TC3 A 1 21 PDB 1TC3 1TC3 1 21 DBREF 1TC3 B 101 120 PDB 1TC3 1TC3 101 120 DBREF 1TC3 C 202 252 GB 1086778 P34257 2 52 And, I know that there is the source orgarnism section. Using these two kinds of information, I have tried to get nucleotide sequences from Database: NCBI, SWISSPROT, ... Is there any good suggestion for this thing? Any comment will be helpful. Thanks, Sang Chul From jason.stajich at duke.edu Tue Oct 12 13:51:12 2004 From: jason.stajich at duke.edu (Jason Stajich) Date: Tue Oct 12 14:00:33 2004 Subject: [Bioperl-l] From PDB to get nucleotide sequences for all related genomes? In-Reply-To: <416BE43E.000001.18215@nhn529> References: <416BE43E.000001.18215@nhn529> Message-ID: <4E6F6B02-1C77-11D9-A8A3-000393C44276@duke.edu> Well given the protein's accession you can get the protein record (Bio::DB::GenPept) parse the record looking for a CDS feature and grab the 'coded_by' section. This gives you another accession number for the CDS sequence, use Bio::DB::GenBank to get that record. Partial examples of stuff like this are in my tutorials http://jason.open-bio.org/Bioperl_Tutorials/ For example this one which does some work to get the CDS for a protein based on a swissprot ID http://jason.open-bio.org/Bioperl_Tutorials/Duke_2004/ BioperlProjects.pdf My recollection is we've answered some or all of these questions on the mailing list several times - Something like this gets you started though. http://www.google.com/search?q=site: bioperl.org+%2Bpipermail+%2Bbioperl-l+%2BCDS&ie=UTF-8&oe=UTF-8 We really need people to volunteer to help bioperl by writing up these questions and their solutions in the FAQ or in stand alone HOWTOs. (This is hopefully the part where those who don't feel qualified as "gurus" but want to help should be raising your hands...) -jason On Oct 12, 2004, at 10:03 AM, ??? wrote: > Dear Bioperl Guru: > > I'm Sang Chul Choi, a graduate student in the program of > bioinformatics at NCSU. > I'm interested in Protein Evolution Modeling and recently I should > apply a > model to all PDB entries. The problem is that I am stuck in getting > nucleotide > sequences of all related genomes for each PDB entry. > > There is "DBREF" section in PDB like this: > ./pdb1t7s.ent > DBREF 1T7S A 74 210 GB 17507755 NP_491893 74 210 > DBREF 1T7S B 74 210 GB 17507755 NP_491893 74 210 > ===================================================== > ./pdb1t9f.ent > DBREF 1T9F A 22 206 GB 17508635 NP_491320 22 206 > ===================================================== > ./pdb1tc3.ent > DBREF 1TC3 A 1 21 PDB 1TC3 1TC3 1 21 > DBREF 1TC3 B 101 120 PDB 1TC3 1TC3 101 120 > DBREF 1TC3 C 202 252 GB 1086778 P34257 2 52 > > And, I know that there is the source orgarnism section. > > Using these two kinds of information, I have tried to get nucleotide > sequences > from Database: NCBI, SWISSPROT, ... > > Is there any good suggestion for this thing? Any comment will be > helpful. > > Thanks, > > Sang Chul_______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l -- Jason Stajich jason.stajich at duke.edu http://www.duke.edu/~jes12/ -------------- next part -------------- A non-text attachment was scrubbed... Name: not available Type: text/enriched Size: 2621 bytes Desc: not available Url : http://portal.open-bio.org/pipermail/bioperl-l/attachments/20041012/756ff84a/attachment.bin From grossman at molgen.mpg.de Wed Oct 13 10:38:27 2004 From: grossman at molgen.mpg.de (Steffen Grossmann) Date: Wed Oct 13 11:05:54 2004 Subject: [Bioperl-l] patch for Bio::SeqFeature::Tools::IDHandler.pm Message-ID: <416D3DE3.4010104@molgen.mpg.de> Dear all, I came across a small bug in the Bio::SeqFeature::Tools::IDHandler.pm module, which can be corrected by the small patch shown below. Actually, $parent is only the ID of the feature, so it doesn't make sense to use the method 'add_SeqFeature' on it. The hash %sf_by_ID has been created before to map the IDs to the actual features. 195c195 < $parent->add_SeqFeature($_); --- > $sf_by_ID{$parent}->add_SeqFeature($_); Thanks! Steffen -- %---------------------------------------------% % Steffen Grossmann % % % % Max Planck Institute for Molecular Genetics % % Computational Molecular Biology % %---------------------------------------------% % Ihnestrasse 73 % % 14195 Berlin % % Germany % %---------------------------------------------% % Tel: (++49 +30) 8413-1167 % % Fax: (++49 +30) 8413-1152 % %---------------------------------------------% From jsun at utdallas.edu Wed Oct 13 12:48:04 2004 From: jsun at utdallas.edu (Sun, Jian) Date: Wed Oct 13 12:47:08 2004 Subject: [Bioperl-l] questions about run StandAloneBlast? Message-ID: Dear Jason; I noticed that you replyed many questions related to StandAloneBlast before, here I have get a problem too when I tried to run blast locally, hope you can help me. Below is the code I am testing: ......... use Bio::Tools::Run::StandAloneBlast; use strict; use warnings; my $filename = 'seqin.fasta'; my @params = ('database' => 'nr', 'outfile' => 'myblast.txt', 'program' => 'blastp', '_READMETHOD' => 'Blast'); my $factory = Bio::Tools::Run::StandAloneBlast->new(@params); my $seqio = Bio::SeqIO->new(-file => $filename, -format => 'Fasta' ); my $seqobj = $seqio->next_seq(); my $report = $factory->blastall($seqobj); ......... And I get the error message as: [NULL_Caption] WARING: >tr|Q6QDR2: Could not find index files for database \nr ------------EXCEPTION------------------------ MSG: blastall call crashed: 256 blastall.exe -p blastp -d "\nr" -i C:\DOCUME~1\...\.. -o myblast.txt STACK Bio::Tools::Run::StandAloneBlast::_runblast c:/perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:751 STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast c:/perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:698 STACK Bio::Tools::Run::StandAloneBlast::blastall c:/perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:553 STACK toplevel test91304.pl:29 ------------------------------------------------------------------------- The DIR I am working on is C:/program Files/Apache Group/Apache2/cgi-bin, so all my *.pl files, the download blastall.exe etc and database nr.fas are under this directory. Thanks for any help Jian From djkojeti at unity.ncsu.edu Wed Oct 13 13:05:17 2004 From: djkojeti at unity.ncsu.edu (Douglas Kojetin) Date: Wed Oct 13 13:04:22 2004 Subject: [Bioperl-l] acceptable PDB/structure formats In-Reply-To: <200410060319.i963JlKr022218@portal.open-bio.org> References: <200410060319.i963JlKr022218@portal.open-bio.org> Message-ID: <0ED2991C-1D3A-11D9-AEDD-000A9597278C@unity.ncsu.edu> Howdy All- I wanted to check one more time and see if anyone has any advice about using structure/PDB files that do not contain all the PDB-formatted headers. See the blurb pasted below (the error is from the following small-liner script, where the PDB/structure file was experimentally calculated from CNS/XPLOR, rather than downloaded from the actual 'PDB' protein data bank): #!/usr/bin/perl -w use Bio::Structure::IO; use strict; my $structio = Bio::Structure::IO->new(-format => 'pdb', -file => "file.pdb"); my $struc = $structio->next_structure; BioPython (using 'from Bio.PDB import *') has no problem reading my CNS/XPLOR structure files ... but I'd prefer to use BioPerl (since I'm more familiar with perl vs. python, although I could look at this as an opportunity to branching out ... but, graduation is close!) Are structure (PDB) files from the protein data bank, with the proper PDB formatting/headers, the only supported structure format? Thanks, Doug > I am seeing an error I believe is associated with the 'format' of my > PDB. It was created using CNS (format similar to XPLOR). When I try > to run the below script, I get an error as follows: > > % ./read_pdb.pl > out > > ------------- EXCEPTION ------------- > MSG: PDB stream with no HEADER. Not pdb in my book > STACK Bio::Structure::IO::pdb::next_structure > /sw/lib/perl5/Bio/Structure/IO/pdb.pm:138 > STACK toplevel ./read_pdb.pl:6 > > -------------------------------------- > > 1. Are CNS or XPLOR formats supported? > 2. Is there an easy way of quickly converting to a 'PDB' authentic > format? It looks like it just wants some header information. From jurgen.pletinckx at algonomics.com Wed Oct 13 13:54:39 2004 From: jurgen.pletinckx at algonomics.com (Jurgen Pletinckx) Date: Wed Oct 13 13:34:04 2004 Subject: [Bioperl-l] acceptable PDB/structure formats In-Reply-To: <0ED2991C-1D3A-11D9-AEDD-000A9597278C@unity.ncsu.edu> Message-ID: # Howdy All- # # I wanted to check one more time and see if anyone has any advice about # using structure/PDB files that do not contain all the PDB-formatted # headers. See the blurb pasted below (the error is from the following # small-liner script, where the PDB/structure file was experimentally # calculated from CNS/XPLOR, rather than downloaded from the actual 'PDB' # protein data bank): # # #!/usr/bin/perl -w # use Bio::Structure::IO; # use strict; # my $structio = Bio::Structure::IO->new(-format => 'pdb', -file => # "file.pdb"); # my $struc = $structio->next_structure; # # BioPython (using 'from Bio.PDB import *') has no problem reading my # CNS/XPLOR structure files ... but I'd prefer to use BioPerl (since I'm # more familiar with perl vs. python, although I could look at this as an # opportunity to branching out ... but, graduation is close!) # # Are structure (PDB) files from the protein data bank, with the proper # PDB formatting/headers, the only supported structure format? Currently, that's the case. Let's see. What are the options? - adding a HEADER line to your files - modifying /sw/lib/perl5/Bio/Structure/IO/pdb.pm. (Or adding a modified version to your library path @INC) Possible modifications include - removing these lines: $line =~ /^HEADER\s+\S+/ || $self->throw("PDB stream with no HEADER. Not pdb in my book"); my($header_line) = unpack "x10 a56", $line; $header{'header'} = $header_line; my($class, $depdate, $idcode) = unpack "x10 a40 a9 x3 a4", $line; $idcode =~ s/^\s*(\S+)\s*$/$1/; $struc->id($idcode); $self->debug("PBD c $class d $depdate id $idcode\n"); # XXX KB from pdb.pm, at line 139, or altering them to if ($line =~ /^HEADER\s+\S+/) { my($header_line) = unpack "x10 a56", $line; $header{'header'} = $header_line; my($class, $depdate, $idcode) = unpack "x10 a40 a9 x3 a4", $line; $idcode =~ s/^\s*(\S+)\s*$/$1/; $struc->id($idcode); $self->debug("PBD c $class d $depdate id $idcode\n"); # XXX KB } else { $self->debug("PDB stream with no HEADER. Not pdb in my book"); } Untested code - and anything that's not been tested is likely to have at least two typos in it :/ Note that, in this case, the id attribute of $struc has not been set - this may or may not be relevant. # > 1. Are CNS or XPLOR formats supported? # > 2. Is there an easy way of quickly converting to a 'PDB' authentic # > format? It looks like it just wants some header information. Only 'straight' PDB format. And the only thing it really needs is a HEADER line, as in HEADER ATTACHMENT PROTEIN 18-JAN-97 1AA0 Best, -- Jurgen Pletinckx AlgoNomics NV From amackey at pcbi.upenn.edu Wed Oct 13 13:55:10 2004 From: amackey at pcbi.upenn.edu (Aaron J. Mackey) Date: Wed Oct 13 13:54:14 2004 Subject: [Bioperl-l] patch for Bio::SeqFeature::Tools::IDHandler.pm In-Reply-To: <416D3DE3.4010104@molgen.mpg.de> References: <416D3DE3.4010104@molgen.mpg.de> Message-ID: <06D8BD61-1D41-11D9-8ACE-000D93392082@pcbi.upenn.edu> done, thanks! -Aaron On Oct 13, 2004, at 10:38 AM, Steffen Grossmann wrote: > Dear all, > > I came across a small bug in the Bio::SeqFeature::Tools::IDHandler.pm > module, which can be corrected by the small patch shown below. > Actually, $parent is only the ID of the feature, so it doesn't make > sense to use the method 'add_SeqFeature' on it. The hash %sf_by_ID has > been created before to map the IDs to the actual features. > > 195c195 > < $parent->add_SeqFeature($_); > --- > > $sf_by_ID{$parent}->add_SeqFeature($_); > > Thanks! > > Steffen > > -- > %---------------------------------------------% > % Steffen Grossmann % > % % > % Max Planck Institute for Molecular Genetics % > % Computational Molecular Biology % > %---------------------------------------------% > % Ihnestrasse 73 % > % 14195 Berlin % > % Germany % > %---------------------------------------------% > % Tel: (++49 +30) 8413-1167 % > % Fax: (++49 +30) 8413-1152 % > %---------------------------------------------% > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- Aaron J. Mackey, Ph.D. Dept. of Biology, Goddard 212 University of Pennsylvania email: amackey@pcbi.upenn.edu 415 S. University Avenue office: 215-898-1205 Philadelphia, PA 19104-6017 fax: 215-746-6697 From allenday at ucla.edu Wed Oct 13 13:59:30 2004 From: allenday at ucla.edu (Allen Day) Date: Wed Oct 13 13:58:33 2004 Subject: [Bioperl-l] Re: [SO-devel] GFF3 - Bioperl - SO In-Reply-To: <416BCB4A.8060303@molgen.mpg.de> References: <416A88AF.1020705@molgen.mpg.de> <416BCB4A.8060303@molgen.mpg.de> Message-ID: We should keep this onlist, others may be interested as well. On Tue, 12 Oct 2004, Steffen Grossmann wrote: > Dear Allen, > > I just had a look at your module and I think its a good start. I > immediately have a bunch of ideas how to extend it to get where I think > one should get to. So, I will accept your offer to work on the module > and apply for a bioperl developer's account. > > So here are the first proposals: > 1) Very easy: The 'official' GFF3 specification (you know where, don't > you?) states that after the ##FASTA directive there are no more Yes, I've written bits of it. > annotations to follow. So, although the ##FASTA directive is not yet > implemented, you should make sure that the rest of the file is not > parsed. At the moment you get back a nonsense-feature for every line > after the ##FASTA line. Good. Please add. > 2) Actually, it would be nice to be able to retrieve hierarchically > nested collections of features from a GFF-file, where the hierarchy > comes from the 'Parent' tag. The concept of parsing a GFF-file > line-by-line, is somehow not compatible with this, because it naturally > only can produce flat arrays of SeqFeatures. Possible workarounds are to > provide some 'unflattening'-mechanism (but where should it naturally > go?), or methods which directly retrieve an array holding the nested > SeqFeatures (which would be an extension to the standard 'next_feature' > approach). I strongly prefer the last option. You might want to take advantage of the ### directive here. Parse everything up to it and cache, then start returning hierarchical features from the cache. When the cache empties and the filehandle is still returning lines, fill the cache again. Rinse, repeat. > 3) Instead of requiring exact compatibility with SOFA, one could also > simply complain about non SOFA-compatible terms. Additionally, if one No, this violates the spec. If you want to do this you can give a ##Ontology directive to describe where the new terms came from. Feature type terms need to be SOFA extensions. > would have a mechanism to map non-SOFA terms to SOFA terms, the module > could be used to create SOFA compatible versions of existing GFF files > (which would be a great tool, I think!). You can do this via a callback mechanism to allow custom typemappings. Good idea. -Allen > These are some thoughts I have. I am not sure whether a discussion about > the future development of the module, should be conducted within the > Bioperl-l list, or whether we should do it privately and then only post > our proposals once we agree... > > Greetings! > > Steffen > > Allen Day wrote: > > >Look at Bio::FeatureIO::gff in bioperl-live. It currently supports > >lookup/validation of ontology terms via Bio::Ontology::OntologyStore, but > >doesn't do and cardinality or type/relation enforcement which you seem to > >be alluding to below. > > > >I'd be very pleased if you want to work on this too. Or anyone else on > >these lists, for that matter :-). > > > >-Allen > > > > > >On Mon, 11 Oct 2004, Steffen Grossmann wrote: > > > > > > > >>Dear all, > >> > >>I fancy very much the approach taken by SO(FA) > >>(http://song.sourceforge.net/) to standardize the vocabulary used for > >>sequence annotation. Also, the GFF3 format is a nice way to represent > >>SO-compatible annotations and it would be a great thing to have this all > >>working seamlessly with bioperl. > >> > >>A first step towards such a seamless integration into bioperl would be a > >>parser which is able to read/write hierarchically nested feature > >>collections from/to GFF3 files. Such a parser should make use of the > >>GFF3 specific 'ID' and 'Parent' tags. > >> > >>Of course, I know about the 'Bio::Tools::GFF' and > >>'Bio::SeqFeature::Tools' modules, where some related stuff can be found. > >>The problem is that the 'Bio::Tools::GFF' module doesn't respect the > >>'Parent' and 'ID' tag structure and grouping in the 'Unflattener' > >>approach is also done conceptually different. > >> > >>Does anybody know about whether there is someone working on such a > >>project? Or, if there is no such project, is someone interested in > >>joining to start it? > >> > >>Thanks in advance for any response! > >> > >>Steffen > >> > >> > >> > >> > >_______________________________________________ > >Bioperl-l mailing list > >Bioperl-l@portal.open-bio.org > >http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > > > > > > From jsun at utdallas.edu Wed Oct 13 14:05:33 2004 From: jsun at utdallas.edu (Sun, Jian) Date: Wed Oct 13 14:08:00 2004 Subject: [Bioperl-l] questions about run StandAloneBlast? Message-ID: Thanks a lot, Joel. I get it work fine now. Thanks a lot. Jian ________________________________ From: Joel Martin [mailto:j_martin@lbl.gov] Sent: Wed 10/13/2004 12:13 PM To: Sun, Jian Subject: Re: [Bioperl-l] questions about run StandAloneBlast? Hello, if your database is called nr.fas then you should call it "nr.fas" instead of "nr". Also you should have run formatdb on it so that you have files named nr.fas.psq etc... joel On Wed, Oct 13, 2004 at 11:48:04AM -0500, Sun, Jian wrote: > Dear Jason; > I noticed that you replyed many questions related to StandAloneBlast before, here I have get a problem too when I tried to run blast locally, hope you can help me. > Below is the code I am testing: > ......... > use Bio::Tools::Run::StandAloneBlast; > use strict; > use warnings; > > my $filename = 'seqin.fasta'; > my @params = ('database' => 'nr', > 'outfile' => 'myblast.txt', > 'program' => 'blastp', > '_READMETHOD' => 'Blast'); > my $factory = Bio::Tools::Run::StandAloneBlast->new(@params); > my $seqio = Bio::SeqIO->new(-file => $filename, > -format => 'Fasta' ); > my $seqobj = $seqio->next_seq(); > my $report = $factory->blastall($seqobj); > ......... > > And I get the error message as: > [NULL_Caption] WARING: >tr|Q6QDR2: Could not find index files for database \nr > ------------EXCEPTION------------------------ > MSG: blastall call crashed: 256 blastall.exe -p blastp -d "\nr" -i C:\DOCUME~1\...\.. -o myblast.txt > > STACK Bio::Tools::Run::StandAloneBlast::_runblast c:/perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:751 > STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast c:/perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:698 > STACK Bio::Tools::Run::StandAloneBlast::blastall c:/perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:553 > STACK toplevel test91304.pl:29 > ------------------------------------------------------------------------- > > The DIR I am working on is C:/program Files/Apache Group/Apache2/cgi-bin, so all my *.pl files, the download blastall.exe etc and database nr.fas are under this directory. > > Thanks for any help > Jian > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l From brian_osborne at cognia.com Thu Oct 14 08:45:59 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Thu Oct 14 08:45:14 2004 Subject: [Bioperl-l] questions about run StandAloneBlast? In-Reply-To: Message-ID: Jian, Did you create the index files for nr using formatdb? Brian O. -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Sun, Jian Sent: Wednesday, October 13, 2004 12:48 PM To: Jason Stajich Cc: bioperl Subject: [Bioperl-l] questions about run StandAloneBlast? Dear Jason; I noticed that you replyed many questions related to StandAloneBlast before, here I have get a problem too when I tried to run blast locally, hope you can help me. Below is the code I am testing: ......... use Bio::Tools::Run::StandAloneBlast; use strict; use warnings; my $filename = 'seqin.fasta'; my @params = ('database' => 'nr', 'outfile' => 'myblast.txt', 'program' => 'blastp', '_READMETHOD' => 'Blast'); my $factory = Bio::Tools::Run::StandAloneBlast->new(@params); my $seqio = Bio::SeqIO->new(-file => $filename, -format => 'Fasta' ); my $seqobj = $seqio->next_seq(); my $report = $factory->blastall($seqobj); ......... And I get the error message as: [NULL_Caption] WARING: >tr|Q6QDR2: Could not find index files for database \nr ------------EXCEPTION------------------------ MSG: blastall call crashed: 256 blastall.exe -p blastp -d "\nr" -i C:\DOCUME~1\...\.. -o myblast.txt STACK Bio::Tools::Run::StandAloneBlast::_runblast c:/perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:751 STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast c:/perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:698 STACK Bio::Tools::Run::StandAloneBlast::blastall c:/perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:553 STACK toplevel test91304.pl:29 ------------------------------------------------------------------------- The DIR I am working on is C:/program Files/Apache Group/Apache2/cgi-bin, so all my *.pl files, the download blastall.exe etc and database nr.fas are under this directory. Thanks for any help Jian _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l From zayed.albertyn at gmail.com Wed Oct 13 22:34:56 2004 From: zayed.albertyn at gmail.com (zayed albertyn) Date: Thu Oct 14 09:00:22 2004 Subject: [Bioperl-l] BLOSUM Matrix parser Message-ID: <81da19f3041013193446abc51f@mail.gmail.com> Good Day Bioperl Enthusiasts, I have been working with amino acid scoring matrices, most notably BLOSUM62, and I was interested in a parser for this matrix. Following the bioperl documentation I came across Bio::Matrix::Scoring which I could load successfully and parse matrix parameters. However, I was unable to actually get slices of the matrix data. As I understand it Bio::Matrix::Scoring is supposed to inherit from Bio::Matrix::Generic. If I load the module and initialize a new object as below: use Bio::Matrix::IO; use Bio::Matrix::MatrixI; my $matrixfile = shift; #BLOSUM62 scoring matrix my $parser = new Bio::Matrix::IO(-format => 'scoring', -file => $matrixfile); How do I use Bio::Matrix::Generic to get slices of the matrix e.g. the BLOSUM62 score for any two arbitrarily chosen amino acids? Thanks Zayed From jason.stajich at duke.edu Thu Oct 14 09:04:25 2004 From: jason.stajich at duke.edu (Jason Stajich) Date: Thu Oct 14 09:03:34 2004 Subject: [Bioperl-l] BLOSUM Matrix parser In-Reply-To: <81da19f3041013193446abc51f@mail.gmail.com> References: <81da19f3041013193446abc51f@mail.gmail.com> Message-ID: <9342B999-1DE1-11D9-BFD9-000393C44276@duke.edu> As it shows in the SYNOPSIS of Bio::Matrix::Generic. my $score = $matrix->get_entry('W', 'R'); On Oct 13, 2004, at 10:34 PM, zayed albertyn wrote: > Good Day Bioperl Enthusiasts, > > I have been working with amino acid scoring matrices, most notably > BLOSUM62, and I was interested in a parser for this matrix. > > Following the bioperl documentation I came across Bio::Matrix::Scoring > which I could load successfully and parse matrix parameters. However, > I was unable to actually get slices of the matrix data. As I > understand it Bio::Matrix::Scoring is supposed to inherit from > Bio::Matrix::Generic. If I load the module and initialize a new object > as below: > > use Bio::Matrix::IO; > use Bio::Matrix::MatrixI; > > my $matrixfile = shift; #BLOSUM62 scoring matrix > > my $parser = new Bio::Matrix::IO(-format => 'scoring', > -file => $matrixfile); > > > How do I use Bio::Matrix::Generic to get slices of the matrix e.g. the > BLOSUM62 score for any two arbitrarily chosen amino acids? > > > Thanks > Zayed > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- Jason Stajich jason.stajich at duke.edu http://www.duke.edu/~jes12/ From Marc.Logghe at devgen.com Thu Oct 14 09:38:32 2004 From: Marc.Logghe at devgen.com (Marc Logghe) Date: Thu Oct 14 09:38:09 2004 Subject: [Bioperl-l] questions about run StandAloneBlast? Message-ID: Hi, the call mentioned in the error was "blastall.exe -p blastp -d "\nr" -i" The database name does not look healthy to me. Don't know whether this is just the error message displaying it like this, or whether it is actually called. In the latter case it will fail for sure. Guess it is a bug in case the param database => 'nr' is translated into -d "\nr" But Brian is right, first check out whether your database is indexed, blastall does not take a plain fastafile (eg your nr.fa is not recognized !!!). Try fastacmd -d -I to find out. Also take care that in case you don't use the full path for your database, blast will look for it relative to the BLASTDB directory. Adjust the environment $BLASTDB if needed. HTH, Marc > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: Thursday, October 14, 2004 2:46 PM > To: Sun, Jian; Jason Stajich > Cc: bioperl > Subject: RE: [Bioperl-l] questions about run StandAloneBlast? > > > Jian, > > Did you create the index files for nr using formatdb? > > Brian O. > > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Sun, Jian > Sent: Wednesday, October 13, 2004 12:48 PM > To: Jason Stajich > Cc: bioperl > Subject: [Bioperl-l] questions about run StandAloneBlast? > > Dear Jason; > I noticed that you replyed many questions related to > StandAloneBlast > before, here I have get a problem too when I tried to run > blast locally, > hope you can help me. > Below is the code I am testing: > ......... > use Bio::Tools::Run::StandAloneBlast; > use strict; > use warnings; > > my $filename = 'seqin.fasta'; > my @params = ('database' => 'nr', > 'outfile' => 'myblast.txt', > 'program' => 'blastp', > '_READMETHOD' => 'Blast'); > my $factory = Bio::Tools::Run::StandAloneBlast->new(@params); > my $seqio = Bio::SeqIO->new(-file => $filename, > -format => 'Fasta' ); > my $seqobj = $seqio->next_seq(); > my $report = $factory->blastall($seqobj); > ......... > > And I get the error message as: > [NULL_Caption] WARING: >tr|Q6QDR2: Could not find index files > for database > \nr > ------------EXCEPTION------------------------ > MSG: blastall call crashed: 256 blastall.exe -p blastp -d "\nr" -i > C:\DOCUME~1\...\.. -o myblast.txt > > STACK Bio::Tools::Run::StandAloneBlast::_runblast > c:/perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:751 > STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast > c:/perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:698 > STACK Bio::Tools::Run::StandAloneBlast::blastall > c:/perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:553 > STACK toplevel test91304.pl:29 > -------------------------------------------------------------- > ----------- > > The DIR I am working on is C:/program Files/Apache > Group/Apache2/cgi-bin, so > all my *.pl files, the download blastall.exe etc and database > nr.fas are > under this directory. > > Thanks for any help > Jian > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > From brian_osborne at cognia.com Thu Oct 14 10:25:54 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Thu Oct 14 10:24:59 2004 Subject: [Bioperl-l] acceptable PDB/structure formats In-Reply-To: <0ED2991C-1D3A-11D9-AEDD-000A9597278C@unity.ncsu.edu> Message-ID: Doug, You could also ask this group if they'd mind your creating a new Structure::IO module for this CNS/XPLOR format and adding it to Bioperl. There's only 2 ways of looking at this, either the HEADER (or headers) is required in PDB format, thus CNS/XPLOR format is not PDB format and you could write a new module, or the HEADER (or headers) is not required in PDB format so the existing module should not be throwing this fatal exception. BIO -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Douglas Kojetin Sent: Wednesday, October 13, 2004 1:05 PM To: bioperl-l@portal.open-bio.org Subject: [Bioperl-l] acceptable PDB/structure formats Howdy All- I wanted to check one more time and see if anyone has any advice about using structure/PDB files that do not contain all the PDB-formatted headers. See the blurb pasted below (the error is from the following small-liner script, where the PDB/structure file was experimentally calculated from CNS/XPLOR, rather than downloaded from the actual 'PDB' protein data bank): #!/usr/bin/perl -w use Bio::Structure::IO; use strict; my $structio = Bio::Structure::IO->new(-format => 'pdb', -file => "file.pdb"); my $struc = $structio->next_structure; BioPython (using 'from Bio.PDB import *') has no problem reading my CNS/XPLOR structure files ... but I'd prefer to use BioPerl (since I'm more familiar with perl vs. python, although I could look at this as an opportunity to branching out ... but, graduation is close!) Are structure (PDB) files from the protein data bank, with the proper PDB formatting/headers, the only supported structure format? Thanks, Doug > I am seeing an error I believe is associated with the 'format' of my > PDB. It was created using CNS (format similar to XPLOR). When I try > to run the below script, I get an error as follows: > > % ./read_pdb.pl > out > > ------------- EXCEPTION ------------- > MSG: PDB stream with no HEADER. Not pdb in my book > STACK Bio::Structure::IO::pdb::next_structure > /sw/lib/perl5/Bio/Structure/IO/pdb.pm:138 > STACK toplevel ./read_pdb.pl:6 > > -------------------------------------- > > 1. Are CNS or XPLOR formats supported? > 2. Is there an easy way of quickly converting to a 'PDB' authentic > format? It looks like it just wants some header information. _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l From djkojeti at unity.ncsu.edu Thu Oct 14 11:22:21 2004 From: djkojeti at unity.ncsu.edu (Douglas Kojetin) Date: Thu Oct 14 11:21:28 2004 Subject: [Bioperl-l] acceptable PDB/structure formats In-Reply-To: References: Message-ID: Hi Brian- Good suggestion on creating a new module-- I think this may be long-term goal, but in the immediate future (I need to do some analysis quickly) I'll probably use a work around. I tried to created a dummy header in my CNS/XPLOR structure file, but I'm seeing the following error after trying to read it: % ./read_pdb.pl Use of uninitialized value in pattern match (m//) at /sw/lib/perl5/Bio/Structure/IO/pdb.pm line 453, line 4268. ... and I'm not sure what's going on there. Any clues? I think I lean more towards your second notion that the HEADER is not necessarily required for the structure format -- which might be different from the actual PDB (database) format. A structure file, consisting only of coordinates, would represent a 'barebones' file. Many other programs/databases have individual headers: - CNS/XPLOR (x-ray and NMR) structure files actually can have a user-defined header with information/statistics about the structure calculation - MODELLER, a modeling program, creates structure files with a unique header - CYANA/DYANA (NMR structure calculations) also creates structure files with a unique header - files written from structural analysis programs such as MOLMOL or PyMOL ... and I'm sure the list goes on and on for formats I am unfamiliar with (AMBER, etc.). What all of these formats do have in common, although their headers differ, is the coordinate lines (I believe) all start with 'ATOM' -- so it shouldn't be a problem to write a structure module to first be compatible with all structure files, and second add specificity/complexity/additional features for individual formats (such as the 'PDB' format, so that information in the header if present can be extracted). Thanks again for the input, Doug On Oct 14, 2004, at 10:25 AM, Brian Osborne wrote: > Doug, > > You could also ask this group if they'd mind your creating a new > Structure::IO module for this CNS/XPLOR format and adding it to > Bioperl. > There's only 2 ways of looking at this, either the HEADER (or headers) > is > required in PDB format, thus CNS/XPLOR format is not PDB format and you > could write a new module, or the HEADER (or headers) is not required > in PDB > format so the existing module should not be throwing this fatal > exception. > > BIO > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Douglas > Kojetin > Sent: Wednesday, October 13, 2004 1:05 PM > To: bioperl-l@portal.open-bio.org > Subject: [Bioperl-l] acceptable PDB/structure formats > > Howdy All- > > I wanted to check one more time and see if anyone has any advice about > using structure/PDB files that do not contain all the PDB-formatted > headers. See the blurb pasted below (the error is from the following > small-liner script, where the PDB/structure file was experimentally > calculated from CNS/XPLOR, rather than downloaded from the actual 'PDB' > protein data bank): > > #!/usr/bin/perl -w > use Bio::Structure::IO; > use strict; > my $structio = Bio::Structure::IO->new(-format => 'pdb', -file => > "file.pdb"); > my $struc = $structio->next_structure; > > BioPython (using 'from Bio.PDB import *') has no problem reading my > CNS/XPLOR structure files ... but I'd prefer to use BioPerl (since I'm > more familiar with perl vs. python, although I could look at this as an > opportunity to branching out ... but, graduation is close!) > > Are structure (PDB) files from the protein data bank, with the proper > PDB formatting/headers, the only supported structure format? > > Thanks, > Doug > > >> I am seeing an error I believe is associated with the 'format' of my >> PDB. It was created using CNS (format similar to XPLOR). When I try >> to run the below script, I get an error as follows: >> >> % ./read_pdb.pl > out >> >> ------------- EXCEPTION ------------- >> MSG: PDB stream with no HEADER. Not pdb in my book >> STACK Bio::Structure::IO::pdb::next_structure >> /sw/lib/perl5/Bio/Structure/IO/pdb.pm:138 >> STACK toplevel ./read_pdb.pl:6 >> >> -------------------------------------- >> >> 1. Are CNS or XPLOR formats supported? >> 2. Is there an easy way of quickly converting to a 'PDB' authentic >> format? It looks like it just wants some header information. > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > From jsun at utdallas.edu Thu Oct 14 11:27:26 2004 From: jsun at utdallas.edu (Sun, Jian) Date: Thu Oct 14 11:31:07 2004 Subject: [Bioperl-l] RE: problem solved !- questions about run StandAloneBlast? Message-ID: Dear All; Thank you all very much. I have solved the problem following Joel Martin's advice and I changed the database's name as nr.fas. And it works fine now. Thanks all again Jian ________________________________ From: Marc Logghe [mailto:Marc.Logghe@devgen.com] Sent: Thu 10/14/2004 8:38 AM To: Brian Osborne; Sun, Jian; Jason Stajich Cc: bioperl Subject: RE: [Bioperl-l] questions about run StandAloneBlast? Hi, the call mentioned in the error was "blastall.exe -p blastp -d "\nr" -i" The database name does not look healthy to me. Don't know whether this is just the error message displaying it like this, or whether it is actually called. In the latter case it will fail for sure. Guess it is a bug in case the param database => 'nr' is translated into -d "\nr" But Brian is right, first check out whether your database is indexed, blastall does not take a plain fastafile (eg your nr.fa is not recognized !!!). Try fastacmd -d -I to find out. Also take care that in case you don't use the full path for your database, blast will look for it relative to the BLASTDB directory. Adjust the environment $BLASTDB if needed. HTH, Marc > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: Thursday, October 14, 2004 2:46 PM > To: Sun, Jian; Jason Stajich > Cc: bioperl > Subject: RE: [Bioperl-l] questions about run StandAloneBlast? > > > Jian, > > Did you create the index files for nr using formatdb? > > Brian O. > > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Sun, Jian > Sent: Wednesday, October 13, 2004 12:48 PM > To: Jason Stajich > Cc: bioperl > Subject: [Bioperl-l] questions about run StandAloneBlast? > > Dear Jason; > I noticed that you replyed many questions related to > StandAloneBlast > before, here I have get a problem too when I tried to run > blast locally, > hope you can help me. > Below is the code I am testing: > ......... > use Bio::Tools::Run::StandAloneBlast; > use strict; > use warnings; > > my $filename = 'seqin.fasta'; > my @params = ('database' => 'nr', > 'outfile' => 'myblast.txt', > 'program' => 'blastp', > '_READMETHOD' => 'Blast'); > my $factory = Bio::Tools::Run::StandAloneBlast->new(@params); > my $seqio = Bio::SeqIO->new(-file => $filename, > -format => 'Fasta' ); > my $seqobj = $seqio->next_seq(); > my $report = $factory->blastall($seqobj); > ......... > > And I get the error message as: > [NULL_Caption] WARING: >tr|Q6QDR2: Could not find index files > for database > \nr > ------------EXCEPTION------------------------ > MSG: blastall call crashed: 256 blastall.exe -p blastp -d "\nr" -i > C:\DOCUME~1\...\.. -o myblast.txt > > STACK Bio::Tools::Run::StandAloneBlast::_runblast > c:/perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:751 > STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast > c:/perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:698 > STACK Bio::Tools::Run::StandAloneBlast::blastall > c:/perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:553 > STACK toplevel test91304.pl:29 > -------------------------------------------------------------- > ----------- > > The DIR I am working on is C:/program Files/Apache > Group/Apache2/cgi-bin, so > all my *.pl files, the download blastall.exe etc and database > nr.fas are > under this directory. > > Thanks for any help > Jian > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > From allenday at ucla.edu Thu Oct 14 13:05:09 2004 From: allenday at ucla.edu (Allen Day) Date: Thu Oct 14 13:04:13 2004 Subject: [Bioperl-l] Re: [SO-devel] GFF3 - Bioperl - SO In-Reply-To: <416EA051.7050308@molgen.mpg.de> References: <416A88AF.1020705@molgen.mpg.de> <416BCB4A.8060303@molgen.mpg.de> <416EA051.7050308@molgen.mpg.de> Message-ID: On Thu, 14 Oct 2004, Steffen Grossmann wrote: > Dear Allen, > > I meanwhile understood that Bio::Tools::GFF in connection with > Bio::SeqFeature::Tools::IDHandler is doing a lot of the stuff I'd like > to have. Somehow, Bio::FeatureIO::gff seems to be a parallel development > to the first alternative. I don't know in how far there are plans to I don't see from a quick look at the source how Bio::Tools::GFF is related to Bio::SeqFeature::Tools::IDHandler. There's nothing preventing use of the IDHandler in Bio::FeatureIO::gff, in fact it sounds like what you've proposed to add so part of your work is already done. > bring the two approaches together, but at the moment that seems to be > more complicated than just bringing one approach to an acceptable state. > Since the Bio::Tools::GFF approach seems to be ahead, I will focus on it > at the moment. I would advise against adding more features into Bio::Tools::GFF. I can't speak for all others, but my future development will not use it, and I'm in the process of converting code which does use it to depend on Bio::FeatureIO::gff. -Allen > > Nevertheless, I add a small patch which fixes the problem with making > features from the lines after the ##FASTA directive. > > --- patch for Bio::FeatureIO::gff.pm starts here > 251a252,255 > > while( my $gff_string = $self->_readline() ) { > > # we just consume the rest of the file... > > } > > > --- patch ends here > > Maybe you can add it, because I am not a bioperl developer yet... > > Steffen > > Allen Day wrote: > > >We should keep this onlist, others may be interested as well. > > > >On Tue, 12 Oct 2004, Steffen Grossmann wrote: > > > > > > > >>Dear Allen, > >> > >>I just had a look at your module and I think its a good start. I > >>immediately have a bunch of ideas how to extend it to get where I think > >>one should get to. So, I will accept your offer to work on the module > >>and apply for a bioperl developer's account. > >> > >>So here are the first proposals: > >>1) Very easy: The 'official' GFF3 specification (you know where, don't > >>you?) states that after the ##FASTA directive there are no more > >> > >> > > > >Yes, I've written bits of it. > > > > > > > >>annotations to follow. So, although the ##FASTA directive is not yet > >>implemented, you should make sure that the rest of the file is not > >>parsed. At the moment you get back a nonsense-feature for every line > >>after the ##FASTA line. > >> > >> > > > >Good. Please add. > > > > > > > >>2) Actually, it would be nice to be able to retrieve hierarchically > >>nested collections of features from a GFF-file, where the hierarchy > >>comes from the 'Parent' tag. The concept of parsing a GFF-file > >>line-by-line, is somehow not compatible with this, because it naturally > >>only can produce flat arrays of SeqFeatures. Possible workarounds are to > >>provide some 'unflattening'-mechanism (but where should it naturally > >>go?), or methods which directly retrieve an array holding the nested > >>SeqFeatures (which would be an extension to the standard 'next_feature' > >>approach). I strongly prefer the last option. > >> > >> > > > >You might want to take advantage of the ### directive here. Parse > >everything up to it and cache, then start returning hierarchical features > >from the cache. When the cache empties and the filehandle is still > >returning lines, fill the cache again. Rinse, repeat. > > > > > > > >>3) Instead of requiring exact compatibility with SOFA, one could also > >>simply complain about non SOFA-compatible terms. Additionally, if one > >> > >> > > > >No, this violates the spec. If you want to do this you can give a > >##Ontology directive to describe where the new terms came from. Feature > >type terms need to be SOFA extensions. > > > > > > > >>would have a mechanism to map non-SOFA terms to SOFA terms, the module > >>could be used to create SOFA compatible versions of existing GFF files > >>(which would be a great tool, I think!). > >> > >> > > > >You can do this via a callback mechanism to allow custom typemappings. > >Good idea. > > > >-Allen > > > > > > > >>These are some thoughts I have. I am not sure whether a discussion about > >>the future development of the module, should be conducted within the > >>Bioperl-l list, or whether we should do it privately and then only post > >>our proposals once we agree... > >> > >>Greetings! > >> > >>Steffen > >> > >>Allen Day wrote: > >> > >> > >> > >>>Look at Bio::FeatureIO::gff in bioperl-live. It currently supports > >>>lookup/validation of ontology terms via Bio::Ontology::OntologyStore, but > >>>doesn't do and cardinality or type/relation enforcement which you seem to > >>>be alluding to below. > >>> > >>>I'd be very pleased if you want to work on this too. Or anyone else on > >>>these lists, for that matter :-). > >>> > >>>-Allen > >>> > >>> > >>>On Mon, 11 Oct 2004, Steffen Grossmann wrote: > >>> > >>> > >>> > >>> > >>> > >>>>Dear all, > >>>> > >>>>I fancy very much the approach taken by SO(FA) > >>>>(http://song.sourceforge.net/) to standardize the vocabulary used for > >>>>sequence annotation. Also, the GFF3 format is a nice way to represent > >>>>SO-compatible annotations and it would be a great thing to have this all > >>>>working seamlessly with bioperl. > >>>> > >>>>A first step towards such a seamless integration into bioperl would be a > >>>>parser which is able to read/write hierarchically nested feature > >>>>collections from/to GFF3 files. Such a parser should make use of the > >>>>GFF3 specific 'ID' and 'Parent' tags. > >>>> > >>>>Of course, I know about the 'Bio::Tools::GFF' and > >>>>'Bio::SeqFeature::Tools' modules, where some related stuff can be found. > >>>>The problem is that the 'Bio::Tools::GFF' module doesn't respect the > >>>>'Parent' and 'ID' tag structure and grouping in the 'Unflattener' > >>>>approach is also done conceptually different. > >>>> > >>>>Does anybody know about whether there is someone working on such a > >>>>project? Or, if there is no such project, is someone interested in > >>>>joining to start it? > >>>> > >>>>Thanks in advance for any response! > >>>> > >>>>Steffen > >>>> > >>>> > >>>> > >>>> > >>>> > >>>> > >>>_______________________________________________ > >>>Bioperl-l mailing list > >>>Bioperl-l@portal.open-bio.org > >>>http://portal.open-bio.org/mailman/listinfo/bioperl-l > >>> > >>> > >>> > >>> > >>> > >> > >> > >> > >_______________________________________________ > >Bioperl-l mailing list > >Bioperl-l@portal.open-bio.org > >http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > > > > > > From gvd at redpoll.pharmacy.ualberta.ca Thu Oct 14 13:00:15 2004 From: gvd at redpoll.pharmacy.ualberta.ca (Gary) Date: Thu Oct 14 13:10:27 2004 Subject: [Bioperl-l] acceptable PDB/structure formats In-Reply-To: Message-ID: Hey Guys, I had this problem as well. I used the same workaround as you (prepending the file with a HEADER line). My recollection is that the header line needs to be pretty strictly formatted. This header string works for me: my $header = "HEADER DEFAULT CLASSIFICATION 24-JAN-70 XXXX\n"; Perhaps it will serve your purposes as well. Regards, g. -- Gary Van Domselaar, PhD. Postdoctoral Fellow, Computing Science and Biological Sciences University of Alberta Edmonton, AB, Canada Phone: 780-492-5969 On Thu, 14 Oct 2004, Douglas Kojetin wrote: > Hi Brian- > > Good suggestion on creating a new module-- I think this may be > long-term goal, but in the immediate future (I need to do some analysis > quickly) I'll probably use a work around. I tried to created a dummy > header in my CNS/XPLOR structure file, but I'm seeing the following > error after trying to read it: > > % ./read_pdb.pl > Use of uninitialized value in pattern match (m//) at > /sw/lib/perl5/Bio/Structure/IO/pdb.pm line 453, line 4268. > > ... and I'm not sure what's going on there. Any clues? > > I think I lean more towards your second notion that the HEADER is not > necessarily required for the structure format -- which might be > different from the actual PDB (database) format. A structure file, > consisting only of coordinates, would represent a 'barebones' file. > Many other programs/databases have individual headers: > > - CNS/XPLOR (x-ray and NMR) structure files actually can have a > user-defined header with information/statistics about the structure > calculation > - MODELLER, a modeling program, creates structure files with a unique > header > - CYANA/DYANA (NMR structure calculations) also creates structure files > with a unique header > - files written from structural analysis programs such as MOLMOL or > PyMOL > > ... and I'm sure the list goes on and on for formats I am unfamiliar > with (AMBER, etc.). > > What all of these formats do have in common, although their headers > differ, is the coordinate lines (I believe) all start with 'ATOM' -- so > it shouldn't be a problem to write a structure module to first be > compatible with all structure files, and second add > specificity/complexity/additional features for individual formats (such > as the 'PDB' format, so that information in the header if present can > be extracted). > > Thanks again for the input, > Doug > > > On Oct 14, 2004, at 10:25 AM, Brian Osborne wrote: > > > Doug, > > > > You could also ask this group if they'd mind your creating a new > > Structure::IO module for this CNS/XPLOR format and adding it to > > Bioperl. > > There's only 2 ways of looking at this, either the HEADER (or headers) > > is > > required in PDB format, thus CNS/XPLOR format is not PDB format and you > > could write a new module, or the HEADER (or headers) is not required > > in PDB > > format so the existing module should not be throwing this fatal > > exception. > > > > BIO > > > > -----Original Message----- > > From: bioperl-l-bounces@portal.open-bio.org > > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Douglas > > Kojetin > > Sent: Wednesday, October 13, 2004 1:05 PM > > To: bioperl-l@portal.open-bio.org > > Subject: [Bioperl-l] acceptable PDB/structure formats > > > > Howdy All- > > > > I wanted to check one more time and see if anyone has any advice about > > using structure/PDB files that do not contain all the PDB-formatted > > headers. See the blurb pasted below (the error is from the following > > small-liner script, where the PDB/structure file was experimentally > > calculated from CNS/XPLOR, rather than downloaded from the actual 'PDB' > > protein data bank): > > > > #!/usr/bin/perl -w > > use Bio::Structure::IO; > > use strict; > > my $structio = Bio::Structure::IO->new(-format => 'pdb', -file => > > "file.pdb"); > > my $struc = $structio->next_structure; > > > > BioPython (using 'from Bio.PDB import *') has no problem reading my > > CNS/XPLOR structure files ... but I'd prefer to use BioPerl (since I'm > > more familiar with perl vs. python, although I could look at this as an > > opportunity to branching out ... but, graduation is close!) > > > > Are structure (PDB) files from the protein data bank, with the proper > > PDB formatting/headers, the only supported structure format? > > > > Thanks, > > Doug > > > > > >> I am seeing an error I believe is associated with the 'format' of my > >> PDB. It was created using CNS (format similar to XPLOR). When I try > >> to run the below script, I get an error as follows: > >> > >> % ./read_pdb.pl > out > >> > >> ------------- EXCEPTION ------------- > >> MSG: PDB stream with no HEADER. Not pdb in my book > >> STACK Bio::Structure::IO::pdb::next_structure > >> /sw/lib/perl5/Bio/Structure/IO/pdb.pm:138 > >> STACK toplevel ./read_pdb.pl:6 > >> > >> -------------------------------------- > >> > >> 1. Are CNS or XPLOR formats supported? > >> 2. Is there an easy way of quickly converting to a 'PDB' authentic > >> format? It looks like it just wants some header information. > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l@portal.open-bio.org > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > From amackey at pcbi.upenn.edu Thu Oct 14 13:29:54 2004 From: amackey at pcbi.upenn.edu (Aaron J. Mackey) Date: Thu Oct 14 13:28:56 2004 Subject: [Bioperl-l] Re: [SO-devel] GFF3 - Bioperl - SO In-Reply-To: References: <416A88AF.1020705@molgen.mpg.de> <416BCB4A.8060303@molgen.mpg.de> <416EA051.7050308@molgen.mpg.de> Message-ID: On Oct 14, 2004, at 1:05 PM, Allen Day wrote: > I would advise against adding more features into Bio::Tools::GFF. I > can't > speak for all others, but my future development will not use it, and > I'm > in the process of converting code which does use it to depend on > Bio::FeatureIO::gff. I would concur with Allen that "features" have gained enough status in the bioperl world to warrant their own namespace; thus, Bio::Tools::GFF should be refactored into Bio::FeatureIO::gff, and we might (eventually) deprecate Bio::Tools::GFF I expect. Having made many trips through Bio::Tools::GFF, I know what an ugly hack it has become to be; in reality, it'll probably remain, if only to support older GFF variants. Vive la GFF3! (and FeatureIO!) But if you have desperate patches to put into Bio::Tools::GFF while FeatureIO stabilizes, feel free. We had a similar situation with Bio::Tools::Blast and Bio::SearchIO; the transition may be rocky, but it's worth it in the end. -Aaron From djkojeti at unity.ncsu.edu Thu Oct 14 13:49:17 2004 From: djkojeti at unity.ncsu.edu (Douglas Kojetin) Date: Thu Oct 14 13:48:20 2004 Subject: [Bioperl-l] acceptable PDB/structure formats In-Reply-To: References: Message-ID: <5ED05FC0-1E09-11D9-B71C-000A9597278C@unity.ncsu.edu> Thanks Gary- This header and the one I created still give errors (although different than when I do not have a header at all). # no header: ------------- EXCEPTION ------------- MSG: PDB stream with no HEADER. Not pdb in my book STACK Bio::Structure::IO::pdb::next_structure /sw/lib/perl5/Bio/Structure/IO/pdb.pm:138 STACK toplevel ./read_pdb.pl:21 # either one of the headers: Use of uninitialized value in pattern match (m//) at /sw/lib/perl5/Bio/Structure/IO/pdb.pm line 453, line 4196. I beginning to wonder if it's a problem with the atom nomenclature. There are documented differences between XPLOR/CNS and PDB nomenclature (and a few other formats as well). See this link for details: http://www.bmrb.wisc.edu/ref_info/atom_nom.tbl I realize it could be a semi-quick conversion, but it's getting more complex than I need at the moment ... I'll probably just learn some basic python and use BioPython for the moment since it appears to work with the different formats (or at least has not reported any errors yet). Thanks again for the input, and I'll try to make some contributions once finish my project(s) and graduate! Doug On Oct 14, 2004, at 1:00 PM, Gary wrote: > Hey Guys, > > I had this problem as well. I used the same workaround as you > (prepending > the file with a HEADER line). My recollection is that the header line > needs to be pretty strictly formatted. This header string works for > me: > my $header = "HEADER DEFAULT CLASSIFICATION > 24-JAN-70 XXXX\n"; From basu at pharm.sunysb.edu Thu Oct 14 14:51:00 2004 From: basu at pharm.sunysb.edu (Siddhartha Basu) Date: Thu Oct 14 14:53:20 2004 Subject: [Bioperl-l] problem with swissprot parsin Message-ID: <416ECA94.8020104@pharm.sunysb.edu> Hi, I have already described this problem in this mailing list but haven't got anybodies attention yet. I had also asked the author of this module but nothing back yet. Anyway i really could'nt figure out how to solve this and so i am writing again. I have also tried by replacing the swiss.pm module from the bioperl-live version. But the problem persists. I understand that this is a maintained module and i am not getting ignored because of maintenance issue. I am trying to make a flat file index of swissprot/trembl files using Bio::DB::Flat module. However, i am getting the following consistent warnings during the indexing process. ====================================================================== Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18676877. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18676916. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18676956. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677002. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677045. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677091. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677136. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677178. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677209. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677249. ======================================================================== Though, the indexing get completed, i could'nt fetch any data from there as it does not return any seq obj. I also get the same warnings when i try to read the swissprot file using the Bio::SeqIO module. I am using bioperl-1.4 and understand it has something to do with the swissprot parser in Seq::IO module. So, does any fix or solution available for this problem. Thanks in advance. -siddhartha From brian_osborne at cognia.com Thu Oct 14 15:30:01 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Thu Oct 14 15:29:10 2004 Subject: [Bioperl-l] problem with swissprot parsin In-Reply-To: <416ECA94.8020104@pharm.sunysb.edu> Message-ID: Siddhartha, Bio::DB::Flat::BinarySearch or Bio::DB::Flat::BDB? Also, please show your code when you ask a question, it simplifies matters. For example, it would tell me which module you used, which file format, and so on. It also helps to attach the actual sequence files, or some smaller test file that shows the same error. What happens occasionally is that a question will get ignored for the simple reason that no one knows how to answer, there's not enough information given in the letter. Brian O. -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Siddhartha Basu Sent: Thursday, October 14, 2004 2:51 PM To: bioperl-l@bioperl.org Subject: [Bioperl-l] problem with swissprot parsin Hi, I have already described this problem in this mailing list but haven't got anybodies attention yet. I had also asked the author of this module but nothing back yet. Anyway i really could'nt figure out how to solve this and so i am writing again. I have also tried by replacing the swiss.pm module from the bioperl-live version. But the problem persists. I understand that this is a maintained module and i am not getting ignored because of maintenance issue. I am trying to make a flat file index of swissprot/trembl files using Bio::DB::Flat module. However, i am getting the following consistent warnings during the indexing process. ====================================================================== Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18676877. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18676916. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18676956. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677002. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677045. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677091. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677136. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677178. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677209. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677249. ======================================================================== Though, the indexing get completed, i could'nt fetch any data from there as it does not return any seq obj. I also get the same warnings when i try to read the swissprot file using the Bio::SeqIO module. I am using bioperl-1.4 and understand it has something to do with the swissprot parser in Seq::IO module. So, does any fix or solution available for this problem. Thanks in advance. -siddhartha _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l From amackey at pcbi.upenn.edu Thu Oct 14 16:26:33 2004 From: amackey at pcbi.upenn.edu (Aaron J. Mackey) Date: Thu Oct 14 16:25:37 2004 Subject: [Bioperl-l] make test!! Message-ID: <5712C9C6-1E1F-11D9-AF00-000A9577009E@pcbi.upenn.edu> I've had only a very few people send me feedback about the current state of bioperl-live "make test" on your favorite old/crotchety/obscure platforms. I'm writing the Change log and thinking about branching, but I'm an experimentalist, I need data! Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure you have everything, "make distclean" if you've built from the cvs checkout before, and start from scratch with the usual litany: perl Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. Setting BIOPERLDEBUG is very noisy, but it's the end result I care about, not so much all the verbiage (unless there's specific verbiage related to the end result ...) Thanks, -Aaron From basu at pharm.sunysb.edu Thu Oct 14 16:53:37 2004 From: basu at pharm.sunysb.edu (Siddhartha Basu) Date: Thu Oct 14 16:55:55 2004 Subject: [Bioperl-l] problem with swissprot parsin In-Reply-To: References: Message-ID: <416EE751.9060600@pharm.sunysb.edu> Hi Brian, Changed it, problem persists. -siddhartha Brian Osborne wrote: > Siddhartha, > > Change @files to @ARGV in the build_index line. Does that fix it? > > Brian O. > > -----Original Message----- > From: Siddhartha Basu [mailto:basu@pharm.sunysb.edu] > Sent: Thursday, October 14, 2004 4:15 PM > To: Brian Osborne > Cc: bioperl-l@bioperl.org > Subject: Re: [Bioperl-l] problem with swissprot parsin > > Hi Brian, > Here is the code that started to give the following error. I presume i > am using Bio::DB::Flat::BDB though i haven't called it directly. I am > trying to index swissprot/trembl files here. > > #!/usr/bin/perl -w > use strict; > use Bio::DB::Flat; > > die "no files\n" unless @ARGV; > my $LOCATION = "/home/basu/odbaindex"; > > my $db = Bio::DB::Flat->new( -directory => $LOCATION, > -dbname => "swissall", > -format => "swiss", > -index => "bdb", > -write_flag => 1, > ) or die "can't create BioFlat indexes\n"; > $db->build_index(@files); > print "Done indexing\n"; > > exit; > > > I get the following warinings. > ====================================================================== > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18676877. > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18676916. > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18676956. > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18677002. > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > ========================================================================= > > I have done a small test with Bio::SeqIO module using a small test > file(swiss.test). Here is the code. > > #!/usr/bin/perl -w > # > use strict; > use Bio::SeqIO; > > my $seq = Bio::SeqIO->new(-file => $ARGV[0], -format => "swiss"); > > while (my $in = $seq->next_seq) { > print $in->id,"\n"; > } > > exit; > > > It gives the same error > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 28. > 1433_CAEEL > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 87. > A4_CAEEL > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 171. > AATC_CAEEL > > I have also attached the test file. > > Hope this will give some clue for the problem. > Thanks for the response. > > siddhartha > > > > Brian Osborne wrote: > >>Siddhartha, >> >>Bio::DB::Flat::BinarySearch or Bio::DB::Flat::BDB? Also, please show your >>code when you ask a question, it simplifies matters. For example, it would >>tell me which module you used, which file format, and so on. It also helps >>to attach the actual sequence files, or some smaller test file that shows >>the same error. What happens occasionally is that a question will get >>ignored for the simple reason that no one knows how to answer, there's not >>enough information given in the letter. >> >>Brian O. >> >>-----Original Message----- >>From: bioperl-l-bounces@portal.open-bio.org >>[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Siddhartha Basu >>Sent: Thursday, October 14, 2004 2:51 PM >>To: bioperl-l@bioperl.org >>Subject: [Bioperl-l] problem with swissprot parsin >> >>Hi, >>I have already described this problem in this mailing list but haven't >>got anybodies attention yet. I had also asked the author of this module >>but nothing back yet. Anyway i really could'nt figure out how to solve >>this and so i am writing again. I have also tried by replacing the >>swiss.pm module from the bioperl-live version. But the problem persists. >>I understand that this is a maintained module and i am not getting >>ignored because of maintenance issue. >> >>I am trying to make a flat file index of swissprot/trembl files using >>Bio::DB::Flat module. However, i am getting the following consistent >>warnings during the indexing process. >>====================================================================== >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18676877. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18676916. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18676956. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18677002. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18677045. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18677091. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18677136. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18677178. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18677209. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18677249. >>======================================================================== >>Though, the indexing get completed, i could'nt fetch any data from there >> as it does not return any seq obj. >>I also get the same warnings when i try to read the swissprot file using >>the Bio::SeqIO module. >>I am using bioperl-1.4 and understand it has something to do with the >>swissprot parser in Seq::IO module. >>So, does any fix or solution available for this problem. >> >>Thanks in advance. >> >>-siddhartha >>_______________________________________________ >>Bioperl-l mailing list >>Bioperl-l@portal.open-bio.org >>http://portal.open-bio.org/mailman/listinfo/bioperl-l >> >> > > > From popgen23 at mac.com Thu Oct 14 18:05:57 2004 From: popgen23 at mac.com (Michael Robeson) Date: Thu Oct 14 18:05:01 2004 Subject: [Bioperl-l] counting gaps in sequence data Message-ID: <39BB5AA7-1E2D-11D9-A84B-000393539070@mac.com> I have a set of data that looks something like the following: >human acgtt---cgatacg---acgact-----t >chimp acgtacgatac---actgca---ac >mouse acgata---acgatcg----acgt I am having trouble setting up a hash etc., to count the number and types of continuous gaps. For example the 'human' sequence above has 2 sets of 3 gaps and 1 set of 5 gaps. The 'chimp' has 2 sets of 3 gaps and finally the 'mouse' has 1 set of 3 gaps and 1 set of 4 gaps. So, I am having trouble being able to assign a dynamic variable (i.e. gap length) and place that in a pattern match so that it can count how many gaps of that length are in that particular sequence. I know how to set up a hash to count the number of times a gap appears: '$gaptype{$gap}++' or something. The problem is: what is the best way (and how) can I set '$gap' to be dynamic. I need to know the length of each consecutive string of gaps. I know how to count the gaps by using the 'tr' function. But it gets confusing when I need to add counts to every instance of that gap length. I also need to know the position of each gap (denoted by the position of the first gap in that particular instance). I know that I can use the 'pos()' command for this. So, my problem is that I think I know some of the bits of code to put into place the problem is I am getting lost on how to structure it all together. For now I am just trying to get my output to look like this: Human number of 3 base pair gaps: 2 at positions: 6, 16 number of 5 base pair gaps: 1 at positions: 25 Chimp .... and so on ... So, any suggestions would be greatly appreciated. If anyone can help me out with all or even just bits of this I would greatly appreciate it. This should help me get started on some more advanced parsing I need to do after this. I like to try and figure things out on my own if I can, so even pseudo code would be of great help! -Thanks -Mike From mcipriano at mbl.edu Thu Oct 14 19:11:26 2004 From: mcipriano at mbl.edu (Michael Cipriano) Date: Thu Oct 14 19:10:51 2004 Subject: [Bioperl-l] counting gaps in sequence data In-Reply-To: <39BB5AA7-1E2D-11D9-A84B-000393539070@mac.com> References: <39BB5AA7-1E2D-11D9-A84B-000393539070@mac.com> Message-ID: <416F079E.9020606@mbl.edu> I don't know if this is the best way, but it is a way, though it won't get you the exact positions. If your sequence was a continuous string with no new lines or anything,; (Can also be an array of sequences, etc, but simplifying it for the example) my $human_sequence = "acgtt---cgatacg---acgact-----t ";; my (@gaps) = $human_sequence =~ /(\-+)/g; my %gap_lengths; foreach my $gap_seq (@gaps) { $gap_lengths{length($gap_seq}); } while(my ($key, $val) = each(%gap_lengths)) { print "$val gaps of length $key\n"; } As an aside, you can also get the locations now that I think of it. if you do my @match_coords; while($human_seqence =~ /(\-+)/g) { $gap_lengths{length($gap_seq}); # You can get the end of the position of the last match with (the last dash in the continuous string of dashes) # You can subtract the length of the match +1 to get the position of the first match also. push(@match_coords(pos($human_sequence)); } Basicaly I think you can see here what you can do. if you want the gap positions stored differently you can do that, so you can figure out how big the gap is at any position, etc. Hope this helps Michael Cipriano Michael Robeson wrote: > I have a set of data that looks something like the following: > > >human > acgtt---cgatacg---acgact-----t > >chimp > acgtacgatac---actgca---ac > >mouse > acgata---acgatcg----acgt > > I am having trouble setting up a hash etc., to count the number and > types of continuous gaps. For example the 'human' sequence above has 2 > sets of 3 gaps and 1 set of 5 gaps. The 'chimp' has 2 sets of 3 gaps > and finally the 'mouse' has 1 set of 3 gaps and 1 set of 4 gaps. > > So, I am having trouble being able to assign a dynamic variable (i.e. > gap length) and place that in a pattern match so that it can count how > many gaps of that length are in that particular sequence. I know how > to set up a hash to count the number of times a gap appears: > '$gaptype{$gap}++' or something. The problem is: what is the best way > (and how) can I set '$gap' to be dynamic. > > I need to know the length of each consecutive string of gaps. I know > how to count the gaps by using the 'tr' function. But it gets > confusing when I need to add counts to every instance of that gap > length. I also need to know the position of each gap (denoted by the > position of the first gap in that particular instance). I know that I > can use the 'pos()' command for this. > > So, my problem is that I think I know some of the bits of code to put > into place the problem is I am getting lost on how to structure it all > together. For now I am just trying to get my output to look like this: > > Human > number of 3 base pair gaps: 2 > at positions: 6, 16 > number of 5 base pair gaps: 1 > at positions: 25 > > Chimp > .... and so on ... > > So, any suggestions would be greatly appreciated. If anyone can help > me out with all or even just bits of this I would greatly appreciate > it. This should help me get started on some more advanced parsing I > need to do after this. I like to try and figure things out on my own > if I can, so even pseudo code would be of great help! > > -Thanks > -Mike > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l From bioperlanand at yahoo.com Thu Oct 14 19:13:08 2004 From: bioperlanand at yahoo.com (Anand Venkatraman) Date: Thu Oct 14 19:12:15 2004 Subject: [Bioperl-l] parsing SwissProt records -- need help Message-ID: <20041014231308.15819.qmail@web61109.mail.yahoo.com> HI, I am new to Bioperl and I am using it to parse data from SwissProt Records. I am trying to get all the accession numbers from the SwissProt file. I am facing problems when I have more than 1 accession number in 1 line - like for example ------------------------- AC P15456; Q9SAW0; ------------------------- Sometimes they might go on for two lines as seen here ---------------------------------------------------------- ID 1A26_HUMAN STANDARD; PRT; 365 AA. AC P30450; O02963; O78073; P79563; Q30208; Q31623; Q95377; Q9BD15; AC Q9BD19; Q9MW42; Q9TQK5; ---------------------------------------------------------- I tried this bit of code, but it only gives me the 1st accession number it finds - P15456 from the 1st example - but I want to get both P15646 and Q9SAW0; ------------------------------------------------------------------ use strict; use Bio::SeqIO; my $sp_file = shift @ARGV or die$!; my $seqio_object = Bio::SeqIO->new(-file => $sp_file, -format => "swiss"); while (my $seq_object = $seqio_object->next_seq) { print "Accession: ",$seq_object->accession_number(), "\n"; } ------------------------------------------------------------------ Is there a way around? Thanks in advance. Anand __________________________________________________ Do You Yahoo!? Tired of spam? Yahoo! Mail has the best spam protection around http://mail.yahoo.com From bioperlanand at yahoo.com Thu Oct 14 19:25:18 2004 From: bioperlanand at yahoo.com (Anand Venkatraman) Date: Thu Oct 14 19:24:17 2004 Subject: [Bioperl-l] problem parsing SwissProt Records Message-ID: <20041014232518.90568.qmail@web61101.mail.yahoo.com> Hi Suddartha, I think this problem occurs because of: [a] In your SwissProt Record, if you look around line (say 10-20 lines before) 18676877, you would find that there should be a line that should have started with RA, but in some records, it starts with RG. And this is because of the SwissProt or UniProt file format, if RG comes then RA doesn't and vice-versa. A note on the abbreviations RA : Reference authors RG: Reference group And as regards the complaints, when there is no RA annotation, then the script doen't find something that gets stored in the "$au" variable of the "swiss.pm" module. Hope it helps. Anand -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Siddhartha Basu Sent: Thursday, October 14, 2004 2:51 PM To: bioperl-l@bioperl.org Subject: [Bioperl-l] problem with swissprot parsin Hi, I have already described this problem in this mailing list but haven't got anybodies attention yet. I had also asked the author of this module but nothing back yet. Anyway i really could'nt figure out how to solve this and so i am writing again. I have also tried by replacing the swiss.pm module from the bioperl-live version. But the problem persists. I understand that this is a maintained module and i am not getting ignored because of maintenance issue. I am trying to make a flat file index of swissprot/trembl files using Bio::DB::Flat module. However, i am getting the following consistent warnings during the indexing process. ====================================================================== Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18676877. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18676916. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18676956. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677002. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677045. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677091. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677136. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677178. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677209. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677249. ======================================================================== Though, the indexing get completed, i could'nt fetch any data from there as it does not return any seq obj. I also get the same warnings when i try to read the swissprot file using the Bio::SeqIO module. I am using bioperl-1.4 and understand it has something to do with the swissprot parser in Seq::IO module. So, does any fix or solution available for this problem. Thanks in advance. -siddhartha _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l _______________________________ Do you Yahoo!? Declare Yourself - Register online to vote today! http://vote.yahoo.com From barry.moore at genetics.utah.edu Thu Oct 14 19:32:20 2004 From: barry.moore at genetics.utah.edu (Barry Moore) Date: Thu Oct 14 19:31:20 2004 Subject: [Bioperl-l] counting gaps in sequence data In-Reply-To: <39BB5AA7-1E2D-11D9-A84B-000393539070@mac.com> References: <39BB5AA7-1E2D-11D9-A84B-000393539070@mac.com> Message-ID: <416F0C84.8080401@genetics.utah.edu> Mike- Something like this maybe? use strict; use warnings; my %seqs = (human => "acgtt---cgatacg---acgact-----t", chimp => "acgtacgatac---actgca---ac", mouse => "acgata---acgatcg----acgt"); for my $seq (keys %seqs) { # An array of your sequences print "\n\nThe $seq sequence has the following gaps:\n"; my %gaptype; for my $gap (1..5) { # 5 or however large you want gaps to be counted while ($seqs{$seq} =~ /[atgc]-{$gap}[atgc]/g) { #notice that this won't catch terminal gaps #This creates a hash of arrays. The arrays hold the locations of the #gaps, and the count of each gaptype is determined by the length of that array. push @{$gaptype{$gap}}, $-[0] + 2; } if (defined @{$gaptype{$gap}}) { my $positions = join ", ", @{$gaptype{$gap}}; print "\tGap length $gap begining at positions:\t$positions\n"; } } } Barry Moore Michael Robeson wrote: > I have a set of data that looks something like the following: > > >human > acgtt---cgatacg---acgact-----t > >chimp > acgtacgatac---actgca---ac > >mouse > acgata---acgatcg----acgt > > I am having trouble setting up a hash etc., to count the number and > types of continuous gaps. For example the 'human' sequence above has 2 > sets of 3 gaps and 1 set of 5 gaps. The 'chimp' has 2 sets of 3 gaps > and finally the 'mouse' has 1 set of 3 gaps and 1 set of 4 gaps. > > So, I am having trouble being able to assign a dynamic variable (i.e. > gap length) and place that in a pattern match so that it can count how > many gaps of that length are in that particular sequence. I know how > to set up a hash to count the number of times a gap appears: > '$gaptype{$gap}++' or something. The problem is: what is the best way > (and how) can I set '$gap' to be dynamic. > > I need to know the length of each consecutive string of gaps. I know > how to count the gaps by using the 'tr' function. But it gets > confusing when I need to add counts to every instance of that gap > length. I also need to know the position of each gap (denoted by the > position of the first gap in that particular instance). I know that I > can use the 'pos()' command for this. > > So, my problem is that I think I know some of the bits of code to put > into place the problem is I am getting lost on how to structure it all > together. For now I am just trying to get my output to look like this: > > Human > number of 3 base pair gaps: 2 > at positions: 6, 16 > number of 5 base pair gaps: 1 > at positions: 25 > > Chimp > .... and so on ... > > So, any suggestions would be greatly appreciated. If anyone can help > me out with all or even just bits of this I would greatly appreciate > it. This should help me get started on some more advanced parsing I > need to do after this. I like to try and figure things out on my own > if I can, so even pseudo code would be of great help! > > -Thanks > -Mike > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l -- Barry Moore Dept. of Human Genetics University of Utah Salt Lake City, UT From goshng at naver.com Fri Oct 15 00:28:45 2004 From: goshng at naver.com (Sang Chul Choi) Date: Fri Oct 15 00:27:47 2004 Subject: [Bioperl-l] It seems a bug: Bio/SeqFeatureI.pm? Message-ID: <416F51FD.000001.23642@nhn428> Dear Friends: In the file Bio/SeqFeatureI.pm, there seems a small bug which should be fixed. I tried to used the method of Seq Object called spliced_seq(). But, when I have Bioperl parse the line like complement(join(2352..2759,2809..3015)) It just complements each fragment and then joins them together. And, I have a strange translated protein. So, I changed the order of operation, and it works. # This is dumb, subseq should work on locations... if( $loc->strand == 1 ) { $seqstr .= $called_seq->subseq($loc->start,$loc->end); } else { #$seqstr = $called_seq->trunc($loc->start,$loc->end)->revcom->seq() . $seqstr; $seqstr .= $called_seq->trunc($loc->start,$loc->end)->revcom->seq(); } Thanks, Sang Chul From popgen23 at mac.com Fri Oct 15 00:55:34 2004 From: popgen23 at mac.com (Michael S. Robeson II) Date: Fri Oct 15 00:54:43 2004 Subject: [Bioperl-l] counting gaps in sequence data In-Reply-To: <416F0C84.8080401@genetics.utah.edu> References: <39BB5AA7-1E2D-11D9-A84B-000393539070@mac.com> <416F0C84.8080401@genetics.utah.edu> Message-ID: <72C1AD26-1E66-11D9-9BA0-000A956C4C82@mac.com> Wow, that seems to work pretty well. However, I am unsure of what the following line means: push @{$gaptype{$gap}}, $-[0] + 2; Especially the " $-[0] + 2" part of it. I understand that it is an array but what is going on there is a little vague. Other than that I pretty much understand the code. Also, about the part not being able to match gaps at the end of a string will be a problem. I am currently working off of what you've posted and seeing if I can fit (using a character class I suppose) a "\Z", "\z", or "$" to match any gaps at the end of a line. -Cheers! -Mike On Oct 14, 2004, at 17:32, Barry Moore wrote: > Mike- > > Something like this maybe? > > use strict; > use warnings; > > my %seqs = (human => "acgtt---cgatacg---acgact-----t", > chimp => "acgtacgatac---actgca---ac", > mouse => "acgata---acgatcg----acgt"); > > for my $seq (keys %seqs) { # An array of your sequences > print "\n\nThe $seq sequence has the following gaps:\n"; > my %gaptype; > for my $gap (1..5) { # 5 or however large you want gaps to be counted > while ($seqs{$seq} =~ /[atgc]-{$gap}[atgc]/g) { #notice that this > won't catch terminal gaps > #This creates a hash of arrays. The arrays hold the locations of > the > #gaps, and the count of each gaptype is determined by the length > of that array. > push @{$gaptype{$gap}}, $-[0] + 2; > } > if (defined @{$gaptype{$gap}}) { > my $positions = join ", ", @{$gaptype{$gap}}; > print "\tGap length $gap begining at positions:\t$positions\n"; > } > } > } > > Barry Moore > > > Michael Robeson wrote: From brian_osborne at cognia.com Fri Oct 15 08:25:11 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Fri Oct 15 08:24:17 2004 Subject: [Bioperl-l] problem with swissprot parsin In-Reply-To: <416EE751.9060600@pharm.sunysb.edu> Message-ID: Siddhartha, Changing @files to @ARGV makes your script index without warnings on my machine, using your Swissprot file or mine. It also retrieves a sequence. Below... Brian O. #!/usr/bin/perl -w use strict; use Bio::DB::Flat; die "no files\n" unless @ARGV; my $LOCATION = "."; my $db = Bio::DB::Flat->new( -directory => $LOCATION, -dbname => "swissall", -format => "swiss", -index => "bdb", -write_flag => 1, ) or die "can't create BioFlat indexes\n"; $db->build_index(@ARGV); print "Done indexing\n"; my $seq = $db->get_Seq_by_acc("P41932"); print $seq->seq; -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Siddhartha Basu Sent: Thursday, October 14, 2004 4:54 PM To: Brian Osborne Cc: bioperl-l@bioperl.org Subject: Re: [Bioperl-l] problem with swissprot parsin Hi Brian, Changed it, problem persists. -siddhartha Brian Osborne wrote: > Siddhartha, > > Change @files to @ARGV in the build_index line. Does that fix it? > > Brian O. > > -----Original Message----- > From: Siddhartha Basu [mailto:basu@pharm.sunysb.edu] > Sent: Thursday, October 14, 2004 4:15 PM > To: Brian Osborne > Cc: bioperl-l@bioperl.org > Subject: Re: [Bioperl-l] problem with swissprot parsin > > Hi Brian, > Here is the code that started to give the following error. I presume i > am using Bio::DB::Flat::BDB though i haven't called it directly. I am > trying to index swissprot/trembl files here. > > #!/usr/bin/perl -w > use strict; > use Bio::DB::Flat; > > die "no files\n" unless @ARGV; > my $LOCATION = "/home/basu/odbaindex"; > > my $db = Bio::DB::Flat->new( -directory => $LOCATION, > -dbname => "swissall", > -format => "swiss", > -index => "bdb", > -write_flag => 1, > ) or die "can't create BioFlat indexes\n"; > $db->build_index(@files); > print "Done indexing\n"; > > exit; > > > I get the following warinings. > ====================================================================== > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18676877. > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18676916. > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18676956. > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18677002. > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > ========================================================================= > > I have done a small test with Bio::SeqIO module using a small test > file(swiss.test). Here is the code. > > #!/usr/bin/perl -w > # > use strict; > use Bio::SeqIO; > > my $seq = Bio::SeqIO->new(-file => $ARGV[0], -format => "swiss"); > > while (my $in = $seq->next_seq) { > print $in->id,"\n"; > } > > exit; > > > It gives the same error > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 28. > 1433_CAEEL > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 87. > A4_CAEEL > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 171. > AATC_CAEEL > > I have also attached the test file. > > Hope this will give some clue for the problem. > Thanks for the response. > > siddhartha > > > > Brian Osborne wrote: > >>Siddhartha, >> >>Bio::DB::Flat::BinarySearch or Bio::DB::Flat::BDB? Also, please show your >>code when you ask a question, it simplifies matters. For example, it would >>tell me which module you used, which file format, and so on. It also helps >>to attach the actual sequence files, or some smaller test file that shows >>the same error. What happens occasionally is that a question will get >>ignored for the simple reason that no one knows how to answer, there's not >>enough information given in the letter. >> >>Brian O. >> >>-----Original Message----- >>From: bioperl-l-bounces@portal.open-bio.org >>[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Siddhartha Basu >>Sent: Thursday, October 14, 2004 2:51 PM >>To: bioperl-l@bioperl.org >>Subject: [Bioperl-l] problem with swissprot parsin >> >>Hi, >>I have already described this problem in this mailing list but haven't >>got anybodies attention yet. I had also asked the author of this module >>but nothing back yet. Anyway i really could'nt figure out how to solve >>this and so i am writing again. I have also tried by replacing the >>swiss.pm module from the bioperl-live version. But the problem persists. >>I understand that this is a maintained module and i am not getting >>ignored because of maintenance issue. >> >>I am trying to make a flat file index of swissprot/trembl files using >>Bio::DB::Flat module. However, i am getting the following consistent >>warnings during the indexing process. >>====================================================================== >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18676877. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18676916. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18676956. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18677002. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18677045. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18677091. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18677136. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18677178. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18677209. >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>18677249. >>======================================================================== >>Though, the indexing get completed, i could'nt fetch any data from there >> as it does not return any seq obj. >>I also get the same warnings when i try to read the swissprot file using >>the Bio::SeqIO module. >>I am using bioperl-1.4 and understand it has something to do with the >>swissprot parser in Seq::IO module. >>So, does any fix or solution available for this problem. >> >>Thanks in advance. >> >>-siddhartha >>_______________________________________________ >>Bioperl-l mailing list >>Bioperl-l@portal.open-bio.org >>http://portal.open-bio.org/mailman/listinfo/bioperl-l >> >> > > > _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l From brian_osborne at cognia.com Fri Oct 15 09:50:45 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Fri Oct 15 09:49:44 2004 Subject: [Bioperl-l] make test!! In-Reply-To: <5712C9C6-1E1F-11D9-AF00-000A9577009E@pcbi.upenn.edu> Message-ID: Aaron, ~/bioperl-live>uname -a CYGWIN_NT-5.0 Cognia-bosborne 1.5.10(0.116/4/2) 2004-05-25 22:07 i686 unknown unknown Cygwin ~/bioperl-live>make test All tests successful, 5 subtests skipped. Files=192, Tests=8597, 553 wallclock secs (277.62 cusr + 68.52 csys = 346.14 CPU) Obscure? Perhaps. But neither old nor crotchety! Brian O. -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Aaron J. Mackey Sent: Thursday, October 14, 2004 4:27 PM To: Bioperl Subject: [Bioperl-l] make test!! I've had only a very few people send me feedback about the current state of bioperl-live "make test" on your favorite old/crotchety/obscure platforms. I'm writing the Change log and thinking about branching, but I'm an experimentalist, I need data! Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure you have everything, "make distclean" if you've built from the cvs checkout before, and start from scratch with the usual litany: perl Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. Setting BIOPERLDEBUG is very noisy, but it's the end result I care about, not so much all the verbiage (unless there's specific verbiage related to the end result ...) Thanks, -Aaron _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l From basu at pharm.sunysb.edu Fri Oct 15 09:55:16 2004 From: basu at pharm.sunysb.edu (Siddhartha Basu) Date: Fri Oct 15 09:57:34 2004 Subject: [Bioperl-l] problem with swissprot parsin In-Reply-To: References: Message-ID: <416FD6C4.3080305@pharm.sunysb.edu> Hi Brian, I retested it again. The good part is that i can fetch the seq obj and the sequence now. The warnings are still there. I will try to index the entire swissprot data file and see what happens. Now,as mentioned by one of the earlier mail in the list that it has to with the absence of RA records in recent swissprot files and the swiss.pm modules spewing out warnings when the variable $au is not getting the data. Since you are even getting the warnings what version of bioperl you are running. -siddhartha Brian Osborne wrote: > Siddhartha, > > Changing @files to @ARGV makes your script index without warnings on my > machine, using your Swissprot file or mine. It also retrieves a sequence. > Below... > > Brian O. > > > #!/usr/bin/perl -w > > use strict; > use Bio::DB::Flat; > > die "no files\n" unless @ARGV; > my $LOCATION = "."; > > my $db = Bio::DB::Flat->new( -directory => $LOCATION, > -dbname => "swissall", > -format => "swiss", > -index => "bdb", > -write_flag => 1, > ) or die "can't create BioFlat indexes\n"; > > $db->build_index(@ARGV); > print "Done indexing\n"; > > my $seq = $db->get_Seq_by_acc("P41932"); > print $seq->seq; > > > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Siddhartha Basu > Sent: Thursday, October 14, 2004 4:54 PM > To: Brian Osborne > Cc: bioperl-l@bioperl.org > Subject: Re: [Bioperl-l] problem with swissprot parsin > > Hi Brian, > Changed it, problem persists. > > -siddhartha > > Brian Osborne wrote: > >>Siddhartha, >> >>Change @files to @ARGV in the build_index line. Does that fix it? >> >>Brian O. >> >>-----Original Message----- >>From: Siddhartha Basu [mailto:basu@pharm.sunysb.edu] >>Sent: Thursday, October 14, 2004 4:15 PM >>To: Brian Osborne >>Cc: bioperl-l@bioperl.org >>Subject: Re: [Bioperl-l] problem with swissprot parsin >> >>Hi Brian, >>Here is the code that started to give the following error. I presume i >>am using Bio::DB::Flat::BDB though i haven't called it directly. I am >>trying to index swissprot/trembl files here. >> >>#!/usr/bin/perl -w >>use strict; >>use Bio::DB::Flat; >> >>die "no files\n" unless @ARGV; >>my $LOCATION = "/home/basu/odbaindex"; >> >>my $db = Bio::DB::Flat->new( -directory => $LOCATION, >> -dbname => "swissall", >> -format => "swiss", >> -index => "bdb", >> -write_flag => 1, >> ) or die "can't create BioFlat indexes\n"; >>$db->build_index(@files); >>print "Done indexing\n"; >> >>exit; >> >> >>I get the following warinings. >> ====================================================================== >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >> 18676877. >> Use of uninitialized value in substitution (s///) at >> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >> 18676916. >> Use of uninitialized value in substitution (s///) at >> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >> 18676956. >> Use of uninitialized value in substitution (s///) at >> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >> 18677002. >> Use of uninitialized value in substitution (s///) at >> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>========================================================================= >> >>I have done a small test with Bio::SeqIO module using a small test >>file(swiss.test). Here is the code. >> >>#!/usr/bin/perl -w >># >>use strict; >>use Bio::SeqIO; >> >>my $seq = Bio::SeqIO->new(-file => $ARGV[0], -format => "swiss"); >> >>while (my $in = $seq->next_seq) { >> print $in->id,"\n"; >>} >> >>exit; >> >> >>It gives the same error >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > > 28. > >>1433_CAEEL >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > > 87. > >>A4_CAEEL >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > > 171. > >>AATC_CAEEL >> >>I have also attached the test file. >> >>Hope this will give some clue for the problem. >>Thanks for the response. >> >>siddhartha >> >> >> >>Brian Osborne wrote: >> >> >>>Siddhartha, >>> >>>Bio::DB::Flat::BinarySearch or Bio::DB::Flat::BDB? Also, please show your >>>code when you ask a question, it simplifies matters. For example, it would >>>tell me which module you used, which file format, and so on. It also helps >>>to attach the actual sequence files, or some smaller test file that shows >>>the same error. What happens occasionally is that a question will get >>>ignored for the simple reason that no one knows how to answer, there's not >>>enough information given in the letter. >>> >>>Brian O. >>> >>>-----Original Message----- >>>From: bioperl-l-bounces@portal.open-bio.org >>>[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Siddhartha Basu >>>Sent: Thursday, October 14, 2004 2:51 PM >>>To: bioperl-l@bioperl.org >>>Subject: [Bioperl-l] problem with swissprot parsin >>> >>>Hi, >>>I have already described this problem in this mailing list but haven't >>>got anybodies attention yet. I had also asked the author of this module >>>but nothing back yet. Anyway i really could'nt figure out how to solve >>>this and so i am writing again. I have also tried by replacing the >>>swiss.pm module from the bioperl-live version. But the problem persists. >>>I understand that this is a maintained module and i am not getting >>>ignored because of maintenance issue. >>> >>>I am trying to make a flat file index of swissprot/trembl files using >>>Bio::DB::Flat module. However, i am getting the following consistent >>>warnings during the indexing process. >>>====================================================================== >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18676877. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18676916. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18676956. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18677002. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18677045. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18677091. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18677136. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18677178. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18677209. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18677249. >>>======================================================================== >>>Though, the indexing get completed, i could'nt fetch any data from there >>> as it does not return any seq obj. >>>I also get the same warnings when i try to read the swissprot file using >>>the Bio::SeqIO module. >>>I am using bioperl-1.4 and understand it has something to do with the >>>swissprot parser in Seq::IO module. >>>So, does any fix or solution available for this problem. >>> >>>Thanks in advance. >>> >>>-siddhartha >>>_______________________________________________ >>>Bioperl-l mailing list >>>Bioperl-l@portal.open-bio.org >>>http://portal.open-bio.org/mailman/listinfo/bioperl-l >>> >>> >> >> >> > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > From chenn at cshl.edu Fri Oct 15 10:04:40 2004 From: chenn at cshl.edu (Jack Chen) Date: Fri Oct 15 10:03:41 2004 Subject: [Bioperl-l] problems with the Bio::Tools::Run::Genewise module In-Reply-To: Message-ID: Hi, Keith, Jason et al., I need you help with this module. I am trying to run genewise and parse genewise result using the module. The simple script I wrote did not work as expected. While I could get the exon coordinates correctly, I could not retrieve sequence data properly, ie, transcript() does not return a sequence. When I ran the program on command line, I could get correct sequences. Any insight is appreciated. Jack ============ > #!/usr/bin/perl -w > use strict; > use Getopt::Long; > use Bio::SeqIO; > use Bio::Tools::Run::Genewise; > use Data::Dumper; > > my ($hmmfile, $gen); > GetOptions('hmm|h:s' => \$hmmfile, > 'genomic|g:s'=> \$gen); > > my $genomic_seq = Bio::SeqIO->new(-file => $gen, -format => 'FASTA'); > my $factory = Bio::Tools::Run::Genewise->new('both' => 1, 'silent' => 1); > > $factory->hmmer(1); > my @genes = $factory->run($hmmfile, $genomic_seq->next_seq); > > for my $g (@genes){ > my @transcripts = $g->transcripts(); > for my $tran (@transcripts){ > print $tran->cds, "\n"; > } > } From brian_osborne at cognia.com Fri Oct 15 10:07:40 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Fri Oct 15 10:09:03 2004 Subject: [Bioperl-l] problem with swissprot parsin In-Reply-To: <416FD6C4.3080305@pharm.sunysb.edu> Message-ID: Siddhartha, bioperl-live, the latest. Instructions on how to download this are at http://cvs.open-bio.org/. Brian O. -----Original Message----- From: Siddhartha Basu [mailto:basu@pharm.sunysb.edu] Sent: Friday, October 15, 2004 9:55 AM To: Brian Osborne Cc: bioperl-l@bioperl.org Subject: Re: [Bioperl-l] problem with swissprot parsin Hi Brian, I retested it again. The good part is that i can fetch the seq obj and the sequence now. The warnings are still there. I will try to index the entire swissprot data file and see what happens. Now,as mentioned by one of the earlier mail in the list that it has to with the absence of RA records in recent swissprot files and the swiss.pm modules spewing out warnings when the variable $au is not getting the data. Since you are even getting the warnings what version of bioperl you are running. -siddhartha Brian Osborne wrote: > Siddhartha, > > Changing @files to @ARGV makes your script index without warnings on my > machine, using your Swissprot file or mine. It also retrieves a sequence. > Below... > > Brian O. > > > #!/usr/bin/perl -w > > use strict; > use Bio::DB::Flat; > > die "no files\n" unless @ARGV; > my $LOCATION = "."; > > my $db = Bio::DB::Flat->new( -directory => $LOCATION, > -d bname => "swissall", > -f ormat => "swiss", > -i ndex => "bdb", > -w rite_flag => 1, > ) or die "can't create BioFlat indexes\n"; > > $db->build_index(@ARGV); > print "Done indexing\n"; > > my $seq = $db->get_Seq_by_acc("P41932"); > print $seq->seq; > > > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Siddhartha Basu > Sent: Thursday, October 14, 2004 4:54 PM > To: Brian Osborne > Cc: bioperl-l@bioperl.org > Subject: Re: [Bioperl-l] problem with swissprot parsin > > Hi Brian, > Changed it, problem persists. > > -siddhartha > > Brian Osborne wrote: > >>Siddhartha, >> >>Change @files to @ARGV in the build_index line. Does that fix it? >> >>Brian O. >> >>-----Original Message----- >>From: Siddhartha Basu [mailto:basu@pharm.sunysb.edu] >>Sent: Thursday, October 14, 2004 4:15 PM >>To: Brian Osborne >>Cc: bioperl-l@bioperl.org >>Subject: Re: [Bioperl-l] problem with swissprot parsin >> >>Hi Brian, >>Here is the code that started to give the following error. I presume i >>am using Bio::DB::Flat::BDB though i haven't called it directly. I am >>trying to index swissprot/trembl files here. >> >>#!/usr/bin/perl -w >>use strict; >>use Bio::DB::Flat; >> >>die "no files\n" unless @ARGV; >>my $LOCATION = "/home/basu/odbaindex"; >> >>my $db = Bio::DB::Flat->new( -directory => $LOCATION, >> -dbname => "swissall", >> -format => "swiss", >> -index => "bdb", >> -write_flag => 1, >> ) or die "can't create BioFlat indexes\n"; >>$db->build_index(@files); >>print "Done indexing\n"; >> >>exit; >> >> >>I get the following warinings. >> ====================================================================== >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >> 18676877. >> Use of uninitialized value in substitution (s///) at >> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >> 18676916. >> Use of uninitialized value in substitution (s///) at >> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >> 18676956. >> Use of uninitialized value in substitution (s///) at >> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >> 18677002. >> Use of uninitialized value in substitution (s///) at >> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>========================================================================= >> >>I have done a small test with Bio::SeqIO module using a small test >>file(swiss.test). Here is the code. >> >>#!/usr/bin/perl -w >># >>use strict; >>use Bio::SeqIO; >> >>my $seq = Bio::SeqIO->new(-file => $ARGV[0], -format => "swiss"); >> >>while (my $in = $seq->next_seq) { >> print $in->id,"\n"; >>} >> >>exit; >> >> >>It gives the same error >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > > 28. > >>1433_CAEEL >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > > 87. > >>A4_CAEEL >>Use of uninitialized value in substitution (s///) at >>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > > 171. > >>AATC_CAEEL >> >>I have also attached the test file. >> >>Hope this will give some clue for the problem. >>Thanks for the response. >> >>siddhartha >> >> >> >>Brian Osborne wrote: >> >> >>>Siddhartha, >>> >>>Bio::DB::Flat::BinarySearch or Bio::DB::Flat::BDB? Also, please show your >>>code when you ask a question, it simplifies matters. For example, it would >>>tell me which module you used, which file format, and so on. It also helps >>>to attach the actual sequence files, or some smaller test file that shows >>>the same error. What happens occasionally is that a question will get >>>ignored for the simple reason that no one knows how to answer, there's not >>>enough information given in the letter. >>> >>>Brian O. >>> >>>-----Original Message----- >>>From: bioperl-l-bounces@portal.open-bio.org >>>[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Siddhartha Basu >>>Sent: Thursday, October 14, 2004 2:51 PM >>>To: bioperl-l@bioperl.org >>>Subject: [Bioperl-l] problem with swissprot parsin >>> >>>Hi, >>>I have already described this problem in this mailing list but haven't >>>got anybodies attention yet. I had also asked the author of this module >>>but nothing back yet. Anyway i really could'nt figure out how to solve >>>this and so i am writing again. I have also tried by replacing the >>>swiss.pm module from the bioperl-live version. But the problem persists. >>>I understand that this is a maintained module and i am not getting >>>ignored because of maintenance issue. >>> >>>I am trying to make a flat file index of swissprot/trembl files using >>>Bio::DB::Flat module. However, i am getting the following consistent >>>warnings during the indexing process. >>>====================================================================== >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18676877. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18676916. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18676956. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18677002. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18677045. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18677091. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18677136. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18677178. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18677209. >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>18677249. >>>======================================================================== >>>Though, the indexing get completed, i could'nt fetch any data from there >>> as it does not return any seq obj. >>>I also get the same warnings when i try to read the swissprot file using >>>the Bio::SeqIO module. >>>I am using bioperl-1.4 and understand it has something to do with the >>>swissprot parser in Seq::IO module. >>>So, does any fix or solution available for this problem. >>> >>>Thanks in advance. >>> >>>-siddhartha >>>_______________________________________________ >>>Bioperl-l mailing list >>>Bioperl-l@portal.open-bio.org >>>http://portal.open-bio.org/mailman/listinfo/bioperl-l >>> >>> >> >> >> > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > From hlapp at gmx.net Fri Oct 15 13:27:45 2004 From: hlapp at gmx.net (Hilmar Lapp) Date: Fri Oct 15 13:26:44 2004 Subject: [Bioperl-l] problem with swissprot parsin In-Reply-To: <416FD6C4.3080305@pharm.sunysb.edu> Message-ID: <872C8BD1-1ECF-11D9-B102-000A959EB4C4@gmx.net> The RG/RA issue has been fixed on the main trunk I believe. Aside from that, different versions of perl will also lead to things being complained about or remaining silent. Generally, *always* add the version of bioperl you are using if you report a problem. -hilmar On Friday, October 15, 2004, at 09:55 AM, Siddhartha Basu wrote: > Hi Brian, > I retested it again. The good part is that i can fetch the seq obj and > the sequence now. The warnings are still there. I will try to index > the entire swissprot data file and see what happens. > > Now,as mentioned by one of the earlier mail in the list that it has to > with the absence of RA records in recent swissprot files and the > swiss.pm modules spewing out warnings when the variable $au is not > getting the data. Since you are even getting the warnings what version > of bioperl you are running. > > -siddhartha > > > > > > Brian Osborne wrote: >> Siddhartha, >> Changing @files to @ARGV makes your script index without warnings on >> my >> machine, using your Swissprot file or mine. It also retrieves a >> sequence. >> Below... >> Brian O. >> #!/usr/bin/perl -w >> use strict; >> use Bio::DB::Flat; >> die "no files\n" unless @ARGV; >> my $LOCATION = "."; >> my $db = Bio::DB::Flat->new( -directory => $LOCATION, >> -dbname => "swissall", >> -format => "swiss", >> -index => "bdb", >> -write_flag => 1, >> ) or die "can't create BioFlat indexes\n"; >> $db->build_index(@ARGV); >> print "Done indexing\n"; >> my $seq = $db->get_Seq_by_acc("P41932"); >> print $seq->seq; >> -----Original Message----- >> From: bioperl-l-bounces@portal.open-bio.org >> [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Siddhartha >> Basu >> Sent: Thursday, October 14, 2004 4:54 PM >> To: Brian Osborne >> Cc: bioperl-l@bioperl.org >> Subject: Re: [Bioperl-l] problem with swissprot parsin >> Hi Brian, >> Changed it, problem persists. >> -siddhartha >> Brian Osborne wrote: >>> Siddhartha, >>> >>> Change @files to @ARGV in the build_index line. Does that fix it? >>> >>> Brian O. >>> >>> -----Original Message----- >>> From: Siddhartha Basu [mailto:basu@pharm.sunysb.edu] >>> Sent: Thursday, October 14, 2004 4:15 PM >>> To: Brian Osborne >>> Cc: bioperl-l@bioperl.org >>> Subject: Re: [Bioperl-l] problem with swissprot parsin >>> >>> Hi Brian, >>> Here is the code that started to give the following error. I presume >>> i >>> am using Bio::DB::Flat::BDB though i haven't called it directly. I am >>> trying to index swissprot/trembl files here. >>> >>> #!/usr/bin/perl -w >>> use strict; >>> use Bio::DB::Flat; >>> >>> die "no files\n" unless @ARGV; >>> my $LOCATION = "/home/basu/odbaindex"; >>> >>> my $db = Bio::DB::Flat->new( -directory => $LOCATION, >>> -dbname => "swissall", >>> -format => "swiss", >>> -index => "bdb", >>> -write_flag => 1, >>> ) or die "can't create BioFlat >>> indexes\n"; >>> $db->build_index(@files); >>> print "Done indexing\n"; >>> >>> exit; >>> >>> >>> I get the following warinings. >>> >>> ===================================================================== >>> = >>> Use of uninitialized value in substitution (s///) at >>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>> line >>> 18676877. >>> Use of uninitialized value in substitution (s///) at >>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>> line >>> 18676916. >>> Use of uninitialized value in substitution (s///) at >>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>> line >>> 18676956. >>> Use of uninitialized value in substitution (s///) at >>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>> line >>> 18677002. >>> Use of uninitialized value in substitution (s///) at >>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>> line >>> ===================================================================== >>> ==== >>> >>> I have done a small test with Bio::SeqIO module using a small test >>> file(swiss.test). Here is the code. >>> >>> #!/usr/bin/perl -w >>> # >>> use strict; >>> use Bio::SeqIO; >>> >>> my $seq = Bio::SeqIO->new(-file => $ARGV[0], -format => "swiss"); >>> >>> while (my $in = $seq->next_seq) { >>> print $in->id,"\n"; >>> } >>> >>> exit; >>> >>> >>> It gives the same error >>> Use of uninitialized value in substitution (s///) at >>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>> line >> 28. >>> 1433_CAEEL >>> Use of uninitialized value in substitution (s///) at >>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>> line >> 87. >>> A4_CAEEL >>> Use of uninitialized value in substitution (s///) at >>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>> line >> 171. >>> AATC_CAEEL >>> >>> I have also attached the test file. >>> >>> Hope this will give some clue for the problem. >>> Thanks for the response. >>> >>> siddhartha >>> >>> >>> >>> Brian Osborne wrote: >>> >>> >>>> Siddhartha, >>>> >>>> Bio::DB::Flat::BinarySearch or Bio::DB::Flat::BDB? Also, please >>>> show your >>>> code when you ask a question, it simplifies matters. For example, >>>> it would >>>> tell me which module you used, which file format, and so on. It >>>> also helps >>>> to attach the actual sequence files, or some smaller test file that >>>> shows >>>> the same error. What happens occasionally is that a question will >>>> get >>>> ignored for the simple reason that no one knows how to answer, >>>> there's not >>>> enough information given in the letter. >>>> >>>> Brian O. >>>> >>>> -----Original Message----- >>>> From: bioperl-l-bounces@portal.open-bio.org >>>> [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of >>>> Siddhartha Basu >>>> Sent: Thursday, October 14, 2004 2:51 PM >>>> To: bioperl-l@bioperl.org >>>> Subject: [Bioperl-l] problem with swissprot parsin >>>> >>>> Hi, >>>> I have already described this problem in this mailing list but >>>> haven't >>>> got anybodies attention yet. I had also asked the author of this >>>> module >>>> but nothing back yet. Anyway i really could'nt figure out how to >>>> solve >>>> this and so i am writing again. I have also tried by replacing the >>>> swiss.pm module from the bioperl-live version. But the problem >>>> persists. >>>> I understand that this is a maintained module and i am not getting >>>> ignored because of maintenance issue. >>>> >>>> I am trying to make a flat file index of swissprot/trembl files >>>> using >>>> Bio::DB::Flat module. However, i am getting the following consistent >>>> warnings during the indexing process. >>>> ==================================================================== >>>> == >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18676877. >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18676916. >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18676956. >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18677002. >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18677045. >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18677091. >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18677136. >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18677178. >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18677209. >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18677249. >>>> ==================================================================== >>>> ==== >>>> Though, the indexing get completed, i could'nt fetch any data from >>>> there >>>> as it does not return any seq obj. >>>> I also get the same warnings when i try to read the swissprot file >>>> using >>>> the Bio::SeqIO module. >>>> I am using bioperl-1.4 and understand it has something to do with >>>> the >>>> swissprot parser in Seq::IO module. >>>> So, does any fix or solution available for this problem. >>>> >>>> Thanks in advance. >>>> >>>> -siddhartha >>>> _______________________________________________ >>>> Bioperl-l mailing list >>>> Bioperl-l@portal.open-bio.org >>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l >>>> >>>> >>> >>> >>> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l@portal.open-bio.org >> http://portal.open-bio.org/mailman/listinfo/bioperl-l > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- From hlapp at gmx.net Fri Oct 15 13:29:27 2004 From: hlapp at gmx.net (Hilmar Lapp) Date: Fri Oct 15 13:28:27 2004 Subject: [Bioperl-l] It seems a bug: Bio/SeqFeatureI.pm? In-Reply-To: <416F51FD.000001.23642@nhn428> Message-ID: Where do you get this feature location from? This code is being tested with real records and passes; if this is an 'official' example it needs to be added to the tests to make sure we cope with it properly. -hilmar On Friday, October 15, 2004, at 12:28 AM, Sang Chul Choi wrote: > Dear Friends: > > In the file Bio/SeqFeatureI.pm, there seems a small bug which should > be fixed. > I tried to used the method of Seq Object called spliced_seq(). But, > when I > have Bioperl parse the line like > > complement(join(2352..2759,2809..3015)) > > It just complements each fragment and then joins them together. And, I > have > a strange translated protein. So, I changed the order of operation, and > it works. > > # This is dumb, subseq should work on locations... > if( $loc->strand == 1 ) { > $seqstr .= $called_seq->subseq($loc->start,$loc->end); > } else { > #$seqstr = > $called_seq->trunc($loc->start,$loc->end)->revcom->seq() . $seqstr; > $seqstr .= > $called_seq->trunc($loc->start,$loc->end)->revcom->seq(); > } > > Thanks, > > Sang Chul > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- From hlapp at gmx.net Fri Oct 15 13:31:24 2004 From: hlapp at gmx.net (Hilmar Lapp) Date: Fri Oct 15 13:30:17 2004 Subject: [Bioperl-l] Re: [SO-devel] GFF3 - Bioperl - SO In-Reply-To: Message-ID: <09450CDE-1ED0-11D9-B102-000A959EB4C4@gmx.net> On Thursday, October 14, 2004, at 01:05 PM, Allen Day wrote: > I would advise against adding more features into Bio::Tools::GFF. I > can't > speak for all others, but my future development will not use it, and > I'm > in the process of converting code which does use it to depend on > Bio::FeatureIO::gff. > Is it possible to rewrite Bio::Tools::GFF as a simple thin wrapper around methods/classes from Bio::FeatureIO? -hilmar -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- From barry.moore at genetics.utah.edu Fri Oct 15 14:50:38 2004 From: barry.moore at genetics.utah.edu (Barry Moore) Date: Fri Oct 15 14:49:38 2004 Subject: [Bioperl-l] counting gaps in sequence data In-Reply-To: <72C1AD26-1E66-11D9-9BA0-000A956C4C82@mac.com> References: <39BB5AA7-1E2D-11D9-A84B-000393539070@mac.com> <416F0C84.8080401@genetics.utah.edu> <72C1AD26-1E66-11D9-9BA0-000A956C4C82@mac.com> Message-ID: <41701BFE.50205@genetics.utah.edu> Mike- $gap is the current gap length that you are iterating through with the second for loop. Call it 3 for now. $gaptype{3} then represents the hash value for the gap of length 3. We are storing the location of the current gap (of length 3) hit in that hash value (say for example $gaptype{3} = 14 where 14 is the location), however there can be more than one gap of length 3, so we want to do something like $gaptype{3} = 14 and 21 and 65. In other words we want the value of $gaptype{3} to contain several values - an array. Remember that hash values must be scalars, but we can reference an array with a scalar and set the hash value equal to that array reference. You could put the location values into an array, @locations = (14, 21, 65), and then set place a reference to that array into the hash value like this $gaptype{3} = \@locaitons, or you could just put an anonymous, unnamed array directly into the hash value like this $gaptype{3} = [14, 21, 65]. The square brackets make that an anonymous array. Since we don't have all these values at once, you do the same thing with push. The terrible looking @{$gaptype{$gap}} thing dereferences an anonymous array pointed to by the hash value $gaptype{$gap}. Push just sees the array behind that reference and pushes $-[0] + 2 onto that array. $-[0] is the first value in the @- array (pg. 667 in your Programming Perl Book). That array stores the begining of that last hit found by the last match (2 is added because $-[0] counts the first position of the string to be matched as 0 and also returns the position just before the match). A regex something like this should work /(\A|[atgc])-{$gap}([atgc]|\z)/g. Although I noticed that it messes up the location of the 3' gap calling it 2 instead of 1. Apparently $-[0] returns 0 for both a first and second position match - go figure. Barry Michael S. Robeson II wrote: > Wow, that seems to work pretty well. However, I am unsure of what the > following line means: > > push @{$gaptype{$gap}}, $-[0] + 2; > > Especially the " $-[0] + 2" part of it. I understand that it is an > array but what is going on there is a little vague. Other than that I > pretty much understand the code. Also, about the part not being able > to match gaps at the end of a string will be a problem. I am currently > working off of what you've posted and seeing if I can fit (using a > character class I suppose) a "\Z", "\z", or "$" to match any gaps at > the end of a line. > > -Cheers! > -Mike > > > On Oct 14, 2004, at 17:32, Barry Moore wrote: > >> Mike- >> >> Something like this maybe? >> >> use strict; >> use warnings; >> >> my %seqs = (human => "acgtt---cgatacg---acgact-----t", >> chimp => "acgtacgatac---actgca---ac", >> mouse => "acgata---acgatcg----acgt"); >> >> for my $seq (keys %seqs) { # An array of your sequences >> print "\n\nThe $seq sequence has the following gaps:\n"; >> my %gaptype; >> for my $gap (1..5) { # 5 or however large you want gaps to be counted >> while ($seqs{$seq} =~ /[atgc]-{$gap}[atgc]/g) { #notice that this >> won't catch terminal gaps >> #This creates a hash of arrays. The arrays hold the locations >> of the >> #gaps, and the count of each gaptype is determined by the length >> of that array. >> push @{$gaptype{$gap}}, $-[0] + 2; >> } >> if (defined @{$gaptype{$gap}}) { >> my $positions = join ", ", @{$gaptype{$gap}}; >> print "\tGap length $gap begining at positions:\t$positions\n"; >> } >> } >> } >> >> Barry Moore >> >> >> Michael Robeson wrote: > > -- Barry Moore Dept. of Human Genetics University of Utah Salt Lake City, UT From tex at biosysadmin.com Fri Oct 15 00:06:17 2004 From: tex at biosysadmin.com (James Thompson) Date: Fri Oct 15 16:17:39 2004 Subject: [Bioperl-l] make test!! In-Reply-To: <5712C9C6-1E1F-11D9-AF00-000A9577009E@pcbi.upenn.edu> Message-ID: Aaron, I've just finished making test with BIOPERLDEBUG=1 on my Solaris 8 / Perl 5.8.5 machine, here are the (filtered) results: All tests successful, 2 subtests skipped. Files=192, Tests=8772, 611 wallclock secs (431.95 cusr + 26.58 csys = 458.53 CPU) I'll try testing this on a Linux machine when I get back on Monday. Can you give me a target date for the 1.5 release so that I can plan out my next couple of weeks? Cheers, James Thompson RIT Bioinformatics On Thu, 14 Oct 2004, Aaron J. Mackey wrote: > > I've had only a very few people send me feedback about the current > state of bioperl-live "make test" on your favorite > old/crotchety/obscure platforms. I'm writing the Change log and > thinking about branching, but I'm an experimentalist, I need data! > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > you have everything, "make distclean" if you've built from the cvs > checkout before, and start from scratch with the usual litany: perl > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > about, not so much all the verbiage (unless there's specific verbiage > related to the end result ...) > > Thanks, > > -Aaron > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > From allenday at ucla.edu Fri Oct 15 16:58:29 2004 From: allenday at ucla.edu (Allen Day) Date: Fri Oct 15 16:57:31 2004 Subject: [Bioperl-l] Re: [SO-devel] GFF3 - Bioperl - SO In-Reply-To: <09450CDE-1ED0-11D9-B102-000A959EB4C4@gmx.net> References: <09450CDE-1ED0-11D9-B102-000A959EB4C4@gmx.net> Message-ID: possibly, but it's going to take some typemapping work. Bio::FeatureIO departs from other SeqFeature handling classes in that it doesn't allow features to be untyped... it uses SeqFeature::Annotated instead of SeqFeature::Generic, which is required to have a SO or SOFA type attached in the form of a Annotation::OntologyTerm. -allen On Fri, 15 Oct 2004, Hilmar Lapp wrote: > > On Thursday, October 14, 2004, at 01:05 PM, Allen Day wrote: > > > I would advise against adding more features into Bio::Tools::GFF. I > > can't > > speak for all others, but my future development will not use it, and > > I'm > > in the process of converting code which does use it to depend on > > Bio::FeatureIO::gff. > > > > Is it possible to rewrite Bio::Tools::GFF as a simple thin wrapper > around methods/classes from Bio::FeatureIO? > > -hilmar > From brian_osborne at cognia.com Fri Oct 15 17:38:34 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Fri Oct 15 17:37:56 2004 Subject: [Bioperl-l] Deprecating Message-ID: Bioperl-l, Any objections to my adding Bio::Tools::RestrictionEnzyme to the DEPRECATED file? It was replaced by Bio::Restriction a while ago. Along the same lines, is there anything else that should be deprecated? Bio::Tools::GFF? Brian O. From allenday at ucla.edu Fri Oct 15 18:11:00 2004 From: allenday at ucla.edu (Allen Day) Date: Fri Oct 15 18:10:20 2004 Subject: [Bioperl-l] Deprecating In-Reply-To: References: Message-ID: On Fri, 15 Oct 2004, Brian Osborne wrote: > Bioperl-l, > > Any objections to my adding Bio::Tools::RestrictionEnzyme to the DEPRECATED > file? It was replaced by Bio::Restriction a while ago. > > Along the same lines, is there anything else that should be deprecated? > Bio::Tools::GFF? not yet, thanks. the replacement is still too unstable. -allen > > Brian O. > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > From skirov at utk.edu Fri Oct 15 18:32:44 2004 From: skirov at utk.edu (Stefan Kirov) Date: Fri Oct 15 18:31:58 2004 Subject: [Bioperl-l] Deprecating In-Reply-To: References: Message-ID: <4170500C.8040702@utk.edu> I wonder if anyone uses *Bio::AlignIO::meme*. Last time (year ago) it did not work for me and I have not seen anyone committing changes.... Stefan Brian Osborne wrote: >Bioperl-l, > >Any objections to my adding Bio::Tools::RestrictionEnzyme to the DEPRECATED >file? It was replaced by Bio::Restriction a while ago. > >Along the same lines, is there anything else that should be deprecated? >Bio::Tools::GFF? > >Brian O. > > > > >_______________________________________________ >Bioperl-l mailing list >Bioperl-l@portal.open-bio.org >http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- Stefan Kirov, Ph.D. University of Tennessee/Oak Ridge National Laboratory 5700 bldg, PO BOX 2008 MS6164 Oak Ridge TN 37831-6164 USA tel +865 576 5120 fax +865-576-5332 e-mail: skirov@utk.edu sao@ornl.gov "And the wars go on with brainwashed pride For the love of God and our human rights And all these things are swept aside" From brian_osborne at cognia.com Fri Oct 15 22:04:18 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Fri Oct 15 22:04:30 2004 Subject: [Bioperl-l] Deprecating In-Reply-To: Message-ID: Steve, An imprimatur? For me? Thank you! ;-) Brian O. -----Original Message----- From: Steve Chervitz [mailto:sac@bioperl.org] Sent: Friday, October 15, 2004 9:57 PM To: Brian Osborne; bioperl-l@bioperl.org Subject: Re: [Bioperl-l] Deprecating As the author of Bio::Tools::RestrictionEnzyme, I give you my imprimatur. In my mind, it was implicitly deprecated when the superior Bio::Restriction modules came out. Steve > From: Brian Osborne > Date: Fri, 15 Oct 2004 17:38:34 -0400 > To: > Subject: [Bioperl-l] Deprecating > > Bioperl-l, > > Any objections to my adding Bio::Tools::RestrictionEnzyme to the DEPRECATED > file? It was replaced by Bio::Restriction a while ago. > > Along the same lines, is there anything else that should be deprecated? > Bio::Tools::GFF? > > Brian O. > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l From basu at pharm.sunysb.edu Thu Oct 14 16:15:10 2004 From: basu at pharm.sunysb.edu (Siddhartha Basu) Date: Fri Oct 15 22:09:37 2004 Subject: [Bioperl-l] problem with swissprot parsin In-Reply-To: References: Message-ID: <416EDE4E.7040800@pharm.sunysb.edu> Hi Brian, Here is the code that started to give the following error. I presume i am using Bio::DB::Flat::BDB though i haven't called it directly. I am trying to index swissprot/trembl files here. #!/usr/bin/perl -w use strict; use Bio::DB::Flat; die "no files\n" unless @ARGV; my $LOCATION = "/home/basu/odbaindex"; my $db = Bio::DB::Flat->new( -directory => $LOCATION, -dbname => "swissall", -format => "swiss", -index => "bdb", -write_flag => 1, ) or die "can't create BioFlat indexes\n"; $db->build_index(@files); print "Done indexing\n"; exit; I get the following warinings. ====================================================================== Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18676877. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18676916. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18676956. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 18677002. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line ========================================================================= I have done a small test with Bio::SeqIO module using a small test file(swiss.test). Here is the code. #!/usr/bin/perl -w # use strict; use Bio::SeqIO; my $seq = Bio::SeqIO->new(-file => $ARGV[0], -format => "swiss"); while (my $in = $seq->next_seq) { print $in->id,"\n"; } exit; It gives the same error Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 28. 1433_CAEEL Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 87. A4_CAEEL Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line 171. AATC_CAEEL I have also attached the test file. Hope this will give some clue for the problem. Thanks for the response. siddhartha Brian Osborne wrote: > Siddhartha, > > Bio::DB::Flat::BinarySearch or Bio::DB::Flat::BDB? Also, please show your > code when you ask a question, it simplifies matters. For example, it would > tell me which module you used, which file format, and so on. It also helps > to attach the actual sequence files, or some smaller test file that shows > the same error. What happens occasionally is that a question will get > ignored for the simple reason that no one knows how to answer, there's not > enough information given in the letter. > > Brian O. > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Siddhartha Basu > Sent: Thursday, October 14, 2004 2:51 PM > To: bioperl-l@bioperl.org > Subject: [Bioperl-l] problem with swissprot parsin > > Hi, > I have already described this problem in this mailing list but haven't > got anybodies attention yet. I had also asked the author of this module > but nothing back yet. Anyway i really could'nt figure out how to solve > this and so i am writing again. I have also tried by replacing the > swiss.pm module from the bioperl-live version. But the problem persists. > I understand that this is a maintained module and i am not getting > ignored because of maintenance issue. > > I am trying to make a flat file index of swissprot/trembl files using > Bio::DB::Flat module. However, i am getting the following consistent > warnings during the indexing process. > ====================================================================== > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18676877. > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18676916. > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18676956. > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18677002. > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18677045. > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18677091. > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18677136. > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18677178. > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18677209. > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line > 18677249. > ======================================================================== > Though, the indexing get completed, i could'nt fetch any data from there > as it does not return any seq obj. > I also get the same warnings when i try to read the swissprot file using > the Bio::SeqIO module. > I am using bioperl-1.4 and understand it has something to do with the > swissprot parser in Seq::IO module. > So, does any fix or solution available for this problem. > > Thanks in advance. > > -siddhartha > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -------------- next part -------------- ID 1433_CAEEL STANDARD; PRT; 248 AA. AC P41932; Q21537; DT 01-NOV-1995 (Rel. 32, Created) DT 01-NOV-1995 (Rel. 32, Last sequence update) DT 01-OCT-2004 (Rel. 45, Last annotation update) DE 14-3-3-like protein 1. GN Name=ftt-1; ORFNames=M117.2; OS Caenorhabditis elegans. OC Eukaryota; Metazoa; Nematoda; Chromadorea; Rhabditida; Rhabditoidea; OC Rhabditidae; Peloderinae; Caenorhabditis. OX NCBI_TaxID=6239; RN [1] RP SEQUENCE FROM N.A. RC STRAIN=Bristol N2; RX MEDLINE=95011616; PubMed=7926802; DOI=10.1016/0378-1119(94)90068-X; RA Wang W., Shakes D.C.; RT "Isolation and sequence analysis of a Caenorhabditis elegans cDNA RT which encodes a 14-3-3 homologue."; RL Gene 147:215-218(1994). RN [2] RP SEQUENCE FROM N.A. RC STRAIN=Bristol N2; RX MEDLINE=99069613; PubMed=9851916; RG THE C. ELEGANS SEQUENCING CONSORTIUM; RT "Genome sequence of the nematode C. elegans: a platform for RT investigating biology."; RL Science 282:2012-2018(1998). CC -!- SIMILARITY: Belongs to the 14-3-3 family. CC -------------------------------------------------------------------------- CC This SWISS-PROT entry is copyright. It is produced through a collaboration CC between the Swiss Institute of Bioinformatics and the EMBL outstation - CC the European Bioinformatics Institute. There are no restrictions on its CC use by non-profit institutions as long as its content is in no way CC modified and this statement is not removed. Usage by and for commercial CC entities requires a license agreement (See http://www.isb-sib.ch/announce/ CC or send an email to license@isb-sib.ch). CC -------------------------------------------------------------------------- DR EMBL; U05038; AAA61872.1; -. DR EMBL; Z73910; CAA98138.1; -. DR PIR; JC2581; JC2581. DR PIR; T23759; T23759. DR HSSP; P93343; 1O9E. DR IntAct; P41932; -. DR WormPep; M117.2; CE06200. DR InterPro; IPR000308; 14-3-3. DR Pfam; PF00244; 14-3-3; 1. DR PRINTS; PR00305; 1433ZETA. DR SMART; SM00101; 14_3_3; 1. DR PROSITE; PS00796; 1433_1; 1. DR PROSITE; PS00797; 1433_2; 1. KW Multigene family. FT CONFLICT 118 118 A -> V (in Ref. 2). SQ SEQUENCE 248 AA; 28162 MW; B9350039628341AF CRC64; MSDTVEELVQ RAKLAEQAER YDDMAAAMKK VTEQGQELSN EERNLLSVAY KNVVGARRSS WRVISSIEQK TEGSEKKQQL AKEYRVKVEQ ELNDICQDVL KLLDEFLIVK AGAAESKAFY LKMKGDYYRY LAEVASEDRA AVVEKSQKAY QEALDIAKDK MQPTHPIRLG LALNFSVFYY EILNTPEHAC QLAKQAFDDA IAELDTLNED SYKDSTLIMQ LLRDNLTLWT SDVGAEDQEQ EGNQEAGN // ID A4_CAEEL STANDARD; PRT; 686 AA. AC Q10651; Q18583; Q95ZX1; DT 28-FEB-2003 (Rel. 41, Created) DT 28-FEB-2003 (Rel. 41, Last sequence update) DT 01-OCT-2004 (Rel. 45, Last annotation update) DE Beta-amyloid-like protein precursor. GN Name=apl-1; ORFNames=C42D8.8; OS Caenorhabditis elegans. OC Eukaryota; Metazoa; Nematoda; Chromadorea; Rhabditida; Rhabditoidea; OC Rhabditidae; Peloderinae; Caenorhabditis. OX NCBI_TaxID=6239; RN [1] RP SEQUENCE OF 6-686 FROM N.A. RC STRAIN=Bristol N2; RX MEDLINE=94089766; PubMed=8265668; RA Daigle I., Li C.; RT "apl-1, a Caenorhabditis elegans gene encoding a protein related to RT the human beta-amyloid protein precursor."; RL Proc. Natl. Acad. Sci. U.S.A. 90:12045-12049(1993). RN [2] RP SEQUENCE FROM N.A. RC STRAIN=Bristol N2; RX MEDLINE=99069613; PubMed=9851916; RG THE C. ELEGANS SEQUENCING CONSORTIUM; RT "Genome sequence of the nematode C. elegans: a platform for RT investigating biology."; RL Science 282:2012-2018(1998). RN [3] RP REVISIONS, AND ALTERNATIVE SPLICING. RA Waterston R.; RL Submitted (JUN-2001) to the EMBL/GenBank/DDBJ databases. CC -!- SUBCELLULAR LOCATION: Type I membrane protein (Potential). CC -!- ALTERNATIVE PRODUCTS: CC Event=Alternative splicing; Named isoforms=2; CC Name=a; CC IsoId=Q10651-1; Sequence=Displayed; CC Name=b; CC IsoId=Q10651-2; Sequence=VSP_000017; CC Note=No experimental confirmation available; CC -!- SIMILARITY: Belongs to the APP family. CC -------------------------------------------------------------------------- CC This SWISS-PROT entry is copyright. It is produced through a collaboration CC between the Swiss Institute of Bioinformatics and the EMBL outstation - CC the European Bioinformatics Institute. There are no restrictions on its CC use by non-profit institutions as long as its content is in no way CC modified and this statement is not removed. Usage by and for commercial CC entities requires a license agreement (See http://www.isb-sib.ch/announce/ CC or send an email to license@isb-sib.ch). CC -------------------------------------------------------------------------- DR EMBL; U00240; AAC46470.1; ALT_INIT. DR EMBL; U56966; AAA98722.1; -. DR EMBL; U56966; AAK68242.1; -. DR PIR; T15795; T15795. DR HSSP; P05067; 1MWP. DR WormPep; C42D8.8a; CE04209. DR WormPep; C42D8.8b; CE27845. DR InterPro; IPR008155; A4_APP. DR InterPro; IPR008154; A4_extra. DR Pfam; PF02177; A4_EXTRA; 1. DR PRINTS; PR00203; AMYLOIDA4. DR SMART; SM00006; A4_EXTRA; 1. DR PROSITE; PS00319; A4_EXTRA; 1. KW Alternative splicing; Amyloid; Glycoprotein; Neurogenesis; Signal; KW Transmembrane. FT SIGNAL 1 21 Potential. FT CHAIN 22 686 Beta-amyloid-like protein. FT DOMAIN 22 621 Extracellular (Potential). FT TRANSMEM 622 642 Potential. FT DOMAIN 643 686 Cytoplasmic (Potential). FT DOMAIN 205 228 Asp-rich. FT DOMAIN 676 679 Clathrin-binding (Potential). FT CARBOHYD 84 84 N-linked (GlcNAc...) (Potential). FT CARBOHYD 201 201 N-linked (GlcNAc...) (Potential). FT CARBOHYD 249 249 N-linked (GlcNAc...) (Potential). FT CARBOHYD 417 417 N-linked (GlcNAc...) (Potential). FT VARSPLIC 538 539 Missing (in isoform b). FT /FTId=VSP_000017. SQ SEQUENCE 686 AA; 79434 MW; A0816858FDD48608 CRC64; MTVGKLMIGL LIPILVATVY AEGSPAGSKR HEKFIPMVAF SCGYRNQYMT EEGSWKTDDE RYATCFSGKL DILKYCRKAY PSMNITNIVE YSHEVSISDW CREEGSPCKW THSVRPYHCI DGEFHSEALQ VPHDCQFSHV NSRDQCNDYQ HWKDEAGKQC KTKKSKGNKD MIVRSFAVLE PCALDMFTGV EFVCCPNDQT NKTDVQKTKE DEDDDDDEDD AYEDDYSEES DEKDEEEPSS QDPYFKIANW TNEHDDFKKA EMRMDEKHRK KVDKVMKEWG DLETRYNEQK AKDPKGAEKF KSQMNARFQK TVSSLEEEHK RMRKEIEAVH EERVQAMLNE KKRDATHDYR QALATHVNKP NKHSVLQSLK AYIRAEEKDR MHTLNRYRHL LKADSKEAAA YKPTVIHRLR YIDLRINGTL AMLRDFPDLE KYVRPIAVTY WKDYRDEVSP DISVEDSELT PIIHDDEFSK NAKLDVKAPT TTAKPVKETD NAKVLPTEAS DSEEEADEYY EDEDDEQVKK TPDMKKKVKV VDIKPKEIKV TIEEEKKAPK LVETSVQTDD EDDDEDSSSS TSSESDEDED KNIKELRVDI EPIIDEPASF YRHDKLIQSP EVERSASSVF QPYVLASAMF ITAICIIAFA ITNARRRRAM RGFIEVDVYT PEERHVAGMQ VNGYENPTYS FFDSKA // ID AATC_CAEEL STANDARD; PRT; 408 AA. AC Q22067; DT 01-NOV-1997 (Rel. 35, Created) DT 01-NOV-1997 (Rel. 35, Last sequence update) DT 01-OCT-2004 (Rel. 45, Last annotation update) DE Probable aspartate aminotransferase, cytoplasmic (EC 2.6.1.1) DE (Transaminase A) (Glutamate oxaloacetate transaminase-1). GN ORFNames=T01C8.5; OS Caenorhabditis elegans. OC Eukaryota; Metazoa; Nematoda; Chromadorea; Rhabditida; Rhabditoidea; OC Rhabditidae; Peloderinae; Caenorhabditis. OX NCBI_TaxID=6239; RN [1] RP SEQUENCE FROM N.A. RC STRAIN=Bristol N2; RX MEDLINE=99069613; PubMed=9851916; RG THE C. ELEGANS SEQUENCING CONSORTIUM; RT "Genome sequence of the nematode C. elegans: a platform for RT investigating biology."; RL Science 282:2012-2018(1998). CC -!- CATALYTIC ACTIVITY: L-aspartate + 2-oxoglutarate = oxaloacetate + CC L-glutamate. CC -!- COFACTOR: Pyridoxal phosphate (By similarity). CC -!- SUBUNIT: Homodimer (By similarity). CC -!- SUBCELLULAR LOCATION: Cytoplasmic (Potential). CC -!- MISCELLANEOUS: In eukaryotes there are cytoplasmic, mitochondrial CC and chloroplastic isozymes. CC -!- SIMILARITY: Belongs to the class-I pyridoxal-phosphate-dependent CC aminotransferase family. CC -------------------------------------------------------------------------- CC This SWISS-PROT entry is copyright. It is produced through a collaboration CC between the Swiss Institute of Bioinformatics and the EMBL outstation - CC the European Bioinformatics Institute. There are no restrictions on its CC use by non-profit institutions as long as its content is in no way CC modified and this statement is not removed. Usage by and for commercial CC entities requires a license agreement (See http://www.isb-sib.ch/announce/ CC or send an email to license@isb-sib.ch). CC -------------------------------------------------------------------------- DR EMBL; U58726; AAB00578.1; -. DR PIR; T29857; T29857. DR HSSP; P00503; 1AJS. DR WormPep; T01C8.5; CE07462. DR InterPro; IPR004839; Aminotrans_I/II. DR InterPro; IPR000796; Asp_trans. DR InterPro; IPR004838; NHtransf_1_BS. DR Pfam; PF00155; Aminotran_1_2; 1. DR PRINTS; PR00799; TRANSAMINASE. DR PROSITE; PS00105; AA_TRANSFER_CLASS_1; 1. KW Aminotransferase; Pyridoxal phosphate; Transferase. FT BINDING 251 251 Pyridoxal phosphate (By similarity). SQ SEQUENCE 408 AA; 45493 MW; A4DDCBCB8C0EFD83 CRC64; MSFFDGIPVA PPIEVFHKNK MYLDETAPVK VNLTIGAYRT EEGQPWVLPV VHETEVEIAN DTSLNHEYLP VLGHEGFRKA ATELVLGAES PAIKEERSFG VQCLSGTGAL RAGAEFLASV CNMKTVYVSN PTWGNHKLVF KKAGFTTVAD YTFWDYDNKR VHIEKFLSDL ESAPEKSVII LHGCAHNPTG MDPTQEQWKL VAEVIKRKNL FTFFDIAYQG FASGDPAADA WAIRYFVDQG MEMVVSQSFA KNFGLYNERV GNLTVVVNNP AVIAGFQSQM SLVIRANWSN PPAHGARIVH KVLTTPARRE QWNQSIQAMS SRIKQMRAAL LRHLMDLGTP GTWDHIIQQI GMFSYTGLTS AQVDHLIANH KVFLLRDGRI NICGLNTKNV EYVAKAIDET VRAVKSNI // From basu at pharm.sunysb.edu Fri Oct 15 11:34:13 2004 From: basu at pharm.sunysb.edu (Siddhartha Basu) Date: Fri Oct 15 22:09:42 2004 Subject: [Bioperl-l] problem with swissprot parsin In-Reply-To: References: Message-ID: <416FEDF5.50808@pharm.sunysb.edu> Hi brian, Ok i have installed bioperl-live. However, now it is coming out with another set warnings. I have used the same code as i did earlier. #!/usr/bin/perl -w # use strict; use Bio::DB::Flat; # die "no files\n" unless @ARGV; my $LOCATION = "."; # my $db = Bio::DB::Flat->new( -directory => $LOCATION, -dbname => "swissall", -format => "swiss", -index => "bdb", -write_flag => 1, ) or die "can't create BioFlat indexes\n"; $db->build_index(@ARGV); #print "Done indexing\n"; my $seq = $db->get_Seq_by_acc("Q09543"); print $seq->seq,"\n"; exit; And i have attached the test file. -siddhartha Brian Osborne wrote: > Siddhartha, > > bioperl-live, the latest. Instructions on how to download this are at > http://cvs.open-bio.org/. > > Brian O. > > -----Original Message----- > From: Siddhartha Basu [mailto:basu@pharm.sunysb.edu] > Sent: Friday, October 15, 2004 9:55 AM > To: Brian Osborne > Cc: bioperl-l@bioperl.org > Subject: Re: [Bioperl-l] problem with swissprot parsin > > Hi Brian, > I retested it again. The good part is that i can fetch the seq obj and > the sequence now. The warnings are still there. I will try to index the > entire swissprot data file and see what happens. > > Now,as mentioned by one of the earlier mail in the list that it has to > with the absence of RA records in recent swissprot files and the > swiss.pm modules spewing out warnings when the variable $au is not > getting the data. Since you are even getting the warnings what version > of bioperl you are running. > > -siddhartha > > > > > > Brian Osborne wrote: > >>Siddhartha, >> >>Changing @files to @ARGV makes your script index without warnings on my >>machine, using your Swissprot file or mine. It also retrieves a sequence. >>Below... >> >>Brian O. >> >> >>#!/usr/bin/perl -w >> >>use strict; >>use Bio::DB::Flat; >> >>die "no files\n" unless @ARGV; >>my $LOCATION = "."; >> >>my $db = Bio::DB::Flat->new( -directory => $LOCATION, >> -d > > bname => "swissall", > >> -f > > ormat => "swiss", > >> -i > > ndex => "bdb", > >> -w > > rite_flag => 1, > >> ) or > > die "can't create BioFlat indexes\n"; > >>$db->build_index(@ARGV); >>print "Done indexing\n"; >> >>my $seq = $db->get_Seq_by_acc("P41932"); >>print $seq->seq; >> >> >> >>-----Original Message----- >>From: bioperl-l-bounces@portal.open-bio.org >>[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Siddhartha Basu >>Sent: Thursday, October 14, 2004 4:54 PM >>To: Brian Osborne >>Cc: bioperl-l@bioperl.org >>Subject: Re: [Bioperl-l] problem with swissprot parsin >> >>Hi Brian, >>Changed it, problem persists. >> >>-siddhartha >> >>Brian Osborne wrote: >> >> >>>Siddhartha, >>> >>>Change @files to @ARGV in the build_index line. Does that fix it? >>> >>>Brian O. >>> >>>-----Original Message----- >>>From: Siddhartha Basu [mailto:basu@pharm.sunysb.edu] >>>Sent: Thursday, October 14, 2004 4:15 PM >>>To: Brian Osborne >>>Cc: bioperl-l@bioperl.org >>>Subject: Re: [Bioperl-l] problem with swissprot parsin >>> >>>Hi Brian, >>>Here is the code that started to give the following error. I presume i >>>am using Bio::DB::Flat::BDB though i haven't called it directly. I am >>>trying to index swissprot/trembl files here. >>> >>>#!/usr/bin/perl -w >>>use strict; >>>use Bio::DB::Flat; >>> >>>die "no files\n" unless @ARGV; >>>my $LOCATION = "/home/basu/odbaindex"; >>> >>>my $db = Bio::DB::Flat->new( -directory => $LOCATION, >>> -dbname => "swissall", >>> -format => "swiss", >>> -index => "bdb", >>> -write_flag => 1, >>> ) or die "can't create BioFlat indexes\n"; >>>$db->build_index(@files); >>>print "Done indexing\n"; >>> >>>exit; >>> >>> >>>I get the following warinings. >>> ====================================================================== >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>> 18676877. >>> Use of uninitialized value in substitution (s///) at >>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>> 18676916. >>> Use of uninitialized value in substitution (s///) at >>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>> 18676956. >>> Use of uninitialized value in substitution (s///) at >>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>> 18677002. >>> Use of uninitialized value in substitution (s///) at >>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >>>========================================================================= >>> >>>I have done a small test with Bio::SeqIO module using a small test >>>file(swiss.test). Here is the code. >>> >>>#!/usr/bin/perl -w >>># >>>use strict; >>>use Bio::SeqIO; >>> >>>my $seq = Bio::SeqIO->new(-file => $ARGV[0], -format => "swiss"); >>> >>>while (my $in = $seq->next_seq) { >>> print $in->id,"\n"; >>>} >>> >>>exit; >>> >>> >>>It gives the same error >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >> >>28. >> >> >>>1433_CAEEL >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >> >>87. >> >> >>>A4_CAEEL >>>Use of uninitialized value in substitution (s///) at >>>/usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, line >> >>171. >> >> >>>AATC_CAEEL >>> >>>I have also attached the test file. >>> >>>Hope this will give some clue for the problem. >>>Thanks for the response. >>> >>>siddhartha >>> -------------- next part -------------- ID AATC_CAEEL STANDARD; PRT; 408 AA. AC Q22067; DT 01-NOV-1997 (Rel. 35, Created) DT 01-NOV-1997 (Rel. 35, Last sequence update) DT 01-OCT-2004 (Rel. 45, Last annotation update) DE Probable aspartate aminotransferase, cytoplasmic (EC 2.6.1.1) DE (Transaminase A) (Glutamate oxaloacetate transaminase-1). GN ORFNames=T01C8.5; OS Caenorhabditis elegans. OC Eukaryota; Metazoa; Nematoda; Chromadorea; Rhabditida; Rhabditoidea; OC Rhabditidae; Peloderinae; Caenorhabditis. OX NCBI_TaxID=6239; RN [1] RP SEQUENCE FROM N.A. RC STRAIN=Bristol N2; RX MEDLINE=99069613; PubMed=9851916; RG THE C. ELEGANS SEQUENCING CONSORTIUM; RT "Genome sequence of the nematode C. elegans: a platform for RT investigating biology."; RL Science 282:2012-2018(1998). CC -!- CATALYTIC ACTIVITY: L-aspartate + 2-oxoglutarate = oxaloacetate + CC L-glutamate. CC -!- COFACTOR: Pyridoxal phosphate (By similarity). CC -!- SUBUNIT: Homodimer (By similarity). CC -!- SUBCELLULAR LOCATION: Cytoplasmic (Potential). CC -!- MISCELLANEOUS: In eukaryotes there are cytoplasmic, mitochondrial CC and chloroplastic isozymes. CC -!- SIMILARITY: Belongs to the class-I pyridoxal-phosphate-dependent CC aminotransferase family. CC -------------------------------------------------------------------------- CC This SWISS-PROT entry is copyright. It is produced through a collaboration CC between the Swiss Institute of Bioinformatics and the EMBL outstation - CC the European Bioinformatics Institute. There are no restrictions on its CC use by non-profit institutions as long as its content is in no way CC modified and this statement is not removed. Usage by and for commercial CC entities requires a license agreement (See http://www.isb-sib.ch/announce/ CC or send an email to license@isb-sib.ch). CC -------------------------------------------------------------------------- DR EMBL; U58726; AAB00578.1; -. DR PIR; T29857; T29857. DR HSSP; P00503; 1AJS. DR WormPep; T01C8.5; CE07462. DR InterPro; IPR004839; Aminotrans_I/II. DR InterPro; IPR000796; Asp_trans. DR InterPro; IPR004838; NHtransf_1_BS. DR Pfam; PF00155; Aminotran_1_2; 1. DR PRINTS; PR00799; TRANSAMINASE. DR PROSITE; PS00105; AA_TRANSFER_CLASS_1; 1. KW Aminotransferase; Pyridoxal phosphate; Transferase. FT BINDING 251 251 Pyridoxal phosphate (By similarity). SQ SEQUENCE 408 AA; 45493 MW; A4DDCBCB8C0EFD83 CRC64; MSFFDGIPVA PPIEVFHKNK MYLDETAPVK VNLTIGAYRT EEGQPWVLPV VHETEVEIAN DTSLNHEYLP VLGHEGFRKA ATELVLGAES PAIKEERSFG VQCLSGTGAL RAGAEFLASV CNMKTVYVSN PTWGNHKLVF KKAGFTTVAD YTFWDYDNKR VHIEKFLSDL ESAPEKSVII LHGCAHNPTG MDPTQEQWKL VAEVIKRKNL FTFFDIAYQG FASGDPAADA WAIRYFVDQG MEMVVSQSFA KNFGLYNERV GNLTVVVNNP AVIAGFQSQM SLVIRANWSN PPAHGARIVH KVLTTPARRE QWNQSIQAMS SRIKQMRAAL LRHLMDLGTP GTWDHIIQQI GMFSYTGLTS AQVDHLIANH KVFLLRDGRI NICGLNTKNV EYVAKAIDET VRAVKSNI // ID 2AAA_CAEEL STANDARD; PRT; 590 AA. AC Q09543; DT 01-NOV-1997 (Rel. 35, Created) DT 10-OCT-2003 (Rel. 42, Last sequence update) DT 01-OCT-2004 (Rel. 45, Last annotation update) DE Probable protein phosphatase PP2A regulatory subunit (Protein DE phosphatase PP2A regulatory subunit A). GN ORFNames=F48E8.5; OS Caenorhabditis elegans. OC Eukaryota; Metazoa; Nematoda; Chromadorea; Rhabditida; Rhabditoidea; OC Rhabditidae; Peloderinae; Caenorhabditis. OX NCBI_TaxID=6239; RN [1] RP SEQUENCE FROM N.A. RC STRAIN=Bristol N2; RX MEDLINE=99069613; PubMed=9851916; RG THE C. ELEGANS SEQUENCING CONSORTIUM; RT "Genome sequence of the nematode C. elegans: a platform for RT investigating biology."; RL Science 282:2012-2018(1998). RN [2] RP REVISIONS. RA Waterston R.; RL Submitted (JUN-2002) to the EMBL/GenBank/DDBJ databases. CC -!- FUNCTION: The PR65 subunit of protein phosphatase 2A serves as a CC scaffolding molecule to coordinate the assembly of the catalytic CC subunit and a variable regulatory B subunit (By similarity). CC -!- SUBUNIT: PP2A exists in several trimeric forms, all of which CC consist of a core composed of a catalytic subunit associated with CC a 65 kDa regulatory subunit (PR65) (subunit A). The core complex CC associates with a third, variable subunit (subunit B), which CC confers distinct properties to the holoenzyme (By similarity). CC -!- DOMAIN: Each HEAT repeat appears to consist of two alpha helices CC joined by a hydrophilic region, the intrarepeat loop. The repeat CC units may be arranged laterally to form a rod-like structure. CC -!- SIMILARITY: Belongs to the phosphatase 2A regulatory subunit A CC family. CC -!- SIMILARITY: Contains 14 HEAT repeats. CC -------------------------------------------------------------------------- CC This SWISS-PROT entry is copyright. It is produced through a collaboration CC between the Swiss Institute of Bioinformatics and the EMBL outstation - CC the European Bioinformatics Institute. There are no restrictions on its CC use by non-profit institutions as long as its content is in no way CC modified and this statement is not removed. Usage by and for commercial CC entities requires a license agreement (See http://www.isb-sib.ch/announce/ CC or send an email to license@isb-sib.ch). CC -------------------------------------------------------------------------- DR EMBL; U23514; AAC46541.2; -. DR PIR; T16411; T16411. DR HSSP; P30153; 1B3U. DR WormPep; F48E8.5; CE30997. DR InterPro; IPR008938; ARM. DR InterPro; IPR000357; HEAT. DR Pfam; PF02985; HEAT; 12. DR PROSITE; PS50077; HEAT_REPEAT; 8. KW Hypothetical protein; Protein phosphatase; Repeat. FT REPEAT 37 73 HEAT 1. FT REPEAT 74 111 HEAT 2. FT REPEAT 113 150 HEAT 3. FT REPEAT 151 188 HEAT 4. FT REPEAT 189 227 HEAT 5. FT REPEAT 228 266 HEAT 6. FT REPEAT 267 305 HEAT 7. FT REPEAT 306 344 HEAT 8. FT REPEAT 349 387 HEAT 9. FT REPEAT 388 426 HEAT 10. FT REPEAT 427 465 HEAT 11. FT REPEAT 466 504 HEAT 12. FT REPEAT 505 543 HEAT 13. FT REPEAT 544 582 HEAT 14. FT DOMAIN 186 189 Poly-Ala. SQ SEQUENCE 590 AA; 66148 MW; E9B6F7DFFEB973E2 CRC64; MSVVEEATDD ALYPIAVLID ELRNEDVTLR LNSIRKLSTI ALALGVERTR NELIQFLTDT IYDEDEVLLV LAEQLGNFTP LVGGPDHVHC LLLPLENLAT VEETVVRDKA VESLRKIADK HSSASLEEHF VPMLRRLATG DWFTSRTSAC GLFSVVYPRV SPAIKSELKS MFRTLCRDDT PMVRRAAAAK LGEFAKVFEK TAVIEGLHSS LTDLHVDEQD SVRLLTVESA IAFGTLLDKA NKKKLIEPIL IELFDDKSWR VRYMVAEKLI EIQNVLGEDM DTTHLVNMYT NLLKDPEGEV RCAATQRLQE FALNLPEDKR QNIICNSLLN VAKELVTDGN QLVKSELAGV IMGLAPLIGK EQTVSELLPI YMQLLNDQTP EVRLNIISSL DKVNEVIGAA QLSTSLLPAI VGLAEDGKWR VRLAIVQFMP LLASQLGQEF FDEKLLPLCL NWLTDHVFSI REASTLIMKE LTQKFGGQWA STNIVPKMQK LQKDTNYLQR MTCLFCLNTL SEAMTQEQIL KEIMPIVKDL VEDDVPNVRF NAAKSLKRIG KNLTPSTLTS EVKPLLEKLG KDSDFDVRYF SEEAKNSLGL // ID Q6ITX2 PRELIMINARY; PRT; 207 AA. AC Q6ITX2; DT 05-JUL-2004 (TrEMBLrel. 27, Created) DT 05-JUL-2004 (TrEMBLrel. 27, Last sequence update) DT 05-JUL-2004 (TrEMBLrel. 27, Last annotation update) DE Methyl-coenzyme M reductase alpha subunit (Fragment). GN Name=mcrA; OS uncultured Methanomicrobiales archaeon. OC Archaea; Euryarchaeota; Methanomicrobia; Methanomicrobiales; OC environmental samples. OX NCBI_TaxID=183760; RN [1] RP SEQUENCE FROM N.A. RA Banning N., Brock F., Parkes R.J., Fry J.C., Weightman A.J.; RL Submitted (MAY-2004) to the EMBL/GenBank/DDBJ databases. DR EMBL; AY625595; AAT45717.1; -. DR InterPro; IPR008924; MCR_alpha_beta_C. DR InterPro; IPR009047; MCR_alpha_C. DR InterPro; IPR009024; MCR_fer_like. DR Pfam; PF02249; MCR_alpha; 1. FT NON_TER 1 1 FT NON_TER 207 207 SQ SEQUENCE 207 AA; 22849 MW; 5309DD59248C9038 CRC64; WHSLAKHAGV IQMGDILPAR RARGPNEPGG IKFGHFADMV QTDRKYPNDP ARASLEVVGA GTMLFDQIWL GSYMSGGVGF TQYATAAYTD NILDDYTYYG MDYIKSKYKV NWQSPSEKDK VKATQDVVND IATEVNLYGM EQYEQYPTAL EDHFGGSQRA SVLAAASGLS VSIATGNSNA GLNGWYLSML MHKEGWSRLG FFGYDLQ // ID Q6L781 PRELIMINARY; PRT; 216 AA. AC Q6L781; DT 05-JUL-2004 (TrEMBLrel. 27, Created) DT 05-JUL-2004 (TrEMBLrel. 27, Last sequence update) DT 05-JUL-2004 (TrEMBLrel. 27, Last annotation update) DE Methyl-coenzyme M reductase alpha subunit (Fragment). GN Name=mcrA; OS uncultured Methanomicrobiales archaeon. OC Archaea; Euryarchaeota; Methanomicrobia; Methanomicrobiales; OC environmental samples. OX NCBI_TaxID=183760; RN [1] RP SEQUENCE FROM N.A. RX PubMed=15240282; RA Shigematsu T., Tang Y., Kobayashi T., Kawaguchi H., Morimura S., RA Kida K.; RT "Effect of Dilution Rate on Metabolic Pathway Shift between RT Aceticlastic and Nonaceticlastic Methanogenesis in Chemostat RT Cultivation."; RL Appl. Environ. Microbiol. 70:4048-4052(2004). DR EMBL; AB158527; BAD21106.1; -. DR InterPro; IPR008924; MCR_alpha_beta_C. DR InterPro; IPR009047; MCR_alpha_C. DR InterPro; IPR009024; MCR_fer_like. DR Pfam; PF02249; MCR_alpha; 1. FT NON_TER 1 1 FT NON_TER 216 216 SQ SEQUENCE 216 AA; 23541 MW; 5265242473ED9CFE CRC64; FIGAYRMCAG EAAVADLAFA AKHAGVVQMA THLPARRARG PNEPGGLAFG LFSDIIQGNR KYPHDPAKAS FEVVGAGTML YDQIWLGSYM SGGVGFTQYA TAAYTDNILD EFTYYGMDYI KDKYKVDWKN PSPKDRVKPT QEIVNDIITE VALNAMEQYE QYPTMMEDHF GGSQRAGVIA AACGLSTSIA TGNSNAGLNG WYLSMLLHKE GWSRLG // ID Q6SEI7 PRELIMINARY; PRT; 162 AA. AC Q6SEI7; DT 05-JUL-2004 (TrEMBLrel. 27, Created) DT 05-JUL-2004 (TrEMBLrel. 27, Last sequence update) DT 05-JUL-2004 (TrEMBLrel. 27, Last annotation update) DE Methyl-coenzyme M reductase alpha subunit (Fragment). GN Name=mcrA; OS uncultured euryarchaeote. OC Archaea; Euryarchaeota; environmental samples. OX NCBI_TaxID=114243; RN [1] RP SEQUENCE FROM N.A. RA Castro H., Reddy K.R., Ogram A.; RL Submitted (NOV-2003) to the EMBL/GenBank/DDBJ databases. DR EMBL; AY459319; AAR24561.1; -. DR InterPro; IPR008924; MCR_alpha_beta_C. DR InterPro; IPR009047; MCR_alpha_C. DR Pfam; PF02249; MCR_alpha; 1. FT NON_TER 1 1 FT NON_TER 162 162 SQ SEQUENCE 162 AA; 18115 MW; 3FF9CD3C09CBC441 CRC64; WCRFTQYATA AYTDNILDEY TYYGMDYIKD KYKVDWKNPN DKDKVKPTQD IANDMATEVA LNGMEQYEQF PTLMEDHFGG SQRAGVLAAA CGLTASIATG NSNAGLNAWY LCMLLHKEGW SRLGFFGYDL QDQCGSANSL AIRPDEGAIG ELRGPNYPNY AM // From basu at pharm.sunysb.edu Fri Oct 15 14:39:31 2004 From: basu at pharm.sunysb.edu (Siddhartha Basu) Date: Fri Oct 15 22:09:44 2004 Subject: [Bioperl-l] problem with swissprot parsin In-Reply-To: <872C8BD1-1ECF-11D9-B102-000A959EB4C4@gmx.net> References: <872C8BD1-1ECF-11D9-B102-000A959EB4C4@gmx.net> Message-ID: <41701963.5080309@pharm.sunysb.edu> Hi hilmar, I am using perl 5.8.3 and bioperl-live. Here is the code: #!/usr/bin/perl -w # use strict; use Bio::DB::Flat; # die "no files\n" unless @ARGV; my $LOCATION = "."; # my $db = Bio::DB::Flat->new( -directory => $LOCATION, -dbname => "swissall", -format => "swiss", -index => "bdb", -write_flag => 1, ) or die "can't create BioFlat indexes\n"; $db->build_index(@ARGV); #print "Done indexing\n"; my $seq = $db->get_Seq_by_acc("Q09543"); print $seq->seq,"\n"; exit; Here is the error: === Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 856, line 80. Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 1002, line 154. Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 1002, line 182. Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 1002, line 214. ==== And i have attached the test file. -siddhartha Hilmar Lapp wrote: > The RG/RA issue has been fixed on the main trunk I believe. > > Aside from that, different versions of perl will also lead to things > being complained about or remaining silent. Generally, *always* add the > version of bioperl you are using if you report a problem. > > -hilmar > > On Friday, October 15, 2004, at 09:55 AM, Siddhartha Basu wrote: > >> Hi Brian, >> I retested it again. The good part is that i can fetch the seq obj >> and the sequence now. The warnings are still there. I will try to >> index the entire swissprot data file and see what happens. >> >> Now,as mentioned by one of the earlier mail in the list that it has >> to with the absence of RA records in recent swissprot files and the >> swiss.pm modules spewing out warnings when the variable $au is not >> getting the data. Since you are even getting the warnings what >> version of bioperl you are running. >> >> -siddhartha >> >> >> >> >> >> Brian Osborne wrote: >> >>> Siddhartha, >>> Changing @files to @ARGV makes your script index without warnings on my >>> machine, using your Swissprot file or mine. It also retrieves a >>> sequence. >>> Below... >>> Brian O. >>> #!/usr/bin/perl -w >>> use strict; >>> use Bio::DB::Flat; >>> die "no files\n" unless @ARGV; >>> my $LOCATION = "."; >>> my $db = Bio::DB::Flat->new( -directory => $LOCATION, >>> -dbname => "swissall", >>> -format => "swiss", >>> -index => "bdb", >>> -write_flag => 1, >>> ) or die "can't create BioFlat >>> indexes\n"; >>> $db->build_index(@ARGV); >>> print "Done indexing\n"; >>> my $seq = $db->get_Seq_by_acc("P41932"); >>> print $seq->seq; >>> -----Original Message----- >>> From: bioperl-l-bounces@portal.open-bio.org >>> [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of >>> Siddhartha Basu >>> Sent: Thursday, October 14, 2004 4:54 PM >>> To: Brian Osborne >>> Cc: bioperl-l@bioperl.org >>> Subject: Re: [Bioperl-l] problem with swissprot parsin >>> Hi Brian, >>> Changed it, problem persists. >>> -siddhartha >>> Brian Osborne wrote: >>> >>>> Siddhartha, >>>> >>>> Change @files to @ARGV in the build_index line. Does that fix it? >>>> >>>> Brian O. >>>> >>>> -----Original Message----- >>>> From: Siddhartha Basu [mailto:basu@pharm.sunysb.edu] >>>> Sent: Thursday, October 14, 2004 4:15 PM >>>> To: Brian Osborne >>>> Cc: bioperl-l@bioperl.org >>>> Subject: Re: [Bioperl-l] problem with swissprot parsin >>>> >>>> Hi Brian, >>>> Here is the code that started to give the following error. I presume i >>>> am using Bio::DB::Flat::BDB though i haven't called it directly. I am >>>> trying to index swissprot/trembl files here. >>>> >>>> #!/usr/bin/perl -w >>>> use strict; >>>> use Bio::DB::Flat; >>>> >>>> die "no files\n" unless @ARGV; >>>> my $LOCATION = "/home/basu/odbaindex"; >>>> >>>> my $db = Bio::DB::Flat->new( -directory => $LOCATION, >>>> -dbname => "swissall", >>>> -format => "swiss", >>>> -index => "bdb", >>>> -write_flag => 1, >>>> ) or die "can't create BioFlat >>>> indexes\n"; >>>> $db->build_index(@files); >>>> print "Done indexing\n"; >>>> >>>> exit; >>>> >>>> >>>> I get the following warinings. >>>> >>>> ===================================================================== = >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18676877. >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18676916. >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18676956. >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18677002. >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> ===================================================================== >>>> ==== >>>> >>>> I have done a small test with Bio::SeqIO module using a small test >>>> file(swiss.test). Here is the code. >>>> >>>> #!/usr/bin/perl -w >>>> # >>>> use strict; >>>> use Bio::SeqIO; >>>> >>>> my $seq = Bio::SeqIO->new(-file => $ARGV[0], -format => "swiss"); >>>> >>>> while (my $in = $seq->next_seq) { >>>> print $in->id,"\n"; >>>> } >>>> >>>> exit; >>>> >>>> >>>> It gives the same error >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>> >>> 28. >>> >>>> 1433_CAEEL >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>> >>> 87. >>> >>>> A4_CAEEL >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>> >>> 171. >>> >>>> AATC_CAEEL >>>> >>>> I have also attached the test file. >>>> >>>> Hope this will give some clue for the problem. >>>> Thanks for the response. >>>> >>>> siddhartha >>>> >>>> >>>> >>>> Brian Osborne wrote: >>>> >>>> >>>>> Siddhartha, >>>>> >>>>> Bio::DB::Flat::BinarySearch or Bio::DB::Flat::BDB? Also, please >>>>> show your >>>>> code when you ask a question, it simplifies matters. For example, >>>>> it would >>>>> tell me which module you used, which file format, and so on. It >>>>> also helps >>>>> to attach the actual sequence files, or some smaller test file >>>>> that shows >>>>> the same error. What happens occasionally is that a question will get >>>>> ignored for the simple reason that no one knows how to answer, >>>>> there's not >>>>> enough information given in the letter. >>>>> >>>>> Brian O. >>>>> >>>>> -----Original Message----- >>>>> From: bioperl-l-bounces@portal.open-bio.org >>>>> [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of >>>>> Siddhartha Basu >>>>> Sent: Thursday, October 14, 2004 2:51 PM >>>>> To: bioperl-l@bioperl.org >>>>> Subject: [Bioperl-l] problem with swissprot parsin >>>>> >>>>> Hi, >>>>> I have already described this problem in this mailing list but >>>>> haven't >>>>> got anybodies attention yet. I had also asked the author of this >>>>> module >>>>> but nothing back yet. Anyway i really could'nt figure out how to >>>>> solve >>>>> this and so i am writing again. I have also tried by replacing the >>>>> swiss.pm module from the bioperl-live version. But the problem >>>>> persists. >>>>> I understand that this is a maintained module and i am not getting >>>>> ignored because of maintenance issue. >>>>> >>>>> I am trying to make a flat file index of swissprot/trembl files using >>>>> Bio::DB::Flat module. However, i am getting the following consistent >>>>> warnings during the indexing process. >>>>> ==================================================================== >>>>> == >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18676877. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18676916. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18676956. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18677002. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18677045. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18677091. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18677136. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18677178. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18677209. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18677249. >>>>> ==================================================================== >>>>> ==== >>>>> Though, the indexing get completed, i could'nt fetch any data from >>>>> there >>>>> as it does not return any seq obj. >>>>> I also get the same warnings when i try to read the swissprot file >>>>> using >>>>> the Bio::SeqIO module. >>>>> I am using bioperl-1.4 and understand it has something to do with the >>>>> swissprot parser in Seq::IO module. >>>>> So, does any fix or solution available for this problem. >>>>> >>>>> Thanks in advance. >>>>> >>>>> -siddhartha >>>>> _______________________________________________ >>>>> Bioperl-l mailing list >>>>> Bioperl-l@portal.open-bio.org >>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l >>>>> >>>>> >>>> >>>> >>>> >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l@portal.open-bio.org >>> http://portal.open-bio.org/mailman/listinfo/bioperl-l >> >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l@portal.open-bio.org >> http://portal.open-bio.org/mailman/listinfo/bioperl-l >> >> -------------- next part -------------- ID AATC_CAEEL STANDARD; PRT; 408 AA. AC Q22067; DT 01-NOV-1997 (Rel. 35, Created) DT 01-NOV-1997 (Rel. 35, Last sequence update) DT 01-OCT-2004 (Rel. 45, Last annotation update) DE Probable aspartate aminotransferase, cytoplasmic (EC 2.6.1.1) DE (Transaminase A) (Glutamate oxaloacetate transaminase-1). GN ORFNames=T01C8.5; OS Caenorhabditis elegans. OC Eukaryota; Metazoa; Nematoda; Chromadorea; Rhabditida; Rhabditoidea; OC Rhabditidae; Peloderinae; Caenorhabditis. OX NCBI_TaxID=6239; RN [1] RP SEQUENCE FROM N.A. RC STRAIN=Bristol N2; RX MEDLINE=99069613; PubMed=9851916; RG THE C. ELEGANS SEQUENCING CONSORTIUM; RT "Genome sequence of the nematode C. elegans: a platform for RT investigating biology."; RL Science 282:2012-2018(1998). CC -!- CATALYTIC ACTIVITY: L-aspartate + 2-oxoglutarate = oxaloacetate + CC L-glutamate. CC -!- COFACTOR: Pyridoxal phosphate (By similarity). CC -!- SUBUNIT: Homodimer (By similarity). CC -!- SUBCELLULAR LOCATION: Cytoplasmic (Potential). CC -!- MISCELLANEOUS: In eukaryotes there are cytoplasmic, mitochondrial CC and chloroplastic isozymes. CC -!- SIMILARITY: Belongs to the class-I pyridoxal-phosphate-dependent CC aminotransferase family. CC -------------------------------------------------------------------------- CC This SWISS-PROT entry is copyright. It is produced through a collaboration CC between the Swiss Institute of Bioinformatics and the EMBL outstation - CC the European Bioinformatics Institute. There are no restrictions on its CC use by non-profit institutions as long as its content is in no way CC modified and this statement is not removed. Usage by and for commercial CC entities requires a license agreement (See http://www.isb-sib.ch/announce/ CC or send an email to license@isb-sib.ch). CC -------------------------------------------------------------------------- DR EMBL; U58726; AAB00578.1; -. DR PIR; T29857; T29857. DR HSSP; P00503; 1AJS. DR WormPep; T01C8.5; CE07462. DR InterPro; IPR004839; Aminotrans_I/II. DR InterPro; IPR000796; Asp_trans. DR InterPro; IPR004838; NHtransf_1_BS. DR Pfam; PF00155; Aminotran_1_2; 1. DR PRINTS; PR00799; TRANSAMINASE. DR PROSITE; PS00105; AA_TRANSFER_CLASS_1; 1. KW Aminotransferase; Pyridoxal phosphate; Transferase. FT BINDING 251 251 Pyridoxal phosphate (By similarity). SQ SEQUENCE 408 AA; 45493 MW; A4DDCBCB8C0EFD83 CRC64; MSFFDGIPVA PPIEVFHKNK MYLDETAPVK VNLTIGAYRT EEGQPWVLPV VHETEVEIAN DTSLNHEYLP VLGHEGFRKA ATELVLGAES PAIKEERSFG VQCLSGTGAL RAGAEFLASV CNMKTVYVSN PTWGNHKLVF KKAGFTTVAD YTFWDYDNKR VHIEKFLSDL ESAPEKSVII LHGCAHNPTG MDPTQEQWKL VAEVIKRKNL FTFFDIAYQG FASGDPAADA WAIRYFVDQG MEMVVSQSFA KNFGLYNERV GNLTVVVNNP AVIAGFQSQM SLVIRANWSN PPAHGARIVH KVLTTPARRE QWNQSIQAMS SRIKQMRAAL LRHLMDLGTP GTWDHIIQQI GMFSYTGLTS AQVDHLIANH KVFLLRDGRI NICGLNTKNV EYVAKAIDET VRAVKSNI // ID 2AAA_CAEEL STANDARD; PRT; 590 AA. AC Q09543; DT 01-NOV-1997 (Rel. 35, Created) DT 10-OCT-2003 (Rel. 42, Last sequence update) DT 01-OCT-2004 (Rel. 45, Last annotation update) DE Probable protein phosphatase PP2A regulatory subunit (Protein DE phosphatase PP2A regulatory subunit A). GN ORFNames=F48E8.5; OS Caenorhabditis elegans. OC Eukaryota; Metazoa; Nematoda; Chromadorea; Rhabditida; Rhabditoidea; OC Rhabditidae; Peloderinae; Caenorhabditis. OX NCBI_TaxID=6239; RN [1] RP SEQUENCE FROM N.A. RC STRAIN=Bristol N2; RX MEDLINE=99069613; PubMed=9851916; RG THE C. ELEGANS SEQUENCING CONSORTIUM; RT "Genome sequence of the nematode C. elegans: a platform for RT investigating biology."; RL Science 282:2012-2018(1998). RN [2] RP REVISIONS. RA Waterston R.; RL Submitted (JUN-2002) to the EMBL/GenBank/DDBJ databases. CC -!- FUNCTION: The PR65 subunit of protein phosphatase 2A serves as a CC scaffolding molecule to coordinate the assembly of the catalytic CC subunit and a variable regulatory B subunit (By similarity). CC -!- SUBUNIT: PP2A exists in several trimeric forms, all of which CC consist of a core composed of a catalytic subunit associated with CC a 65 kDa regulatory subunit (PR65) (subunit A). The core complex CC associates with a third, variable subunit (subunit B), which CC confers distinct properties to the holoenzyme (By similarity). CC -!- DOMAIN: Each HEAT repeat appears to consist of two alpha helices CC joined by a hydrophilic region, the intrarepeat loop. The repeat CC units may be arranged laterally to form a rod-like structure. CC -!- SIMILARITY: Belongs to the phosphatase 2A regulatory subunit A CC family. CC -!- SIMILARITY: Contains 14 HEAT repeats. CC -------------------------------------------------------------------------- CC This SWISS-PROT entry is copyright. It is produced through a collaboration CC between the Swiss Institute of Bioinformatics and the EMBL outstation - CC the European Bioinformatics Institute. There are no restrictions on its CC use by non-profit institutions as long as its content is in no way CC modified and this statement is not removed. Usage by and for commercial CC entities requires a license agreement (See http://www.isb-sib.ch/announce/ CC or send an email to license@isb-sib.ch). CC -------------------------------------------------------------------------- DR EMBL; U23514; AAC46541.2; -. DR PIR; T16411; T16411. DR HSSP; P30153; 1B3U. DR WormPep; F48E8.5; CE30997. DR InterPro; IPR008938; ARM. DR InterPro; IPR000357; HEAT. DR Pfam; PF02985; HEAT; 12. DR PROSITE; PS50077; HEAT_REPEAT; 8. KW Hypothetical protein; Protein phosphatase; Repeat. FT REPEAT 37 73 HEAT 1. FT REPEAT 74 111 HEAT 2. FT REPEAT 113 150 HEAT 3. FT REPEAT 151 188 HEAT 4. FT REPEAT 189 227 HEAT 5. FT REPEAT 228 266 HEAT 6. FT REPEAT 267 305 HEAT 7. FT REPEAT 306 344 HEAT 8. FT REPEAT 349 387 HEAT 9. FT REPEAT 388 426 HEAT 10. FT REPEAT 427 465 HEAT 11. FT REPEAT 466 504 HEAT 12. FT REPEAT 505 543 HEAT 13. FT REPEAT 544 582 HEAT 14. FT DOMAIN 186 189 Poly-Ala. SQ SEQUENCE 590 AA; 66148 MW; E9B6F7DFFEB973E2 CRC64; MSVVEEATDD ALYPIAVLID ELRNEDVTLR LNSIRKLSTI ALALGVERTR NELIQFLTDT IYDEDEVLLV LAEQLGNFTP LVGGPDHVHC LLLPLENLAT VEETVVRDKA VESLRKIADK HSSASLEEHF VPMLRRLATG DWFTSRTSAC GLFSVVYPRV SPAIKSELKS MFRTLCRDDT PMVRRAAAAK LGEFAKVFEK TAVIEGLHSS LTDLHVDEQD SVRLLTVESA IAFGTLLDKA NKKKLIEPIL IELFDDKSWR VRYMVAEKLI EIQNVLGEDM DTTHLVNMYT NLLKDPEGEV RCAATQRLQE FALNLPEDKR QNIICNSLLN VAKELVTDGN QLVKSELAGV IMGLAPLIGK EQTVSELLPI YMQLLNDQTP EVRLNIISSL DKVNEVIGAA QLSTSLLPAI VGLAEDGKWR VRLAIVQFMP LLASQLGQEF FDEKLLPLCL NWLTDHVFSI REASTLIMKE LTQKFGGQWA STNIVPKMQK LQKDTNYLQR MTCLFCLNTL SEAMTQEQIL KEIMPIVKDL VEDDVPNVRF NAAKSLKRIG KNLTPSTLTS EVKPLLEKLG KDSDFDVRYF SEEAKNSLGL // ID Q6ITX2 PRELIMINARY; PRT; 207 AA. AC Q6ITX2; DT 05-JUL-2004 (TrEMBLrel. 27, Created) DT 05-JUL-2004 (TrEMBLrel. 27, Last sequence update) DT 05-JUL-2004 (TrEMBLrel. 27, Last annotation update) DE Methyl-coenzyme M reductase alpha subunit (Fragment). GN Name=mcrA; OS uncultured Methanomicrobiales archaeon. OC Archaea; Euryarchaeota; Methanomicrobia; Methanomicrobiales; OC environmental samples. OX NCBI_TaxID=183760; RN [1] RP SEQUENCE FROM N.A. RA Banning N., Brock F., Parkes R.J., Fry J.C., Weightman A.J.; RL Submitted (MAY-2004) to the EMBL/GenBank/DDBJ databases. DR EMBL; AY625595; AAT45717.1; -. DR InterPro; IPR008924; MCR_alpha_beta_C. DR InterPro; IPR009047; MCR_alpha_C. DR InterPro; IPR009024; MCR_fer_like. DR Pfam; PF02249; MCR_alpha; 1. FT NON_TER 1 1 FT NON_TER 207 207 SQ SEQUENCE 207 AA; 22849 MW; 5309DD59248C9038 CRC64; WHSLAKHAGV IQMGDILPAR RARGPNEPGG IKFGHFADMV QTDRKYPNDP ARASLEVVGA GTMLFDQIWL GSYMSGGVGF TQYATAAYTD NILDDYTYYG MDYIKSKYKV NWQSPSEKDK VKATQDVVND IATEVNLYGM EQYEQYPTAL EDHFGGSQRA SVLAAASGLS VSIATGNSNA GLNGWYLSML MHKEGWSRLG FFGYDLQ // ID Q6L781 PRELIMINARY; PRT; 216 AA. AC Q6L781; DT 05-JUL-2004 (TrEMBLrel. 27, Created) DT 05-JUL-2004 (TrEMBLrel. 27, Last sequence update) DT 05-JUL-2004 (TrEMBLrel. 27, Last annotation update) DE Methyl-coenzyme M reductase alpha subunit (Fragment). GN Name=mcrA; OS uncultured Methanomicrobiales archaeon. OC Archaea; Euryarchaeota; Methanomicrobia; Methanomicrobiales; OC environmental samples. OX NCBI_TaxID=183760; RN [1] RP SEQUENCE FROM N.A. RX PubMed=15240282; RA Shigematsu T., Tang Y., Kobayashi T., Kawaguchi H., Morimura S., RA Kida K.; RT "Effect of Dilution Rate on Metabolic Pathway Shift between RT Aceticlastic and Nonaceticlastic Methanogenesis in Chemostat RT Cultivation."; RL Appl. Environ. Microbiol. 70:4048-4052(2004). DR EMBL; AB158527; BAD21106.1; -. DR InterPro; IPR008924; MCR_alpha_beta_C. DR InterPro; IPR009047; MCR_alpha_C. DR InterPro; IPR009024; MCR_fer_like. DR Pfam; PF02249; MCR_alpha; 1. FT NON_TER 1 1 FT NON_TER 216 216 SQ SEQUENCE 216 AA; 23541 MW; 5265242473ED9CFE CRC64; FIGAYRMCAG EAAVADLAFA AKHAGVVQMA THLPARRARG PNEPGGLAFG LFSDIIQGNR KYPHDPAKAS FEVVGAGTML YDQIWLGSYM SGGVGFTQYA TAAYTDNILD EFTYYGMDYI KDKYKVDWKN PSPKDRVKPT QEIVNDIITE VALNAMEQYE QYPTMMEDHF GGSQRAGVIA AACGLSTSIA TGNSNAGLNG WYLSMLLHKE GWSRLG // ID Q6SEI7 PRELIMINARY; PRT; 162 AA. AC Q6SEI7; DT 05-JUL-2004 (TrEMBLrel. 27, Created) DT 05-JUL-2004 (TrEMBLrel. 27, Last sequence update) DT 05-JUL-2004 (TrEMBLrel. 27, Last annotation update) DE Methyl-coenzyme M reductase alpha subunit (Fragment). GN Name=mcrA; OS uncultured euryarchaeote. OC Archaea; Euryarchaeota; environmental samples. OX NCBI_TaxID=114243; RN [1] RP SEQUENCE FROM N.A. RA Castro H., Reddy K.R., Ogram A.; RL Submitted (NOV-2003) to the EMBL/GenBank/DDBJ databases. DR EMBL; AY459319; AAR24561.1; -. DR InterPro; IPR008924; MCR_alpha_beta_C. DR InterPro; IPR009047; MCR_alpha_C. DR Pfam; PF02249; MCR_alpha; 1. FT NON_TER 1 1 FT NON_TER 162 162 SQ SEQUENCE 162 AA; 18115 MW; 3FF9CD3C09CBC441 CRC64; WCRFTQYATA AYTDNILDEY TYYGMDYIKD KYKVDWKNPN DKDKVKPTQD IANDMATEVA LNGMEQYEQF PTLMEDHFGG SQRAGVLAAA CGLTASIATG NSNAGLNAWY LCMLLHKEGW SRLGFFGYDL QDQCGSANSL AIRPDEGAIG ELRGPNYPNY AM // From chenn at cshl.edu Thu Oct 14 22:33:24 2004 From: chenn at cshl.edu (Jack Chen) Date: Fri Oct 15 22:09:55 2004 Subject: [Bioperl-l] problems with the Bio::Tools::Run::Genewise module Message-ID: Hi, Keith, Jason et al., I need you help with this module. I am trying to run genewise and parse genewise result using the module. The simple script I wrote did not work as expected. While I could get the exon coordinates correctly, I could not retrieve sequence data properly. When I ran the program on command line, I could get correct sequences. Thanks, Jack ============ #!/usr/bin/perl -w use strict; use Getopt::Long; use Bio::SeqIO; use Bio::Tools::Run::Genewise; use Data::Dumper; my ($hmmfile, $gen); GetOptions('hmm|h:s' => \$hmmfile, 'genomic|g:s'=> \$gen); my $genomic_seq = Bio::SeqIO->new(-file => $gen, -format => 'FASTA'); my $factory = Bio::Tools::Run::Genewise->new('both' => 1, 'silent' => 1); $factory->hmmer(1); my @genes = $factory->run($hmmfile, $genomic_seq->next_seq); for my $g (@genes){ my @transcripts = $g->transcripts(); for my $tran (@transcripts){ print $tran->cds, "\n"; } } From grossman at molgen.mpg.de Thu Oct 14 11:50:41 2004 From: grossman at molgen.mpg.de (Steffen Grossmann) Date: Fri Oct 15 22:10:07 2004 Subject: [Bioperl-l] Re: [SO-devel] GFF3 - Bioperl - SO In-Reply-To: References: <416A88AF.1020705@molgen.mpg.de> <416BCB4A.8060303@molgen.mpg.de> Message-ID: <416EA051.7050308@molgen.mpg.de> Dear Allen, I meanwhile understood that Bio::Tools::GFF in connection with Bio::SeqFeature::Tools::IDHandler is doing a lot of the stuff I'd like to have. Somehow, Bio::FeatureIO::gff seems to be a parallel development to the first alternative. I don't know in how far there are plans to bring the two approaches together, but at the moment that seems to be more complicated than just bringing one approach to an acceptable state. Since the Bio::Tools::GFF approach seems to be ahead, I will focus on it at the moment. Nevertheless, I add a small patch which fixes the problem with making features from the lines after the ##FASTA directive. --- patch for Bio::FeatureIO::gff.pm starts here 251a252,255 > while( my $gff_string = $self->_readline() ) { > # we just consume the rest of the file... > } > --- patch ends here Maybe you can add it, because I am not a bioperl developer yet... Steffen Allen Day wrote: >We should keep this onlist, others may be interested as well. > >On Tue, 12 Oct 2004, Steffen Grossmann wrote: > > > >>Dear Allen, >> >>I just had a look at your module and I think its a good start. I >>immediately have a bunch of ideas how to extend it to get where I think >>one should get to. So, I will accept your offer to work on the module >>and apply for a bioperl developer's account. >> >>So here are the first proposals: >>1) Very easy: The 'official' GFF3 specification (you know where, don't >>you?) states that after the ##FASTA directive there are no more >> >> > >Yes, I've written bits of it. > > > >>annotations to follow. So, although the ##FASTA directive is not yet >>implemented, you should make sure that the rest of the file is not >>parsed. At the moment you get back a nonsense-feature for every line >>after the ##FASTA line. >> >> > >Good. Please add. > > > >>2) Actually, it would be nice to be able to retrieve hierarchically >>nested collections of features from a GFF-file, where the hierarchy >>comes from the 'Parent' tag. The concept of parsing a GFF-file >>line-by-line, is somehow not compatible with this, because it naturally >>only can produce flat arrays of SeqFeatures. Possible workarounds are to >>provide some 'unflattening'-mechanism (but where should it naturally >>go?), or methods which directly retrieve an array holding the nested >>SeqFeatures (which would be an extension to the standard 'next_feature' >>approach). I strongly prefer the last option. >> >> > >You might want to take advantage of the ### directive here. Parse >everything up to it and cache, then start returning hierarchical features >from the cache. When the cache empties and the filehandle is still >returning lines, fill the cache again. Rinse, repeat. > > > >>3) Instead of requiring exact compatibility with SOFA, one could also >>simply complain about non SOFA-compatible terms. Additionally, if one >> >> > >No, this violates the spec. If you want to do this you can give a >##Ontology directive to describe where the new terms came from. Feature >type terms need to be SOFA extensions. > > > >>would have a mechanism to map non-SOFA terms to SOFA terms, the module >>could be used to create SOFA compatible versions of existing GFF files >>(which would be a great tool, I think!). >> >> > >You can do this via a callback mechanism to allow custom typemappings. >Good idea. > >-Allen > > > >>These are some thoughts I have. I am not sure whether a discussion about >>the future development of the module, should be conducted within the >>Bioperl-l list, or whether we should do it privately and then only post >>our proposals once we agree... >> >>Greetings! >> >>Steffen >> >>Allen Day wrote: >> >> >> >>>Look at Bio::FeatureIO::gff in bioperl-live. It currently supports >>>lookup/validation of ontology terms via Bio::Ontology::OntologyStore, but >>>doesn't do and cardinality or type/relation enforcement which you seem to >>>be alluding to below. >>> >>>I'd be very pleased if you want to work on this too. Or anyone else on >>>these lists, for that matter :-). >>> >>>-Allen >>> >>> >>>On Mon, 11 Oct 2004, Steffen Grossmann wrote: >>> >>> >>> >>> >>> >>>>Dear all, >>>> >>>>I fancy very much the approach taken by SO(FA) >>>>(http://song.sourceforge.net/) to standardize the vocabulary used for >>>>sequence annotation. Also, the GFF3 format is a nice way to represent >>>>SO-compatible annotations and it would be a great thing to have this all >>>>working seamlessly with bioperl. >>>> >>>>A first step towards such a seamless integration into bioperl would be a >>>>parser which is able to read/write hierarchically nested feature >>>>collections from/to GFF3 files. Such a parser should make use of the >>>>GFF3 specific 'ID' and 'Parent' tags. >>>> >>>>Of course, I know about the 'Bio::Tools::GFF' and >>>>'Bio::SeqFeature::Tools' modules, where some related stuff can be found. >>>>The problem is that the 'Bio::Tools::GFF' module doesn't respect the >>>>'Parent' and 'ID' tag structure and grouping in the 'Unflattener' >>>>approach is also done conceptually different. >>>> >>>>Does anybody know about whether there is someone working on such a >>>>project? Or, if there is no such project, is someone interested in >>>>joining to start it? >>>> >>>>Thanks in advance for any response! >>>> >>>>Steffen >>>> >>>> >>>> >>>> >>>> >>>> >>>_______________________________________________ >>>Bioperl-l mailing list >>>Bioperl-l@portal.open-bio.org >>>http://portal.open-bio.org/mailman/listinfo/bioperl-l >>> >>> >>> >>> >>> >> >> >> >_______________________________________________ >Bioperl-l mailing list >Bioperl-l@portal.open-bio.org >http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > -- %---------------------------------------------% % Steffen Grossmann % % % % Max Planck Institute for Molecular Genetics % % Computational Molecular Biology % %---------------------------------------------% % Ihnestrasse 73 % % 14195 Berlin % % Germany % %---------------------------------------------% % Tel: (++49 +30) 8413-1167 % % Fax: (++49 +30) 8413-1152 % %---------------------------------------------% From mebradley at chem.ufl.edu Fri Oct 15 14:22:04 2004 From: mebradley at chem.ufl.edu (Michael Bradley) Date: Fri Oct 15 22:10:14 2004 Subject: [Bioperl-l] data structure returned from tribeMCL Message-ID: <000601c4b2e3$e33d4420$8601a8c0@bradleydell> After running the Bio::Tools::Run::TribeMCL module I am unable to dereference the data structure returned. The following example given in the module's documentation does not seem to work for me. my $fact = Bio::Tools::Run::TribeMCL->new(@params); # Run the program # returns an array reference to clusters where members are the ids # for example :2 clusters with 3 members per cluster: # $fam = [ [mem1 mem2 mem3],[mem1 mem2 mem3]] # pass in either the blastfile path/searchio obj/the array ref to scores my $fam = $fact->run($sio); # print out your clusters for (my $i = 0; $i [$i]})." members\n"; foreach my $member (@{$fam->[$i]}){ print "\t$member\n"; } } I would greatly appreciate any advice ***************************** Michael E. Bradley **************************** From Mikko.Arvas at postgrad.manchester.ac.uk Thu Oct 14 11:08:28 2004 From: Mikko.Arvas at postgrad.manchester.ac.uk (Mikko Arvas) Date: Fri Oct 15 22:10:38 2004 Subject: [Bioperl-l] basic problems with bioperl-db/biosql Message-ID: <20041014160828.d3cscu8084ckoc4k@webmail2.manchester.ac.uk> Hi, I am trying to get started using bioperl-db, but I am failing miserably. I got bioperl 1.4 and the latest bioperl-db and biosql tarballs from CVS on SuSe 8.1. Installation gave one error: t/simpleseq.....ok 6/59gzip: t/data/Titin.fasta.gz: No such file or directory Can't call method "namespace" on an undefined value at t/simpleseq.t line 48. I tried: > perl load_seqdatabase.pl --dbname biosql --format fasta test.fasta Loading test.fasta ... -------------------- WARNING --------------------- MSG: insert in Bio::DB::BioSQL::SeqAdaptor (driver) failed, values were ("NCRA-XX3-01-000002","NCRA-XX3-01-000002","unknown","NCU10033.1 predicted protein (1437 - 1101)","0","") FKs (9,) Duplicate entry 'unknown-9-0' for key 2 --------------------------------------------------- Could not store unknown: ------------- EXCEPTION ------------- MSG: You're trying to lie about the length: is 56 but you say 1161 etc.... It reads always just one sequence to bioentry/biosequence tables in regardless of the number in file and there are no duplicates in the file. I tried: #!/usr/bin/perl -w use strict; use warnings; use Bio::DB::BioDB; use Bio::SeqIO; my $db = Bio::DB::BioDB->new( -database => 'biosql', -user => 'root', -dbname => 'biosql', -host => 'localhost', -driver => 'mysql'); my $in = Bio::SeqIO->new(-format => 'fasta', -file => 'just_one_seq.fasta'); my $seq = $in->next_seq(); my $pseq = $db->create_persistent($seq); $pseq->namespace('bioperl'); $pseq->create(); No error messages, but nothing goes into the database. Basic DBI connections outside bioperl work, the OBDA howto example of getting sequences from EMBL works, but I can't figure out a way to get the single sequence put to biosql by load_seqdatabase.pl out of there by Bio::DB::Registry. Is my script wrong, is my installion wrong, why load_seqdatabase.pl fails? Please help, mikko From sac at portal.open-bio.org Fri Oct 15 21:56:45 2004 From: sac at portal.open-bio.org (Steve Chervitz) Date: Fri Oct 15 22:10:42 2004 Subject: [Bioperl-l] Deprecating In-Reply-To: Message-ID: As the author of Bio::Tools::RestrictionEnzyme, I give you my imprimatur. In my mind, it was implicitly deprecated when the superior Bio::Restriction modules came out. Steve > From: Brian Osborne > Date: Fri, 15 Oct 2004 17:38:34 -0400 > To: > Subject: [Bioperl-l] Deprecating > > Bioperl-l, > > Any objections to my adding Bio::Tools::RestrictionEnzyme to the DEPRECATED > file? It was replaced by Bio::Restriction a while ago. > > Along the same lines, is there anything else that should be deprecated? > Bio::Tools::GFF? > > Brian O. > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l From brian_osborne at cognia.com Sat Oct 16 00:56:49 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Sat Oct 16 00:56:21 2004 Subject: [Bioperl-l] Deprecating In-Reply-To: <4170500C.8040702@utk.edu> Message-ID: Stefan, I took a look at AlignIO/meme.pm and fixed some obvious problems but I think it's possible that the file used in the tests, t/data/meme.dat, may not have all the information I need to debug the module (and I don't have meme myself). Question: is "strand" ever stipulated in the meme output file? There's no "+" or "-" indicated in meme.dat. This file is the result of an analysis of DNA, so I'm a bit surprised not to see some indication of strand (and the code, before I modified it, was using a regexp that attempted to capture strand information). Can you enlighten me here? Here's one of the relevant sections: Sequence name Start P-value Site ------------- ----- --------- ----------------------- -- 6603 1311 2.59e-15 GGCGCATTGA CAGAAAAATTGAATTCCCACCCCCC AATGAGGAGG 83796 1284 2.59e-15 GGAGGATTGA CAGAAAAATTGAATTCCCACCCCCC AACGAGGAGG 20218 938 6.34e-12 TTTTTGGTAA CCTTAAAATAAAATCCCCACCACCA CTTTTAAAAA 10657 1685 8.70e-12 GGCCCGCGCG CAGACAAAGACATTCCACAGCTCCC GCCCCCTCCA Perhaps when one runs meme with DNA one can tell it to just do 1 strand, rather than both? This would explain the absence of strand information, but it means the regexp changes depending on this mode. Again, I don't have meme or use meme, so you're going to have to tell me, or send me output files with and without strand stipulation. Brian O. -----Original Message----- From: Stefan Kirov [mailto:skirov@utk.edu] Sent: Friday, October 15, 2004 6:33 PM To: Brian Osborne Cc: bioperl-l@bioperl.org Subject: Re: [Bioperl-l] Deprecating I wonder if anyone uses *Bio::AlignIO::meme*. Last time (year ago) it did not work for me and I have not seen anyone committing changes.... Stefan Brian Osborne wrote: >Bioperl-l, > >Any objections to my adding Bio::Tools::RestrictionEnzyme to the DEPRECATED >file? It was replaced by Bio::Restriction a while ago. > >Along the same lines, is there anything else that should be deprecated? >Bio::Tools::GFF? > >Brian O. > > > > >_______________________________________________ >Bioperl-l mailing list >Bioperl-l@portal.open-bio.org >http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- Stefan Kirov, Ph.D. University of Tennessee/Oak Ridge National Laboratory 5700 bldg, PO BOX 2008 MS6164 Oak Ridge TN 37831-6164 USA tel +865 576 5120 fax +865-576-5332 e-mail: skirov@utk.edu sao@ornl.gov "And the wars go on with brainwashed pride For the love of God and our human rights And all these things are swept aside" From brian_osborne at cognia.com Sat Oct 16 10:34:58 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Sat Oct 16 10:34:33 2004 Subject: [Bioperl-l] problem with swissprot parsin In-Reply-To: <41701963.5080309@pharm.sunysb.edu> Message-ID: Siddhartha, >> getting the data. Since you are even getting the warnings what >> version of bioperl you are running. Sorry, I wasn't clear. The script runs, I can retrieve a sequence, and I see no warnings. bioperl-live, perl 5.8.2, Cygwin. Brian O. -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Siddhartha Basu Sent: Friday, October 15, 2004 2:40 PM To: bioperl-l@bioperl.org Subject: Re: [Bioperl-l] problem with swissprot parsin Hi hilmar, I am using perl 5.8.3 and bioperl-live. Here is the code: #!/usr/bin/perl -w # use strict; use Bio::DB::Flat; # die "no files\n" unless @ARGV; my $LOCATION = "."; # my $db = Bio::DB::Flat->new( -directory => $LOCATION, -dbname => "swissall", -format => "swiss", -index => "bdb", -write_flag => 1, ) or die "can't create BioFlat indexes\n"; $db->build_index(@ARGV); #print "Done indexing\n"; my $seq = $db->get_Seq_by_acc("Q09543"); print $seq->seq,"\n"; exit; Here is the error: === Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 856, line 80. Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 1002, line 154. Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 1002, line 182. Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 1002, line 214. ==== And i have attached the test file. -siddhartha Hilmar Lapp wrote: > The RG/RA issue has been fixed on the main trunk I believe. > > Aside from that, different versions of perl will also lead to things > being complained about or remaining silent. Generally, *always* add the > version of bioperl you are using if you report a problem. > > -hilmar > > On Friday, October 15, 2004, at 09:55 AM, Siddhartha Basu wrote: > >> Hi Brian, >> I retested it again. The good part is that i can fetch the seq obj >> and the sequence now. The warnings are still there. I will try to >> index the entire swissprot data file and see what happens. >> >> Now,as mentioned by one of the earlier mail in the list that it has >> to with the absence of RA records in recent swissprot files and the >> swiss.pm modules spewing out warnings when the variable $au is not >> getting the data. Since you are even getting the warnings what >> version of bioperl you are running. >> >> -siddhartha >> >> >> >> >> >> Brian Osborne wrote: >> >>> Siddhartha, >>> Changing @files to @ARGV makes your script index without warnings on my >>> machine, using your Swissprot file or mine. It also retrieves a >>> sequence. >>> Below... >>> Brian O. >>> #!/usr/bin/perl -w >>> use strict; >>> use Bio::DB::Flat; >>> die "no files\n" unless @ARGV; >>> my $LOCATION = "."; >>> my $db = Bio::DB::Flat->new( -directory => $LOCATION, >>> -dbname => "swissall", >>> -format => "swiss", >>> -index => "bdb", >>> -write_flag => 1, >>> ) or die "can't create BioFlat >>> indexes\n"; >>> $db->build_index(@ARGV); >>> print "Done indexing\n"; >>> my $seq = $db->get_Seq_by_acc("P41932"); >>> print $seq->seq; >>> -----Original Message----- >>> From: bioperl-l-bounces@portal.open-bio.org >>> [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of >>> Siddhartha Basu >>> Sent: Thursday, October 14, 2004 4:54 PM >>> To: Brian Osborne >>> Cc: bioperl-l@bioperl.org >>> Subject: Re: [Bioperl-l] problem with swissprot parsin >>> Hi Brian, >>> Changed it, problem persists. >>> -siddhartha >>> Brian Osborne wrote: >>> >>>> Siddhartha, >>>> >>>> Change @files to @ARGV in the build_index line. Does that fix it? >>>> >>>> Brian O. >>>> >>>> -----Original Message----- >>>> From: Siddhartha Basu [mailto:basu@pharm.sunysb.edu] >>>> Sent: Thursday, October 14, 2004 4:15 PM >>>> To: Brian Osborne >>>> Cc: bioperl-l@bioperl.org >>>> Subject: Re: [Bioperl-l] problem with swissprot parsin >>>> >>>> Hi Brian, >>>> Here is the code that started to give the following error. I presume i >>>> am using Bio::DB::Flat::BDB though i haven't called it directly. I am >>>> trying to index swissprot/trembl files here. >>>> >>>> #!/usr/bin/perl -w >>>> use strict; >>>> use Bio::DB::Flat; >>>> >>>> die "no files\n" unless @ARGV; >>>> my $LOCATION = "/home/basu/odbaindex"; >>>> >>>> my $db = Bio::DB::Flat->new( -directory => $LOCATION, >>>> -dbname => "swissall", >>>> -format => "swiss", >>>> -index => "bdb", >>>> -write_flag => 1, >>>> ) or die "can't create BioFlat >>>> indexes\n"; >>>> $db->build_index(@files); >>>> print "Done indexing\n"; >>>> >>>> exit; >>>> >>>> >>>> I get the following warinings. >>>> >>>> ===================================================================== = >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18676877. >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18676916. >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18676956. >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> 18677002. >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>>> ===================================================================== >>>> ==== >>>> >>>> I have done a small test with Bio::SeqIO module using a small test >>>> file(swiss.test). Here is the code. >>>> >>>> #!/usr/bin/perl -w >>>> # >>>> use strict; >>>> use Bio::SeqIO; >>>> >>>> my $seq = Bio::SeqIO->new(-file => $ARGV[0], -format => "swiss"); >>>> >>>> while (my $in = $seq->next_seq) { >>>> print $in->id,"\n"; >>>> } >>>> >>>> exit; >>>> >>>> >>>> It gives the same error >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>> >>> 28. >>> >>>> 1433_CAEEL >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>> >>> 87. >>> >>>> A4_CAEEL >>>> Use of uninitialized value in substitution (s///) at >>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>> line >>> >>> 171. >>> >>>> AATC_CAEEL >>>> >>>> I have also attached the test file. >>>> >>>> Hope this will give some clue for the problem. >>>> Thanks for the response. >>>> >>>> siddhartha >>>> >>>> >>>> >>>> Brian Osborne wrote: >>>> >>>> >>>>> Siddhartha, >>>>> >>>>> Bio::DB::Flat::BinarySearch or Bio::DB::Flat::BDB? Also, please >>>>> show your >>>>> code when you ask a question, it simplifies matters. For example, >>>>> it would >>>>> tell me which module you used, which file format, and so on. It >>>>> also helps >>>>> to attach the actual sequence files, or some smaller test file >>>>> that shows >>>>> the same error. What happens occasionally is that a question will get >>>>> ignored for the simple reason that no one knows how to answer, >>>>> there's not >>>>> enough information given in the letter. >>>>> >>>>> Brian O. >>>>> >>>>> -----Original Message----- >>>>> From: bioperl-l-bounces@portal.open-bio.org >>>>> [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of >>>>> Siddhartha Basu >>>>> Sent: Thursday, October 14, 2004 2:51 PM >>>>> To: bioperl-l@bioperl.org >>>>> Subject: [Bioperl-l] problem with swissprot parsin >>>>> >>>>> Hi, >>>>> I have already described this problem in this mailing list but >>>>> haven't >>>>> got anybodies attention yet. I had also asked the author of this >>>>> module >>>>> but nothing back yet. Anyway i really could'nt figure out how to >>>>> solve >>>>> this and so i am writing again. I have also tried by replacing the >>>>> swiss.pm module from the bioperl-live version. But the problem >>>>> persists. >>>>> I understand that this is a maintained module and i am not getting >>>>> ignored because of maintenance issue. >>>>> >>>>> I am trying to make a flat file index of swissprot/trembl files using >>>>> Bio::DB::Flat module. However, i am getting the following consistent >>>>> warnings during the indexing process. >>>>> ==================================================================== >>>>> == >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18676877. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18676916. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18676956. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18677002. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18677045. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18677091. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18677136. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18677178. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18677209. >>>>> Use of uninitialized value in substitution (s///) at >>>>> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 855, >>>>> line >>>>> 18677249. >>>>> ==================================================================== >>>>> ==== >>>>> Though, the indexing get completed, i could'nt fetch any data from >>>>> there >>>>> as it does not return any seq obj. >>>>> I also get the same warnings when i try to read the swissprot file >>>>> using >>>>> the Bio::SeqIO module. >>>>> I am using bioperl-1.4 and understand it has something to do with the >>>>> swissprot parser in Seq::IO module. >>>>> So, does any fix or solution available for this problem. >>>>> >>>>> Thanks in advance. >>>>> >>>>> -siddhartha >>>>> _______________________________________________ >>>>> Bioperl-l mailing list >>>>> Bioperl-l@portal.open-bio.org >>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l >>>>> >>>>> >>>> >>>> >>>> >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l@portal.open-bio.org >>> http://portal.open-bio.org/mailman/listinfo/bioperl-l >> >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l@portal.open-bio.org >> http://portal.open-bio.org/mailman/listinfo/bioperl-l >> >> From skirov at utk.edu Sat Oct 16 11:41:29 2004 From: skirov at utk.edu (Stefan Kirov) Date: Sat Oct 16 11:40:49 2004 Subject: [Bioperl-l] Deprecating In-Reply-To: References: Message-ID: <41714129.30504@utk.edu> Brian, Brian Osborne wrote: >Stefan, > >I took a look at AlignIO/meme.pm and fixed some obvious problems but I think >it's possible that the file used in the tests, t/data/meme.dat, may not have >all the information I need to debug the module (and I don't have meme >myself). > I don't think there were tests for AlignIO/meme.pm. Anyway id there are I am not able to find these. t/data/meme.dat is a test file for Bio/Matrix/PSM/IO/meme.pm. But as this is presumably the same format AlignIO/meme.pm should read.... > Question: is "strand" ever stipulated in the meme output file? >There's no "+" or "-" indicated in meme.dat. This file is the result of an >analysis of DNA, so I'm a bit surprised not to see some indication of strand >(and the code, before I modified it, was using a regexp that attempted to >capture strand information). Can you enlighten me here? Here's one of the >relevant sections: > > >Sequence name Start P-value Site >------------- ----- --------- ----------------------- >-- >6603 1311 2.59e-15 GGCGCATTGA >CAGAAAAATTGAATTCCCACCCCCC AATGAGGAGG >83796 1284 2.59e-15 GGAGGATTGA >CAGAAAAATTGAATTCCCACCCCCC AACGAGGAGG >20218 938 6.34e-12 TTTTTGGTAA >CCTTAAAATAAAATCCCCACCACCA CTTTTAAAAA >10657 1685 8.70e-12 GGCCCGCGCG >CAGACAAAGACATTCCACAGCTCCC GCCCCCTCCA > >Perhaps when one runs meme with DNA one can tell it to just do 1 strand, >rather than both? > You are quite right on this. I had somewhere an example with strands... I'll find it (or regenrate it) ASAP and send it to you. I will try to rewrite the tests for meme (other one) for the new test file. > This would explain the absence of strand information, but >it means the regexp changes depending on this mode. Again, I don't have meme >or use meme, so you're going to have to tell me, or send me output files >with and without strand stipulation. > >Brian O. > >-----Original Message----- >From: Stefan Kirov [mailto:skirov@utk.edu] >Sent: Friday, October 15, 2004 6:33 PM >To: Brian Osborne >Cc: bioperl-l@bioperl.org >Subject: Re: [Bioperl-l] Deprecating > >I wonder if anyone uses *Bio::AlignIO::meme*. Last time (year ago) it >did not work for me and I have not seen anyone committing changes.... >Stefan > >Brian Osborne wrote: > > > >>Bioperl-l, >> >>Any objections to my adding Bio::Tools::RestrictionEnzyme to the DEPRECATED >>file? It was replaced by Bio::Restriction a while ago. >> >>Along the same lines, is there anything else that should be deprecated? >>Bio::Tools::GFF? >> >>Brian O. >> >> >> >> >>_______________________________________________ >>Bioperl-l mailing list >>Bioperl-l@portal.open-bio.org >>http://portal.open-bio.org/mailman/listinfo/bioperl-l >> >> >> >> > >-- >Stefan Kirov, Ph.D. >University of Tennessee/Oak Ridge National Laboratory >5700 bldg, PO BOX 2008 MS6164 >Oak Ridge TN 37831-6164 >USA >tel +865 576 5120 >fax +865-576-5332 >e-mail: skirov@utk.edu >sao@ornl.gov > >"And the wars go on with brainwashed pride >For the love of God and our human rights >And all these things are swept aside" > > > > -- Stefan Kirov, Ph.D. University of Tennessee/Oak Ridge National Laboratory 5700 bldg, PO BOX 2008 MS6164 Oak Ridge TN 37831-6164 USA tel +865 576 5120 fax +865-576-5332 e-mail: skirov@utk.edu sao@ornl.gov "And the wars go on with brainwashed pride For the love of God and our human rights And all these things are swept aside" From brian_osborne at cognia.com Sat Oct 16 15:59:04 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Sat Oct 16 15:58:04 2004 Subject: [Bioperl-l] Deprecating In-Reply-To: <41714129.30504@utk.edu> Message-ID: Stefan, If you want to help with meme tests just add them to AlignIO.t, it's the section at the end. Brian O. -----Original Message----- From: Stefan Kirov [mailto:skirov@utk.edu] Sent: Saturday, October 16, 2004 11:41 AM To: Brian Osborne Cc: bioperl-l@bioperl.org Subject: Re: [Bioperl-l] Deprecating Brian, Brian Osborne wrote: >Stefan, > >I took a look at AlignIO/meme.pm and fixed some obvious problems but I think >it's possible that the file used in the tests, t/data/meme.dat, may not have >all the information I need to debug the module (and I don't have meme >myself). > I don't think there were tests for AlignIO/meme.pm. Anyway id there are I am not able to find these. t/data/meme.dat is a test file for Bio/Matrix/PSM/IO/meme.pm. But as this is presumably the same format AlignIO/meme.pm should read.... > Question: is "strand" ever stipulated in the meme output file? >There's no "+" or "-" indicated in meme.dat. This file is the result of an >analysis of DNA, so I'm a bit surprised not to see some indication of strand >(and the code, before I modified it, was using a regexp that attempted to >capture strand information). Can you enlighten me here? Here's one of the >relevant sections: > > >Sequence name Start P-value Site >------------- ----- --------- ---------------------- - >-- >6603 1311 2.59e-15 GGCGCATTGA >CAGAAAAATTGAATTCCCACCCCCC AATGAGGAGG >83796 1284 2.59e-15 GGAGGATTGA >CAGAAAAATTGAATTCCCACCCCCC AACGAGGAGG >20218 938 6.34e-12 TTTTTGGTAA >CCTTAAAATAAAATCCCCACCACCA CTTTTAAAAA >10657 1685 8.70e-12 GGCCCGCGCG >CAGACAAAGACATTCCACAGCTCCC GCCCCCTCCA > >Perhaps when one runs meme with DNA one can tell it to just do 1 strand, >rather than both? > You are quite right on this. I had somewhere an example with strands... I'll find it (or regenrate it) ASAP and send it to you. I will try to rewrite the tests for meme (other one) for the new test file. > This would explain the absence of strand information, but >it means the regexp changes depending on this mode. Again, I don't have meme >or use meme, so you're going to have to tell me, or send me output files >with and without strand stipulation. > >Brian O. > >-----Original Message----- >From: Stefan Kirov [mailto:skirov@utk.edu] >Sent: Friday, October 15, 2004 6:33 PM >To: Brian Osborne >Cc: bioperl-l@bioperl.org >Subject: Re: [Bioperl-l] Deprecating > >I wonder if anyone uses *Bio::AlignIO::meme*. Last time (year ago) it >did not work for me and I have not seen anyone committing changes.... >Stefan > >Brian Osborne wrote: > > > >>Bioperl-l, >> >>Any objections to my adding Bio::Tools::RestrictionEnzyme to the DEPRECATED >>file? It was replaced by Bio::Restriction a while ago. >> >>Along the same lines, is there anything else that should be deprecated? >>Bio::Tools::GFF? >> >>Brian O. >> >> >> >> >>_______________________________________________ >>Bioperl-l mailing list >>Bioperl-l@portal.open-bio.org >>http://portal.open-bio.org/mailman/listinfo/bioperl-l >> >> >> >> > >-- >Stefan Kirov, Ph.D. >University of Tennessee/Oak Ridge National Laboratory >5700 bldg, PO BOX 2008 MS6164 >Oak Ridge TN 37831-6164 >USA >tel +865 576 5120 >fax +865-576-5332 >e-mail: skirov@utk.edu >sao@ornl.gov > >"And the wars go on with brainwashed pride >For the love of God and our human rights >And all these things are swept aside" > > > > -- Stefan Kirov, Ph.D. University of Tennessee/Oak Ridge National Laboratory 5700 bldg, PO BOX 2008 MS6164 Oak Ridge TN 37831-6164 USA tel +865 576 5120 fax +865-576-5332 e-mail: skirov@utk.edu sao@ornl.gov "And the wars go on with brainwashed pride For the love of God and our human rights And all these things are swept aside" From skirov at utk.edu Sat Oct 16 16:40:49 2004 From: skirov at utk.edu (Stefan Kirov) Date: Sat Oct 16 16:39:58 2004 Subject: [Bioperl-l] Deprecating In-Reply-To: References: Message-ID: <41718751.3010108@utk.edu> Brian, My question is if we need another meme parser? If you think this is necessary I can add them... What do you think? Stefan Brian Osborne wrote: >Stefan, > >If you want to help with meme tests just add them to AlignIO.t, it's the >section at the end. > >Brian O. > > >-----Original Message----- >From: Stefan Kirov [mailto:skirov@utk.edu] >Sent: Saturday, October 16, 2004 11:41 AM >To: Brian Osborne >Cc: bioperl-l@bioperl.org >Subject: Re: [Bioperl-l] Deprecating > >Brian, > >Brian Osborne wrote: > > > >>Stefan, >> >>I took a look at AlignIO/meme.pm and fixed some obvious problems but I >> >> >think > > >>it's possible that the file used in the tests, t/data/meme.dat, may not >> >> >have > > >>all the information I need to debug the module (and I don't have meme >>myself). >> >> >> >I don't think there were tests for AlignIO/meme.pm. Anyway id there are >I am not able to find these. t/data/meme.dat is a test file for >Bio/Matrix/PSM/IO/meme.pm. But as this is presumably the same format >AlignIO/meme.pm should read.... > > > >>Question: is "strand" ever stipulated in the meme output file? >>There's no "+" or "-" indicated in meme.dat. This file is the result of an >>analysis of DNA, so I'm a bit surprised not to see some indication of >> >> >strand > > >>(and the code, before I modified it, was using a regexp that attempted to >>capture strand information). Can you enlighten me here? Here's one of the >>relevant sections: >> >> >>Sequence name Start P-value Site >>------------- ----- --------- ---------------------- >> >> >- > > >>-- >>6603 1311 2.59e-15 GGCGCATTGA >>CAGAAAAATTGAATTCCCACCCCCC AATGAGGAGG >>83796 1284 2.59e-15 GGAGGATTGA >>CAGAAAAATTGAATTCCCACCCCCC AACGAGGAGG >>20218 938 6.34e-12 TTTTTGGTAA >>CCTTAAAATAAAATCCCCACCACCA CTTTTAAAAA >>10657 1685 8.70e-12 GGCCCGCGCG >>CAGACAAAGACATTCCACAGCTCCC GCCCCCTCCA >> >>Perhaps when one runs meme with DNA one can tell it to just do 1 strand, >>rather than both? >> >> >> >You are quite right on this. I had somewhere an example with strands... >I'll find it (or regenrate it) ASAP and send it to you. I will try to >rewrite the tests for meme (other one) for the new test file. > > > >>This would explain the absence of strand information, but >>it means the regexp changes depending on this mode. Again, I don't have >> >> >meme > > >>or use meme, so you're going to have to tell me, or send me output files >>with and without strand stipulation. >> >>Brian O. >> >>-----Original Message----- >>From: Stefan Kirov [mailto:skirov@utk.edu] >>Sent: Friday, October 15, 2004 6:33 PM >>To: Brian Osborne >>Cc: bioperl-l@bioperl.org >>Subject: Re: [Bioperl-l] Deprecating >> >>I wonder if anyone uses *Bio::AlignIO::meme*. Last time (year ago) it >>did not work for me and I have not seen anyone committing changes.... >>Stefan >> >>Brian Osborne wrote: >> >> >> >> >> >>>Bioperl-l, >>> >>>Any objections to my adding Bio::Tools::RestrictionEnzyme to the >>> >>> >DEPRECATED > > >>>file? It was replaced by Bio::Restriction a while ago. >>> >>>Along the same lines, is there anything else that should be deprecated? >>>Bio::Tools::GFF? >>> >>>Brian O. >>> >>> >>> >>> >>>_______________________________________________ >>>Bioperl-l mailing list >>>Bioperl-l@portal.open-bio.org >>>http://portal.open-bio.org/mailman/listinfo/bioperl-l >>> >>> >>> >>> >>> >>> >>-- >>Stefan Kirov, Ph.D. >>University of Tennessee/Oak Ridge National Laboratory >>5700 bldg, PO BOX 2008 MS6164 >>Oak Ridge TN 37831-6164 >>USA >>tel +865 576 5120 >>fax +865-576-5332 >>e-mail: skirov@utk.edu >>sao@ornl.gov >> >>"And the wars go on with brainwashed pride >>For the love of God and our human rights >>And all these things are swept aside" >> >> >> >> >> >> > >-- >Stefan Kirov, Ph.D. >University of Tennessee/Oak Ridge National Laboratory >5700 bldg, PO BOX 2008 MS6164 >Oak Ridge TN 37831-6164 >USA >tel +865 576 5120 >fax +865-576-5332 >e-mail: skirov@utk.edu >sao@ornl.gov > >"And the wars go on with brainwashed pride >For the love of God and our human rights >And all these things are swept aside" > > > > -- Stefan Kirov, Ph.D. University of Tennessee/Oak Ridge National Laboratory 5700 bldg, PO BOX 2008 MS6164 Oak Ridge TN 37831-6164 USA tel +865 576 5120 fax +865-576-5332 e-mail: skirov@utk.edu sao@ornl.gov "And the wars go on with brainwashed pride For the love of God and our human rights And all these things are swept aside" From brian_osborne at cognia.com Sat Oct 16 18:12:22 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Sat Oct 16 18:12:14 2004 Subject: [Bioperl-l] Deprecating In-Reply-To: <41718751.3010108@utk.edu> Message-ID: Stefan, Done, we hope. AlignIO/meme.pm passes its tests whether or not there's a strand column. Now if you'd like to put it through its paces with real scripts that would certainly help, but for the moment I can't do much more, and the Alignment objects look reasonable in the debugger. Brian O. -----Original Message----- From: Stefan Kirov [mailto:skirov@utk.edu] Sent: Saturday, October 16, 2004 4:41 PM To: Brian Osborne Cc: bioperl-l@bioperl.org Subject: Re: [Bioperl-l] Deprecating Brian, My question is if we need another meme parser? If you think this is necessary I can add them... What do you think? Stefan Brian Osborne wrote: >Stefan, > >If you want to help with meme tests just add them to AlignIO.t, it's the >section at the end. > >Brian O. > > >-----Original Message----- >From: Stefan Kirov [mailto:skirov@utk.edu] >Sent: Saturday, October 16, 2004 11:41 AM >To: Brian Osborne >Cc: bioperl-l@bioperl.org >Subject: Re: [Bioperl-l] Deprecating > >Brian, > >Brian Osborne wrote: > > > >>Stefan, >> >>I took a look at AlignIO/meme.pm and fixed some obvious problems but I >> >> >think > > >>it's possible that the file used in the tests, t/data/meme.dat, may not >> >> >have > > >>all the information I need to debug the module (and I don't have meme >>myself). >> >> >> >I don't think there were tests for AlignIO/meme.pm. Anyway id there are >I am not able to find these. t/data/meme.dat is a test file for >Bio/Matrix/PSM/IO/meme.pm. But as this is presumably the same format >AlignIO/meme.pm should read.... > > > >>Question: is "strand" ever stipulated in the meme output file? >>There's no "+" or "-" indicated in meme.dat. This file is the result of an >>analysis of DNA, so I'm a bit surprised not to see some indication of >> >> >strand > > >>(and the code, before I modified it, was using a regexp that attempted to >>capture strand information). Can you enlighten me here? Here's one of the >>relevant sections: >> >> >>Sequence name Start P-value Site >>------------- ----- --------- --------------------- - >> >> >- > > >>-- >>6603 1311 2.59e-15 GGCGCATTGA >>CAGAAAAATTGAATTCCCACCCCCC AATGAGGAGG >>83796 1284 2.59e-15 GGAGGATTGA >>CAGAAAAATTGAATTCCCACCCCCC AACGAGGAGG >>20218 938 6.34e-12 TTTTTGGTAA >>CCTTAAAATAAAATCCCCACCACCA CTTTTAAAAA >>10657 1685 8.70e-12 GGCCCGCGCG >>CAGACAAAGACATTCCACAGCTCCC GCCCCCTCCA >> >>Perhaps when one runs meme with DNA one can tell it to just do 1 strand, >>rather than both? >> >> >> >You are quite right on this. I had somewhere an example with strands... >I'll find it (or regenrate it) ASAP and send it to you. I will try to >rewrite the tests for meme (other one) for the new test file. > > > >>This would explain the absence of strand information, but >>it means the regexp changes depending on this mode. Again, I don't have >> >> >meme > > >>or use meme, so you're going to have to tell me, or send me output files >>with and without strand stipulation. >> >>Brian O. >> >>-----Original Message----- >>From: Stefan Kirov [mailto:skirov@utk.edu] >>Sent: Friday, October 15, 2004 6:33 PM >>To: Brian Osborne >>Cc: bioperl-l@bioperl.org >>Subject: Re: [Bioperl-l] Deprecating >> >>I wonder if anyone uses *Bio::AlignIO::meme*. Last time (year ago) it >>did not work for me and I have not seen anyone committing changes.... >>Stefan >> >>Brian Osborne wrote: >> >> >> >> >> >>>Bioperl-l, >>> >>>Any objections to my adding Bio::Tools::RestrictionEnzyme to the >>> >>> >DEPRECATED > > >>>file? It was replaced by Bio::Restriction a while ago. >>> >>>Along the same lines, is there anything else that should be deprecated? >>>Bio::Tools::GFF? >>> >>>Brian O. >>> >>> >>> >>> >>>_______________________________________________ >>>Bioperl-l mailing list >>>Bioperl-l@portal.open-bio.org >>>http://portal.open-bio.org/mailman/listinfo/bioperl-l >>> >>> >>> >>> >>> >>> >>-- >>Stefan Kirov, Ph.D. >>University of Tennessee/Oak Ridge National Laboratory >>5700 bldg, PO BOX 2008 MS6164 >>Oak Ridge TN 37831-6164 >>USA >>tel +865 576 5120 >>fax +865-576-5332 >>e-mail: skirov@utk.edu >>sao@ornl.gov >> >>"And the wars go on with brainwashed pride >>For the love of God and our human rights >>And all these things are swept aside" >> >> >> >> >> >> > >-- >Stefan Kirov, Ph.D. >University of Tennessee/Oak Ridge National Laboratory >5700 bldg, PO BOX 2008 MS6164 >Oak Ridge TN 37831-6164 >USA >tel +865 576 5120 >fax +865-576-5332 >e-mail: skirov@utk.edu >sao@ornl.gov > >"And the wars go on with brainwashed pride >For the love of God and our human rights >And all these things are swept aside" > > > > -- Stefan Kirov, Ph.D. University of Tennessee/Oak Ridge National Laboratory 5700 bldg, PO BOX 2008 MS6164 Oak Ridge TN 37831-6164 USA tel +865 576 5120 fax +865-576-5332 e-mail: skirov@utk.edu sao@ornl.gov "And the wars go on with brainwashed pride For the love of God and our human rights And all these things are swept aside" From hlapp at gmx.net Sat Oct 16 22:08:36 2004 From: hlapp at gmx.net (Hilmar Lapp) Date: Sat Oct 16 22:07:41 2004 Subject: [Bioperl-l] problem with swissprot parsin In-Reply-To: <41701963.5080309@pharm.sunysb.edu> Message-ID: <749DC2ED-1FE1-11D9-8CC1-000A959EB4C4@gmx.net> On Friday, October 15, 2004, at 11:39 AM, Siddhartha Basu wrote: > Here is the error: > === > Use of uninitialized value in substitution (s///) at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 856, > line 80. > Use of uninitialized value in string eq at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 1002, > line > 154. > Use of uninitialized value in string eq at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 1002, > line > 182. > Use of uninitialized value in string eq at > /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 1002, > line > 214. > ==== > Note that these are warnings, not errors. They should not in any way have negatively affected your script. The first of the 4 warnings means that for that sequence one of the references wouldn't have the author set. The other three had zero effect other than cluttering the terminal screen. I fixed the code to make these warnings go away and handle the RA/RG case correctly. -hilmar -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- From hlapp at gmx.net Sat Oct 16 22:25:03 2004 From: hlapp at gmx.net (Hilmar Lapp) Date: Sat Oct 16 22:24:03 2004 Subject: [Bioperl-l] make test!! In-Reply-To: <5712C9C6-1E1F-11D9-AF00-000A9577009E@pcbi.upenn.edu> Message-ID: Failed Test Stat Wstat Total Fail Failed List of Failed ------------------------------------------------------------------------ ------- t/SiteMatrix.t 15 1 6.67% 8 from TEST_VERBOSE=1: . . . not ok 8 # Test 8 got: '9/16' (t/SiteMatrix.t at line 49) # Expected: '5/8' . . . This is using perl 5.6.0 on Mac OSX 10.2. -hilmar On Thursday, October 14, 2004, at 01:26 PM, Aaron J. Mackey wrote: > > I've had only a very few people send me feedback about the current > state of bioperl-live "make test" on your favorite > old/crotchety/obscure platforms. I'm writing the Change log and > thinking about branching, but I'm an experimentalist, I need data! > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > you have everything, "make distclean" if you've built from the cvs > checkout before, and start from scratch with the usual litany: perl > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > about, not so much all the verbiage (unless there's specific verbiage > related to the end result ...) > > Thanks, > > -Aaron > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- From hlapp at gmx.net Sun Oct 17 00:19:43 2004 From: hlapp at gmx.net (Hilmar Lapp) Date: Sun Oct 17 00:18:52 2004 Subject: [Bioperl-l] basic problems with bioperl-db/biosql In-Reply-To: <20041014160828.d3cscu8084ckoc4k@webmail2.manchester.ac.uk> Message-ID: On Thursday, October 14, 2004, at 08:08 AM, Mikko Arvas wrote: > Hi, > > I am trying to get started using bioperl-db, but I am failing > miserably. > I got bioperl 1.4 and the latest bioperl-db and biosql tarballs from > CVS on > SuSe 8.1. There is a fix to the GO-format ontology parser that is on the 1.4 branch but not in the 1.4.0 release. If you intend to load GO or SO/SOFA, you will want that fix therefore upgrade from the 1.4 CVS branch. > > Installation gave one error: > t/simpleseq.....ok 6/59gzip: t/data/Titin.fasta.gz: No such file or > directory > Can't call method "namespace" on an undefined value at t/simpleseq.t > line > 48. Sorry about that, I forgot to add the file. It's in CVS now. > > I tried: >> perl load_seqdatabase.pl --dbname biosql --format fasta test.fasta > Loading test.fasta ... > > -------------------- WARNING --------------------- > MSG: insert in Bio::DB::BioSQL::SeqAdaptor (driver) failed, values were > ("NCRA-XX3-01-000002","NCRA-XX3-01-000002","unknown","NCU10033.1 > predicted protein (1437 - 1101)","0","") FKs (9,) > Duplicate entry 'unknown-9-0' for key 2 > --------------------------------------------------- Technically, this is because a previous entry also had 'unknown' as accession number and version 0. Practically, this is not your fault. Basically, this will happen inevitably if you load fasta format straight away. The reason is that $seq->accession_number is not set by the bioperl fasta parser (and, worse yet, defaults to 'unknown'), and $seq->primary_id as well as $seq->display_id are set to the ID part from the fasta description line. Biosql mandates through a unique key constraint that the combination of accession number, version, and namespace be unique, which it can't be if all accession numbers have the same value. If your sequences come in fasta format, you almost certainly want to write your own SequenceProcessor (see POD for Bio::Factory::SequenceProcessorI) to set the IDs straight. Using Bio::Seq::BaseSeqProcessor as a base class this is a relatively simple task. As an example: package My::FastaSeqProcessor; use vars qw(@ISA); use strict; use Bio::Seq::BaseSeqProcessor; @ISA = qw(Bio::Seq::BaseSeqProcessor); sub process_seq{ my ($self,$seq) = @_; # I don't think the fasta ID qualifies as primary_id $seq->primary_id(undef); # we do want to have an accession number $seq->accession_number($seq->display_id); # there's many more things you could do here ... return ($seq); # make sure you return an array! } 1; You then pipeline your sequence objects through your module using --pipeline "My::FastaSeqProcessor". > Could not store unknown: > ------------- EXCEPTION ------------- > MSG: You're trying to lie about the length: is 56 but you say 1161 This is caused by the previous problem. The reason is that when the INSERT fails it tries to find the entry in the database whose existence caused the unique key violation. In your case, it will be totally unrelated, and set the sequence length to something that's got nothing to do with the sequence. > etc.... > > It reads always just one sequence to bioentry/biosequence tables in > regardless of the number in file and there are no duplicates in the > file. Any exception will cause the script to die, unless you supply --safe on the command line. (Exceptions thrown by the SeqIO parser will still let the script die though.) In your case that wouldn't have helped because the problem isn't something isolated to a few entries in the file. Generally speaking though, using --safe is usually preferable once you know that your file is generally OK. > > I tried: > > #!/usr/bin/perl -w > use strict; > use warnings; > use Bio::DB::BioDB; > use Bio::SeqIO; > my $db = Bio::DB::BioDB->new( > -database => 'biosql', > -user => 'root', > -dbname => 'biosql', > -host => 'localhost', > -driver => 'mysql'); > my $in = Bio::SeqIO->new(-format => 'fasta', > -file => 'just_one_seq.fasta'); > my $seq = $in->next_seq(); > my $pseq = $db->create_persistent($seq); > $pseq->namespace('bioperl'); > $pseq->create(); > > No error messages, but nothing goes into the database. I suspect it does go into the database but since you don't commit it gets rolled back when the script terminates. Try adding $pseq->commit. > Basic DBI > connections outside bioperl work, the OBDA howto example of getting > sequences from EMBL works, but I can't figure out a way to get the > single > sequence put to biosql by load_seqdatabase.pl out of there by > Bio::DB::Registry. I believe the latest update on OBDA/Bio::DB::Registry working off of Biosql was that it doesn't. I haven't had a chance to track the reported issue down. Bioperl-db etc should definitely work though. -hilmar -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- From popgen23 at mac.com Sun Oct 17 11:39:49 2004 From: popgen23 at mac.com (Michael S. Robeson II) Date: Sun Oct 17 11:39:03 2004 Subject: [Bioperl-l] Counting gaps in sequence data revisited. Message-ID: I just wanted to thank everyone for their help and suggestions. This is the final full working code to count continuos gaps in a every sequence in a multi-sequence FASTA file. It may not be elegant but it is fast and works well. Sorry for the long post but I wanted to share this with those that do any DNA work. :-) I show in order: the format of the input data, the output of the input data, and finally the working script. I have yet to add comments into the code but I am sure many of you veterans will figure it out. -Thanks again all! As always comments, questions or suggestions are welcome! -Mike -------- INPUT -------- >dog atcg--acgat---act-ca---- >cat acgt-acgt----acgt-gt-agct- >mouse ---acgtacg-atcg---actgac- ------- OUTPUT --------- ***Discovered the following DNA sequences:*** dog found! cat found! mouse found! >>>>>> mouse <<<<<< Indel size: 1 Times found: 2 Positions: 11 25 Indel size: 3 Times found: 2 Positions: 1 16 >>>>>> cat <<<<<< Indel size: 1 Times found: 4 Positions: 5 18 21 26 Indel size: 4 Times found: 1 Positions: 10 >>>>>> dog <<<<<< Indel size: 1 Times found: 1 Positions: 18 Indel size: 2 Times found: 1 Positions: 5 Indel size: 3 Times found: 1 Positions: 12 Indel size: 4 Times found: 1 Positions: 21 ------- Script ------- #!usr/bin/perl # By Michael S. Robeson II, with the help of friends at lernperl.org and bioperl.org! :-) # 10/16/2004 use warnings; use strict; ############################### # Open Sequence Data & OUTFILE ############################### print "Enter in the name of the DNA sequence file:\n"; chomp (my $dna_seq = ); open(DNA_SEQ, $dna_seq) or die "Can't open file: $!\n"; open(OUTFILE, ">indel_list_"."$dna_seq") or die "Can't open outfile: $!\n"; ############################ # Read sequence data into a hash ############################ my %sequences; $/ = '>'; print "\n***Discovered the following DNA sequences:***\n"; while ( ) { chomp; next unless s/^\s*(.+)//; my $name = $1; s/\s//g; $sequences{$name} = $_; print "$name found!\n"; } close DNA_SEQ; ###################################### # iterate over gaps and write to file ###################################### foreach (keys %sequences) { print "\t\t\>\>\>\>\>\> $_ \<\<\<\<\<\<\n"; print OUTFILE "\>\>\>\>\>\> $_ \<\<\<\<\<\<\n"; my $dna = $sequences{$_}; my %gap_data; my %position; while ($dna =~ /(\-+)/g) { my $gap_pos = pos ($dna) - length($&) + 1; my $gap_length = length $1; #$1 =~ tr/\-+// $gap_data{$gap_length}++; $position{$gap_length} .= "$gap_pos"." \n"; } my @indels = keys (%gap_data); my @keys = sort { $a <=> $b} @indels; foreach my $key (@keys) { print "Indel size:\t$key\tTimes found:\t$gap_data{$key}\n"; print OUTFILE "Indel size:\t$key\tTimes found:\t$gap_data{$key}\n"; print "Positions:\n"; print OUTFILE "Positions:\n"; print "$position{$key}"; print OUTFILE "$position{$key}"; print "\n"; print OUTFILE "\n"; } # Can replace the last "foreach loop" above with the while loop # below to do the same thing. Only Gap sizes will not be sorted. # nor is it set up to print to a file # # while (my ($key, $vlaue) = each (%gap_data)) { # print "Indel size:\t$key\tTimes found:\t$gap_data{$key}\n"; # print "Positions:\n"; # print "$position{$key}"; # print "\n\n"; # } } From popgen23 at mac.com Sun Oct 17 18:57:13 2004 From: popgen23 at mac.com (Michael S. Robeson II) Date: Sun Oct 17 18:56:23 2004 Subject: [Bioperl-l] Re: Counting gaps in sequence data revisited. In-Reply-To: References: Message-ID: I cleaned up the code a little. So, here it is for anyone interested: #!usr/bin/perl # By Michael S. Robeson II with the help from the folks at lernperl.org and bioperl.org # 10/16/2004 # Last updated: 10/17/2004 # This script was made for the purpose of searching for indels (gaps) in aligned # DNA or protein sequences that are in FASTA format. It tallys up all of the different # size gaps within each sequence string. While it does this it counts the number of # times each gap of a given size is represented in each sequence and at the same time # reports all of the positions that that particular "gap-size" or indel appears. # contact: robeson@colorado.edu if you have questions or comments use warnings; use strict; ######################### # Introduction ######################### print "\n\t**Welcome to Mike Robeson's Gap-Counting Script!**\n A - Just be sure that your sequence alignment file is in FASTA format! B - Make sure there are no duplicate names within an individual file! C - Output file will be based on the name of the input file. It is named by appending \'indel_list_\' to the name of your input file.\n\n"; ############################### # Open Sequence Data & OUTFILE ############################### print "Enter in the name of the DNA sequence file:\n"; chomp (my $dna_seq = ); open(DNA_SEQ, $dna_seq) or die "Can't open file: $!\n"; open(OUTFILE, ">indel_list_"."$dna_seq") or die "Can't open outfile: $!\n"; ################################# # Read sequence data into a hash ################################# my %sequences; $/ = '>'; print "\n***Discovered the following DNA sequences:***\n"; while ( ) { chomp; next unless s/^\s*(.+)//; my $name = $1; s/\s//g; $sequences{$name} = $_; print "$name found!\n"; print"\n"; } close DNA_SEQ; ###################################### # Iterate over gaps and write to file ###################################### foreach (keys %sequences) { print "\t\t\>\>\>\>\>\> $_ \<\<\<\<\<\<\n"; print OUTFILE "\>\>\>\>\>\> $_ \<\<\<\<\<\<\n"; my $dna = $sequences{$_}; my %gap_data; my %position; while ($dna =~ /(\-+)/g) { my $gap_length = length $1; my $gap_pos = pos ($dna) - $gap_length + 1; $gap_data{$gap_length}++; $position{$gap_length} .= "$gap_pos"." \n"; } my @indels = keys (%gap_data); my @keys = sort { $a <=> $b} @indels; foreach my $key (@keys) { print "Indel size:\t$key\tTimes found:\t$gap_data{$key}\n"; print OUTFILE "Indel size:\t$key\tTimes found:\t$gap_data{$key}\n"; print "Positions:\n"; print OUTFILE "Positions:\n"; print "$position{$key}"; print OUTFILE "$position{$key}"; print "\n"; print OUTFILE "\n"; } } From allenday at ucla.edu Mon Oct 18 04:03:35 2004 From: allenday at ucla.edu (Allen Day) Date: Mon Oct 18 04:03:03 2004 Subject: [Bioperl-l] Re: [SO-devel] GFF3 - Bioperl - SO In-Reply-To: <4172983F.3030807@molgen.mpg.de> References: <416A88AF.1020705@molgen.mpg.de> <416BCB4A.8060303@molgen.mpg.de> <416EA051.7050308@molgen.mpg.de> <4172983F.3030807@molgen.mpg.de> Message-ID: On Sun, 17 Oct 2004, Steffen Grossmann wrote: > Ok, ok, if you really want to convince me that Bio::FeatureIO::gff is > the technology of the future... (although I would also like to hear > Chris Mungall's opinion on this point...) I'd like to hear Chris weigh in as well. > So let's get back to the technicalities. > > There is something which prevents the use of > Bio::SeqFeature::Tools::IDHandler with Bio::FeatureIO::gff, namely the > extensive use of the tag/value annotation system in the former. On one > hand, this comes from repeated calls of Bio::SeqFeatureI's 'primary_id' > method, on the other hand there are calls of 'get_tagset_values'. We can map Bio::SeqFeature::Annotated::primary_id to something reasonable in the AnnotationCollection, but my guess is that avoiding the tagset will be more difficult. I'd prefer not to add SeqFeatureI compliance as far as tagset methods go -- one of the main reasons I added SeqFeature::Annotated was to get rid of this "feature". I haven't looked at the AnnotationAdaptor you mention below, but it sounds like a reasonable approach. Regarding your earlier mail about returning unflattened features, we can do this pretty easily by implementing GFF3 '###' tag handling. I don't remember if I mentioned this before. -Allen > I am not completely sure, but I think that compliance of > Bio::SeqFeature::Tools::IDHandler with both concepts can be achieved by > two changes: > > 1) Bio::SeqFeatureI::primary_id and Bio::SeqFeature::Annotated have to > be made compatible. Just create a Bio::SeqFeature::Annotated object and > try to call 'primary_id' on it to see that it isn't at the moment. In > principle this can be done by storing the ID in the > AnnotationCollectionI object when the tag/value system is not present. > The problem is that the tag/value system is present in > Bio::SeqFeature::Annotated (it has to be, because it implements > Bio::SeqFeatureI), but it is not functional. Any suggestions? > > 2) Bio::SeqFeature::Tools::IDHandler can be made compatible with both > annotation systems by using the Bio::SeqFeature::AnnotationAdaptor > module. This should not cause any problems... > > Steffen > > > > Allen Day wrote: > > >On Thu, 14 Oct 2004, Steffen Grossmann wrote: > > > > > > > >>Dear Allen, > >> > >>I meanwhile understood that Bio::Tools::GFF in connection with > >>Bio::SeqFeature::Tools::IDHandler is doing a lot of the stuff I'd like > >>to have. Somehow, Bio::FeatureIO::gff seems to be a parallel development > >>to the first alternative. I don't know in how far there are plans to > >> > >> > > > >I don't see from a quick look at the source how Bio::Tools::GFF is related > >to Bio::SeqFeature::Tools::IDHandler. There's nothing preventing use of > >the IDHandler in Bio::FeatureIO::gff, in fact it sounds like what you've > >proposed to add so part of your work is already done. > > > > > > > >>bring the two approaches together, but at the moment that seems to be > >>more complicated than just bringing one approach to an acceptable state. > >>Since the Bio::Tools::GFF approach seems to be ahead, I will focus on it > >>at the moment. > >> > >> > > > >I would advise against adding more features into Bio::Tools::GFF. I can't > >speak for all others, but my future development will not use it, and I'm > >in the process of converting code which does use it to depend on > >Bio::FeatureIO::gff. > > > >-Allen > > > > > > > > > From Mikko.Arvas at vtt.fi Mon Oct 18 10:11:03 2004 From: Mikko.Arvas at vtt.fi (Mikko Arvas) Date: Mon Oct 18 10:10:12 2004 Subject: [Bioperl-l] basic problems with bioperl-db/biosql In-Reply-To: References: <20041014160828.d3cscu8084ckoc4k@webmail2.manchester.ac.uk> Message-ID: <4.3.2.7.2.20041018143635.00cbea60@vttmail.vtt.fi> Dear Hilmar, Thank you so much! That really got me going, but I am afraid there will be a few followups ;-). You should really make a howto on this, although the examples in Persistent_Bioperl_BOSC03.pdf offer a good way to start up At 21:19 16.10.2004 -0700, Hilmar Lapp wrote: >On Thursday, October 14, 2004, at 08:08 AM, Mikko Arvas wrote: >>Hi, >>I am trying to get started using bioperl-db, but I am failing >>miserably. >>I got bioperl 1.4 and the latest bioperl-db and biosql tarballs from >>CVS on >>SuSe 8.1. >>I tried: >>#!/usr/bin/perl -w >>use strict; >>use warnings; >>use Bio::DB::BioDB; >>use Bio::SeqIO; >>my $db = Bio::DB::BioDB->new( >> -database => 'biosql', >> -user => 'root', >> -dbname => 'biosql', >> -host => 'localhost', >> -driver => 'mysql'); >>my $in = Bio::SeqIO->new(-format => 'fasta', >> -file => 'just_one_seq.fasta'); >>my $seq = $in->next_seq(); >>my $pseq = $db->create_persistent($seq); >>$pseq->namespace('bioperl'); >>$pseq->create(); >>No error messages, but nothing goes into the database. >I suspect it does go into the database but since you don't commit it >gets rolled back when the script terminates. >Try adding $pseq->commit. YES, that does it! Things like $seq->remove and $seq->add_SeqFeature($feat); $seq->store; start to work with it too. However if I have in BioSQL something like this in bioentry and correspondingly in biosequence: +-------------+----------------+----------+-----------+------------+ | bioentry_id | biodatabase_id | name | accession | identifier | +-------------+----------------+----------+-----------+------------+ | 9 | 9 | YAL001C | unknown | YAL001C | | 12 | 9 | XX0115.2 | ma00001 | XX0115.2 | +-------------+----------------+----------+-----------+------------+ and I do this: #!/usr/bin/perl -w use strict; use warnings; use Bio::Seq; use Bio::Seq::SeqFactory; use Bio::DB::BioDB; my $db = Bio::DB::BioDB->new( -database => 'biosql', -user => 'root', -dbname => 'biosql', -host => 'localhost', -driver => 'mysql'); my $seq =Bio::Seq->new(-primary_id => "XX0115.2", -namespace => "bioperl"); my $seqfact = Bio::Seq::SeqFactory->new(-type=>"Bio::Seq"); my $adp = $db->get_object_adaptor($seq); my $dbseq=$adp->find_by_unique_key($seq, -obj_factory => $seqfact); I get the XX0115.2, but if that doesn't exist in the database I get YAL001C instead, which is a little bit funny. If I use instead: my $seq =Bio::Seq->new(-accession => "XX0115.2", -namespace => "bioperl"); it works as it should. Is this do to the fact that YAL001C doesn't have an accession, so I should make sure that there is always an accession or is the -primery_id search somehow problematic and should be avoided? Thanks again for your help and thanks even more for upkeeping such wonderful modules like these! Cheers, mikko Mikko Arvas VTT Biotechnology e-mail: mikko.arvas@vtt.fi tel: +358-(0)9-456 5827 mobile: +358-(0)44-381 0502 fax: +358-(0)9-455 2103 mail: Tietotie 2, Espoo P.O. Box 1500 FIN-02044 VTT, Finland From michael.watson at bbsrc.ac.uk Mon Oct 18 10:50:42 2004 From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C)) Date: Mon Oct 18 10:51:14 2004 Subject: [Bioperl-l] Bio::Tools::Glimmer Message-ID: <8975119BCD0AC5419D61A9CF1A923E95E89581@iahce2knas1.iah.bbsrc.reserved> Hi I am a bit confused about the state of the Bio::Tools::Glimmer module. I have glimmer version 2.13 and Bioperl-1.4. The glimmer website (http://www.tigr.org/software/glimmer/) states that version 2.13 is the current release. In Bio::Tools::Glimmer, in sub _parse_predictions, not only is there a comment which confidently states "# glimmer 3.0 output", it tests for a line which says "Predicted genes" whereas glimmer 2.13 outputs "Putative Genes". On testing the module with glimmer 2.13 output, the module is not successful, presumably as it is based on version 3.0 output. Is there a reason the bioperl module is based on glimmer 3.0? Cheers Mick From basu at pharm.sunysb.edu Mon Oct 18 11:23:53 2004 From: basu at pharm.sunysb.edu (Siddhartha Basu) Date: Mon Oct 18 11:26:14 2004 Subject: [Bioperl-l] problem with swissprot parsin In-Reply-To: <749DC2ED-1FE1-11D9-8CC1-000A959EB4C4@gmx.net> References: <749DC2ED-1FE1-11D9-8CC1-000A959EB4C4@gmx.net> Message-ID: <4173E009.1050005@pharm.sunysb.edu> Hi hilmar Hilmar Lapp wrote: > > On Friday, October 15, 2004, at 11:39 AM, Siddhartha Basu wrote: > >> Here is the error: >> === >> Use of uninitialized value in substitution (s///) at >> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 856, >> line 80. >> Use of uninitialized value in string eq at >> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 1002, line >> 154. >> Use of uninitialized value in string eq at >> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 1002, line >> 182. >> Use of uninitialized value in string eq at >> /usr/lib/perl5/site_perl/5.8.3/Bio/SeqIO/swiss.pm line 1002, line >> 214. >> ==== >> > > Note that these are warnings, not errors. Yes, those were warnings, sorry for saying errors. >They should not in any way > have negatively affected your script. The first of the 4 warnings means > that for that sequence one of the references wouldn't have the author > set. The other three had zero effect other than cluttering the terminal > screen. Thanks for making it clear. > > I fixed the code to make these warnings go away and handle the RA/RG > case correctly. Where can i get it? -siddhartha > > -hilmar > From hlapp at gnf.org Mon Oct 18 15:31:25 2004 From: hlapp at gnf.org (Hilmar Lapp) Date: Mon Oct 18 15:30:31 2004 Subject: [Bioperl-l] problem with swissprot parsin In-Reply-To: <4173E009.1050005@pharm.sunysb.edu> References: <749DC2ED-1FE1-11D9-8CC1-000A959EB4C4@gmx.net> <4173E009.1050005@pharm.sunysb.edu> Message-ID: <4CB5439A-213C-11D9-AA2A-000A95AE92B0@gnf.org> On Oct 18, 2004, at 8:23 AM, Siddhartha Basu wrote: >> I fixed the code to make these warnings go away and handle the RA/RG >> case correctly. > Where can i get it? > It's only on the CVS head, which is I thought what you had checked out. So just do a cvs update. Otherwise, if you are still using the 1.4 release, I can migrate the fix to the branch. In any case, you'll have to update from CVS, or you wait a few more days until Aaron pushes 1.5 out the door. -hilmar -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- From hlapp at gnf.org Mon Oct 18 15:41:16 2004 From: hlapp at gnf.org (Hilmar Lapp) Date: Mon Oct 18 15:40:14 2004 Subject: [Bioperl-l] basic problems with bioperl-db/biosql In-Reply-To: <4.3.2.7.2.20041018143635.00cbea60@vttmail.vtt.fi> References: <20041014160828.d3cscu8084ckoc4k@webmail2.manchester.ac.uk> <4.3.2.7.2.20041018143635.00cbea60@vttmail.vtt.fi> Message-ID: On Oct 18, 2004, at 7:11 AM, Mikko Arvas wrote: > > However if I have in BioSQL something like this in bioentry and > correspondingly > in biosequence: > +-------------+----------------+----------+-----------+------------+ > | bioentry_id | biodatabase_id | name | accession | identifier | > +-------------+----------------+----------+-----------+------------+ > | 9 | 9 | YAL001C | unknown | YAL001C | > | 12 | 9 | XX0115.2 | ma00001 | XX0115.2 | > +-------------+----------------+----------+-----------+------------+ > > and I do this: > > #!/usr/bin/perl -w > use strict; > use warnings; > use Bio::Seq; > use Bio::Seq::SeqFactory; > use Bio::DB::BioDB; > my $db = Bio::DB::BioDB->new( -database => 'biosql', -user => 'root', > -dbname => 'biosql', -host => 'localhost', -driver => 'mysql'); > my $seq =Bio::Seq->new(-primary_id => "XX0115.2", > -namespace => "bioperl"); > my $seqfact = Bio::Seq::SeqFactory->new(-type=>"Bio::Seq"); > my $adp = $db->get_object_adaptor($seq); > my $dbseq=$adp->find_by_unique_key($seq, -obj_factory => $seqfact); > > I get the XX0115.2, but if that doesn't exist in the database I get > YAL001C instead, > which is a little bit funny. It is due to the (stupid IMO) rule in bioperl that the default value for the accession number is 'unknown'. Also, there are multiple unique keys on bioentry, and the adaptor will search all of them until it finds a match. So, if using the identifier (primary_id) you set fails it will try the accession number ('unknown') and version (default 0) - which will match the YAL001C entry. That's why it is almost never a good idea to let sequences with accession number 'unknown' into your database ... (apart from the fact that you can have only one per namespace anyway unless you increment versions ...). > If I use instead: > my $seq =Bio::Seq->new(-accession => "XX0115.2", -namespace => > "bioperl"); > it works as it should. > > Is this do to the fact that YAL001C doesn't have an accession, so I > should make sure that there is always an accession Right. Accession is required (NOT NULL) in biosql, and it's not a good idea to leave it at a non-meaningful default. Primary_id (or Identifier in biosql) is rather meant for 'internal' identifiers. E.g., NCBI's GI number, or the source primary key if you imported seqs from somewhere. Almost all 'identifiers' you encounter will be accessions, not primary_id's in the sense of bioperl. > or is the -primery_id search somehow problematic and should be > avoided? No, not at all, it's perfectly fine ... Great if you find the software is useful. That's the goal :-) -hilmar -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- From hlapp at gnf.org Mon Oct 18 15:52:16 2004 From: hlapp at gnf.org (Hilmar Lapp) Date: Mon Oct 18 15:51:14 2004 Subject: [Bioperl-l] Re: [SO-devel] GFF3 - Bioperl - SO In-Reply-To: References: <416A88AF.1020705@molgen.mpg.de> <416BCB4A.8060303@molgen.mpg.de> <416EA051.7050308@molgen.mpg.de> <4172983F.3030807@molgen.mpg.de> Message-ID: <364A86B6-213F-11D9-AA2A-000A95AE92B0@gnf.org> On Oct 18, 2004, at 1:03 AM, Allen Day wrote: > I haven't looked at the AnnotationAdaptor you mention > below, but it sounds like a reasonable approach. I wrote that module to integrate the tag system of SeqFeatureI's with the annotation bundle, which SeqFeatureI's also happen to have. SeqFeature::AnnotationAdaptor allows one to look at a feature's tags and annotation collection together as if there were no tag system but only an annotation bundle instead. It works bi-directional, i.e., if you modify an annotation object that in reality is a tag it will modify the tag. The motivation (use case) was that for bioperl-db I had already written modules for serializing and de-serializing an annotation bundle (along with seq objects), and didn't want to write ugly special case code for a feature's tag system. -hilmar -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- From allenday at ucla.edu Wed Oct 20 00:08:45 2004 From: allenday at ucla.edu (Allen Day) Date: Wed Oct 20 00:07:41 2004 Subject: [Bioperl-l] Re: [SO-devel] GFF3 - Bioperl - SO In-Reply-To: <364A86B6-213F-11D9-AA2A-000A95AE92B0@gnf.org> References: <416A88AF.1020705@molgen.mpg.de> <416BCB4A.8060303@molgen.mpg.de> <416EA051.7050308@molgen.mpg.de> <4172983F.3030807@molgen.mpg.de> <364A86B6-213F-11D9-AA2A-000A95AE92B0@gnf.org> Message-ID: this sounds like reusable code for tag->annotationcollection mapping for annotated seqfeatures. may help to ease the seqfeature api transition. -allen On Mon, 18 Oct 2004, Hilmar Lapp wrote: > > On Oct 18, 2004, at 1:03 AM, Allen Day wrote: > > > I haven't looked at the AnnotationAdaptor you mention > > below, but it sounds like a reasonable approach. > > I wrote that module to integrate the tag system of SeqFeatureI's with > the annotation bundle, which SeqFeatureI's also happen to have. > SeqFeature::AnnotationAdaptor allows one to look at a feature's tags > and annotation collection together as if there were no tag system but > only an annotation bundle instead. It works bi-directional, i.e., if > you modify an annotation object that in reality is a tag it will modify > the tag. > > The motivation (use case) was that for bioperl-db I had already written > modules for serializing and de-serializing an annotation bundle (along > with seq objects), and didn't want to write ugly special case code for > a feature's tag system. > > -hilmar > From allenday at ucla.edu Wed Oct 20 04:33:59 2004 From: allenday at ucla.edu (Allen Day) Date: Wed Oct 20 04:32:51 2004 Subject: [Bioperl-l] friendlier bioperl-guts-l messages Message-ID: I've set up syncmail [1] to do the cvs commit diffs. It's a little nicer than the homebrew in that it puts the filename and version numbers of the commit into the message subject. Let me know if you run into problems... it was throwing some errors as I set it up but it seems stable now. -Allen [1] http://cvs-syncmail.sourceforge.net From mlemieux at bioinfo.ca Wed Oct 20 06:52:28 2004 From: mlemieux at bioinfo.ca (Madeleine Lemieux) Date: Wed Oct 20 06:51:34 2004 Subject: [Bioperl-l] Re: Installing BioPerl under Mac OS X Message-ID: <225C6409-2286-11D9-8BBB-000A95B139D2@bioinfo.ca> Andrew, I've just finished installing the latest BioPerl release (1.4) under Mac OS X 10.3 (10.3.4 when I started but now 10.3.5). Like you, I'm fairly new at this. You refer to being a Linux newbie. Are you installing BioPerl under Linux or OS X? If the former, I can't help since my experience is with OS X; otherwise, read on. I found Steve Cannon's instructions useful as a starting point (http://www.tc.umn.edu/~cann0010/Bioperl_OSX_install.html). Xcode tools are pre-installed with OS X 10.3 so I didn't need to do the first step. You may want to create /usr/local/bin, /usr/local/lib, /usr/local/share and /usr/local/src directories for your installations since many programs use this a default locations. Make sure they show up in your $PATH in ~/.bash_profile (Terminal) or ~/.bashrc (Xterm). That's also where you need to put some of the environment variables for blast, amongst others. Before starting, you might want to do a "fink selfupdate" to get this very nice package manager up to date. It comes pre-installed with Panther, I believe, but if not, you can get it from http://fink.sourceforge.net/. If you use fink to install, it usually put things under /sw in its own little world which is actually nice if you're unsure of yourself since it removes the risk of trashing things in /usr/bin or /usr/lib. Just remember to add /sw/bin to your search path. I used fink to install libwww-pm581 and GD. I then forced the installation of the BioPerl bundle using CPAN. This was necessary as quite a few of the tests failed but not on things I cared about especially. I then downloaded the latest BioPerl release and followed the installation instructions. Worked fine. I have also installed (following each package's installation instructions) wwwBlast (latest OS X version from NCBI), t-coffee (the Unix version, not the Mac one), clustalw (the OS X version) and EMBOSS. These were all straightforward installations as per instructions. I never successfully compiled the NCBI C++ Toolbox - my suspicion is that there are some assumptions made about paths that are incorrect on my machine and no amount of fiddling with the configure settings helped - but the C Toolkit (for Unix not Mac) compiled and installed like a charm, according to instructions in readme.unx. If you want to go through bptutorial.pl with the graphical debugger (I've started doing this and I think it's great), you'll need to install pTk (I downloaded TK800.024 from CPAN.) and then ptkdb (also from CPAN). I had problems compiling pTk but eventually got it working (see below). After pTk was up and running, the ptkdb installation went seamlessly. If you use this, remember: ptkdb has to be run in an xterm window, not a terminal :-) (I can't remember whether I had to install X11 but if so it was from the disks that shipped with my iBook.) 1. Tk looks for perl under /usr/local/bin/perl but it's in /usr/bin/perl. ln -s /usr/bin/perl /usr/local/bin/perl takes care of that problem. 2. Make reported the following: LeMeiLin:~/BioPerl/Tk800.024 $ make cd pTk && make DEFINE="" cc -c -I.. -I/usr/X11R6/include -I. -Ibitmaps -I/usr/X11R6/include -g -pipe -pipe -fno-common -DPERL_DARWIN -no-cpp-precomp -fno-strict-aliasing -I/usr/ local/include -Os -DVERSION=\"800.024\" -DXS_VERSION=\"800.024\" "-I/ System/Library/Perl/5.8.1/darwin-thread-multi-2level/CORE" -Wall -Wno- implicit-int -Wno-comment -Wno-unused -D__USE_FIXED_PROTOTYPES__ Xlib_f.c In file included from /usr/include/sys/event.h:154, from /usr/include/sys/select.h:71, from tkUnixPort.h:56, from tkPort.h:42, from Xlib_f.c:1: /usr/include/mach/mach.h:79: error: parse error before '->' token make[1]: *** [Xlib_f.o] Error 1 make: *** [pTk/libpTk.a] Error 2 My fix: commented out line 1615 of Lang.h (#define panic Tcl_panic) 3. Make then reported: --center not a valid option My fix: changed POD2MAN_EXE switches --center and --release to -c and -r, respectively, in Tk/MMutil.pm line 335 4. I also changed line 5 in demos/widget ("use Tk 800.000") to ("use Tk 800.024") since that's my version. Sorry! I guess my --verbose switch was on :-) Good luck, Madeleine From nathanhaigh at ukonline.co.uk Wed Oct 20 07:34:50 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Wed Oct 20 07:33:50 2004 Subject: [Bioperl-l] Test Message Message-ID: <000701c4b698$d655fbe0$3cf4cdd9@Desktop> Sorry about this, my messages don't seem to be getting through to the mailing list! Just trying a bog standard plain text e-mail Here's hoping! From nathanhaigh at ukonline.co.uk Wed Oct 20 08:25:43 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Wed Oct 20 08:24:39 2004 Subject: [Bioperl-l] Another test - form my new defaults Message-ID: <001d01c4b69f$ebf4c9c0$3cf4cdd9@Desktop> Another test, to see if I can get my message through without help from the moderator. Ok, that last one worked, so here's another test to check my new default mail settings! Nathan --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 20/10/2004 13:25:40 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From nathanhaigh at ukonline.co.uk Wed Oct 20 09:08:06 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Wed Oct 20 09:07:07 2004 Subject: [Bioperl-l] last test 3 Message-ID: Last test ? Nathan --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 20/10/2004 14:08:03 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From nathanhaigh at ukonline.co.uk Wed Oct 20 09:41:41 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Wed Oct 20 09:40:35 2004 Subject: [Bioperl-l] last test 6 Message-ID: Another test --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 20/10/2004 14:41:38 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From nathanhaigh at ukonline.co.uk Wed Oct 20 10:20:07 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Wed Oct 20 10:19:18 2004 Subject: [Bioperl-l] make test!! In-Reply-To: <5712C9C6-1E1F-11D9-AF00-000A9577009E@pcbi.upenn.edu> Message-ID: <005901c4b6af$e741aeb0$3cf4cdd9@Desktop> Apologise for all the pervious messages! I just wanted to get this onto the mailing list: ? I have managed to do a "nmake test" (WinXP) on bioperl-live. ? System: WinXP Pro ActiveState Perl 5.8.0 build 804 Nmake v6.00.8168.0 ? A note beforehand: The error message I had previously got, and heard others have also received on other OS's. That contain a "line too long" error when trying "make test", is due to the limitations of the particular OS. Versions of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) have got round this problem by splitting long command lines from Makefiles into a series of smaller commands. ? Test Summary: Failed Test????? Stat Wstat Total Fail? Failed? List of Failed ------------------------------------------------------------------------------- t\Index.t????????? 22? 5632??? 41?? 21? 51.22%? 21-41 t\Registry.t?????? 22? 5632??? 11??? 9? 81.82%? 3-11 t\seqread_fail.t? 255 65280??? 13??? 0?? 0.00%? ?? 115 subtests skipped. Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% okay. NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : return code '0xff' Stop. ? Particulars: t\Index......................NOK 21Can't call method "length" on an undefined value at t\Index.t line 124, line ?54. t\Index......................dubious ??????? Test returned status 22 (wstat 5632, 0x1600) DIED. FAILED tests 21-41 ??????? Failed 21/41 tests, 48.78% okay t\Registry...................ok 2/11The getpwuid function is unimplemented at K:\Downloads\FlashGet\Software\Bioinform atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. t\Registry...................dubious ??????? Test returned status 22 (wstat 5632, 0x1600) t\seqread_fail...............ok 1/13 ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: BioFetch Error 4: ID [XXX111] not found in database [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. STACK: Error::throw STACK: Bio::Root::Root::throw K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\lib/Bio/Root/R oot.pm:328 STACK: Bio::DB::BioFetch::postprocess_data K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l ib/Bio/DB/BioFetch.pm:406 STACK: Bio::DB::WebDBSeqI::get_seq_stream K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li b/Bio/DB/WebDBSeqI.pm:525 STACK: Bio::DB::WebDBSeqI::get_Stream_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ lib/Bio/DB/WebDBSeqI.pm:287 STACK: Bio::DB::WebDBSeqI::get_Seq_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\lib /Bio/DB/WebDBSeqI.pm:153 STACK: main::fetch t\seqread_fail.t:69 STACK: t\seqread_fail.t:81 ----------------------------------------------------------- t\seqread_fail...............dubious ??????? Test returned status 255 (wstat 65280, 0xff00) ?? ?????after all the subtests completed successfully ? ? Nathan ? > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. Mackey > Sent: 14 October 2004 21:27 > To: Bioperl > Subject: [Bioperl-l] make test!! > Importance: High > > > I've had only a very few people send me feedback about the current > state of bioperl-live "make test" on your favorite > old/crotchety/obscure platforms.? I'm writing the Change log and > thinking about branching, but I'm an experimentalist, I need data! > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > you have everything, "make distclean" if you've built from the cvs > checkout before, and start from scratch with the usual litany: perl > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > about, not so much all the verbiage (unless there's specific verbiage > related to the end result ...) > > Thanks, > > -Aaron > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0442-2, 14/10/2004 > Tested on: 14/10/2004 21:59:20 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > ? --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 20/10/2004 15:20:04 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From luisa.pugliese at safan-bioinformatics.it Wed Oct 20 10:38:32 2004 From: luisa.pugliese at safan-bioinformatics.it (luisa pugliese) Date: Wed Oct 20 10:37:07 2004 Subject: [Bioperl-l] creating a simplealign object from strings Message-ID: <006001c4b6b2$792861a0$f3ee669e@chagall> Dear all, I am working with a huge protein alignment that comes from a web page and I would like to import it into bioperl. In order to do this I created a hash with seqnames as keys and sequences, including gaps, as values. Then I used LocatableSeq in order to create sequence objects that can be then imported into a simplealign object with the function add_seq. Using LocatableSeq I got the following error: ---------------------------- MSG: Attempting to set the sequence to [----------DPQMWDFDDLNFTG-MP-PADE-DYSPCMLET-ETLNKYVV---II---AYA--LVF--L--LSL LGNSL-----VM----L----VILY-----SRV-----GR-----SV-TD-----V--YL-LN-LALADLLFAL-- ---TLPIWAASKV-----NG------WIF--GTF-----LC-KVVSL----L----K----E-----VN---FY-- -SG-I-----LL-----LACISV--D-R--YL-----AIVH---ATR---T-----L----TQ---K---RH---- L-----VK-FV-----CLG-----CWGLSMNLSL-----PFFLFRQ----AY-----HPNNSSP--VCYEVLG--- --NDTAKWRMVL-----RI--LPHT--FGFIVPLFVMLFCYGF-TLRTLFKAHM-----------------GQ--- -KHR-----A---M-RVIFAVV-LIFLLC---WLP----YNLVLLADTLMRTQV7TCERRNNIGRALDATEILGFL ---H---SC-----L--NP----IIYA-----FIGQ---N-----FRH----GF-----L-----K--ILAMHGLV SKEFLA--RHRVTS-----------------------------] which does not look healthy STACK Bio::PrimarySeq::seq /home/luisa/bioperl_new/bioperl-1.4/Bio/PrimarySeq.pm:268 STACK Bio::PrimarySeq::new /home/luisa/bioperl_new/bioperl-1.4/Bio/PrimarySeq.pm:217 STACK Bio::LocatableSeq::new /home/luisa/bioperl_new/bioperl-1.4/Bio/LocatableSeq.pm:100 STACK toplevel /home/luisa/perl/string2seq.pl:33 ------------------------------- This is not the first sequence in the file and on a smaller set the script worked. Does anybody knows what should I do in order to avoid this problem? Thanking you all, best regards Luisa ============================= Luisa Pugliese, Ph.D. luisa.pugliese@safan-bioinformatics.it S.A.F.AN. BIOINFORMATICS Corso Tazzoli 215/13 -10137 Torino - ITALY tel +39 011 3026230 fax +39 011 3165080 cell. +39 333 6130644 From sanges at biogem.it Wed Oct 20 10:56:39 2004 From: sanges at biogem.it (Remo Sanges) Date: Wed Oct 20 10:55:54 2004 Subject: [Bioperl-l] creating a simplealign object from strings In-Reply-To: <006001c4b6b2$792861a0$f3ee669e@chagall> References: <006001c4b6b2$792861a0$f3ee669e@chagall> Message-ID: <3F2C859E-22A8-11D9-A84E-000A95B95F88@biogem.it> On Oct 20, 2004, at 4:38 PM, luisa pugliese wrote: > Dear all, > I am working with a huge protein alignment that comes from a web > page > and I would like to import it into bioperl. In order to do this I > created a > hash with seqnames as keys and sequences, including gaps, as values. > Then I > used LocatableSeq in order to create sequence objects that can be then > imported into a simplealign object with the function add_seq. > Using LocatableSeq I got the following error: > ---------------------------- > MSG: Attempting to set the sequence to > [----------DPQMWDFDDLNFTG-MP-PADE-DYSPCMLET-ETLNKYVV---II---AYA--LVF-- > L--LSL > LGNSL-----VM----L----VILY-----SRV-----GR-----SV-TD-----V--YL-LN- > LALADLLFAL-- > ---TLPIWAASKV-----NG------WIF--GTF-----LC-KVVSL----L----K----E----- > VN---FY-- > -SG-I-----LL-----LACISV--D-R--YL-----AIVH---ATR---T-----L----TQ---K--- > RH---- > L-----VK-FV-----CLG-----CWGLSMNLSL-----PFFLFRQ----AY-----HPNNSSP-- > VCYEVLG--- > --NDTAKWRMVL-----RI--LPHT--FGFIVPLFVMLFCYGF- > TLRTLFKAHM-----------------GQ--- > -KHR-----A---M-RVIFAVV-LIFLLC---WLP---- > YNLVLLADTLMRTQV7TCERRNNIGRALDATEILGFL > ---H---SC-----L--NP----IIYA-----FIGQ---N-----FRH----GF-----L-----K-- > ILAMHGLV > SKEFLA--RHRVTS-----------------------------] which does not look > healthy Probably you have a problem in parsing your web page... If you check the lines of your sequence you can see a number in this: -KHR-----A---M-RVIFAVV-LIFLLC---WLP---- YNLVLLADTLMRTQV7TCERRNNIGRALDATEILGFL This is why your sequence 'does not look healthy' to bioperl Trying to correct this should solve your problem HTH Remo From nathanhaigh at ukonline.co.uk Wed Oct 20 11:23:42 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Wed Oct 20 11:22:46 2004 Subject: [Bioperl-l] creating a simplealign object from strings In-Reply-To: <006001c4b6b2$792861a0$f3ee669e@chagall> Message-ID: <005a01c4b6b8$cc22b1c0$3cf4cdd9@Desktop> There must be some non-standard characters in the sequence that you are trying to set! If you look at Bio::PrimarySeq::validate_seq method, you will notice that the only allowed characters are (A-Z) and '-','.', '*' and '?' You should do some error checking on your sequence before you try to add it to your alignment object. a simple substitution regexp for any chars not allowed, and convert them to missing data or gaps to maintain your alignment. If you do this you will notice that there is a number 7 in the sequence you showed. Hope this helps Nathan > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of luisa pugliese > Sent: 20 October 2004 15:39 > To: Bioperl-l@portal.open-bio.org > Subject: [Bioperl-l] creating a simplealign object from strings > > Dear all, > I am working with a huge protein alignment that comes from a web page > and I would like to import it into bioperl. In order to do this I created a > hash with seqnames as keys and sequences, including gaps, as values. Then I > used LocatableSeq in order to create sequence objects that can be then > imported into a simplealign object with the function add_seq. > Using LocatableSeq I got the following error: > ---------------------------- > MSG: Attempting to set the sequence to > [----------DPQMWDFDDLNFTG-MP-PADE-DYSPCMLET-ETLNKYVV---II---AYA--LVF--L--LSL > LGNSL-----VM----L----VILY-----SRV-----GR-----SV-TD-----V--YL-LN-LALADLLFAL-- > ---TLPIWAASKV-----NG------WIF--GTF-----LC-KVVSL----L----K----E-----VN---FY-- > -SG-I-----LL-----LACISV--D-R--YL-----AIVH---ATR---T-----L----TQ---K---RH---- > L-----VK-FV-----CLG-----CWGLSMNLSL-----PFFLFRQ----AY-----HPNNSSP--VCYEVLG--- > --NDTAKWRMVL-----RI--LPHT--FGFIVPLFVMLFCYGF-TLRTLFKAHM-----------------GQ--- > -KHR-----A---M-RVIFAVV-LIFLLC---WLP----YNLVLLADTLMRTQV7TCERRNNIGRALDATEILGFL > ---H---SC-----L--NP----IIYA-----FIGQ---N-----FRH----GF-----L-----K--ILAMHGLV > SKEFLA--RHRVTS-----------------------------] which does not look healthy > STACK Bio::PrimarySeq::seq > /home/luisa/bioperl_new/bioperl-1.4/Bio/PrimarySeq.pm:268 > STACK Bio::PrimarySeq::new > /home/luisa/bioperl_new/bioperl-1.4/Bio/PrimarySeq.pm:217 > STACK Bio::LocatableSeq::new > /home/luisa/bioperl_new/bioperl-1.4/Bio/LocatableSeq.pm:100 > STACK toplevel /home/luisa/perl/string2seq.pl:33 > ------------------------------- > This is not the first sequence in the file and on a smaller set the script > worked. > Does anybody knows what should I do in order to avoid this problem? > Thanking you all, > best regards > Luisa > > ============================= > Luisa Pugliese, Ph.D. > luisa.pugliese@safan-bioinformatics.it > S.A.F.AN. BIOINFORMATICS > Corso Tazzoli 215/13 -10137 Torino - ITALY > tel +39 011 3026230 > fax +39 011 3165080 > cell. +39 333 6130644 > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 20/10/2004 16:23:40 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From brian_osborne at cognia.com Wed Oct 20 14:04:25 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Wed Oct 20 14:04:10 2004 Subject: [Bioperl-l] make test!! In-Reply-To: <005901c4b6af$e741aeb0$3cf4cdd9@Desktop> Message-ID: Nathan, I noticed most of the Registry tests failing. I know what part of the problem is (getpwuid() not implemented in Windows/Activestate Perl) and I think I've fixed at least that part. Can you install the most recent Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? >perl -w -I. t/Registry.t Brian O. -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh Sent: Wednesday, October 20, 2004 10:20 AM To: 'Bioperl' Subject: RE: [Bioperl-l] make test!! Apologise for all the pervious messages! I just wanted to get this onto the mailing list: I have managed to do a "nmake test" (WinXP) on bioperl-live. System: WinXP Pro ActiveState Perl 5.8.0 build 804 Nmake v6.00.8168.0 A note beforehand: The error message I had previously got, and heard others have also received on other OS's. That contain a "line too long" error when trying "make test", is due to the limitations of the particular OS. Versions of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) have got round this problem by splitting long command lines from Makefiles into a series of smaller commands. Test Summary: Failed Test Stat Wstat Total Fail Failed List of Failed ---------------------------------------------------------------------------- --- t\Index.t 22 5632 41 21 51.22% 21-41 t\Registry.t 22 5632 11 9 81.82% 3-11 t\seqread_fail.t 255 65280 13 0 0.00% ?? 115 subtests skipped. Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% okay. NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : return code '0xff' Stop. Particulars: t\Index......................NOK 21Can't call method "length" on an undefined value at t\Index.t line 124, line 54. t\Index......................dubious Test returned status 22 (wstat 5632, 0x1600) DIED. FAILED tests 21-41 Failed 21/41 tests, 48.78% okay t\Registry...................ok 2/11The getpwuid function is unimplemented at K:\Downloads\FlashGet\Software\Bioinform atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. t\Registry...................dubious Test returned status 22 (wstat 5632, 0x1600) t\seqread_fail...............ok 1/13 ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: BioFetch Error 4: ID [XXX111] not found in database [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. STACK: Error::throw STACK: Bio::Root::Root::throw K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li b/Bio/Root/R oot.pm:328 STACK: Bio::DB::BioFetch::postprocess_data K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l ib/Bio/DB/BioFetch.pm:406 STACK: Bio::DB::WebDBSeqI::get_seq_stream K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li b/Bio/DB/WebDBSeqI.pm:525 STACK: Bio::DB::WebDBSeqI::get_Stream_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ lib/Bio/DB/WebDBSeqI.pm:287 STACK: Bio::DB::WebDBSeqI::get_Seq_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li b /Bio/DB/WebDBSeqI.pm:153 STACK: main::fetch t\seqread_fail.t:69 STACK: t\seqread_fail.t:81 ----------------------------------------------------------- t\seqread_fail...............dubious Test returned status 255 (wstat 65280, 0xff00) after all the subtests completed successfully Nathan > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. Mackey > Sent: 14 October 2004 21:27 > To: Bioperl > Subject: [Bioperl-l] make test!! > Importance: High > > > I've had only a very few people send me feedback about the current > state of bioperl-live "make test" on your favorite > old/crotchety/obscure platforms. I'm writing the Change log and > thinking about branching, but I'm an experimentalist, I need data! > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > you have everything, "make distclean" if you've built from the cvs > checkout before, and start from scratch with the usual litany: perl > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > about, not so much all the verbiage (unless there's specific verbiage > related to the end result ...) > > Thanks, > > -Aaron > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0442-2, 14/10/2004 > Tested on: 14/10/2004 21:59:20 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 20/10/2004 15:20:04 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l From amackey at pcbi.upenn.edu Wed Oct 20 14:35:38 2004 From: amackey at pcbi.upenn.edu (Aaron J. Mackey) Date: Wed Oct 20 14:34:30 2004 Subject: [Bioperl-l] make test failures Message-ID: Thanks to all of you who sent me test failures (and successes); looks like we're in pretty good shape on most common platforms (Index.t and Registry.t on Windows). I was disturbed by three independent failures of the test harness to complete its final report on test failures (i.e. it said "all tests passed" or somesuch, but then make' shell died with a 255 error code before the table of failed tests could be output). Is anyone else seeing this and have some wise words? It's an upsetting showstopper because even though all tests pass, CPAN wouldn't install with the error code coming back from make test. -Aaron From brian_osborne at cognia.com Wed Oct 20 16:55:32 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Wed Oct 20 16:54:57 2004 Subject: [Bioperl-l] make test!! In-Reply-To: <005901c4b6af$e741aeb0$3cf4cdd9@Desktop> Message-ID: Nathan, My guess is that your ActiveState distribution doesn't include Fcntl.pm, which is used by Bio::DB::FileCache. I've changed Index.t to account for this possibility - can you test the latest t/Index.t? >perl -I. -w t/Index.t Thanks again, Brian O. -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh Sent: Wednesday, October 20, 2004 10:20 AM To: 'Bioperl' Subject: RE: [Bioperl-l] make test!! Apologise for all the pervious messages! I just wanted to get this onto the mailing list: I have managed to do a "nmake test" (WinXP) on bioperl-live. System: WinXP Pro ActiveState Perl 5.8.0 build 804 Nmake v6.00.8168.0 A note beforehand: The error message I had previously got, and heard others have also received on other OS's. That contain a "line too long" error when trying "make test", is due to the limitations of the particular OS. Versions of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) have got round this problem by splitting long command lines from Makefiles into a series of smaller commands. Test Summary: Failed Test Stat Wstat Total Fail Failed List of Failed ---------------------------------------------------------------------------- --- t\Index.t 22 5632 41 21 51.22% 21-41 t\Registry.t 22 5632 11 9 81.82% 3-11 t\seqread_fail.t 255 65280 13 0 0.00% ?? 115 subtests skipped. Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% okay. NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : return code '0xff' Stop. Particulars: t\Index......................NOK 21Can't call method "length" on an undefined value at t\Index.t line 124, line 54. t\Index......................dubious Test returned status 22 (wstat 5632, 0x1600) DIED. FAILED tests 21-41 Failed 21/41 tests, 48.78% okay t\Registry...................ok 2/11The getpwuid function is unimplemented at K:\Downloads\FlashGet\Software\Bioinform atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. t\Registry...................dubious Test returned status 22 (wstat 5632, 0x1600) t\seqread_fail...............ok 1/13 ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: BioFetch Error 4: ID [XXX111] not found in database [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. STACK: Error::throw STACK: Bio::Root::Root::throw K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li b/Bio/Root/R oot.pm:328 STACK: Bio::DB::BioFetch::postprocess_data K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l ib/Bio/DB/BioFetch.pm:406 STACK: Bio::DB::WebDBSeqI::get_seq_stream K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li b/Bio/DB/WebDBSeqI.pm:525 STACK: Bio::DB::WebDBSeqI::get_Stream_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ lib/Bio/DB/WebDBSeqI.pm:287 STACK: Bio::DB::WebDBSeqI::get_Seq_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li b /Bio/DB/WebDBSeqI.pm:153 STACK: main::fetch t\seqread_fail.t:69 STACK: t\seqread_fail.t:81 ----------------------------------------------------------- t\seqread_fail...............dubious Test returned status 255 (wstat 65280, 0xff00) after all the subtests completed successfully Nathan > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. Mackey > Sent: 14 October 2004 21:27 > To: Bioperl > Subject: [Bioperl-l] make test!! > Importance: High > > > I've had only a very few people send me feedback about the current > state of bioperl-live "make test" on your favorite > old/crotchety/obscure platforms. I'm writing the Change log and > thinking about branching, but I'm an experimentalist, I need data! > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > you have everything, "make distclean" if you've built from the cvs > checkout before, and start from scratch with the usual litany: perl > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > about, not so much all the verbiage (unless there's specific verbiage > related to the end result ...) > > Thanks, > > -Aaron > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0442-2, 14/10/2004 > Tested on: 14/10/2004 21:59:20 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 20/10/2004 15:20:04 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l From kvddrift at earthlink.net Wed Oct 20 17:48:11 2004 From: kvddrift at earthlink.net (Koen van der Drift) Date: Wed Oct 20 17:47:05 2004 Subject: [Bioperl-l] Re: Installing BioPerl under Mac OS X In-Reply-To: <225C6409-2286-11D9-8BBB-000A95B139D2@bioinfo.ca> References: <225C6409-2286-11D9-8BBB-000A95B139D2@bioinfo.ca> Message-ID: On Oct 20, 2004, at 6:52 AM, Madeleine Lemieux wrote: > I used fink to install libwww-pm581 and GD. I then forced the > installation of the BioPerl bundle using CPAN. This was necessary as > quite a few of the tests failed but not on things I cared about > especially. I then downloaded the latest BioPerl release and followed > the installation instructions. Worked fine. Madeleine, I am curious why didn't use fink to install bioperl. Version 1.4 has been available for a few months, and is actually part of the most recent binary release (Fink 0.7.1). Did you get any particular errors when you tried to install it? I am the fink-maintainer of bioperl, so if there are any problems please let me know, so I can try to fix the package. > > I have also installed (following each package's installation > instructions) wwwBlast (latest OS X version from NCBI), t-coffee (the > Unix version, not the Mac one), clustalw (the OS X version) and > EMBOSS. Just as a note, all three, as well as pTk (804.026) are also availble through fink. - Koen. From cain at cshl.org Wed Oct 20 18:01:06 2004 From: cain at cshl.org (Scott Cain) Date: Wed Oct 20 18:07:35 2004 Subject: [Bioperl-l] Handling gff3 Target and Dbxref tags through FeatureIO Message-ID: <1098309665.1511.80.camel@localhost.localdomain> Hi Allen, I am in fairly urgent need of the ability to handle Target and Dbxref tags in GFF3, as I need to add that ability to the chado GFF3 bulk loader. Can you give me some guidance on what I need to do? Thanks, Scott -- ------------------------------------------------------------------------ Scott Cain, Ph. D. cain@cshl.org GMOD Coordinator (http://www.gmod.org/) 216-392-3087 Cold Spring Harbor Laboratory From allenday at ucla.edu Wed Oct 20 18:47:41 2004 From: allenday at ucla.edu (Allen Day) Date: Wed Oct 20 18:46:33 2004 Subject: [Bioperl-l] Re: Handling gff3 Target and Dbxref tags through FeatureIO In-Reply-To: <1098309665.1511.80.camel@localhost.localdomain> References: <1098309665.1511.80.camel@localhost.localdomain> Message-ID: Dbxref tags - these can be added to the AnnotationCollection as Bio::Annotation::DBLink objects. These are already being created, but due to oversight on my part not attached. The code fragment below illustrates this. Just add a few lines to add them to the Collection and voila! #Handle Dbxref attributes if($attr{Dbxref}){ foreach my $value (@{ $attr{Dbxref} }){ my $a = Bio::Annotation::DBLink->new(); my($db,$accession) = $value =~ /^(.+?):(.+)$/; if(!$db or !$accession){ #dbxref malformed $self->throw("Error in line:\n$feature_string\nDbxref value '$value' did not conform to GFF3 specification"); } $a->database($db); $a->primary_id($accession); } } Target tags - Bio::SeqFeature::Annotated needs to be able to have Bio::LocatableSeq or Bio::Location::Simple attachments. Presumably you can have multiple targets. Do something like create methods add_location() and locations() methods. -Allen On Wed, 20 Oct 2004, Scott Cain wrote: > Hi Allen, > > I am in fairly urgent need of the ability to handle Target and Dbxref > tags in GFF3, as I need to add that ability to the chado GFF3 bulk > loader. Can you give me some guidance on what I need to do? > > Thanks, > Scott > > From sdavis2 at mail.nih.gov Wed Oct 20 21:08:19 2004 From: sdavis2 at mail.nih.gov (Sean Davis) Date: Wed Oct 20 21:50:53 2004 Subject: [Bioperl-l] Re: Installing BioPerl under Mac OS X References: <225C6409-2286-11D9-8BBB-000A95B139D2@bioinfo.ca> Message-ID: <000001c4b710$88033d90$04653744@WATSON> Just a quick question--what branch is the fink package built from? Sean ----- Original Message ----- From: "Koen van der Drift" To: "Madeleine Lemieux" Cc: ; Sent: Wednesday, October 20, 2004 5:48 PM Subject: Re: [Bioperl-l] Re: Installing BioPerl under Mac OS X > > On Oct 20, 2004, at 6:52 AM, Madeleine Lemieux wrote: > > > I used fink to install libwww-pm581 and GD. I then forced the > > installation of the BioPerl bundle using CPAN. This was necessary as > > quite a few of the tests failed but not on things I cared about > > especially. I then downloaded the latest BioPerl release and followed > > the installation instructions. Worked fine. > > > Madeleine, I am curious why didn't use fink to install bioperl. Version > 1.4 has been available for a few months, and is actually part of the > most recent binary release (Fink 0.7.1). Did you get any particular > errors when you tried to install it? I am the fink-maintainer of > bioperl, so if there are any problems please let me know, so I can try > to fix the package. > > > > > > I have also installed (following each package's installation > > instructions) wwwBlast (latest OS X version from NCBI), t-coffee (the > > Unix version, not the Mac one), clustalw (the OS X version) and > > EMBOSS. > > Just as a note, all three, as well as pTk (804.026) are also availble > through fink. > > > - Koen. > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > From kvddrift at earthlink.net Wed Oct 20 22:38:31 2004 From: kvddrift at earthlink.net (Koen van der Drift) Date: Wed Oct 20 22:37:32 2004 Subject: [Bioperl-l] Re: Installing BioPerl under Mac OS X In-Reply-To: <000001c4b710$88033d90$04653744@WATSON> References: <225C6409-2286-11D9-8BBB-000A95B139D2@bioinfo.ca> <000001c4b710$88033d90$04653744@WATSON> Message-ID: <4BF0191E-230A-11D9-A2E2-003065A5FDCC@earthlink.net> On Oct 20, 2004, at 9:08 PM, Sean Davis wrote: > Just a quick question--what branch is the fink package built from? > 1.4 - Koen. From mlemieux at bioinfo.ca Thu Oct 21 01:27:56 2004 From: mlemieux at bioinfo.ca (Madeleine Lemieux) Date: Thu Oct 21 01:26:56 2004 Subject: [Bioperl-l] Re: Installing BioPerl under Mac OS X In-Reply-To: References: <225C6409-2286-11D9-8BBB-000A95B139D2@bioinfo.ca> Message-ID: Koen, >> I have also installed (following each package's installation >> instructions) wwwBlast (latest OS X version from NCBI), t-coffee (the >> Unix version, not the Mac one), clustalw (the OS X version) and >> EMBOSS. > > Just as a note, all three, as well as pTk (804.026) are also availble > through fink. My fink (0.7.1) does not list clustalw, pTk, t-coffee or wwwBlast among its packages so I just downloaded the source or executables that were available. I've used fink several times but don't know much about it. Is there some way other than using the list option to find out what packages are available? > Madeleine, I am curious why didn't use fink to install bioperl. > Version 1.4 has been available for a few months, and is actually part > of the most recent binary release (Fink 0.7.1). Did you get any > particular errors when you tried to install it? I am the > fink-maintainer of bioperl, so if there are any problems please let me > know, so I can try to fix the package. I was quite pleased to see bioperl as one of the fink packages but see below for what happens when I try use fink to install bioperl-pm581. Is there a log file somewhere that might contain more useful information? Madeleine ----------- LeMeiLin:~ $ fink install bioperl-pm581 /usr/bin/sudo /sw/bin/fink install bioperl-pm581 Password: Information about 1853 packages read in 1 seconds. The following package will be installed or updated: bioperl-pm581 The following 10 additional packages will be installed: libwww-pm581 libxml-pm581 soap-lite-pm581 uri-pm581 xml-dom-pm581 xml-node-pm581 xml-parser-pm581 xml-regexp-pm xml-twig-pm581 xml-writer-pm Do you want to continue? [Y/n] Y gzip -dc /sw/src/URI-1.30.tar.gz | /sw/bin/tar -xf - --no-same-owner --no-same-permissions /usr/bin/perl5.8.1 Makefile.PL PERL=/usr/bin/perl5.8.1 PREFIX=/sw INSTALLPRIVLIB=/sw/lib/perl5/5.8.1 INSTALLARCHLIB=/sw/lib/perl5/5.8.1/darwin-thread-multi-2level INSTALLSITELIB=/sw/lib/perl5/5.8.1 INSTALLSITEARCH=/sw/lib/perl5/5.8.1/darwin-thread-multi-2level INSTALLMAN1DIR=/sw/share/man/man1 INSTALLMAN3DIR=/sw/share/man/man3 INSTALLSITEMAN1DIR=/sw/share/man/man1 INSTALLSITEMAN3DIR=/sw/share/man/man3 INSTALLBIN=/sw/bin INSTALLSITEBIN=/sw/bin INSTALLSCRIPT=/sw/bin Checking if your kit is complete... Looks good Writing Makefile for URI make cp URI/nntp.pm blib/lib/URI/nntp.pm cp URI/gopher.pm blib/lib/URI/gopher.pm cp URI/rlogin.pm blib/lib/URI/rlogin.pm cp URI/https.pm blib/lib/URI/https.pm cp URI/snews.pm blib/lib/URI/snews.pm cp URI/URL.pm blib/lib/URI/URL.pm cp URI/Split.pm blib/lib/URI/Split.pm cp URI/_userpass.pm blib/lib/URI/_userpass.pm cp URI/urn/isbn.pm blib/lib/URI/urn/isbn.pm cp URI/mailto.pm blib/lib/URI/mailto.pm cp URI/file/QNX.pm blib/lib/URI/file/QNX.pm cp URI/_login.pm blib/lib/URI/_login.pm cp URI/ldapi.pm blib/lib/URI/ldapi.pm cp URI/file/Unix.pm blib/lib/URI/file/Unix.pm cp URI/_segment.pm blib/lib/URI/_segment.pm cp URI/_query.pm blib/lib/URI/_query.pm cp URI/mms.pm blib/lib/URI/mms.pm cp URI/file/Mac.pm blib/lib/URI/file/Mac.pm cp URI/urn.pm blib/lib/URI/urn.pm cp URI/_ldap.pm blib/lib/URI/_ldap.pm cp URI/Heuristic.pm blib/lib/URI/Heuristic.pm cp URI/rsync.pm blib/lib/URI/rsync.pm cp URI/ssh.pm blib/lib/URI/ssh.pm cp URI/WithBase.pm blib/lib/URI/WithBase.pm cp URI/pop.pm blib/lib/URI/pop.pm cp URI/file/Base.pm blib/lib/URI/file/Base.pm cp URI/file/Win32.pm blib/lib/URI/file/Win32.pm cp URI/_foreign.pm blib/lib/URI/_foreign.pm cp URI.pm blib/lib/URI.pm cp URI/file/FAT.pm blib/lib/URI/file/FAT.pm cp URI/news.pm blib/lib/URI/news.pm cp URI/ldap.pm blib/lib/URI/ldap.pm cp URI/_generic.pm blib/lib/URI/_generic.pm cp URI/rtsp.pm blib/lib/URI/rtsp.pm cp URI/ftp.pm blib/lib/URI/ftp.pm cp URI/Escape.pm blib/lib/URI/Escape.pm cp URI/_server.pm blib/lib/URI/_server.pm cp URI/http.pm blib/lib/URI/http.pm cp URI/ldaps.pm blib/lib/URI/ldaps.pm cp URI/file.pm blib/lib/URI/file.pm cp URI/QueryParam.pm blib/lib/URI/QueryParam.pm cp URI/file/OS2.pm blib/lib/URI/file/OS2.pm cp URI/sip.pm blib/lib/URI/sip.pm cp URI/urn/oid.pm blib/lib/URI/urn/oid.pm cp URI/telnet.pm blib/lib/URI/telnet.pm cp URI/tn3270.pm blib/lib/URI/tn3270.pm cp URI/rtspu.pm blib/lib/URI/rtspu.pm cp URI/sips.pm blib/lib/URI/sips.pm cp URI/data.pm blib/lib/URI/data.pm Manifying blib/man3/URI::Escape.3pm Manifying blib/man3/URI.3pm Manifying blib/man3/URI::URL.3pm Manifying blib/man3/URI::ldap.3pm Manifying blib/man3/URI::file.3pm Manifying blib/man3/URI::data.3pm Manifying blib/man3/URI::WithBase.3pm Manifying blib/man3/URI::QueryParam.3pm Manifying blib/man3/URI::Heuristic.3pm Manifying blib/man3/URI::Split.3pm make test PERL_DL_NONLAZY=1 /usr/bin/perl5.8.1 "-MExtUtils::Command::MM" "-e" "test_harness(0, 'blib/lib', 'blib/arch')" t/*.t t/abs............ok t/clone..........ok t/data...........ok t/escape.........ok t/file...........ok t/ftp............ok t/generic........ok t/heuristic......FAILED test 7 Failed 1/15 tests, 93.33% okay t/http...........ok t/ldap...........ok t/mailto.........ok t/mix............ok t/mms............ok t/news...........ok t/old-absconf....ok t/old-base.......ok t/old-relbase....ok t/pop............ok t/query-param....ok t/query..........ok t/rel............ok t/rfc2732........ok t/roy-test.......ok t/rsync..........ok t/rtsp...........ok t/sip............ok t/split..........ok t/storable.......ok t/urn-isbn.......skipped all skipped: Needs the Business::ISBN module installed t/urn-oid........ok Failed Test Stat Wstat Total Fail Failed List of Failed ------------------------------------------------------------------------ ------- t/heuristic.t 15 1 6.67% 7 1 test skipped. Failed 1/30 test scripts, 96.67% okay. 1/447 subtests failed, 99.78% okay. make: *** [test_dynamic] Error 2 ### execution of make failed, exit code 2 Failed: compiling uri-pm581-1.30-11 failed LeMeiLin:~ $ From nathanhaigh at ukonline.co.uk Thu Oct 21 05:29:27 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Thu Oct 21 05:28:38 2004 Subject: [Bioperl-l] make test!! In-Reply-To: Message-ID: <000401c4b750$76b42280$3cf4cdd9@Desktop> I appear to have Fcntl.pm included (version 1.04). I'll run the latest index tests though! Nathan > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: 20 October 2004 21:56 > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Nathan, > > My guess is that your ActiveState distribution doesn't include Fcntl.pm, > which is used by Bio::DB::FileCache. I've changed Index.t to account for > this possibility - can you test the latest t/Index.t? > > >perl -I. -w t/Index.t > > Thanks again, > > Brian O. > > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > Sent: Wednesday, October 20, 2004 10:20 AM > To: 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Apologise for all the pervious messages! I just wanted to get this onto the > mailing list: > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > System: WinXP Pro > ActiveState Perl 5.8.0 build 804 > Nmake v6.00.8168.0 > > A note beforehand: > The error message I had previously got, and heard others have also received > on other OS's. That contain a "line too long" error when > trying "make test", is due to the limitations of the particular OS. Versions > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > have got round this problem by splitting long command lines from Makefiles > into a series of smaller commands. > > Test Summary: > Failed Test Stat Wstat Total Fail Failed List of Failed > ---------------------------------------------------------------------------- > --- > t\Index.t 22 5632 41 21 51.22% 21-41 > t\Registry.t 22 5632 11 9 81.82% 3-11 > t\seqread_fail.t 255 65280 13 0 0.00% ?? > 115 subtests skipped. > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > okay. > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : > return code '0xff' > Stop. > > Particulars: > t\Index......................NOK 21Can't call method "length" on an > undefined value at t\Index.t line 124, line > 54. > t\Index......................dubious > Test returned status 22 (wstat 5632, 0x1600) > DIED. FAILED tests 21-41 > Failed 21/41 tests, 48.78% okay > t\Registry...................ok 2/11The getpwuid function is unimplemented > at K:\Downloads\FlashGet\Software\Bioinform > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > t\Registry...................dubious > Test returned status 22 (wstat 5632, 0x1600) > t\seqread_fail...............ok 1/13 > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: BioFetch Error 4: ID [XXX111] not found in database > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > STACK: Error::throw > STACK: Bio::Root::Root::throw > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b/Bio/Root/R > oot.pm:328 > STACK: Bio::DB::BioFetch::postprocess_data > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > ib/Bio/DB/BioFetch.pm:406 > STACK: Bio::DB::WebDBSeqI::get_seq_stream > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b/Bio/DB/WebDBSeqI.pm:525 > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > lib/Bio/DB/WebDBSeqI.pm:287 > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b > /Bio/DB/WebDBSeqI.pm:153 > STACK: main::fetch t\seqread_fail.t:69 > STACK: t\seqread_fail.t:81 > ----------------------------------------------------------- > t\seqread_fail...............dubious > Test returned status 255 (wstat 65280, 0xff00) > after all the subtests completed successfully > > > Nathan > > > -----Original Message----- > > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. Mackey > > Sent: 14 October 2004 21:27 > > To: Bioperl > > Subject: [Bioperl-l] make test!! > > Importance: High > > > > > > I've had only a very few people send me feedback about the current > > state of bioperl-live "make test" on your favorite > > old/crotchety/obscure platforms. I'm writing the Change log and > > thinking about branching, but I'm an experimentalist, I need data! > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > you have everything, "make distclean" if you've built from the cvs > > checkout before, and start from scratch with the usual litany: perl > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > about, not so much all the verbiage (unless there's specific verbiage > > related to the end result ...) > > > > Thanks, > > > > -Aaron > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l@portal.open-bio.org > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0442-2, 14/10/2004 > > Tested on: 14/10/2004 21:59:20 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0442-3, 15/10/2004 > Tested on: 20/10/2004 15:20:04 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0442-3, 15/10/2004 > Tested on: 21/10/2004 07:12:28 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0443-1, 20/10/2004 Tested on: 21/10/2004 10:28:48 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From kvddrift at earthlink.net Thu Oct 21 06:07:46 2004 From: kvddrift at earthlink.net (Koen van der Drift) Date: Thu Oct 21 06:06:58 2004 Subject: [Bioperl-l] Re: Installing BioPerl under Mac OS X In-Reply-To: References: <225C6409-2286-11D9-8BBB-000A95B139D2@bioinfo.ca> Message-ID: <0E98809C-2349-11D9-A2E2-003065A5FDCC@earthlink.net> On Oct 21, 2004, at 1:27 AM, Madeleine Lemieux wrote: > Koen, > >>> I have also installed (following each package's installation >>> instructions) wwwBlast (latest OS X version from NCBI), t-coffee >>> (the Unix version, not the Mac one), clustalw (the OS X version) and >>> EMBOSS. >> >> Just as a note, all three, as well as pTk (804.026) are also availble >> through fink. > My fink (0.7.1) does not list clustalw, pTk, t-coffee or wwwBlast > among its packages so I just downloaded the source or executables that > were available. I've used fink several times but don't know much about > it. Is there some way other than using the list option to find out > what packages are available? They are called: tk-pm581 clustalw tcoffee wwwblast You may have to enable the unstable tree in fink to be able to install these, see http://fink.sourceforge.net/faq/usage-fink.php?phpLang=en#unstable. > I was quite pleased to see bioperl as one of the fink packages but see > below for what happens when I try use fink to install bioperl-pm581. > Is there a log file somewhere that might contain more useful > information? > > ### execution of make failed, exit code 2 > Failed: compiling uri-pm581-1.30-11 failed > LeMeiLin:~ $ > That's a problem with the uri-pm581 package. Version 1.33 is now available, so you might want to update the fink info files (see the FAQ entry above). Bioperl is part of the bindist in 0.7.1, so you can also do: sudo apt-get install bioperl-pm581 to install it directly without compiling. good luck, - Koen. From sdavis2 at mail.nih.gov Thu Oct 21 06:21:13 2004 From: sdavis2 at mail.nih.gov (Sean Davis) Date: Thu Oct 21 06:20:06 2004 Subject: [Bioperl-l] Re: Installing BioPerl under Mac OS X In-Reply-To: References: <225C6409-2286-11D9-8BBB-000A95B139D2@bioinfo.ca> Message-ID: I had a similar experience. Also, with a continuously evolving project like bioperl, I have found it advantageous to have the CVS versions available. Sean On Oct 21, 2004, at 1:27 AM, Madeleine Lemieux wrote: > Koen, > >>> I have also installed (following each package's installation >>> instructions) wwwBlast (latest OS X version from NCBI), t-coffee >>> (the Unix version, not the Mac one), clustalw (the OS X version) and >>> EMBOSS. >> >> Just as a note, all three, as well as pTk (804.026) are also availble >> through fink. > My fink (0.7.1) does not list clustalw, pTk, t-coffee or wwwBlast > among its packages so I just downloaded the source or executables that > were available. I've used fink several times but don't know much about > it. Is there some way other than using the list option to find out > what packages are available? > >> Madeleine, I am curious why didn't use fink to install bioperl. >> Version 1.4 has been available for a few months, and is actually part >> of the most recent binary release (Fink 0.7.1). Did you get any >> particular errors when you tried to install it? I am the >> fink-maintainer of bioperl, so if there are any problems please let >> me know, so I can try to fix the package. > I was quite pleased to see bioperl as one of the fink packages but see > below for what happens when I try use fink to install bioperl-pm581. > Is there a log file somewhere that might contain more useful > information? > > Madeleine > > ----------- > LeMeiLin:~ $ fink install bioperl-pm581 > /usr/bin/sudo /sw/bin/fink install bioperl-pm581 > Password: > Information about 1853 packages read in 1 seconds. > The following package will be installed or updated: > bioperl-pm581 > The following 10 additional packages will be installed: > libwww-pm581 libxml-pm581 soap-lite-pm581 uri-pm581 xml-dom-pm581 > xml-node-pm581 xml-parser-pm581 xml-regexp-pm xml-twig-pm581 > xml-writer-pm > Do you want to continue? [Y/n] Y > gzip -dc /sw/src/URI-1.30.tar.gz | /sw/bin/tar -xf - --no-same-owner > --no-same-permissions > /usr/bin/perl5.8.1 Makefile.PL PERL=/usr/bin/perl5.8.1 PREFIX=/sw > INSTALLPRIVLIB=/sw/lib/perl5/5.8.1 > INSTALLARCHLIB=/sw/lib/perl5/5.8.1/darwin-thread-multi-2level > INSTALLSITELIB=/sw/lib/perl5/5.8.1 > INSTALLSITEARCH=/sw/lib/perl5/5.8.1/darwin-thread-multi-2level > INSTALLMAN1DIR=/sw/share/man/man1 INSTALLMAN3DIR=/sw/share/man/man3 > INSTALLSITEMAN1DIR=/sw/share/man/man1 > INSTALLSITEMAN3DIR=/sw/share/man/man3 INSTALLBIN=/sw/bin > INSTALLSITEBIN=/sw/bin INSTALLSCRIPT=/sw/bin > Checking if your kit is complete... > Looks good > Writing Makefile for URI > make > cp URI/nntp.pm blib/lib/URI/nntp.pm > cp URI/gopher.pm blib/lib/URI/gopher.pm > cp URI/rlogin.pm blib/lib/URI/rlogin.pm > cp URI/https.pm blib/lib/URI/https.pm > cp URI/snews.pm blib/lib/URI/snews.pm > cp URI/URL.pm blib/lib/URI/URL.pm > cp URI/Split.pm blib/lib/URI/Split.pm > cp URI/_userpass.pm blib/lib/URI/_userpass.pm > cp URI/urn/isbn.pm blib/lib/URI/urn/isbn.pm > cp URI/mailto.pm blib/lib/URI/mailto.pm > cp URI/file/QNX.pm blib/lib/URI/file/QNX.pm > cp URI/_login.pm blib/lib/URI/_login.pm > cp URI/ldapi.pm blib/lib/URI/ldapi.pm > cp URI/file/Unix.pm blib/lib/URI/file/Unix.pm > cp URI/_segment.pm blib/lib/URI/_segment.pm > cp URI/_query.pm blib/lib/URI/_query.pm > cp URI/mms.pm blib/lib/URI/mms.pm > cp URI/file/Mac.pm blib/lib/URI/file/Mac.pm > cp URI/urn.pm blib/lib/URI/urn.pm > cp URI/_ldap.pm blib/lib/URI/_ldap.pm > cp URI/Heuristic.pm blib/lib/URI/Heuristic.pm > cp URI/rsync.pm blib/lib/URI/rsync.pm > cp URI/ssh.pm blib/lib/URI/ssh.pm > cp URI/WithBase.pm blib/lib/URI/WithBase.pm > cp URI/pop.pm blib/lib/URI/pop.pm > cp URI/file/Base.pm blib/lib/URI/file/Base.pm > cp URI/file/Win32.pm blib/lib/URI/file/Win32.pm > cp URI/_foreign.pm blib/lib/URI/_foreign.pm > cp URI.pm blib/lib/URI.pm > cp URI/file/FAT.pm blib/lib/URI/file/FAT.pm > cp URI/news.pm blib/lib/URI/news.pm > cp URI/ldap.pm blib/lib/URI/ldap.pm > cp URI/_generic.pm blib/lib/URI/_generic.pm > cp URI/rtsp.pm blib/lib/URI/rtsp.pm > cp URI/ftp.pm blib/lib/URI/ftp.pm > cp URI/Escape.pm blib/lib/URI/Escape.pm > cp URI/_server.pm blib/lib/URI/_server.pm > cp URI/http.pm blib/lib/URI/http.pm > cp URI/ldaps.pm blib/lib/URI/ldaps.pm > cp URI/file.pm blib/lib/URI/file.pm > cp URI/QueryParam.pm blib/lib/URI/QueryParam.pm > cp URI/file/OS2.pm blib/lib/URI/file/OS2.pm > cp URI/sip.pm blib/lib/URI/sip.pm > cp URI/urn/oid.pm blib/lib/URI/urn/oid.pm > cp URI/telnet.pm blib/lib/URI/telnet.pm > cp URI/tn3270.pm blib/lib/URI/tn3270.pm > cp URI/rtspu.pm blib/lib/URI/rtspu.pm > cp URI/sips.pm blib/lib/URI/sips.pm > cp URI/data.pm blib/lib/URI/data.pm > Manifying blib/man3/URI::Escape.3pm > Manifying blib/man3/URI.3pm > Manifying blib/man3/URI::URL.3pm > Manifying blib/man3/URI::ldap.3pm > Manifying blib/man3/URI::file.3pm > Manifying blib/man3/URI::data.3pm > Manifying blib/man3/URI::WithBase.3pm > Manifying blib/man3/URI::QueryParam.3pm > Manifying blib/man3/URI::Heuristic.3pm > Manifying blib/man3/URI::Split.3pm > make test > PERL_DL_NONLAZY=1 /usr/bin/perl5.8.1 "-MExtUtils::Command::MM" "-e" > "test_harness(0, 'blib/lib', 'blib/arch')" t/*.t > t/abs............ok > t/clone..........ok > t/data...........ok > t/escape.........ok > t/file...........ok > t/ftp............ok > t/generic........ok > t/heuristic......FAILED test 7 > Failed 1/15 tests, 93.33% okay > t/http...........ok > t/ldap...........ok > t/mailto.........ok > t/mix............ok > t/mms............ok > t/news...........ok > t/old-absconf....ok > t/old-base.......ok > t/old-relbase....ok > t/pop............ok > t/query-param....ok > t/query..........ok > t/rel............ok > t/rfc2732........ok > t/roy-test.......ok > t/rsync..........ok > t/rtsp...........ok > t/sip............ok > t/split..........ok > t/storable.......ok > t/urn-isbn.......skipped > all skipped: Needs the Business::ISBN module installed > t/urn-oid........ok > Failed Test Stat Wstat Total Fail Failed List of Failed > ----------------------------------------------------------------------- > -------- > t/heuristic.t 15 1 6.67% 7 > 1 test skipped. > Failed 1/30 test scripts, 96.67% okay. 1/447 subtests failed, 99.78% > okay. > make: *** [test_dynamic] Error 2 > ### execution of make failed, exit code 2 > Failed: compiling uri-pm581-1.30-11 failed > LeMeiLin:~ $ > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l From kvddrift at earthlink.net Thu Oct 21 06:31:49 2004 From: kvddrift at earthlink.net (Koen van der Drift) Date: Thu Oct 21 06:30:38 2004 Subject: [Bioperl-l] Re: Installing BioPerl under Mac OS X In-Reply-To: References: <225C6409-2286-11D9-8BBB-000A95B139D2@bioinfo.ca> Message-ID: <6A9A025C-234C-11D9-A2E2-003065A5FDCC@earthlink.net> On Oct 21, 2004, at 6:21 AM, Sean Davis wrote: > Also, with a continuously evolving project like bioperl, I have found > it advantageous to have the CVS versions available. > On of the fink policies is that each package should result in the exact same .deb file independently of the machine it was installed on. Therefore it is not possible to use cvs snapshots, because as you say they evolve continuously. - Koen. From michael.watson at bbsrc.ac.uk Thu Oct 21 09:38:46 2004 From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C)) Date: Thu Oct 21 09:40:09 2004 Subject: [Bioperl-l] EMBL Identifier line is incorrect when using SeqIO (1.4) Message-ID: <8975119BCD0AC5419D61A9CF1A923E95E895E6@iahce2knas1.iah.bbsrc.reserved> Hi Using bioperl-1.4 on Suse Linux, I find that when writing sequences in EMBL format using SeqIO, there is no space left after the display_id e.g. "J18191-1h03.p1k" becomes "ID J18191-1h03.p1kstandard; DNA; UNK; 1657 BP." Mick From nathanhaigh at ukonline.co.uk Thu Oct 21 08:49:06 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Thu Oct 21 09:44:26 2004 Subject: [Bioperl-l] make test!! In-Reply-To: Message-ID: <000d01c4b76c$5bb3fd90$3cf4cdd9@Desktop> Ok, I've done some more testing (with the latest CVS 9am GMT) and here is what I've found! I've run "namke test" with and without BIOPERLDEBUG, and running individual tests using " perl -I. -w t/test_name.t". Below are the contents of 3 files with details of errors, if you would like me to e-mail the files directly directly to you, let me know: Errors.txt - summary and details of failed tests, and other tests with peculiar warnings etc Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set Perl_test.txt - individual tests run with BIOPERLDEBUG set, using "perl -I. -w t/test_name.t" My System: WinXP Pro ActiveState Perl 5.8.0 Nmake 6.00.8168.0 My Summary: ESEfinder.t - causes perl to crash on test 2 during "nmake test", but ok in other tests! Biblio_biofetch.t - throws warning and exception when using BIOPERLDEBUG, but doesn't appear in summary! Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 ProtPsm.t - needs "plan tests" in test file changing to 5. When running the individual test can't locate Bio::Matrix::PSM::ProtMatrix Registry.t - several error including "No seqdatabase.ini file found", " No database with name testflat in Registry" Primaryqual.t - Test returned status 255. and 'Can't locate object method "header"' in individual test seqread_fail.t - gives an exception, is this supposed to happen? Hope this help to iron out bugs when running BioPerl on Windows! Nathan Errors_debug.txt ############## Failed Test Stat Wstat Total Fail Failed List of Failed ------------------------------------------------------------------------------- t\ESEfinder.t 5 1280 12 10 83.33% 3-12 t\Index.t 22 5632 41 21 51.22% 21-41 t\ProtPsm.t 1 ?? % ?? t\Registry.t 255 65280 11 8 72.73% 4-11 t\primaryqual.t 255 65280 31 0 0.00% ?? t\seqread_fail.t 255 65280 13 0 0.00% ?? 2 subtests skipped. Failed 6/193 test scripts, 96.89% okay. 35/8919 subtests failed, 99.61% okay. NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : return code '0xff' Stop. Particulars: ------------ t\Biblio_biofetch............ok 1/11Warning: Couldn't connect to BioFetch server with Bio::DB::Medline.pm! ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: retrieval type pipeline unsupported STACK: Error::throw STACK: Bio::Root::Root::throw K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\bl ib\lib/Bio/Root/Root.pm:328 STACK: Bio::DB::Biblio::biofetch::get_seq_stream K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbi operl-live-debug\blib\lib/Bio/DB/Biblio/biofetch.pm:237 STACK: Bio::DB::DBFetch::get_Stream_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-l ive-debug\blib\lib/Bio/DB/DBFetch.pm:194 STACK: Bio::DB::Biblio::biofetch::get_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl -live-debug\blib\lib/Bio/DB/Biblio/biofetch.pm:153 STACK: t\Biblio_biofetch.t:71 ----------------------------------------------------------- t\ESEfinder..................dubious Test returned status 5 (wstat 1280, 0x500) DIED. FAILED tests 3-12 Failed 10/12 tests, 16.67% okay t\Index......................NOK 21Can't call method "length" on an undefined value at t\Index.t line 126, line 54. t\Index......................dubious Test returned status 22 (wstat 5632, 0x1600) DIED. FAILED tests 21-41 Failed 21/41 tests, 48.78% okay t\primaryqual................dubious Test returned status 255 (wstat 65280, 0xff00) after all the subtests completed successfully t\ProtPsm....................ok 5/1Don't know which tests failed: got 5 ok, expected 1 t\Registry...................ok 2/11This Perl doesn't implement function getpwuid(). Skipping... -------------------- WARNING --------------------- MSG: No seqdatabase.ini file found in ~/.bioinformatics/ nor in /etc/bioinformatics/ nor in directory specified by t/data/registry/flat;t/data/registry/bdb. Using web to get database registry from http://www.open-bio.org/registry/seqdatabase.ini --------------------------------------------------- -------------------- WARNING --------------------- MSG: Stored the default registry configuration in /.bioinformatics/seqdatabase.ini --------------------------------------------------- t\Registry...................NOK 5 -------------------- WARNING --------------------- MSG: No database with name testflat in Registry --------------------------------------------------- Can't call method "get_Seq_by_id" on an undefined value at t\Registry.t line 66, line 11. t\Registry...................dubious Test returned status 255 (wstat 65280, 0xff00) DIED. FAILED tests 4-11 Failed 8/11 tests, 27.27% okay t\SeqIO......................ok 196/284 -------------------- WARNING --------------------- MSG: Bio::PrimarySeq=HASH(0x2a9363c) is not a SeqI compliant sequence object! STACK Bio::SeqIO::embl::write_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu g\blib\lib/Bio\SeqIO\embl.pm:410 STACK toplevel t\SeqIO.t:527 t\SeqIO......................ok 198/284 t\SeqIO......................ok 199/284-------------------- WARNING --------------------- MSG: test is not a SeqI compliant sequence object! STACK Bio::SeqIO::embl::write_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu g\blib\lib/Bio\SeqIO\embl.pm:410 STACK (eval) t\SeqIO.t:530 STACK toplevel t\SeqIO.t:529 t\SeqIO......................ok 253/284Location parse, processing 1..105 Location parse, processing <1..>105 Location parse, processing 69^70 Location parse, processing 103^102 t\SeqIO......................ok 259/284 -------------------- WARNING --------------------- MSG: When building a location, start (103) is expected to be less than end (102), however it was not. Switching start and end and setting strand to -1 STACK Bio::Location::Atomic::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug \blib\lib/Bio/Location/Atomic.pm:104 STACK Bio::Location::Simple::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug \blib\lib/Bio\Location\Simple.pm:91 STACK Bio::Factory::FTLocationFactory::_parse_location K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218 t\SeqIO......................ok 262/284STACK Bio::Factory::FTLocationFactory::from_string K:\Downloads\FlashGet\Softwa re\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157 STACK (eval) K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/ FTHelper.pm:124 STACK Bio::SeqIO::FTHelper::_generic_seqfeature K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123 STACK Bio::SeqIO::genbank::next_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-de bug\blib\lib/Bio\SeqIO\genbank.pm:488 STACK (eval) t\SeqIO.t:681 STACK toplevel t\SeqIO.t:680 t\seqread_fail...............ok 1/13 ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: BioFetch Error 4: ID [XXX111] not found in database [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. STACK: Error::throw STACK: Bio::Root::Root::throw K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\bl ib\lib/Bio/Root/Root.pm:328 STACK: Bio::DB::BioFetch::postprocess_data K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl- live-debug\blib\lib/Bio/DB/BioFetch.pm:406 STACK: Bio::DB::WebDBSeqI::get_seq_stream K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-l ive-debug\blib\lib/Bio/DB/WebDBSeqI.pm:525 STACK: Bio::DB::WebDBSeqI::get_Stream_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl -live-debug\blib\lib/Bio/DB/WebDBSeqI.pm:287 STACK: Bio::DB::WebDBSeqI::get_Seq_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-li ve-debug\blib\lib/Bio/DB/WebDBSeqI.pm:153 STACK: main::fetch t\seqread_fail.t:69 STACK: t\seqread_fail.t:81 ----------------------------------------------------------- t\seqread_fail...............dubious Test returned status 255 (wstat 65280, 0xff00) after all the subtests completed successfully t\Swiss......................ok 2/5Location parse, processing 1..? -------------------- WARNING --------------------- MSG: could not find a valid fuzzy encoding for ? STACK Bio::Location::Fuzzy::_fuzzypointdecode K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554 STACK Bio::Location::Fuzzy::end K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ blib\lib/Bio\Location\Fuzzy.pm:254 STACK Bio::Location::Atomic::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug \blib\lib/Bio/Location/Atomic.pm:101 STACK Bio::Location::Fuzzy::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ blib\lib/Bio/Location/Fuzzy.pm:139 STACK Bio::Factory::FTLocationFactory::_parse_location K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218 STACK Bio::Factory::FTLocationFactory::from_string K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157 STACK (eval) K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/ FTHelper.pm:124 STACK Bio::SeqIO::FTHelper::_generic_seqfeature K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123 STACK Bio::SeqIO::swiss::next_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu g\blib\lib/Bio\SeqIO\swiss.pm:326 STACK toplevel t\Swiss.t:47 Location parse, processing ?..409 -------------------- WARNING --------------------- MSG: could not find a valid fuzzy encoding for ? STACK Bio::Location::Fuzzy::_fuzzypointdecode K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554 STACK Bio::Location::Fuzzy::start K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu g\blib\lib/Bio\Location\Fuzzy.pm:229 STACK Bio::Location::Atomic::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug \blib\lib/Bio/Location/Atomic.pm:100 STACK Bio::Location::Fuzzy::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ blib\lib/Bio\Location\Fuzzy.pm:139 STACK Bio::Factory::FTLocationFactory::_parse_location K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218 STACK Bio::Factory::FTLocationFactory::from_string K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157 STACK (eval) K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/ FTHelper.pm:124 STACK Bio::SeqIO::FTHelper::_generic_seqfeature K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123 STACK Bio::SeqIO::swiss::next_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu g\blib\lib/Bio\SeqIO\swiss.pm:326 STACK toplevel t\Swiss.t:47 Location parse, processing 388..388 Location parse, processing 1..? -------------------- WARNING --------------------- MSG: could not find a valid fuzzy encoding for ? STACK Bio::Location::Fuzzy::_fuzzypointdecode K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554 STACK Bio::Location::Fuzzy::end K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ blib\lib/Bio\Location\Fuzzy.pm:254 STACK Bio::Location::Atomic::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug \blib\lib/Bio/Location/Atomic.pm:101 STACK Bio::Location::Fuzzy::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ blib\lib/Bio\Location\Fuzzy.pm:139 STACK Bio::Factory::FTLocationFactory::_parse_location K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218 STACK Bio::Factory::FTLocationFactory::from_string K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157 STACK (eval) K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/ FTHelper.pm:124 STACK Bio::SeqIO::FTHelper::_generic_seqfeature K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123 STACK Bio::SeqIO::swiss::next_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu g\blib\lib/Bio\SeqIO\swiss.pm:326 STACK toplevel t\Swiss.t:62 Location parse, processing ?..409 -------------------- WARNING --------------------- MSG: could not find a valid fuzzy encoding for ? STACK Bio::Location::Fuzzy::_fuzzypointdecode K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554 STACK Bio::Location::Fuzzy::start K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu g\blib\lib/Bio\Location\Fuzzy.pm:229 STACK Bio::Location::Atomic::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug \blib\lib/Bio/Location/Atomic.pm:100 STACK Bio::Location::Fuzzy::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ blib\lib/Bio\Location\Fuzzy.pm:139 STACK Bio::Factory::FTLocationFactory::_parse_location K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218 STACK Bio::Factory::FTLocationFactory::from_string K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157 STACK (eval) K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/ FTHelper.pm:124 STACK Bio::SeqIO::FTHelper::_generic_seqfeature K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123 STACK Bio::SeqIO::swiss::next_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu g\blib\lib/Bio\SeqIO\swiss.pm:326 STACK toplevel t\Swiss.t:62 Location parse, processing 388..388 t\Swiss......................ok errors.txt ####### Failed Test Stat Wstat Total Fail Failed List of Failed ------------------------------------------------------------------------------- t\Index.t 22 5632 41 21 51.22% 21-41 t\ProtPsm.t 1 ?? % ?? t\Registry.t 255 65280 11 8 72.73% 4-11 t\primaryqual.t 255 65280 31 0 0.00% ?? t\seqread_fail.t 255 65280 13 0 0.00% ?? 115 subtests skipped. Failed 5/193 test scripts, 97.41% okay. 25/8919 subtests failed, 99.72% okay. NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : return code '0xff' Stop. Particulars: ------------ t\Index......................NOK 21Can't call method "length" on an undefined value at t\Index.t line 126, line 54. t\Index......................dubious Test returned status 22 (wstat 5632, 0x1600) DIED. FAILED tests 21-41 Failed 21/41 tests, 48.78% okay t\primaryqual................dubious Test returned status 255 (wstat 65280, 0xff00) after all the subtests completed successfully t\ProtPsm....................ok 5/1Don't know which tests failed: got 5 ok, expected 1 t\Registry...................ok 2/11This Perl doesn't implement function getpwuid(). Skipping... -------------------- WARNING --------------------- MSG: No seqdatabase.ini file found in ~/.bioinformatics/ nor in /etc/bioinformatics/ nor in directory specified by t/data/registry/flat;t/data/registry/bdb. Using web to get database registry from http://www.open-bio.org/registry/seqdatabase.ini --------------------------------------------------- -------------------- WARNING --------------------- MSG: Stored the default registry configuration in /.bioinformatics/seqdatabase.ini --------------------------------------------------- t\Registry...................ok 3/11 t\Registry...................NOK 5-------------------- WARNING --------------------- MSG: No database with name testflat in Registry --------------------------------------------------- Can't call method "get_Seq_by_id" on an undefined value at t\Registry.t line 66, line 11. t\Registry...................dubious Test returned status 255 (wstat 65280, 0xff00) DIED. FAILED tests 4-11 t\seqread_fail...............ok 1/13 ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: BioFetch Error 4: ID [XXX111] not found in database [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. STACK: Error::throw STACK: Bio::Root::Root::throw K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live\blib\lib /Bio/Root/Root.pm:328 STACK: Bio::DB::BioFetch::postprocess_data K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl- live\blib\lib/Bio/DB/BioFetch.pm:406 STACK: Bio::DB::WebDBSeqI::get_seq_stream K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-l ive\blib\lib/Bio/DB/WebDBSeqI.pm:525 STACK: Bio::DB::WebDBSeqI::get_Stream_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl -live\blib\lib/Bio/DB/WebDBSeqI.pm:287 STACK: Bio::DB::WebDBSeqI::get_Seq_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-li ve\blib\lib/Bio/DB/WebDBSeqI.pm:153 STACK: main::fetch t\seqread_fail.t:69 STACK: t\seqread_fail.t:81 ----------------------------------------------------------- t\seqread_fail...............dubious Test returned status 255 (wstat 65280, 0xff00) after all the subtests completed successfully perl_tests.txt ########### perl -I. -w t/ESEfinder.t ------------------------- 1..12 error is 0 ok 1 ok 2 $Bio::Tools::Analysis::DNA::ESEfinder=HASH(0x1db571c) = bless( { # verbose stuff here removed >bioperl atcgatgctatgcatgctatgggtgtgattcgatgcgactgttcatcgtagccccccccc cccccctttt ok 3 Subroutine new redefined at Bio\Location\Simple.pm line 89, line 31. Subroutine start redefined at Bio\Location\Simple.pm line 111, line 31. Subroutine end redefined at Bio\Location\Simple.pm line 137, line 31. Subroutine length redefined at Bio\Location\Simple.pm line 174, line 31. Subroutine location_type redefined at Bio\Location\Simple.pm line 265, line 31. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 312, line 31. Subroutine trunc redefined at Bio\Location\Simple.pm line 343, line 31. ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 perl -I. -w t/Index.t --------------------- 1..41 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 Subroutine new redefined at Bio\Location\Simple.pm line 89, line 87. Subroutine start redefined at Bio\Location\Simple.pm line 111, line 87. Subroutine end redefined at Bio\Location\Simple.pm line 137, line 87. Subroutine length redefined at Bio\Location\Simple.pm line 174, line 87. Subroutine location_type redefined at Bio\Location\Simple.pm line 265, line 87. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 312, line 87. Subroutine trunc redefined at Bio\Location\Simple.pm line 343, line 87. Subroutine new redefined at Bio\Location\Fuzzy.pm line 137, line 92. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 164, line 92. Subroutine start redefined at Bio\Location\Fuzzy.pm line 226, line 92. Subroutine end redefined at Bio\Location\Fuzzy.pm line 251, line 92. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 276, line 92. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 295, line 92. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 315, line 92. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 344, line 92. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 363, line 92. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 383, line 92. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 450, line 92. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 537, line 92. ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 not ok 21 # Failed test 21 in t/Index.t at line 118 not ok 22 # Failed test 22 in t/Index.t at line 125 Can't call method "length" on an undefined value at t/Index.t line 126, line 54. perl -I. -w t/ProtPsm.t ----------------------- 1..1 Can't locate package Bio::Matrix::PSM::ProtMatrix for @Bio::Matrix::PSM::ProtPsm::ISA at t/ProtPsm.t line 22. ok 1 ok 2 ok 3 ok 4 ok 5 perl -I. -w t/Registry.t ------------------------ 1..11 ok 1 ok 2 This Perl doesn't implement function getpwuid(). Skipping... -------------------- WARNING --------------------- MSG: No seqdatabase.ini file found in ~/.bioinformatics/ nor in /etc/bioinformatics/ nor in directory specified by t/data/registry/flat;t/data/registry/bdb. Using web to get database registry from http://www.open-bio.org/registry/seqdatabase.ini --------------------------------------------------- -------------------- WARNING --------------------- MSG: Stored the default registry configuration in /.bioinformatics/seqdatabase.ini --------------------------------------------------- ok 3 not ok 4 # Failed test 4 in t/Registry.t at line 61 not ok 5 # Failed test 5 in t/Registry.t at line 63 -------------------- WARNING --------------------- MSG: No database with name testflat in Registry --------------------------------------------------- not ok 6 # Failed test 6 in t/Registry.t at line 65 Can't call method "get_Seq_by_id" on an undefined value at t/Registry.t line 66, line 11. perl -I. -w t/primaryqual.t --------------------------- # lots of output then: Can't locate object method "header" via package "Bio::Seq::SeqWithQuality" at Bio\SeqIO\qual.pm line 211, line 1. > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: 20 October 2004 19:04 > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Nathan, > > I noticed most of the Registry tests failing. I know what part of the > problem is (getpwuid() not implemented in Windows/Activestate Perl) and I > think I've fixed at least that part. Can you install the most recent > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > >perl -w -I. t/Registry.t > > > Brian O. > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > Sent: Wednesday, October 20, 2004 10:20 AM > To: 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Apologise for all the pervious messages! I just wanted to get this onto the > mailing list: > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > System: WinXP Pro > ActiveState Perl 5.8.0 build 804 > Nmake v6.00.8168.0 > > A note beforehand: > The error message I had previously got, and heard others have also received > on other OS's. That contain a "line too long" error when > trying "make test", is due to the limitations of the particular OS. Versions > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > have got round this problem by splitting long command lines from Makefiles > into a series of smaller commands. > > Test Summary: > Failed Test Stat Wstat Total Fail Failed List of Failed > ---------------------------------------------------------------------------- > --- > t\Index.t 22 5632 41 21 51.22% 21-41 > t\Registry.t 22 5632 11 9 81.82% 3-11 > t\seqread_fail.t 255 65280 13 0 0.00% ?? > 115 subtests skipped. > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > okay. > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : > return code '0xff' > Stop. > > Particulars: > t\Index......................NOK 21Can't call method "length" on an > undefined value at t\Index.t line 124, line > 54. > t\Index......................dubious > Test returned status 22 (wstat 5632, 0x1600) > DIED. FAILED tests 21-41 > Failed 21/41 tests, 48.78% okay > t\Registry...................ok 2/11The getpwuid function is unimplemented > at K:\Downloads\FlashGet\Software\Bioinform > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > t\Registry...................dubious > Test returned status 22 (wstat 5632, 0x1600) > t\seqread_fail...............ok 1/13 > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: BioFetch Error 4: ID [XXX111] not found in database > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > STACK: Error::throw > STACK: Bio::Root::Root::throw > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b/Bio/Root/R > oot.pm:328 > STACK: Bio::DB::BioFetch::postprocess_data > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > ib/Bio/DB/BioFetch.pm:406 > STACK: Bio::DB::WebDBSeqI::get_seq_stream > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b/Bio/DB/WebDBSeqI.pm:525 > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > lib/Bio/DB/WebDBSeqI.pm:287 > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b > /Bio/DB/WebDBSeqI.pm:153 > STACK: main::fetch t\seqread_fail.t:69 > STACK: t\seqread_fail.t:81 > ----------------------------------------------------------- > t\seqread_fail...............dubious > Test returned status 255 (wstat 65280, 0xff00) > after all the subtests completed successfully > > > Nathan > > > -----Original Message----- > > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. Mackey > > Sent: 14 October 2004 21:27 > > To: Bioperl > > Subject: [Bioperl-l] make test!! > > Importance: High > > > > > > I've had only a very few people send me feedback about the current > > state of bioperl-live "make test" on your favorite > > old/crotchety/obscure platforms. I'm writing the Change log and > > thinking about branching, but I'm an experimentalist, I need data! > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > you have everything, "make distclean" if you've built from the cvs > > checkout before, and start from scratch with the usual litany: perl > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > about, not so much all the verbiage (unless there's specific verbiage > > related to the end result ...) > > > > Thanks, > > > > -Aaron > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l@portal.open-bio.org > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0442-2, 14/10/2004 > > Tested on: 14/10/2004 21:59:20 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0442-3, 15/10/2004 > Tested on: 20/10/2004 15:20:04 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0442-3, 15/10/2004 > Tested on: 21/10/2004 07:12:10 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0443-1, 20/10/2004 Tested on: 21/10/2004 12:58:59 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0443-1, 20/10/2004 Tested on: 21/10/2004 13:46:01 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From luisa.pugliese at safan-bioinformatics.it Thu Oct 21 10:03:37 2004 From: luisa.pugliese at safan-bioinformatics.it (luisa pugliese) Date: Thu Oct 21 10:02:21 2004 Subject: [Bioperl-l] extracting sequences by id from simplealign object Message-ID: <007b01c4b776$c2942850$f3ee669e@chagall> Dear all, now that I solved the problems on how to put strings into simplealign objects, I have somehow the opposite problem: I would like to extract a sequence from the alignment. I saw that there are many ways of doing it using the sequential number of the sequence but I didn't find how to do it using the id. Does anybody knows if this is possible and how? Many thanks Luisa ============================= Luisa Pugliese, Ph.D. luisa.pugliese@safan-bioinformatics.it S.A.F.AN. BIOINFORMATICS Corso Tazzoli 215/13 -10137 Torino - ITALY tel +39 011 3026230 fax +39 011 3165080 cell. +39 333 6130644 From hlapp at gmx.net Thu Oct 21 11:42:22 2004 From: hlapp at gmx.net (Hilmar Lapp) Date: Thu Oct 21 11:41:12 2004 Subject: [Bioperl-l] EMBL Identifier line is incorrect when using SeqIO (1.4) In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E95E895E6@iahce2knas1.iah.bbsrc.reserved> Message-ID: If you make the ID shorter, is there still no space? I believe the ID is length-limited in EMBL, but I'd have to check the specs to be sure. -hilmar On Thursday, October 21, 2004, at 06:38 AM, michael watson (IAH-C) wrote: > Hi > > Using bioperl-1.4 on Suse Linux, I find that when writing sequences in > EMBL format using SeqIO, there is no space left after the display_id > e.g. > > "J18191-1h03.p1k" becomes "ID J18191-1h03.p1kstandard; DNA; UNK; 1657 > BP." > > Mick > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- From luisa.pugliese at safan-bioinformatics.it Thu Oct 21 12:07:07 2004 From: luisa.pugliese at safan-bioinformatics.it (luisa pugliese) Date: Thu Oct 21 12:05:49 2004 Subject: [Bioperl-l] reading an alignment Message-ID: <00a901c4b788$03d43290$f3ee669e@chagall> Dear all, again me... now there is something that should be really trivial, but I am not able to do. I created an alignment with bioperl, then when I try to read it back, if I use the syntax: $profile1 = 'test1.msf' I am able to work on it with clustalw but I am not able to loop over it with foreach my $sel_seq ($profile1->each_seq){ } on the other side, I am not able to read it with the syntax: my $in = Bio::AlignIO->new(-format => 'msf', -file => 'test1.msf'); my $aln = $in ->next_aln(); because I get the following error message: ------------------- WARNING --------------------- MSG: seq doesn't validate, mismatch is 1 --------------------------------------------------- ------------- EXCEPTION ------------- MSG: Attempting to set the sequence to [/1-650-------------------ANQTL-GG-DFFL-LGIFS-----QISHPGR/1-650L---CL---LIF- -SIF--L--MAVSWNIT-----LI----L----LIHI/1-650-----DSS-----LH-----TP-MY-----F-- FI-NQ-LSLIDLTYISV/1-650----TVPKMLVNQL-----AK-----DKTI--SVL-----GC-GTQMY--/1- 650--F----Y----L-----QL---GG---AE-C-----CL-----LAAMAY/1-650--D-R--YV-----AIC H---PLR--YS-----V----LM---S---HR-/1-650---V-----CL-LL-----ASG-----CWFVGSVDGF MLT--PIAMSF--/1-650---PF-----CRSHEIQHFFCEVPAVLKLS-CSDTSLYKIF-----MY--/1-650L CCV--IMLLIPVTVISVSYYY-IILTIHKMNS--------VEGR-----/1-650KK----AFT-----T---C-S SHITVV-SLFYG---------------AA/1-650IYNYMLP-----SSYQTPEKDMMSSFFYTIL---T---PV- ----L--NP/1-650----IIYS-----FRNK---D-----VTR----AL-----K-----K--M/1-650LSV-- ---------------------------------------------] which does not look healthy STACK Bio::PrimarySeq::seq /home/luisa/bioperl_new/bioperl-1.4/Bio/PrimarySeq.pm:268 STACK Bio::PrimarySeq::new /home/luisa/bioperl_new/bioperl-1.4/Bio/PrimarySeq.pm:217 STACK Bio::LocatableSeq::new /home/luisa/bioperl_new/bioperl-1.4/Bio/LocatableSeq.pm:100 STACK Bio::AlignIO::msf::next_aln /home/luisa/bioperl_new/bioperl-1.4/Bio/AlignIO/msf.pm:133 STACK toplevel /home/luisa/bioperl_course/work_on_clustalw.pl:71 ------------------------------------ many thanks if somebody can open my eyes on what is going on! Luisa ============================= Luisa Pugliese, Ph.D. luisa.pugliese@safan-bioinformatics.it S.A.F.AN. BIOINFORMATICS Corso Tazzoli 215/13 -10137 Torino - ITALY tel +39 011 3026230 fax +39 011 3165080 cell. +39 333 6130644 From Bernhard.Schmalhofer at biomax.de Thu Oct 21 12:49:21 2004 From: Bernhard.Schmalhofer at biomax.de (Bernhard Schmalhofer) Date: Thu Oct 21 12:48:25 2004 Subject: [Bioperl-l] EMBL Identifier line is incorrect when using SeqIO (1.4) In-Reply-To: References: Message-ID: <4177E891.4090905@biomax.de> Hilmar Lapp wrote: >> Using bioperl-1.4 on Suse Linux, I find that when writing sequences in >> EMBL format using SeqIO, there is no space left after the display_id >> e.g. >> >> "J18191-1h03.p1k" becomes "ID J18191-1h03.p1kstandard; DNA; UNK; 1657 >> BP. > If you make the ID shorter, is there still no space? I believe the ID is > length-limited in EMBL, but I'd have to check the specs to be sure. > > -hilmar > I have run into the same problem. For the application I'm currently working on, I'm using a wrapper around Bio::SeqIO that does a if ( $content =~ m/^ID\s+\S+standard; / ) { # This seems to be a bug in Bio::SeqIO $content =~ s/standard; / standard; /; } In the BioPerl-CVS there is a version that truncates the ID to 10 charactes and leaves a space before the 'standard;'. CU, Bernhard -- ************************************************** Dipl.-Physiker Bernhard Schmalhofer Senior Developer Biomax Informatics AG Lochhamer Str. 11 82152 Martinsried, Germany Tel: +49 89 895574-839 Fax: +49 89 895574-825 eMail: Bernhard.Schmalhofer@biomax.com Website: www.biomax.com ************************************************** From cain at cshl.org Thu Oct 21 13:41:00 2004 From: cain at cshl.org (Scott Cain) Date: Thu Oct 21 13:44:58 2004 Subject: [Bioperl-l] Re: Handling gff3 Target and Dbxref tags through FeatureIO In-Reply-To: References: <1098309665.1511.80.camel@localhost.localdomain> Message-ID: <1098380460.1500.10.camel@localhost.localdomain> On Wed, 2004-10-20 at 18:47, Allen Day wrote: > Target tags - Bio::SeqFeature::Annotated needs to be able to have > Bio::LocatableSeq or Bio::Location::Simple attachments. Presumably you > can have multiple targets. Do something like create methods > add_location() and locations() methods. > Is there a reason that you can think of that I should use Bio::LocatableSeq over Bio::Location::Simple, as the latter is probably more 'simple'. Thanks, Scott -- ------------------------------------------------------------------------ Scott Cain, Ph. D. cain@cshl.org GMOD Coordinator (http://www.gmod.org/) 216-392-3087 Cold Spring Harbor Laboratory From cain at cshl.org Thu Oct 21 14:02:03 2004 From: cain at cshl.org (Scott Cain) Date: Thu Oct 21 14:00:55 2004 Subject: [Bioperl-l] Re: Handling gff3 Target and Dbxref tags through FeatureIO In-Reply-To: <1098380460.1500.10.camel@localhost.localdomain> References: <1098309665.1511.80.camel@localhost.localdomain> <1098380460.1500.10.camel@localhost.localdomain> Message-ID: <1098381723.1502.27.camel@localhost.localdomain> On Thu, 2004-10-21 at 13:41, Scott Cain wrote: > On Wed, 2004-10-20 at 18:47, Allen Day wrote: > > Target tags - Bio::SeqFeature::Annotated needs to be able to have > > Bio::LocatableSeq or Bio::Location::Simple attachments. Presumably you > > can have multiple targets. Do something like create methods > > add_location() and locations() methods. > > > Is there a reason that you can think of that I should use > Bio::LocatableSeq over Bio::Location::Simple, as the latter is probably > more 'simple'. Should Bio::SeqFeature::Annotated have a targets hash and add_ and get_targets methods? That seems like the right thing to do, but I am not sure it fits with the design. Thanks, Scott -- ------------------------------------------------------------------------ Scott Cain, Ph. D. cain@cshl.org GMOD Coordinator (http://www.gmod.org/) 216-392-3087 Cold Spring Harbor Laboratory From allenday at ucla.edu Thu Oct 21 14:09:04 2004 From: allenday at ucla.edu (Allen Day) Date: Thu Oct 21 14:08:00 2004 Subject: [Bioperl-l] Re: Handling gff3 Target and Dbxref tags through FeatureIO In-Reply-To: <1098380460.1500.10.camel@localhost.localdomain> References: <1098309665.1511.80.camel@localhost.localdomain> <1098380460.1500.10.camel@localhost.localdomain> Message-ID: take a look at Bio::LoationI. maybe Bio::SeqFeature::Annotated can inherit from this, and the interface has already set up an each_Location() method for you to get all the locations out. but i don't understand the Bio::Location::CoordinatePolicy yet, it looks like it affects calls to start() and end(). -allen On Thu, 21 Oct 2004, Scott Cain wrote: > On Wed, 2004-10-20 at 18:47, Allen Day wrote: > > Target tags - Bio::SeqFeature::Annotated needs to be able to have > > Bio::LocatableSeq or Bio::Location::Simple attachments. Presumably you > > can have multiple targets. Do something like create methods > > add_location() and locations() methods. > > > Is there a reason that you can think of that I should use > Bio::LocatableSeq over Bio::Location::Simple, as the latter is probably > more 'simple'. > > Thanks, > Scott > > From morten.lindow at gmail.com Thu Oct 21 16:43:36 2004 From: morten.lindow at gmail.com (Morten Lindow) Date: Thu Oct 21 16:42:28 2004 Subject: [Bioperl-l] Bio::DB::GFF getting a spliced sequence Message-ID: <188a160d04102113436f92c642@mail.gmail.com> Hi, Is there a neat way of getting a spliced mRNA sequence from a Bio::DB::GFF database? I have used genbank2gff3.pl to convert a genbank file to gff3. Then loaded the file succesfully with load_gff.PLS into postgresql. Here is a hack I am trying, but isn't there a neater way, similar to the spliced_seq method you can call on split_locations?: my $agg = Bio::DB::GFF::Aggregator->new(-method => 'spliced_mRNA', -main_method => 'mRNA', -sub_parts => 'exon'); my $dbgff = Bio::DB::GFF->new( -adaptor => $adaptor, -aggregator => [$agg], -dsn => $dsn, ); my @transcripts = $dbgff->features('spliced_mRNA'); foreach my $f (@transcripts){ print ">" . $f->display_id, "\n"; foreach my $feat ($f->get_SeqFeatures()){ print $feat->seq if $f->primary_tag eq 'exon'; } print "\n"; } -- Morten Lindow, Ph.d student Bioinformatics University of Copenhagen From brian_osborne at cognia.com Thu Oct 21 20:21:35 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Thu Oct 21 20:21:59 2004 Subject: [Bioperl-l] make test!! In-Reply-To: <000901c4b765$5d2b8690$3cf4cdd9@Desktop> Message-ID: Nathan, OK, thank you. Some of the messages you're seeing from Registry.t are warnings, not errors, but at any rate there are still errors. So am I correct in assuming that you have the modules DB_File and BerkeleyDB installed, as well as the Berkeley DB library? I can't do more with Index.t, as I said I was just guessing there. My first instinct is still to suspect something is wrong with Fcntl, Storable, or DB_File, these are used by DB/FileCache and the problem with Index.t lies with DB/InMemoryCache or DB/FileCache, most likely the latter. Someone using ActiveState Perl is going to have to address this one. Brian O. -----Original Message----- From: Nathan Haigh [mailto:nathanhaigh@ukonline.co.uk] Sent: Thursday, October 21, 2004 7:59 AM To: 'Brian Osborne'; 'Bioperl' Subject: RE: [Bioperl-l] make test!! Ok, I've done some more testing (with the latest CVS 9am GMT) and here is what I've found! I've run "namke test" with and without BIOPERLDEBUG, and running individual tests using " perl -I. -w t/test_name.t". Attached are 3 files with details of errors: Errors.txt - summary and details of failed tests, and other tests with peculiar warnings etc Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set Perl_test.txt - individual tests run with BIOPERLDEBUG set, using "perl -I. -w t/test_name.t" My System: WinXP Pro ActiveState Perl 5.8.0 Nmake 6.00.8168.0 My Summary: ESEfinder.t - causes perl to crash on test 2 during "nmake test", but ok in other tests! Biblio_biofetch.t - throws warning and exception when using BIOPERLDEBUG, but doesn't appear in summary! Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 ProtPsm.t - needs "plan tests" in test file changing to 5. When running the individual test can't locate Bio::Matrix::PSM::ProtMatrix Registry.t - several error including "No seqdatabase.ini file found", " No database with name testflat in Registry" Primaryqual.t - Test returned status 255. and 'Can't locate object method "header"' in individual test seqread_fail.t - gives an exception, is this supposed to happen? Hope this help to iron out bugs when running BioPerl on Windows! Nathan > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: 20 October 2004 19:04 > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Nathan, > > I noticed most of the Registry tests failing. I know what part of the > problem is (getpwuid() not implemented in Windows/Activestate Perl) and I > think I've fixed at least that part. Can you install the most recent > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > >perl -w -I. t/Registry.t > > > Brian O. > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > Sent: Wednesday, October 20, 2004 10:20 AM > To: 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Apologise for all the pervious messages! I just wanted to get this onto the > mailing list: > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > System: WinXP Pro > ActiveState Perl 5.8.0 build 804 > Nmake v6.00.8168.0 > > A note beforehand: > The error message I had previously got, and heard others have also received > on other OS's. That contain a "line too long" error when > trying "make test", is due to the limitations of the particular OS. Versions > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > have got round this problem by splitting long command lines from Makefiles > into a series of smaller commands. > > Test Summary: > Failed Test Stat Wstat Total Fail Failed List of Failed > -------------------------------------------------------------------------- -- > --- > t\Index.t 22 5632 41 21 51.22% 21-41 > t\Registry.t 22 5632 11 9 81.82% 3-11 > t\seqread_fail.t 255 65280 13 0 0.00% ?? > 115 subtests skipped. > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > okay. > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : > return code '0xff' > Stop. > > Particulars: > t\Index......................NOK 21Can't call method "length" on an > undefined value at t\Index.t line 124, line > 54. > t\Index......................dubious > Test returned status 22 (wstat 5632, 0x1600) > DIED. FAILED tests 21-41 > Failed 21/41 tests, 48.78% okay > t\Registry...................ok 2/11The getpwuid function is unimplemented > at K:\Downloads\FlashGet\Software\Bioinform > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > t\Registry...................dubious > Test returned status 22 (wstat 5632, 0x1600) > t\seqread_fail...............ok 1/13 > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: BioFetch Error 4: ID [XXX111] not found in database > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > STACK: Error::throw > STACK: Bio::Root::Root::throw > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b/Bio/Root/R > oot.pm:328 > STACK: Bio::DB::BioFetch::postprocess_data > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > ib/Bio/DB/BioFetch.pm:406 > STACK: Bio::DB::WebDBSeqI::get_seq_stream > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b/Bio/DB/WebDBSeqI.pm:525 > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > lib/Bio/DB/WebDBSeqI.pm:287 > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b > /Bio/DB/WebDBSeqI.pm:153 > STACK: main::fetch t\seqread_fail.t:69 > STACK: t\seqread_fail.t:81 > ----------------------------------------------------------- > t\seqread_fail...............dubious > Test returned status 255 (wstat 65280, 0xff00) > after all the subtests completed successfully > > > Nathan > > > -----Original Message----- > > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. Mackey > > Sent: 14 October 2004 21:27 > > To: Bioperl > > Subject: [Bioperl-l] make test!! > > Importance: High > > > > > > I've had only a very few people send me feedback about the current > > state of bioperl-live "make test" on your favorite > > old/crotchety/obscure platforms. I'm writing the Change log and > > thinking about branching, but I'm an experimentalist, I need data! > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > you have everything, "make distclean" if you've built from the cvs > > checkout before, and start from scratch with the usual litany: perl > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > about, not so much all the verbiage (unless there's specific verbiage > > related to the end result ...) > > > > Thanks, > > > > -Aaron > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l@portal.open-bio.org > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0442-2, 14/10/2004 > > Tested on: 14/10/2004 21:59:20 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0442-3, 15/10/2004 > Tested on: 20/10/2004 15:20:04 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0442-3, 15/10/2004 > Tested on: 21/10/2004 07:12:10 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0443-1, 20/10/2004 Tested on: 21/10/2004 12:58:59 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From brian_osborne at cognia.com Thu Oct 21 20:21:36 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Thu Oct 21 20:22:02 2004 Subject: [Bioperl-l] make test!! In-Reply-To: <000901c4b765$5d2b8690$3cf4cdd9@Desktop> Message-ID: Nathan, > seqread_fail.t - gives an exception, is this supposed to happen? Yes, I think what this test is doing is attempting to fetch using a non-existent id, so you see some nasty messages but the tests pass. Brian O. -----Original Message----- From: Nathan Haigh [mailto:nathanhaigh@ukonline.co.uk] Sent: Thursday, October 21, 2004 7:59 AM To: 'Brian Osborne'; 'Bioperl' Subject: RE: [Bioperl-l] make test!! Ok, I've done some more testing (with the latest CVS 9am GMT) and here is what I've found! I've run "namke test" with and without BIOPERLDEBUG, and running individual tests using " perl -I. -w t/test_name.t". Attached are 3 files with details of errors: Errors.txt - summary and details of failed tests, and other tests with peculiar warnings etc Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set Perl_test.txt - individual tests run with BIOPERLDEBUG set, using "perl -I. -w t/test_name.t" My System: WinXP Pro ActiveState Perl 5.8.0 Nmake 6.00.8168.0 My Summary: ESEfinder.t - causes perl to crash on test 2 during "nmake test", but ok in other tests! Biblio_biofetch.t - throws warning and exception when using BIOPERLDEBUG, but doesn't appear in summary! Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 ProtPsm.t - needs "plan tests" in test file changing to 5. When running the individual test can't locate Bio::Matrix::PSM::ProtMatrix Registry.t - several error including "No seqdatabase.ini file found", " No database with name testflat in Registry" Primaryqual.t - Test returned status 255. and 'Can't locate object method "header"' in individual test seqread_fail.t - gives an exception, is this supposed to happen? Hope this help to iron out bugs when running BioPerl on Windows! Nathan > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: 20 October 2004 19:04 > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Nathan, > > I noticed most of the Registry tests failing. I know what part of the > problem is (getpwuid() not implemented in Windows/Activestate Perl) and I > think I've fixed at least that part. Can you install the most recent > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > >perl -w -I. t/Registry.t > > > Brian O. > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > Sent: Wednesday, October 20, 2004 10:20 AM > To: 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Apologise for all the pervious messages! I just wanted to get this onto the > mailing list: > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > System: WinXP Pro > ActiveState Perl 5.8.0 build 804 > Nmake v6.00.8168.0 > > A note beforehand: > The error message I had previously got, and heard others have also received > on other OS's. That contain a "line too long" error when > trying "make test", is due to the limitations of the particular OS. Versions > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > have got round this problem by splitting long command lines from Makefiles > into a series of smaller commands. > > Test Summary: > Failed Test Stat Wstat Total Fail Failed List of Failed > -------------------------------------------------------------------------- -- > --- > t\Index.t 22 5632 41 21 51.22% 21-41 > t\Registry.t 22 5632 11 9 81.82% 3-11 > t\seqread_fail.t 255 65280 13 0 0.00% ?? > 115 subtests skipped. > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > okay. > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : > return code '0xff' > Stop. > > Particulars: > t\Index......................NOK 21Can't call method "length" on an > undefined value at t\Index.t line 124, line > 54. > t\Index......................dubious > Test returned status 22 (wstat 5632, 0x1600) > DIED. FAILED tests 21-41 > Failed 21/41 tests, 48.78% okay > t\Registry...................ok 2/11The getpwuid function is unimplemented > at K:\Downloads\FlashGet\Software\Bioinform > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > t\Registry...................dubious > Test returned status 22 (wstat 5632, 0x1600) > t\seqread_fail...............ok 1/13 > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: BioFetch Error 4: ID [XXX111] not found in database > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > STACK: Error::throw > STACK: Bio::Root::Root::throw > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b/Bio/Root/R > oot.pm:328 > STACK: Bio::DB::BioFetch::postprocess_data > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > ib/Bio/DB/BioFetch.pm:406 > STACK: Bio::DB::WebDBSeqI::get_seq_stream > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b/Bio/DB/WebDBSeqI.pm:525 > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > lib/Bio/DB/WebDBSeqI.pm:287 > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b > /Bio/DB/WebDBSeqI.pm:153 > STACK: main::fetch t\seqread_fail.t:69 > STACK: t\seqread_fail.t:81 > ----------------------------------------------------------- > t\seqread_fail...............dubious > Test returned status 255 (wstat 65280, 0xff00) > after all the subtests completed successfully > > > Nathan > > > -----Original Message----- > > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. Mackey > > Sent: 14 October 2004 21:27 > > To: Bioperl > > Subject: [Bioperl-l] make test!! > > Importance: High > > > > > > I've had only a very few people send me feedback about the current > > state of bioperl-live "make test" on your favorite > > old/crotchety/obscure platforms. I'm writing the Change log and > > thinking about branching, but I'm an experimentalist, I need data! > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > you have everything, "make distclean" if you've built from the cvs > > checkout before, and start from scratch with the usual litany: perl > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > about, not so much all the verbiage (unless there's specific verbiage > > related to the end result ...) > > > > Thanks, > > > > -Aaron > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l@portal.open-bio.org > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0442-2, 14/10/2004 > > Tested on: 14/10/2004 21:59:20 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0442-3, 15/10/2004 > Tested on: 20/10/2004 15:20:04 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0442-3, 15/10/2004 > Tested on: 21/10/2004 07:12:10 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0443-1, 20/10/2004 Tested on: 21/10/2004 12:58:59 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From brian_osborne at cognia.com Thu Oct 21 20:21:37 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Thu Oct 21 20:22:04 2004 Subject: [Bioperl-l] make test!! In-Reply-To: <000901c4b765$5d2b8690$3cf4cdd9@Desktop> Message-ID: Nathan, > Primaryqual.t - Test returned status 255. and 'Can't locate object method "header"' in individual test I appear to have fixed this. Brian O. -----Original Message----- From: Nathan Haigh [mailto:nathanhaigh@ukonline.co.uk] Sent: Thursday, October 21, 2004 7:59 AM To: 'Brian Osborne'; 'Bioperl' Subject: RE: [Bioperl-l] make test!! Ok, I've done some more testing (with the latest CVS 9am GMT) and here is what I've found! I've run "namke test" with and without BIOPERLDEBUG, and running individual tests using " perl -I. -w t/test_name.t". Attached are 3 files with details of errors: Errors.txt - summary and details of failed tests, and other tests with peculiar warnings etc Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set Perl_test.txt - individual tests run with BIOPERLDEBUG set, using "perl -I. -w t/test_name.t" My System: WinXP Pro ActiveState Perl 5.8.0 Nmake 6.00.8168.0 My Summary: ESEfinder.t - causes perl to crash on test 2 during "nmake test", but ok in other tests! Biblio_biofetch.t - throws warning and exception when using BIOPERLDEBUG, but doesn't appear in summary! Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 ProtPsm.t - needs "plan tests" in test file changing to 5. When running the individual test can't locate Bio::Matrix::PSM::ProtMatrix Registry.t - several error including "No seqdatabase.ini file found", " No database with name testflat in Registry" Primaryqual.t - Test returned status 255. and 'Can't locate object method "header"' in individual test seqread_fail.t - gives an exception, is this supposed to happen? Hope this help to iron out bugs when running BioPerl on Windows! Nathan > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: 20 October 2004 19:04 > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Nathan, > > I noticed most of the Registry tests failing. I know what part of the > problem is (getpwuid() not implemented in Windows/Activestate Perl) and I > think I've fixed at least that part. Can you install the most recent > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > >perl -w -I. t/Registry.t > > > Brian O. > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > Sent: Wednesday, October 20, 2004 10:20 AM > To: 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Apologise for all the pervious messages! I just wanted to get this onto the > mailing list: > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > System: WinXP Pro > ActiveState Perl 5.8.0 build 804 > Nmake v6.00.8168.0 > > A note beforehand: > The error message I had previously got, and heard others have also received > on other OS's. That contain a "line too long" error when > trying "make test", is due to the limitations of the particular OS. Versions > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > have got round this problem by splitting long command lines from Makefiles > into a series of smaller commands. > > Test Summary: > Failed Test Stat Wstat Total Fail Failed List of Failed > -------------------------------------------------------------------------- -- > --- > t\Index.t 22 5632 41 21 51.22% 21-41 > t\Registry.t 22 5632 11 9 81.82% 3-11 > t\seqread_fail.t 255 65280 13 0 0.00% ?? > 115 subtests skipped. > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > okay. > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : > return code '0xff' > Stop. > > Particulars: > t\Index......................NOK 21Can't call method "length" on an > undefined value at t\Index.t line 124, line > 54. > t\Index......................dubious > Test returned status 22 (wstat 5632, 0x1600) > DIED. FAILED tests 21-41 > Failed 21/41 tests, 48.78% okay > t\Registry...................ok 2/11The getpwuid function is unimplemented > at K:\Downloads\FlashGet\Software\Bioinform > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > t\Registry...................dubious > Test returned status 22 (wstat 5632, 0x1600) > t\seqread_fail...............ok 1/13 > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: BioFetch Error 4: ID [XXX111] not found in database > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > STACK: Error::throw > STACK: Bio::Root::Root::throw > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b/Bio/Root/R > oot.pm:328 > STACK: Bio::DB::BioFetch::postprocess_data > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > ib/Bio/DB/BioFetch.pm:406 > STACK: Bio::DB::WebDBSeqI::get_seq_stream > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b/Bio/DB/WebDBSeqI.pm:525 > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > lib/Bio/DB/WebDBSeqI.pm:287 > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b > /Bio/DB/WebDBSeqI.pm:153 > STACK: main::fetch t\seqread_fail.t:69 > STACK: t\seqread_fail.t:81 > ----------------------------------------------------------- > t\seqread_fail...............dubious > Test returned status 255 (wstat 65280, 0xff00) > after all the subtests completed successfully > > > Nathan > > > -----Original Message----- > > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. Mackey > > Sent: 14 October 2004 21:27 > > To: Bioperl > > Subject: [Bioperl-l] make test!! > > Importance: High > > > > > > I've had only a very few people send me feedback about the current > > state of bioperl-live "make test" on your favorite > > old/crotchety/obscure platforms. I'm writing the Change log and > > thinking about branching, but I'm an experimentalist, I need data! > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > you have everything, "make distclean" if you've built from the cvs > > checkout before, and start from scratch with the usual litany: perl > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > about, not so much all the verbiage (unless there's specific verbiage > > related to the end result ...) > > > > Thanks, > > > > -Aaron > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l@portal.open-bio.org > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0442-2, 14/10/2004 > > Tested on: 14/10/2004 21:59:20 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0442-3, 15/10/2004 > Tested on: 20/10/2004 15:20:04 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0442-3, 15/10/2004 > Tested on: 21/10/2004 07:12:10 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0443-1, 20/10/2004 Tested on: 21/10/2004 12:58:59 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From cain at cshl.org Thu Oct 21 22:27:35 2004 From: cain at cshl.org (Scott Cain) Date: Thu Oct 21 22:26:32 2004 Subject: [Bioperl-l] Re: Handling gff3 Target and Dbxref tags through FeatureIO In-Reply-To: References: <1098309665.1511.80.camel@localhost.localdomain> <1098380460.1500.10.camel@localhost.localdomain> Message-ID: <1098412055.1920.35.camel@localhost.localdomain> I don't know; I've spent a little time thinking about what is needed (at least short term for me) and Bio::Location::Simple has the methods I think I need: start,end,strand,seq_id,is_remote. I think we just need an object array @targets, and add_target and get_targets methods. I have a hard time thinking of a reason a line of GFF would have more than one target, but I guess we should plan for it. On Thu, 2004-10-21 at 14:09, Allen Day wrote: > take a look at Bio::LoationI. maybe Bio::SeqFeature::Annotated can > inherit from this, and the interface has already set up an each_Location() > method for you to get all the locations out. but i don't understand the > Bio::Location::CoordinatePolicy yet, it looks like it affects calls to > start() and end(). > > -allen > > > On Thu, 21 Oct 2004, Scott Cain wrote: > > > On Wed, 2004-10-20 at 18:47, Allen Day wrote: > > > Target tags - Bio::SeqFeature::Annotated needs to be able to have > > > Bio::LocatableSeq or Bio::Location::Simple attachments. Presumably you > > > can have multiple targets. Do something like create methods > > > add_location() and locations() methods. > > > > > Is there a reason that you can think of that I should use > > Bio::LocatableSeq over Bio::Location::Simple, as the latter is probably > > more 'simple'. > > > > Thanks, > > Scott > > > > -- ------------------------------------------------------------------------ Scott Cain, Ph. D. cain@cshl.org GMOD Coordinator (http://www.gmod.org/) 216-392-3087 Cold Spring Harbor Laboratory From grossman at molgen.mpg.de Fri Oct 22 02:33:33 2004 From: grossman at molgen.mpg.de (Steffen Grossmann) Date: Fri Oct 22 02:32:28 2004 Subject: [Bioperl-l] Re: [SO-devel] GFF3 - Bioperl - SO In-Reply-To: References: <416A88AF.1020705@molgen.mpg.de> <416BCB4A.8060303@molgen.mpg.de> <416EA051.7050308@molgen.mpg.de> Message-ID: <4178A9BD.6000504@molgen.mpg.de> Ok, ok, if you really want to convince me that Bio::FeatureIO::gff is the technology of the future... (although I would also like to hear Chris Mungall's opinion on this point...) So let's get back to the technicalities. There is something which prevents the use of Bio::SeqFeature::Tools::IDHandler with Bio::FeatureIO::gff, namely the extensive use of the tag/value annotation system in the former. On one hand, this comes from repeated calls of Bio::SeqFeatureI's 'primary_id' method, on the other hand there are calls of 'get_tagset_values'. I am not completely sure, but I think that compliance of Bio::SeqFeature::Tools::IDHandler with both concepts can be achieved by two changes: 1) Bio::SeqFeatureI::primary_id and Bio::SeqFeature::Annotated have to be made compatible. Just create a Bio::SeqFeature::Annotated object and try to call 'primary_id' on it to see that it isn't at the moment. In principle this can be done by storing the ID in the AnnotationCollectionI object when the tag/value system is not present. The problem is that the tag/value system is present in Bio::SeqFeature::Annotated (it has to be, because it implements Bio::SeqFeatureI), but it is not functional. Any suggestions? 2) Bio::SeqFeature::Tools::IDHandler can be made compatible with both annotation systems by using the Bio::SeqFeature::AnnotationAdaptor module. This should not cause any problems... Steffen Allen Day wrote: >On Thu, 14 Oct 2004, Steffen Grossmann wrote: > > > >>Dear Allen, >> >>I meanwhile understood that Bio::Tools::GFF in connection with >>Bio::SeqFeature::Tools::IDHandler is doing a lot of the stuff I'd like >>to have. Somehow, Bio::FeatureIO::gff seems to be a parallel development >>to the first alternative. I don't know in how far there are plans to >> >> > >I don't see from a quick look at the source how Bio::Tools::GFF is related >to Bio::SeqFeature::Tools::IDHandler. There's nothing preventing use of >the IDHandler in Bio::FeatureIO::gff, in fact it sounds like what you've >proposed to add so part of your work is already done. > > > >>bring the two approaches together, but at the moment that seems to be >>more complicated than just bringing one approach to an acceptable state. >>Since the Bio::Tools::GFF approach seems to be ahead, I will focus on it >>at the moment. >> >> > >I would advise against adding more features into Bio::Tools::GFF. I can't >speak for all others, but my future development will not use it, and I'm >in the process of converting code which does use it to depend on >Bio::FeatureIO::gff. > >-Allen > > > -- %---------------------------------------------% % Steffen Grossmann % % % % Max Planck Institute for Molecular Genetics % % Computational Molecular Biology % %---------------------------------------------% % Ihnestrasse 73 % % 14195 Berlin % % Germany % %---------------------------------------------% % Tel: (++49 +30) 8413-1167 % % Fax: (++49 +30) 8413-1152 % %---------------------------------------------% From grossman at molgen.mpg.de Fri Oct 22 02:33:49 2004 From: grossman at molgen.mpg.de (Steffen Grossmann) Date: Fri Oct 22 02:32:39 2004 Subject: [Bioperl-l] Re: [SO-devel] GFF3 - Bioperl - SO In-Reply-To: References: <416A88AF.1020705@molgen.mpg.de> <416BCB4A.8060303@molgen.mpg.de> <416EA051.7050308@molgen.mpg.de> <4172983F.3030807@molgen.mpg.de> Message-ID: <4178A9CD.4010907@molgen.mpg.de> Allen, it might be understandable that you don't want to use the tag/value annotation system, but it is then problematic to let Bio::SeqFeature::Annotated inherit from Bio::SeqFeatureI which requires to implement the tag/value scheme. This is some kind of indirect deprecation of functionality, which I don't think helps in making things clearer. Moreover, Bio::FeatureIO::gff is only able to write out features of the type Bio::SeqFeature::Annotated, so I think that the discussion about deprecating Bio::Tools::GFF and replacing it with Bio::FeatureIO::gff is dangerous, since Bio::SeqFeature::Generic is of widespread use and GFF output of such features should be maintained. These are just some thoughts about the structure, I'd be curious to learn about your and other people's opinions about it. By the way, also Bio::SeqFeature::AnnotationAdaptor does not work together with Bio::SeqFeature::Annotated, so the workaround proposed below does not work. Steffen Allen Day wrote: >On Sun, 17 Oct 2004, Steffen Grossmann wrote: > > > >>Ok, ok, if you really want to convince me that Bio::FeatureIO::gff is >>the technology of the future... (although I would also like to hear >>Chris Mungall's opinion on this point...) >> >> > >I'd like to hear Chris weigh in as well. > > > >>So let's get back to the technicalities. >> >>There is something which prevents the use of >>Bio::SeqFeature::Tools::IDHandler with Bio::FeatureIO::gff, namely the >>extensive use of the tag/value annotation system in the former. On one >>hand, this comes from repeated calls of Bio::SeqFeatureI's 'primary_id' >>method, on the other hand there are calls of 'get_tagset_values'. >> >> > >We can map Bio::SeqFeature::Annotated::primary_id to something reasonable >in the AnnotationCollection, but my guess is that avoiding the tagset will >be more difficult. > >I'd prefer not to add SeqFeatureI compliance as far as tagset methods go >-- one of the main reasons I added SeqFeature::Annotated was to get rid of >this "feature". I haven't looked at the AnnotationAdaptor you mention >below, but it sounds like a reasonable approach. > >Regarding your earlier mail about returning unflattened features, we can >do this pretty easily by implementing GFF3 '###' tag handling. I don't >remember if I mentioned this before. > >-Allen > > > >>I am not completely sure, but I think that compliance of >>Bio::SeqFeature::Tools::IDHandler with both concepts can be achieved by >>two changes: >> >>1) Bio::SeqFeatureI::primary_id and Bio::SeqFeature::Annotated have to >>be made compatible. Just create a Bio::SeqFeature::Annotated object and >>try to call 'primary_id' on it to see that it isn't at the moment. In >>principle this can be done by storing the ID in the >>AnnotationCollectionI object when the tag/value system is not present. >>The problem is that the tag/value system is present in >>Bio::SeqFeature::Annotated (it has to be, because it implements >>Bio::SeqFeatureI), but it is not functional. Any suggestions? >> >>2) Bio::SeqFeature::Tools::IDHandler can be made compatible with both >>annotation systems by using the Bio::SeqFeature::AnnotationAdaptor >>module. This should not cause any problems... >> >>Steffen >> >> >> >>Allen Day wrote: >> >> >> >>>On Thu, 14 Oct 2004, Steffen Grossmann wrote: >>> >>> >>> >>> >>> >>>>Dear Allen, >>>> >>>>I meanwhile understood that Bio::Tools::GFF in connection with >>>>Bio::SeqFeature::Tools::IDHandler is doing a lot of the stuff I'd like >>>>to have. Somehow, Bio::FeatureIO::gff seems to be a parallel development >>>>to the first alternative. I don't know in how far there are plans to >>>> >>>> >>>> >>>> >>>I don't see from a quick look at the source how Bio::Tools::GFF is related >>>to Bio::SeqFeature::Tools::IDHandler. There's nothing preventing use of >>>the IDHandler in Bio::FeatureIO::gff, in fact it sounds like what you've >>>proposed to add so part of your work is already done. >>> >>> >>> >>> >>> >>>>bring the two approaches together, but at the moment that seems to be >>>>more complicated than just bringing one approach to an acceptable state. >>>>Since the Bio::Tools::GFF approach seems to be ahead, I will focus on it >>>>at the moment. >>>> >>>> >>>> >>>> >>>I would advise against adding more features into Bio::Tools::GFF. I can't >>>speak for all others, but my future development will not use it, and I'm >>>in the process of converting code which does use it to depend on >>>Bio::FeatureIO::gff. >>> >>>-Allen >>> >>> >>> >>> >>> >> >> >> >_______________________________________________ >Bioperl-l mailing list >Bioperl-l@portal.open-bio.org >http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > -- %---------------------------------------------% % Steffen Grossmann % % % % Max Planck Institute for Molecular Genetics % % Computational Molecular Biology % %---------------------------------------------% % Ihnestrasse 73 % % 14195 Berlin % % Germany % %---------------------------------------------% % Tel: (++49 +30) 8413-1167 % % Fax: (++49 +30) 8413-1152 % %---------------------------------------------% From maria at cbm.bio.uniroma2.it Fri Oct 22 03:01:29 2004 From: maria at cbm.bio.uniroma2.it (Maria Persico) Date: Fri Oct 22 03:05:46 2004 Subject: [Bioperl-l] problems with Bio::Graph::ProteinGraph Message-ID: Hi All, I am experiencing some problems with Bio::Graph::ProteinGraph: this may be a stupid problem but... sorry, ....I am a beginner: I did a copy-paste of the synopsis in the http://doc.bioperl.org/bioperl-live/Bio/Graph/ProteinGraph.html web page I want to read a dip file that I downloaded from DIP database website. my script was: #!/usr/bin/perl -w use strict; use Bio::Graph::SimpleGraph; use Bio::Graph::IO; use XML::Twig; my $n1; my $n2; my $graphio; my $graph; my $gr; my @seqs; my $g1; my $g2; my $io; my $out; ### read in from file my $graphio = Bio::Graph::IO::dip2->new(-file=>'yeast-dip', -format=>'dip'); #my $graph = $graphio->next_network(); while (my $graph = $graphio->next_network()){ print $out->write_network($graph); } The message that I receive is: Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.0/Bio/Graph/IO/dip2.pm line 72, line 1. Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.0/Bio/Graph/IO/dip2.pm line 72, line 2. Use of uninitialized value in exists at /usr/lib/perl5/site_perl/5.8.0/Bio/Graph/IO/dip2.pm line 73, line 2. I copied the module dip.pm in dip2.pm and I put some print for some of the variables I am interested....the variables are print out , the error message is the same for each line of the file that is read and the script ends with Can't call method "write_network" on an undefined value at ./graph.pl line 21, line 15161. what's the problem??? thanks, Maria Maria Persico MINT database, Cesareni Group Universita' di Tor Vergata, via della Ricerca Scientifica 00133 Roma, Italy Tel: +39 0672594315 FAX: +39 0672594766 e-mail: maria@cbm.bio.uniroma2.it From nathanhaigh at ukonline.co.uk Fri Oct 22 03:30:08 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Fri Oct 22 03:29:02 2004 Subject: [Bioperl-l] make test!! In-Reply-To: Message-ID: I have the following versions installed: DB_File 1.810 BerkeleyDB 0.25 And I'm pretty sure I have the library (I remember using a BTree quite a while back). Having just had a look at Bio::DB::Registry, _load_registry refers to the ENV variable HOME. Windows doesn't have such a variable by default, so the user must either set it themselves, and failing this, Bio::DB::Registry should assume a default e.g. C:/ Therefore I've changed this sub to read: sub _load_registry { my ($self) = @_; my $home; if (defined $ENV{"HOME"}) { $home = $ENV{"HOME"} } # use this if it's set elsif ($^O eq 'MSWin32') { $home = 'C:/' } # def windows home if $ENV{HOME} isn't set else { $home = (getpwuid($>))[7] } my @ini_files = _get_ini_files($home); unless (@ini_files) { etc etc I don't know if you still need to test for failure of getpwuid, since you should never get to this stage on windows - I can't think of a reason why the c: drive is inaccessible! Nathan > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: 22 October 2004 01:22 > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Nathan, > > OK, thank you. Some of the messages you're seeing from Registry.t are > warnings, not errors, but at any rate there are still errors. So am I > correct in assuming that you have the modules DB_File and BerkeleyDB > installed, as well as the Berkeley DB library? > > I can't do more with Index.t, as I said I was just guessing there. My first > instinct is still to suspect something is wrong with Fcntl, Storable, or > DB_File, these are used by DB/FileCache and the problem with Index.t lies > with DB/InMemoryCache or DB/FileCache, most likely the latter. Someone using > ActiveState Perl is going to have to address this one. > > Brian O. > > -----Original Message----- > From: Nathan Haigh [mailto:nathanhaigh@ukonline.co.uk] > Sent: Thursday, October 21, 2004 7:59 AM > To: 'Brian Osborne'; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Ok, I've done some more testing (with the latest CVS 9am GMT) and here is > what I've found! I've run "namke test" with and without > BIOPERLDEBUG, and running individual tests using " perl -I. -w > t/test_name.t". > > Attached are 3 files with details of errors: > Errors.txt - summary and details of failed tests, and other > tests with peculiar warnings etc > Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set > Perl_test.txt - individual tests run with BIOPERLDEBUG set, using > "perl -I. -w t/test_name.t" > > My System: > WinXP Pro > ActiveState Perl 5.8.0 > Nmake 6.00.8168.0 > > My Summary: > ESEfinder.t - causes perl to crash on test 2 during "nmake test", but ok > in other tests! > Biblio_biofetch.t - throws warning and exception when using > BIOPERLDEBUG, but doesn't appear in summary! > Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 > ProtPsm.t - needs "plan tests" in test file changing to 5. When > running the individual test can't locate > Bio::Matrix::PSM::ProtMatrix > Registry.t - several error including "No seqdatabase.ini file found", " > No database with name testflat in Registry" > Primaryqual.t - Test returned status 255. and 'Can't locate object method > "header"' in individual test > seqread_fail.t - gives an exception, is this supposed to happen? > > Hope this help to iron out bugs when running BioPerl on Windows! > Nathan > > > > -----Original Message----- > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > Sent: 20 October 2004 19:04 > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Nathan, > > > > I noticed most of the Registry tests failing. I know what part of the > > problem is (getpwuid() not implemented in Windows/Activestate Perl) and I > > think I've fixed at least that part. Can you install the most recent > > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > > > >perl -w -I. t/Registry.t > > > > > > Brian O. > > > > -----Original Message----- > > From: bioperl-l-bounces@portal.open-bio.org > > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > > Sent: Wednesday, October 20, 2004 10:20 AM > > To: 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Apologise for all the pervious messages! I just wanted to get this onto > the > > mailing list: > > > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > > > System: WinXP Pro > > ActiveState Perl 5.8.0 build 804 > > Nmake v6.00.8168.0 > > > > A note beforehand: > > The error message I had previously got, and heard others have also > received > > on other OS's. That contain a "line too long" error when > > trying "make test", is due to the limitations of the particular OS. > Versions > > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > > have got round this problem by splitting long command lines from Makefiles > > into a series of smaller commands. > > > > Test Summary: > > Failed Test Stat Wstat Total Fail Failed List of Failed > > -------------------------------------------------------------------------- > -- > > --- > > t\Index.t 22 5632 41 21 51.22% 21-41 > > t\Registry.t 22 5632 11 9 81.82% 3-11 > > t\seqread_fail.t 255 65280 13 0 0.00% ?? > > 115 subtests skipped. > > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > > okay. > > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : > > return code '0xff' > > Stop. > > > > Particulars: > > t\Index......................NOK 21Can't call method "length" on an > > undefined value at t\Index.t line 124, line > > 54. > > t\Index......................dubious > > Test returned status 22 (wstat 5632, 0x1600) > > DIED. FAILED tests 21-41 > > Failed 21/41 tests, 48.78% okay > > t\Registry...................ok 2/11The getpwuid function is unimplemented > > at K:\Downloads\FlashGet\Software\Bioinform > > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > > t\Registry...................dubious > > Test returned status 22 (wstat 5632, 0x1600) > > t\seqread_fail...............ok 1/13 > > ------------- EXCEPTION: Bio::Root::Exception ------------- > > MSG: BioFetch Error 4: ID [XXX111] not found in database > > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > > STACK: Error::throw > > STACK: Bio::Root::Root::throw > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > b/Bio/Root/R > > oot.pm:328 > > STACK: Bio::DB::BioFetch::postprocess_data > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > > ib/Bio/DB/BioFetch.pm:406 > > STACK: Bio::DB::WebDBSeqI::get_seq_stream > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > b/Bio/DB/WebDBSeqI.pm:525 > > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > > lib/Bio/DB/WebDBSeqI.pm:287 > > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > b > > /Bio/DB/WebDBSeqI.pm:153 > > STACK: main::fetch t\seqread_fail.t:69 > > STACK: t\seqread_fail.t:81 > > ----------------------------------------------------------- > > t\seqread_fail...............dubious > > Test returned status 255 (wstat 65280, 0xff00) > > after all the subtests completed successfully > > > > > > Nathan > > > > > -----Original Message----- > > > From: bioperl-l-bounces@portal.open-bio.org > > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. > Mackey > > > Sent: 14 October 2004 21:27 > > > To: Bioperl > > > Subject: [Bioperl-l] make test!! > > > Importance: High > > > > > > > > > I've had only a very few people send me feedback about the current > > > state of bioperl-live "make test" on your favorite > > > old/crotchety/obscure platforms. I'm writing the Change log and > > > thinking about branching, but I'm an experimentalist, I need data! > > > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > > you have everything, "make distclean" if you've built from the cvs > > > checkout before, and start from scratch with the usual litany: perl > > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > > about, not so much all the verbiage (unless there's specific verbiage > > > related to the end result ...) > > > > > > Thanks, > > > > > > -Aaron > > > > > > _______________________________________________ > > > Bioperl-l mailing list > > > Bioperl-l@portal.open-bio.org > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > --- > > > avast! Antivirus: Inbound message clean. > > > Virus Database (VPS): 0442-2, 14/10/2004 > > > Tested on: 14/10/2004 21:59:20 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > --- > > avast! Antivirus: Outbound message clean. > > Virus Database (VPS): 0442-3, 15/10/2004 > > Tested on: 20/10/2004 15:20:04 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > > > > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l@portal.open-bio.org > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0442-3, 15/10/2004 > > Tested on: 21/10/2004 07:12:10 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0443-1, 20/10/2004 > Tested on: 21/10/2004 12:58:59 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > > > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0443-2, 21/10/2004 > Tested on: 22/10/2004 06:20:06 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0443-2, 21/10/2004 Tested on: 22/10/2004 08:29:49 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From simon.andrews at bbsrc.ac.uk Fri Oct 22 03:38:48 2004 From: simon.andrews at bbsrc.ac.uk (simon andrews (BI)) Date: Fri Oct 22 03:38:14 2004 Subject: [Bioperl-l] EMBL Identifier line is incorrect when using SeqIO(1.4) Message-ID: I subitted a patch to fix this a while back. I think it's now applied to the version in CVS. The bug report has a copy of the patch: http://bugzilla.open-bio.org/show_bug.cgi?id=1618 Simon. > -----Original Message----- > From: Hilmar Lapp [mailto:hlapp@gmx.net] > Sent: 21 October 2004 16:42 > To: michael watson (IAH-C) > Cc: Bioperl > Subject: Re: [Bioperl-l] EMBL Identifier line is incorrect > when using SeqIO(1.4) > > > If you make the ID shorter, is there still no space? I believe the ID > is length-limited in EMBL, but I'd have to check the specs to be sure. > > -hilmar > > On Thursday, October 21, 2004, at 06:38 AM, michael watson (IAH-C) > wrote: > > > Hi > > > > Using bioperl-1.4 on Suse Linux, I find that when writing > sequences in > > EMBL format using SeqIO, there is no space left after the display_id > > e.g. > > > > "J18191-1h03.p1k" becomes "ID J18191-1h03.p1kstandard; > DNA; UNK; 1657 > > BP." > > > > Mick > > > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l@portal.open-bio.org > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > > -- > ------------------------------------------------------------- > Hilmar Lapp email: lapp at gnf.org > GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 > ------------------------------------------------------------- > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > From michael.watson at bbsrc.ac.uk Fri Oct 22 05:10:37 2004 From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C)) Date: Fri Oct 22 05:13:06 2004 Subject: [Bioperl-l] EMBL Identifier line is incorrect when using SeqIO (1.4) Message-ID: <8975119BCD0AC5419D61A9CF1A923E95E895F3@iahce2knas1.iah.bbsrc.reserved> Hi Yes I tracked it down - the ID is limited to a string of 11 characters in the Bioperl module, and so I assume it is so in the EMBL format. Mick -----Original Message----- From: Hilmar Lapp [mailto:hlapp@gmx.net] Sent: 21 October 2004 16:42 To: michael watson (IAH-C) Cc: Bioperl Subject: Re: [Bioperl-l] EMBL Identifier line is incorrect when using SeqIO (1.4) If you make the ID shorter, is there still no space? I believe the ID is length-limited in EMBL, but I'd have to check the specs to be sure. -hilmar On Thursday, October 21, 2004, at 06:38 AM, michael watson (IAH-C) wrote: > Hi > > Using bioperl-1.4 on Suse Linux, I find that when writing sequences in > EMBL format using SeqIO, there is no space left after the display_id > e.g. > > "J18191-1h03.p1k" becomes "ID J18191-1h03.p1kstandard; DNA; UNK; 1657 > BP." > > Mick > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- From nathanhaigh at ukonline.co.uk Fri Oct 22 06:12:31 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Fri Oct 22 06:12:01 2004 Subject: [Bioperl-l] Bioblio_biofetch.t failure on windows Message-ID: When running nmake I get an exception error ?retrieval type pipeline unsupported? ? I have narrowed down the bug to Bio::DB::WebDBSeqI.pm which sets the default retrieval_type to pipeline. Needless to say pipes and forks are not well implemented on windows (if at all)! I?ve notice in the CVS that has been several attempts to fix bug such as this - I don?t know if they were to address this particular problem. But as far as I see, there seems to be several attempts at a workaround in the get_seq_stream. Could the line: ????? $self->retrieval_type('io_string') if $self->retrieval_type =~ /pipeline/ && $^O =~ /^MSWin/; be simply moved into the ?new? sub after setting the retrieval type or would this break something else? For the time being copying the line into the ?new? sub fixes things in the Biblio_biofetch test; except for reporting inconsistence between the actual and expected identifier numbers (but this loos like it?s due to the comparison between two different id?s . ? So that it reads: ? ??? $params??????? && $self->url_params($params); ??? $db??????????? && $self->db($db); ??? $ret_type????? && $self->retrieval_type($ret_type); ??? # workaround for MSWin systems ??? $self->retrieval_type('io_string') if $self->retrieval_type =~ /pipeline/ && $^O =~ /^MSWin/; ??? $delay????????? = $self->delay_policy unless defined $delay; ??? From nathanhaigh at ukonline.co.uk Fri Oct 22 06:18:26 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Fri Oct 22 06:17:26 2004 Subject: [Bioperl-l] Bioblio_biofetch.t failure on windows Message-ID: When running nmake I get an exception error ?retrieval type pipeline unsupported? ? I have narrowed down the bug to Bio::DB::WebDBSeqI.pm which sets the default retrieval_type to pipeline. Needless to say pipes and forks are not well implemented on windows (if at all)! I?ve notice in the CVS that has been several attempts to fix bug such as this - I don?t know if they were to address this particular problem. But as far as I see, there seems to be several attempts at a workaround in the get_seq_stream. Could the line: ????? $self->retrieval_type('io_string') if $self->retrieval_type =~ /pipeline/ && $^O =~ /^MSWin/; be simply moved into the ?new? sub after setting the retrieval type or would this break something else? For the time being copying the line into the ?new? sub fixes things in the Biblio_biofetch test; except for reporting inconsistence between the actual and expected identifier numbers (but this loos like it?s due to the comparison between two different id?s . ? So that it reads: ? ??? $params??????? && $self->url_params($params); ??? $db??????????? && $self->db($db); ??? $ret_type????? && $self->retrieval_type($ret_type); ??? # workaround for MSWin systems ??? $self->retrieval_type('io_string') if $self->retrieval_type =~ /pipeline/ && $^O =~ /^MSWin/; ??? $delay????????? = $self->delay_policy unless defined $delay; ??? From brian_osborne at cognia.com Fri Oct 22 17:11:59 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Fri Oct 22 17:12:20 2004 Subject: [Bioperl-l] make test!! In-Reply-To: Message-ID: Nathan, Registry.t shouldn't fail if there's no $HOME set since it uses $OBDA_SEARCH_PATH, it sets OBDA_SEARCH_PATH for its own use, and it also supplies its own *ini file. To prove this to myself I just unset HOME on my machine and Registry.t still works (and $OBDA_SEARCH_PATH was unset as well, I never use it). So, I understand your point but the absence of $HOME shouldn't be the problem. Registry.pm is part of the OBDA system so the user is responsible for either seeing that $HOME is set or setting $OBDA_SEARCH_PATH, either will work (and in UNIX you could put the *ini file in /etc/bioinformatics). Questions: did this change you made in your local Registry.pm fix Registry.t? What are the errors using the Registry.t I sent you last night? So you have both modules and the Berkeley DB library? There's goes my latest hypothesis! The problem here is that I'm just guessing when it comes to ActiveState, and you can see that my guesses aren't always on target. What would be great is if someone using ActiveState would sit down with the Perl debugger and step through the code line by line so we'd know _exactly_ where the failures are. Can someone help us here? If you're not familiar with the debugger this would be a good opportunity to learn about it, it's a fantastic tool (and absolutely required if you want to improve your coding skills). I'm not just talking about Registry but about the other errors that Nathan is showing us. Brian O. -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh Sent: Friday, October 22, 2004 3:30 AM To: 'Brian Osborne'; 'Bioperl' Subject: RE: [Bioperl-l] make test!! I have the following versions installed: DB_File 1.810 BerkeleyDB 0.25 And I'm pretty sure I have the library (I remember using a BTree quite a while back). Having just had a look at Bio::DB::Registry, _load_registry refers to the ENV variable HOME. Windows doesn't have such a variable by default, so the user must either set it themselves, and failing this, Bio::DB::Registry should assume a default e.g. C:/ Therefore I've changed this sub to read: sub _load_registry { my ($self) = @_; my $home; if (defined $ENV{"HOME"}) { $home = $ENV{"HOME"} } # use this if it's set elsif ($^O eq 'MSWin32') { $home = 'C:/' } # def windows home if $ENV{HOME} isn't set else { $home = (getpwuid($>))[7] } my @ini_files = _get_ini_files($home); unless (@ini_files) { etc etc I don't know if you still need to test for failure of getpwuid, since you should never get to this stage on windows - I can't think of a reason why the c: drive is inaccessible! Nathan > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: 22 October 2004 01:22 > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Nathan, > > OK, thank you. Some of the messages you're seeing from Registry.t are > warnings, not errors, but at any rate there are still errors. So am I > correct in assuming that you have the modules DB_File and BerkeleyDB > installed, as well as the Berkeley DB library? > > I can't do more with Index.t, as I said I was just guessing there. My first > instinct is still to suspect something is wrong with Fcntl, Storable, or > DB_File, these are used by DB/FileCache and the problem with Index.t lies > with DB/InMemoryCache or DB/FileCache, most likely the latter. Someone using > ActiveState Perl is going to have to address this one. > > Brian O. > > -----Original Message----- > From: Nathan Haigh [mailto:nathanhaigh@ukonline.co.uk] > Sent: Thursday, October 21, 2004 7:59 AM > To: 'Brian Osborne'; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Ok, I've done some more testing (with the latest CVS 9am GMT) and here is > what I've found! I've run "namke test" with and without > BIOPERLDEBUG, and running individual tests using " perl -I. -w > t/test_name.t". > > Attached are 3 files with details of errors: > Errors.txt - summary and details of failed tests, and other > tests with peculiar warnings etc > Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set > Perl_test.txt - individual tests run with BIOPERLDEBUG set, using > "perl -I. -w t/test_name.t" > > My System: > WinXP Pro > ActiveState Perl 5.8.0 > Nmake 6.00.8168.0 > > My Summary: > ESEfinder.t - causes perl to crash on test 2 during "nmake test", but ok > in other tests! > Biblio_biofetch.t - throws warning and exception when using > BIOPERLDEBUG, but doesn't appear in summary! > Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 > ProtPsm.t - needs "plan tests" in test file changing to 5. When > running the individual test can't locate > Bio::Matrix::PSM::ProtMatrix > Registry.t - several error including "No seqdatabase.ini file found", " > No database with name testflat in Registry" > Primaryqual.t - Test returned status 255. and 'Can't locate object method > "header"' in individual test > seqread_fail.t - gives an exception, is this supposed to happen? > > Hope this help to iron out bugs when running BioPerl on Windows! > Nathan > > > > -----Original Message----- > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > Sent: 20 October 2004 19:04 > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Nathan, > > > > I noticed most of the Registry tests failing. I know what part of the > > problem is (getpwuid() not implemented in Windows/Activestate Perl) and I > > think I've fixed at least that part. Can you install the most recent > > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > > > >perl -w -I. t/Registry.t > > > > > > Brian O. > > > > -----Original Message----- > > From: bioperl-l-bounces@portal.open-bio.org > > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > > Sent: Wednesday, October 20, 2004 10:20 AM > > To: 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Apologise for all the pervious messages! I just wanted to get this onto > the > > mailing list: > > > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > > > System: WinXP Pro > > ActiveState Perl 5.8.0 build 804 > > Nmake v6.00.8168.0 > > > > A note beforehand: > > The error message I had previously got, and heard others have also > received > > on other OS's. That contain a "line too long" error when > > trying "make test", is due to the limitations of the particular OS. > Versions > > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > > have got round this problem by splitting long command lines from Makefiles > > into a series of smaller commands. > > > > Test Summary: > > Failed Test Stat Wstat Total Fail Failed List of Failed > > -------------------------------------------------------------------------- > -- > > --- > > t\Index.t 22 5632 41 21 51.22% 21-41 > > t\Registry.t 22 5632 11 9 81.82% 3-11 > > t\seqread_fail.t 255 65280 13 0 0.00% ?? > > 115 subtests skipped. > > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > > okay. > > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : > > return code '0xff' > > Stop. > > > > Particulars: > > t\Index......................NOK 21Can't call method "length" on an > > undefined value at t\Index.t line 124, line > > 54. > > t\Index......................dubious > > Test returned status 22 (wstat 5632, 0x1600) > > DIED. FAILED tests 21-41 > > Failed 21/41 tests, 48.78% okay > > t\Registry...................ok 2/11The getpwuid function is unimplemented > > at K:\Downloads\FlashGet\Software\Bioinform > > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > > t\Registry...................dubious > > Test returned status 22 (wstat 5632, 0x1600) > > t\seqread_fail...............ok 1/13 > > ------------- EXCEPTION: Bio::Root::Exception ------------- > > MSG: BioFetch Error 4: ID [XXX111] not found in database > > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > > STACK: Error::throw > > STACK: Bio::Root::Root::throw > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > b/Bio/Root/R > > oot.pm:328 > > STACK: Bio::DB::BioFetch::postprocess_data > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > > ib/Bio/DB/BioFetch.pm:406 > > STACK: Bio::DB::WebDBSeqI::get_seq_stream > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > b/Bio/DB/WebDBSeqI.pm:525 > > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > > lib/Bio/DB/WebDBSeqI.pm:287 > > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > b > > /Bio/DB/WebDBSeqI.pm:153 > > STACK: main::fetch t\seqread_fail.t:69 > > STACK: t\seqread_fail.t:81 > > ----------------------------------------------------------- > > t\seqread_fail...............dubious > > Test returned status 255 (wstat 65280, 0xff00) > > after all the subtests completed successfully > > > > > > Nathan > > > > > -----Original Message----- > > > From: bioperl-l-bounces@portal.open-bio.org > > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. > Mackey > > > Sent: 14 October 2004 21:27 > > > To: Bioperl > > > Subject: [Bioperl-l] make test!! > > > Importance: High > > > > > > > > > I've had only a very few people send me feedback about the current > > > state of bioperl-live "make test" on your favorite > > > old/crotchety/obscure platforms. I'm writing the Change log and > > > thinking about branching, but I'm an experimentalist, I need data! > > > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > > you have everything, "make distclean" if you've built from the cvs > > > checkout before, and start from scratch with the usual litany: perl > > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > > about, not so much all the verbiage (unless there's specific verbiage > > > related to the end result ...) > > > > > > Thanks, > > > > > > -Aaron > > > > > > _______________________________________________ > > > Bioperl-l mailing list > > > Bioperl-l@portal.open-bio.org > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > --- > > > avast! Antivirus: Inbound message clean. > > > Virus Database (VPS): 0442-2, 14/10/2004 > > > Tested on: 14/10/2004 21:59:20 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > --- > > avast! Antivirus: Outbound message clean. > > Virus Database (VPS): 0442-3, 15/10/2004 > > Tested on: 20/10/2004 15:20:04 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > > > > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l@portal.open-bio.org > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0442-3, 15/10/2004 > > Tested on: 21/10/2004 07:12:10 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0443-1, 20/10/2004 > Tested on: 21/10/2004 12:58:59 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > > > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0443-2, 21/10/2004 > Tested on: 22/10/2004 06:20:06 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0443-2, 21/10/2004 Tested on: 22/10/2004 08:29:49 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l From brian_osborne at cognia.com Fri Oct 22 17:16:32 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Fri Oct 22 17:16:04 2004 Subject: FW: [Bioperl-l] make test!! Message-ID: Nathan, Registry.t shouldn't fail if there's no $HOME set since it uses $OBDA_SEARCH_PATH, it sets OBDA_SEARCH_PATH for its own use, and it also supplies its own *ini file. To prove this to myself I just unset HOME on my machine and Registry.t still works (and $OBDA_SEARCH_PATH was unset as well, I never use it). So, I understand your point but the absence of $HOME shouldn't be the problem. Registry.pm is part of the OBDA system so the user is responsible for either seeing that $HOME is set or setting $OBDA_SEARCH_PATH, either will work (and in UNIX you could put the *ini file in /etc/bioinformatics). Questions: did this change you made in your local Registry.pm fix Registry.t? What are the errors using the Registry.t I sent you last night? So you have both modules and the Berkeley DB library? There's goes my latest hypothesis! The problem here is that I'm just guessing when it comes to ActiveState, and you can see that my guesses aren't always on target. What would be great is if someone using ActiveState would sit down with the Perl debugger and step through the code line by line so we'd know _exactly_ where the failures are. Can someone help us here? If you're not familiar with the debugger this would be a good opportunity to learn about it, it's a fantastic tool (and absolutely required if you want to improve your coding skills). I'm not just talking about Registry but about the other errors that Nathan is showing us. Brian O. -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh Sent: Friday, October 22, 2004 3:30 AM To: 'Brian Osborne'; 'Bioperl' Subject: RE: [Bioperl-l] make test!! I have the following versions installed: DB_File 1.810 BerkeleyDB 0.25 And I'm pretty sure I have the library (I remember using a BTree quite a while back). Having just had a look at Bio::DB::Registry, _load_registry refers to the ENV variable HOME. Windows doesn't have such a variable by default, so the user must either set it themselves, and failing this, Bio::DB::Registry should assume a default e.g. C:/ Therefore I've changed this sub to read: sub _load_registry { my ($self) = @_; my $home; if (defined $ENV{"HOME"}) { $home = $ENV{"HOME"} } # use this if it's set elsif ($^O eq 'MSWin32') { $home = 'C:/' } # def windows home if $ENV{HOME} isn't set else { $home = (getpwuid($>))[7] } my @ini_files = _get_ini_files($home); unless (@ini_files) { etc etc I don't know if you still need to test for failure of getpwuid, since you should never get to this stage on windows - I can't think of a reason why the c: drive is inaccessible! Nathan > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: 22 October 2004 01:22 > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Nathan, > > OK, thank you. Some of the messages you're seeing from Registry.t are > warnings, not errors, but at any rate there are still errors. So am I > correct in assuming that you have the modules DB_File and BerkeleyDB > installed, as well as the Berkeley DB library? > > I can't do more with Index.t, as I said I was just guessing there. My first > instinct is still to suspect something is wrong with Fcntl, Storable, or > DB_File, these are used by DB/FileCache and the problem with Index.t lies > with DB/InMemoryCache or DB/FileCache, most likely the latter. Someone using > ActiveState Perl is going to have to address this one. > > Brian O. > > -----Original Message----- > From: Nathan Haigh [mailto:nathanhaigh@ukonline.co.uk] > Sent: Thursday, October 21, 2004 7:59 AM > To: 'Brian Osborne'; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Ok, I've done some more testing (with the latest CVS 9am GMT) and here is > what I've found! I've run "namke test" with and without > BIOPERLDEBUG, and running individual tests using " perl -I. -w > t/test_name.t". > > Attached are 3 files with details of errors: > Errors.txt - summary and details of failed tests, and other > tests with peculiar warnings etc > Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set > Perl_test.txt - individual tests run with BIOPERLDEBUG set, using > "perl -I. -w t/test_name.t" > > My System: > WinXP Pro > ActiveState Perl 5.8.0 > Nmake 6.00.8168.0 > > My Summary: > ESEfinder.t - causes perl to crash on test 2 during "nmake test", but ok > in other tests! > Biblio_biofetch.t - throws warning and exception when using > BIOPERLDEBUG, but doesn't appear in summary! > Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 > ProtPsm.t - needs "plan tests" in test file changing to 5. When > running the individual test can't locate > Bio::Matrix::PSM::ProtMatrix > Registry.t - several error including "No seqdatabase.ini file found", " > No database with name testflat in Registry" > Primaryqual.t - Test returned status 255. and 'Can't locate object method > "header"' in individual test > seqread_fail.t - gives an exception, is this supposed to happen? > > Hope this help to iron out bugs when running BioPerl on Windows! > Nathan > > > > -----Original Message----- > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > Sent: 20 October 2004 19:04 > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Nathan, > > > > I noticed most of the Registry tests failing. I know what part of the > > problem is (getpwuid() not implemented in Windows/Activestate Perl) and I > > think I've fixed at least that part. Can you install the most recent > > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > > > >perl -w -I. t/Registry.t > > > > > > Brian O. > > > > -----Original Message----- > > From: bioperl-l-bounces@portal.open-bio.org > > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > > Sent: Wednesday, October 20, 2004 10:20 AM > > To: 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Apologise for all the pervious messages! I just wanted to get this onto > the > > mailing list: > > > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > > > System: WinXP Pro > > ActiveState Perl 5.8.0 build 804 > > Nmake v6.00.8168.0 > > > > A note beforehand: > > The error message I had previously got, and heard others have also > received > > on other OS's. That contain a "line too long" error when > > trying "make test", is due to the limitations of the particular OS. > Versions > > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > > have got round this problem by splitting long command lines from Makefiles > > into a series of smaller commands. > > > > Test Summary: > > Failed Test Stat Wstat Total Fail Failed List of Failed > > -------------------------------------------------------------------------- > -- > > --- > > t\Index.t 22 5632 41 21 51.22% 21-41 > > t\Registry.t 22 5632 11 9 81.82% 3-11 > > t\seqread_fail.t 255 65280 13 0 0.00% ?? > > 115 subtests skipped. > > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > > okay. > > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : > > return code '0xff' > > Stop. > > > > Particulars: > > t\Index......................NOK 21Can't call method "length" on an > > undefined value at t\Index.t line 124, line > > 54. > > t\Index......................dubious > > Test returned status 22 (wstat 5632, 0x1600) > > DIED. FAILED tests 21-41 > > Failed 21/41 tests, 48.78% okay > > t\Registry...................ok 2/11The getpwuid function is unimplemented > > at K:\Downloads\FlashGet\Software\Bioinform > > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > > t\Registry...................dubious > > Test returned status 22 (wstat 5632, 0x1600) > > t\seqread_fail...............ok 1/13 > > ------------- EXCEPTION: Bio::Root::Exception ------------- > > MSG: BioFetch Error 4: ID [XXX111] not found in database > > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > > STACK: Error::throw > > STACK: Bio::Root::Root::throw > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > b/Bio/Root/R > > oot.pm:328 > > STACK: Bio::DB::BioFetch::postprocess_data > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > > ib/Bio/DB/BioFetch.pm:406 > > STACK: Bio::DB::WebDBSeqI::get_seq_stream > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > b/Bio/DB/WebDBSeqI.pm:525 > > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > > lib/Bio/DB/WebDBSeqI.pm:287 > > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > b > > /Bio/DB/WebDBSeqI.pm:153 > > STACK: main::fetch t\seqread_fail.t:69 > > STACK: t\seqread_fail.t:81 > > ----------------------------------------------------------- > > t\seqread_fail...............dubious > > Test returned status 255 (wstat 65280, 0xff00) > > after all the subtests completed successfully > > > > > > Nathan > > > > > -----Original Message----- > > > From: bioperl-l-bounces@portal.open-bio.org > > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. > Mackey > > > Sent: 14 October 2004 21:27 > > > To: Bioperl > > > Subject: [Bioperl-l] make test!! > > > Importance: High > > > > > > > > > I've had only a very few people send me feedback about the current > > > state of bioperl-live "make test" on your favorite > > > old/crotchety/obscure platforms. I'm writing the Change log and > > > thinking about branching, but I'm an experimentalist, I need data! > > > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > > you have everything, "make distclean" if you've built from the cvs > > > checkout before, and start from scratch with the usual litany: perl > > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > > about, not so much all the verbiage (unless there's specific verbiage > > > related to the end result ...) > > > > > > Thanks, > > > > > > -Aaron > > > > > > _______________________________________________ > > > Bioperl-l mailing list > > > Bioperl-l@portal.open-bio.org > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > --- > > > avast! Antivirus: Inbound message clean. > > > Virus Database (VPS): 0442-2, 14/10/2004 > > > Tested on: 14/10/2004 21:59:20 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > --- > > avast! Antivirus: Outbound message clean. > > Virus Database (VPS): 0442-3, 15/10/2004 > > Tested on: 20/10/2004 15:20:04 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > > > > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l@portal.open-bio.org > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0442-3, 15/10/2004 > > Tested on: 21/10/2004 07:12:10 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0443-1, 20/10/2004 > Tested on: 21/10/2004 12:58:59 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > > > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0443-2, 21/10/2004 > Tested on: 22/10/2004 06:20:06 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0443-2, 21/10/2004 Tested on: 22/10/2004 08:29:49 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l From nathanhaigh at ukonline.co.uk Sat Oct 23 16:28:22 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Sat Oct 23 16:45:07 2004 Subject: [Bioperl-l] make test!! In-Reply-To: Message-ID: <000501c4b93e$d7da85f0$e8f0cdd9@Desktop> Sorry but I don't have time to expand on this at the moment, I will tomorrow morning! Having said that, if I make the change I suggested to Bio::DB::registry.pm and run the test file you e-mailed me I get the following: perl -w -I. t\Registry.t 1..12 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 So, this seems to work for me! I have Activestate komodo that allows debugging step by step, and this Is how I found the error. I will e-mail you details about this bug in the morning. Nathan > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: 22 October 2004 22:12 > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Nathan, > > Registry.t shouldn't fail if there's no $HOME set since it uses > $OBDA_SEARCH_PATH, it sets OBDA_SEARCH_PATH for its own use, and it also > supplies its own *ini file. To prove this to myself I just unset HOME on my > machine and Registry.t still works (and $OBDA_SEARCH_PATH was unset as well, > I never use it). > > So, I understand your point but the absence of $HOME shouldn't be the > problem. Registry.pm is part of the OBDA system so the user is responsible > for either seeing that $HOME is set or setting $OBDA_SEARCH_PATH, either > will work (and in UNIX you could put the *ini file in /etc/bioinformatics). > Questions: did this change you made in your local Registry.pm fix > Registry.t? What are the errors using the Registry.t I sent you last night? > > So you have both modules and the Berkeley DB library? There's goes my latest > hypothesis! > > The problem here is that I'm just guessing when it comes to ActiveState, and > you can see that my guesses aren't always on target. What would be great is > if someone using ActiveState would sit down with the Perl debugger and step > through the code line by line so we'd know _exactly_ where the failures are. > Can someone help us here? If you're not familiar with the debugger this > would be a good opportunity to learn about it, it's a fantastic tool (and > absolutely required if you want to improve your coding skills). I'm not just > talking about Registry but about the other errors that Nathan is showing us. > > Brian O. > > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > Sent: Friday, October 22, 2004 3:30 AM > To: 'Brian Osborne'; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > I have the following versions installed: > DB_File 1.810 > BerkeleyDB 0.25 > And I'm pretty sure I have the library (I remember using a BTree quite a > while back). > > Having just had a look at Bio::DB::Registry, _load_registry refers to the > ENV variable HOME. Windows doesn't have such a variable by > default, so the user must either set it themselves, and failing this, > Bio::DB::Registry should assume a default e.g. C:/ > > Therefore I've changed this sub to read: > sub _load_registry { > my ($self) = @_; > my $home; > > if (defined $ENV{"HOME"}) { $home = $ENV{"HOME"} } # use this if it's > set > elsif ($^O eq 'MSWin32') { $home = 'C:/' } # def windows home > if $ENV{HOME} isn't set > else { $home = (getpwuid($>))[7] } > > my @ini_files = _get_ini_files($home); > > unless (@ini_files) { > > etc etc > > > I don't know if you still need to test for failure of getpwuid, since you > should never get to this stage on windows - I can't think > of a reason why the c: drive is inaccessible! > > Nathan > > > -----Original Message----- > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > Sent: 22 October 2004 01:22 > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Nathan, > > > > OK, thank you. Some of the messages you're seeing from Registry.t are > > warnings, not errors, but at any rate there are still errors. So am I > > correct in assuming that you have the modules DB_File and BerkeleyDB > > installed, as well as the Berkeley DB library? > > > > I can't do more with Index.t, as I said I was just guessing there. My > first > > instinct is still to suspect something is wrong with Fcntl, Storable, or > > DB_File, these are used by DB/FileCache and the problem with Index.t lies > > with DB/InMemoryCache or DB/FileCache, most likely the latter. Someone > using > > ActiveState Perl is going to have to address this one. > > > > Brian O. > > > > -----Original Message----- > > From: Nathan Haigh [mailto:nathanhaigh@ukonline.co.uk] > > Sent: Thursday, October 21, 2004 7:59 AM > > To: 'Brian Osborne'; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Ok, I've done some more testing (with the latest CVS 9am GMT) and here is > > what I've found! I've run "namke test" with and without > > BIOPERLDEBUG, and running individual tests using " perl -I. -w > > t/test_name.t". > > > > Attached are 3 files with details of errors: > > Errors.txt - summary and details of failed tests, and other > > tests with peculiar warnings etc > > Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set > > Perl_test.txt - individual tests run with BIOPERLDEBUG set, > using > > "perl -I. -w t/test_name.t" > > > > My System: > > WinXP Pro > > ActiveState Perl 5.8.0 > > Nmake 6.00.8168.0 > > > > My Summary: > > ESEfinder.t - causes perl to crash on test 2 during "nmake test", but > ok > > in other tests! > > Biblio_biofetch.t - throws warning and exception when using > > BIOPERLDEBUG, but doesn't appear in summary! > > Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 > > ProtPsm.t - needs "plan tests" in test file changing to 5. When > > running the individual test can't locate > > Bio::Matrix::PSM::ProtMatrix > > Registry.t - several error including "No seqdatabase.ini file found", > " > > No database with name testflat in Registry" > > Primaryqual.t - Test returned status 255. and 'Can't locate object > method > > "header"' in individual test > > seqread_fail.t - gives an exception, is this supposed to happen? > > > > Hope this help to iron out bugs when running BioPerl on Windows! > > Nathan > > > > > > > -----Original Message----- > > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > > Sent: 20 October 2004 19:04 > > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > > Subject: RE: [Bioperl-l] make test!! > > > > > > Nathan, > > > > > > I noticed most of the Registry tests failing. I know what part of the > > > problem is (getpwuid() not implemented in Windows/Activestate Perl) and > I > > > think I've fixed at least that part. Can you install the most recent > > > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > > > > > >perl -w -I. t/Registry.t > > > > > > > > > Brian O. > > > > > > -----Original Message----- > > > From: bioperl-l-bounces@portal.open-bio.org > > > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > > > Sent: Wednesday, October 20, 2004 10:20 AM > > > To: 'Bioperl' > > > Subject: RE: [Bioperl-l] make test!! > > > > > > Apologise for all the pervious messages! I just wanted to get this onto > > the > > > mailing list: > > > > > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > > > > > System: WinXP Pro > > > ActiveState Perl 5.8.0 build 804 > > > Nmake v6.00.8168.0 > > > > > > A note beforehand: > > > The error message I had previously got, and heard others have also > > received > > > on other OS's. That contain a "line too long" error when > > > trying "make test", is due to the limitations of the particular OS. > > Versions > > > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > > > have got round this problem by splitting long command lines from > Makefiles > > > into a series of smaller commands. > > > > > > Test Summary: > > > Failed Test Stat Wstat Total Fail Failed List of Failed > > > > -------------------------------------------------------------------------- > > -- > > > --- > > > t\Index.t 22 5632 41 21 51.22% 21-41 > > > t\Registry.t 22 5632 11 9 81.82% 3-11 > > > t\seqread_fail.t 255 65280 13 0 0.00% ?? > > > 115 subtests skipped. > > > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > > > okay. > > > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' > : > > > return code '0xff' > > > Stop. > > > > > > Particulars: > > > t\Index......................NOK 21Can't call method "length" on an > > > undefined value at t\Index.t line 124, line > > > 54. > > > t\Index......................dubious > > > Test returned status 22 (wstat 5632, 0x1600) > > > DIED. FAILED tests 21-41 > > > Failed 21/41 tests, 48.78% okay > > > t\Registry...................ok 2/11The getpwuid function is > unimplemented > > > at K:\Downloads\FlashGet\Software\Bioinform > > > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > > > t\Registry...................dubious > > > Test returned status 22 (wstat 5632, 0x1600) > > > t\seqread_fail...............ok 1/13 > > > ------------- EXCEPTION: Bio::Root::Exception ------------- > > > MSG: BioFetch Error 4: ID [XXX111] not found in database > > > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > > > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > > > STACK: Error::throw > > > STACK: Bio::Root::Root::throw > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b/Bio/Root/R > > > oot.pm:328 > > > STACK: Bio::DB::BioFetch::postprocess_data > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > > > ib/Bio/DB/BioFetch.pm:406 > > > STACK: Bio::DB::WebDBSeqI::get_seq_stream > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b/Bio/DB/WebDBSeqI.pm:525 > > > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > > > lib/Bio/DB/WebDBSeqI.pm:287 > > > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b > > > /Bio/DB/WebDBSeqI.pm:153 > > > STACK: main::fetch t\seqread_fail.t:69 > > > STACK: t\seqread_fail.t:81 > > > ----------------------------------------------------------- > > > t\seqread_fail...............dubious > > > Test returned status 255 (wstat 65280, 0xff00) > > > after all the subtests completed successfully > > > > > > > > > Nathan > > > > > > > -----Original Message----- > > > > From: bioperl-l-bounces@portal.open-bio.org > > > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. > > Mackey > > > > Sent: 14 October 2004 21:27 > > > > To: Bioperl > > > > Subject: [Bioperl-l] make test!! > > > > Importance: High > > > > > > > > > > > > I've had only a very few people send me feedback about the current > > > > state of bioperl-live "make test" on your favorite > > > > old/crotchety/obscure platforms. I'm writing the Change log and > > > > thinking about branching, but I'm an experimentalist, I need data! > > > > > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > > > you have everything, "make distclean" if you've built from the cvs > > > > checkout before, and start from scratch with the usual litany: perl > > > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > > > about, not so much all the verbiage (unless there's specific verbiage > > > > related to the end result ...) > > > > > > > > Thanks, > > > > > > > > -Aaron > > > > > > > > _______________________________________________ > > > > Bioperl-l mailing list > > > > Bioperl-l@portal.open-bio.org > > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > --- > > > > avast! Antivirus: Inbound message clean. > > > > Virus Database (VPS): 0442-2, 14/10/2004 > > > > Tested on: 14/10/2004 21:59:20 > > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > > http://www.avast.com > > > > > > > > > > > > > > --- > > > avast! Antivirus: Outbound message clean. > > > Virus Database (VPS): 0442-3, 15/10/2004 > > > Tested on: 20/10/2004 15:20:04 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > > > > > > > > > _______________________________________________ > > > Bioperl-l mailing list > > > Bioperl-l@portal.open-bio.org > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > > > > > > --- > > > avast! Antivirus: Inbound message clean. > > > Virus Database (VPS): 0442-3, 15/10/2004 > > > Tested on: 21/10/2004 07:12:10 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > --- > > avast! Antivirus: Outbound message clean. > > Virus Database (VPS): 0443-1, 20/10/2004 > > Tested on: 21/10/2004 12:58:59 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > > > > > > > > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0443-2, 21/10/2004 > > Tested on: 22/10/2004 06:20:06 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0443-2, 21/10/2004 > Tested on: 22/10/2004 08:29:49 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > From nathanhaigh at ukonline.co.uk Sat Oct 23 16:23:18 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Sat Oct 23 16:45:13 2004 Subject: [Bioperl-l] make test!! In-Reply-To: Message-ID: I get the following error: perl -w -I. t\Registry.t 1..12 ok 1 ok 2 ok 3 This Perl doesn't implement function getpwuid(). Skipping... -------------------- WARNING --------------------- MSG: No seqdatabase.ini file found in ~/.bioinformatics/ nor in /etc/bioinformatics/ nor in directory specified by t/data/registry/flat;t/data/registry/bdb. Using web to get database registry from http://www.open-bio.org/registry/seqdatabase.ini --------------------------------------------------- ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: can't connect: IO::Socket::INET: Bad hostname 'www.open-bio.org' STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:328 STACK: Bio::Root::HTTPget::getFH Bio/Root/HTTPget.pm:207 STACK: Bio::DB::Registry::_load_registry Bio/DB/Registry.pm:128 STACK: Bio::DB::Registry::new Bio/DB/Registry.pm:97 STACK: t\Registry.t:57 ----------------------------------------------------------- Nathan > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: 22 October 2004 22:12 > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Nathan, > > Please replace your t/Registry.t with the attached Registry.t file and tell > me what happens after: > > >perl -w -I. t/Registry.t > > Brian O. > > -----Original Message----- > From: Nathan Haigh [mailto:nathanhaigh@ukonline.co.uk] > Sent: Thursday, October 21, 2004 7:59 AM > To: 'Brian Osborne'; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Ok, I've done some more testing (with the latest CVS 9am GMT) and here is > what I've found! I've run "namke test" with and without > BIOPERLDEBUG, and running individual tests using " perl -I. -w > t/test_name.t". > > Attached are 3 files with details of errors: > Errors.txt - summary and details of failed tests, and other > tests with peculiar warnings etc > Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set > Perl_test.txt - individual tests run with BIOPERLDEBUG set, using > "perl -I. -w t/test_name.t" > > My System: > WinXP Pro > ActiveState Perl 5.8.0 > Nmake 6.00.8168.0 > > My Summary: > ESEfinder.t - causes perl to crash on test 2 during "nmake test", but ok > in other tests! > Biblio_biofetch.t - throws warning and exception when using > BIOPERLDEBUG, but doesn't appear in summary! > Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 > ProtPsm.t - needs "plan tests" in test file changing to 5. When > running the individual test can't locate > Bio::Matrix::PSM::ProtMatrix > Registry.t - several error including "No seqdatabase.ini file found", " > No database with name testflat in Registry" > Primaryqual.t - Test returned status 255. and 'Can't locate object method > "header"' in individual test > seqread_fail.t - gives an exception, is this supposed to happen? > > Hope this help to iron out bugs when running BioPerl on Windows! > Nathan > > > > -----Original Message----- > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > Sent: 20 October 2004 19:04 > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Nathan, > > > > I noticed most of the Registry tests failing. I know what part of the > > problem is (getpwuid() not implemented in Windows/Activestate Perl) and I > > think I've fixed at least that part. Can you install the most recent > > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > > > >perl -w -I. t/Registry.t > > > > > > Brian O. > > > > -----Original Message----- > > From: bioperl-l-bounces@portal.open-bio.org > > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > > Sent: Wednesday, October 20, 2004 10:20 AM > > To: 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Apologise for all the pervious messages! I just wanted to get this onto > the > > mailing list: > > > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > > > System: WinXP Pro > > ActiveState Perl 5.8.0 build 804 > > Nmake v6.00.8168.0 > > > > A note beforehand: > > The error message I had previously got, and heard others have also > received > > on other OS's. That contain a "line too long" error when > > trying "make test", is due to the limitations of the particular OS. > Versions > > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > > have got round this problem by splitting long command lines from Makefiles > > into a series of smaller commands. > > > > Test Summary: > > Failed Test Stat Wstat Total Fail Failed List of Failed > > -------------------------------------------------------------------------- > -- > > --- > > t\Index.t 22 5632 41 21 51.22% 21-41 > > t\Registry.t 22 5632 11 9 81.82% 3-11 > > t\seqread_fail.t 255 65280 13 0 0.00% ?? > > 115 subtests skipped. > > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > > okay. > > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : > > return code '0xff' > > Stop. > > > > Particulars: > > t\Index......................NOK 21Can't call method "length" on an > > undefined value at t\Index.t line 124, line > > 54. > > t\Index......................dubious > > Test returned status 22 (wstat 5632, 0x1600) > > DIED. FAILED tests 21-41 > > Failed 21/41 tests, 48.78% okay > > t\Registry...................ok 2/11The getpwuid function is unimplemented > > at K:\Downloads\FlashGet\Software\Bioinform > > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > > t\Registry...................dubious > > Test returned status 22 (wstat 5632, 0x1600) > > t\seqread_fail...............ok 1/13 > > ------------- EXCEPTION: Bio::Root::Exception ------------- > > MSG: BioFetch Error 4: ID [XXX111] not found in database > > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > > STACK: Error::throw > > STACK: Bio::Root::Root::throw > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > b/Bio/Root/R > > oot.pm:328 > > STACK: Bio::DB::BioFetch::postprocess_data > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > > ib/Bio/DB/BioFetch.pm:406 > > STACK: Bio::DB::WebDBSeqI::get_seq_stream > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > b/Bio/DB/WebDBSeqI.pm:525 > > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > > lib/Bio/DB/WebDBSeqI.pm:287 > > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > b > > /Bio/DB/WebDBSeqI.pm:153 > > STACK: main::fetch t\seqread_fail.t:69 > > STACK: t\seqread_fail.t:81 > > ----------------------------------------------------------- > > t\seqread_fail...............dubious > > Test returned status 255 (wstat 65280, 0xff00) > > after all the subtests completed successfully > > > > > > Nathan > > > > > -----Original Message----- > > > From: bioperl-l-bounces@portal.open-bio.org > > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. > Mackey > > > Sent: 14 October 2004 21:27 > > > To: Bioperl > > > Subject: [Bioperl-l] make test!! > > > Importance: High > > > > > > > > > I've had only a very few people send me feedback about the current > > > state of bioperl-live "make test" on your favorite > > > old/crotchety/obscure platforms. I'm writing the Change log and > > > thinking about branching, but I'm an experimentalist, I need data! > > > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > > you have everything, "make distclean" if you've built from the cvs > > > checkout before, and start from scratch with the usual litany: perl > > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > > about, not so much all the verbiage (unless there's specific verbiage > > > related to the end result ...) > > > > > > Thanks, > > > > > > -Aaron > > > > > > _______________________________________________ > > > Bioperl-l mailing list > > > Bioperl-l@portal.open-bio.org > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > --- > > > avast! Antivirus: Inbound message clean. > > > Virus Database (VPS): 0442-2, 14/10/2004 > > > Tested on: 14/10/2004 21:59:20 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > --- > > avast! Antivirus: Outbound message clean. > > Virus Database (VPS): 0442-3, 15/10/2004 > > Tested on: 20/10/2004 15:20:04 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > > > > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l@portal.open-bio.org > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0442-3, 15/10/2004 > > Tested on: 21/10/2004 07:12:10 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0443-1, 20/10/2004 > Tested on: 21/10/2004 12:58:59 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0443-3, 22/10/2004 > Tested on: 23/10/2004 21:17:55 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0443-3, 22/10/2004 Tested on: 23/10/2004 21:22:10 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From popgen23 at mac.com Sat Oct 23 22:22:17 2004 From: popgen23 at mac.com (Michael S. Robeson II) Date: Sat Oct 23 22:21:12 2004 Subject: [Bioperl-l] comparing data between hashes Message-ID: <865D5CD2-2563-11D9-A61F-000A956C4C82@mac.com> I have a several "hash of a hashes" that look like this (sorry if my formating is a little off): Human => { # HoH for human 1 => [1,32,54,67] # numbers in [ ] is a string delimited by commas not separate hash values 2 => [14,52,74,87] 5 => [33,44,64,107] } Chimp => { # HoH for Chimp 1 => [1,32,67] 2 => [14,74,87] 5 => [33,44] } Note: The numbers in between the [ ] is a STRING delimited by commas and NOT separate hash values. I already have a working script that appends these numbers to the appropriate hash separated by a comma or newline like this: $class{$position} .= "$pos" . " ,"; #to get: 5 => [33,44,64,107] And I am having trouble trying to compare data. I want to compare each number (i.e. 1, 2, & 5) and its data with e the same number in the other species. For example, I would like to print out a table (see below) that compares the data between the group "1" in each species. Alleles for set: 1 Allele: 1 32 54 67 Human 1 1 1 1 # 1 = present Chimp 1 1 0 1 # 0 = absent And so on for 2 and 5. I can most likely do the print formating for the table myself so I do not need help with that. I just need help with being able to compare the data within each Hash of a Hash (HoH). I do not know if I should read this data into yet another Hash (which would be very busy) or an array somehow? I have been trying to figure this out all week to no avail. Any ideas or suggestions? - Thanks - Mike From hlapp at gmx.net Sat Oct 23 23:08:46 2004 From: hlapp at gmx.net (Hilmar Lapp) Date: Sat Oct 23 23:07:47 2004 Subject: [Bioperl-l] Re: Handling gff3 Target and Dbxref tags through FeatureIO In-Reply-To: Message-ID: <04C5139E-256A-11D9-A97C-000A959EB4C4@gmx.net> On Thursday, October 21, 2004, at 11:09 AM, Allen Day wrote: > but i don't understand the > Bio::Location::CoordinatePolicy yet, it looks like it affects calls to > start() and end(). > You only need to worry about this for fuzzy locations. The coordinate policy in effect essentially determines what you consider as the start coordinate for a location like <1..10 and similarly for the end coordinate. At the time consensus could not be reached and so we designed this API that lets you have your way if you can implement it as a policy object. There's some default ones two for the most common cases (use max, use min, etc). -hilmar -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- From nathanhaigh at ukonline.co.uk Sun Oct 24 04:00:26 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Sun Oct 24 03:59:33 2004 Subject: [Bioperl-l] make test!! In-Reply-To: Message-ID: <000001c4b99f$86de49f0$1ff2cdd9@Desktop> Ops, must have been a problem with my web connection! It actually gives the following output: perl -w -I. t\Registry.t 1..12 ok 1 ok 2 ok 3 This Perl doesn't implement function getpwuid(). Skipping... -------------------- WARNING --------------------- MSG: No seqdatabase.ini file found in ~/.bioinformatics/ nor in /etc/bioinformatics/ nor in directory specified by t/data/registry/flat;t/data/registry/bdb. Using web to get database registry from http://www.open-bio.org/registry/seqdatabase.ini --------------------------------------------------- -------------------- WARNING --------------------- MSG: Stored the default registry configuration in /.bioinformatics/seqdatabase.ini --------------------------------------------------- ok 4 not ok 5 # Failed test 5 in t\Registry.t at line 63 -------------------- WARNING --------------------- MSG: No database with name testflat in Registry --------------------------------------------------- not ok 6 # Failed test 6 in t\Registry.t at line 65 Can't call method "get_Seq_by_id" on an undefined value at t\Registry.t line 66, line 11. I'm just going to debug this, and post further details! Nathan > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Nathan Haigh > Sent: 23 October 2004 21:23 > To: 'Brian Osborne'; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > I get the following error: > > > perl -w -I. t\Registry.t > 1..12 > ok 1 > ok 2 > ok 3 > This Perl doesn't implement function getpwuid(). Skipping... > > -------------------- WARNING --------------------- > MSG: No seqdatabase.ini file found in ~/.bioinformatics/ > nor in /etc/bioinformatics/ nor in directory specified by > t/data/registry/flat;t/data/registry/bdb. Using web to get database registry from > http://www.open-bio.org/registry/seqdatabase.ini > --------------------------------------------------- > > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: can't connect: IO::Socket::INET: Bad hostname 'www.open-bio.org' > STACK: Error::throw > STACK: Bio::Root::Root::throw Bio/Root/Root.pm:328 > STACK: Bio::Root::HTTPget::getFH Bio/Root/HTTPget.pm:207 > STACK: Bio::DB::Registry::_load_registry Bio/DB/Registry.pm:128 > STACK: Bio::DB::Registry::new Bio/DB/Registry.pm:97 > STACK: t\Registry.t:57 > ----------------------------------------------------------- > > Nathan > > > -----Original Message----- > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > Sent: 22 October 2004 22:12 > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Nathan, > > > > Please replace your t/Registry.t with the attached Registry.t file and tell > > me what happens after: > > > > >perl -w -I. t/Registry.t > > > > Brian O. > > > > -----Original Message----- > > From: Nathan Haigh [mailto:nathanhaigh@ukonline.co.uk] > > Sent: Thursday, October 21, 2004 7:59 AM > > To: 'Brian Osborne'; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Ok, I've done some more testing (with the latest CVS 9am GMT) and here is > > what I've found! I've run "namke test" with and without > > BIOPERLDEBUG, and running individual tests using " perl -I. -w > > t/test_name.t". > > > > Attached are 3 files with details of errors: > > Errors.txt - summary and details of failed tests, and other > > tests with peculiar warnings etc > > Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set > > Perl_test.txt - individual tests run with BIOPERLDEBUG set, using > > "perl -I. -w t/test_name.t" > > > > My System: > > WinXP Pro > > ActiveState Perl 5.8.0 > > Nmake 6.00.8168.0 > > > > My Summary: > > ESEfinder.t - causes perl to crash on test 2 during "nmake test", but ok > > in other tests! > > Biblio_biofetch.t - throws warning and exception when using > > BIOPERLDEBUG, but doesn't appear in summary! > > Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 > > ProtPsm.t - needs "plan tests" in test file changing to 5. When > > running the individual test can't locate > > Bio::Matrix::PSM::ProtMatrix > > Registry.t - several error including "No seqdatabase.ini file found", " > > No database with name testflat in Registry" > > Primaryqual.t - Test returned status 255. and 'Can't locate object method > > "header"' in individual test > > seqread_fail.t - gives an exception, is this supposed to happen? > > > > Hope this help to iron out bugs when running BioPerl on Windows! > > Nathan > > > > > > > -----Original Message----- > > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > > Sent: 20 October 2004 19:04 > > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > > Subject: RE: [Bioperl-l] make test!! > > > > > > Nathan, > > > > > > I noticed most of the Registry tests failing. I know what part of the > > > problem is (getpwuid() not implemented in Windows/Activestate Perl) and I > > > think I've fixed at least that part. Can you install the most recent > > > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > > > > > >perl -w -I. t/Registry.t > > > > > > > > > Brian O. > > > > > > -----Original Message----- > > > From: bioperl-l-bounces@portal.open-bio.org > > > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > > > Sent: Wednesday, October 20, 2004 10:20 AM > > > To: 'Bioperl' > > > Subject: RE: [Bioperl-l] make test!! > > > > > > Apologise for all the pervious messages! I just wanted to get this onto > > the > > > mailing list: > > > > > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > > > > > System: WinXP Pro > > > ActiveState Perl 5.8.0 build 804 > > > Nmake v6.00.8168.0 > > > > > > A note beforehand: > > > The error message I had previously got, and heard others have also > > received > > > on other OS's. That contain a "line too long" error when > > > trying "make test", is due to the limitations of the particular OS. > > Versions > > > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > > > have got round this problem by splitting long command lines from Makefiles > > > into a series of smaller commands. > > > > > > Test Summary: > > > Failed Test Stat Wstat Total Fail Failed List of Failed > > > -------------------------------------------------------------------------- > > -- > > > --- > > > t\Index.t 22 5632 41 21 51.22% 21-41 > > > t\Registry.t 22 5632 11 9 81.82% 3-11 > > > t\seqread_fail.t 255 65280 13 0 0.00% ?? > > > 115 subtests skipped. > > > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > > > okay. > > > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : > > > return code '0xff' > > > Stop. > > > > > > Particulars: > > > t\Index......................NOK 21Can't call method "length" on an > > > undefined value at t\Index.t line 124, line > > > 54. > > > t\Index......................dubious > > > Test returned status 22 (wstat 5632, 0x1600) > > > DIED. FAILED tests 21-41 > > > Failed 21/41 tests, 48.78% okay > > > t\Registry...................ok 2/11The getpwuid function is unimplemented > > > at K:\Downloads\FlashGet\Software\Bioinform > > > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > > > t\Registry...................dubious > > > Test returned status 22 (wstat 5632, 0x1600) > > > t\seqread_fail...............ok 1/13 > > > ------------- EXCEPTION: Bio::Root::Exception ------------- > > > MSG: BioFetch Error 4: ID [XXX111] not found in database > > > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > > > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > > > STACK: Error::throw > > > STACK: Bio::Root::Root::throw > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b/Bio/Root/R > > > oot.pm:328 > > > STACK: Bio::DB::BioFetch::postprocess_data > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > > > ib/Bio/DB/BioFetch.pm:406 > > > STACK: Bio::DB::WebDBSeqI::get_seq_stream > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b/Bio/DB/WebDBSeqI.pm:525 > > > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > > > lib/Bio/DB/WebDBSeqI.pm:287 > > > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b > > > /Bio/DB/WebDBSeqI.pm:153 > > > STACK: main::fetch t\seqread_fail.t:69 > > > STACK: t\seqread_fail.t:81 > > > ----------------------------------------------------------- > > > t\seqread_fail...............dubious > > > Test returned status 255 (wstat 65280, 0xff00) > > > after all the subtests completed successfully > > > > > > > > > Nathan > > > > > > > -----Original Message----- > > > > From: bioperl-l-bounces@portal.open-bio.org > > > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. > > Mackey > > > > Sent: 14 October 2004 21:27 > > > > To: Bioperl > > > > Subject: [Bioperl-l] make test!! > > > > Importance: High > > > > > > > > > > > > I've had only a very few people send me feedback about the current > > > > state of bioperl-live "make test" on your favorite > > > > old/crotchety/obscure platforms. I'm writing the Change log and > > > > thinking about branching, but I'm an experimentalist, I need data! > > > > > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > > > you have everything, "make distclean" if you've built from the cvs > > > > checkout before, and start from scratch with the usual litany: perl > > > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > > > about, not so much all the verbiage (unless there's specific verbiage > > > > related to the end result ...) > > > > > > > > Thanks, > > > > > > > > -Aaron > > > > > > > > _______________________________________________ > > > > Bioperl-l mailing list > > > > Bioperl-l@portal.open-bio.org > > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > --- > > > > avast! Antivirus: Inbound message clean. > > > > Virus Database (VPS): 0442-2, 14/10/2004 > > > > Tested on: 14/10/2004 21:59:20 > > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > > http://www.avast.com > > > > > > > > > > > > > > --- > > > avast! Antivirus: Outbound message clean. > > > Virus Database (VPS): 0442-3, 15/10/2004 > > > Tested on: 20/10/2004 15:20:04 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > > > > > > > > > _______________________________________________ > > > Bioperl-l mailing list > > > Bioperl-l@portal.open-bio.org > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > > > > > > --- > > > avast! Antivirus: Inbound message clean. > > > Virus Database (VPS): 0442-3, 15/10/2004 > > > Tested on: 21/10/2004 07:12:10 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > --- > > avast! Antivirus: Outbound message clean. > > Virus Database (VPS): 0443-1, 20/10/2004 > > Tested on: 21/10/2004 12:58:59 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > > > > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0443-3, 22/10/2004 > > Tested on: 23/10/2004 21:17:55 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0443-3, 22/10/2004 > Tested on: 23/10/2004 21:22:10 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l From nathanhaigh at ukonline.co.uk Sun Oct 24 04:42:00 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Sun Oct 24 04:41:07 2004 Subject: [Bioperl-l] make test!! In-Reply-To: Message-ID: Ok, here goes (with your test file, and without my patch)! So what you are saying I that $ENV{HOME} should be set by the user? But shouldn't this default to something in order for the test to work? If this isn't set in windows the test fails as follows: 1) In Registry.pm $home doesn't get set on window because by default there is not $ENV{"HOME"} (unless set by the user!) and getpwuid isn't implemented in ActiveState Perl for windows. 2) So _get_ini_files() doesn't get called. 3) try to retrieve ini file from web (successful) 4) try to store the ini file in $home.bioinformatics (not successful) a) the path $home/.bioinformatics is not a valid windows path ($home is not set so this becomes just /.bioinformatics) b) for some reason ActiveState perl doesn't see anything wrong with it when trying to create the dir, but when it tries to open it, perl dies with a 'permission denied' error. But no sign of the dir on my filesystem! I suppose it depends how you want to catch this. There are 3 options as far as I see If the env variable HOME should be set beforehand: 1) The test could just skip these tests if $ENV{HOME} isn't set 2) The test script set a temp dir for $ENV{HOME} if it isn't already set - to enable the test to complete in full, then cleanup after itself. 3) The registry.pm file should assume a default if $ENV{HOME} isn't set and can't be got at with getpwuid. (this is what my patch does, and works, but then it leaves the dir in c: which the user might not want cluttering up - especially if they doen't use the module and it was just created during the test) I would prefer either option 2, so that all tests can still be run, or 3) which assume a default $ENV{HOME} unless the user has specified something specific. Or some combination of 2 and 3; so that the test can create a tmp dir for the ini file and clean up the dir at the end to save clutter if the user never uses this module (and so doesn't have $ENV{HOME} set). Hope this clears things up a bit! Nathan > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: 22 October 2004 22:17 > To: bioperl-l@bioperl.org; nathanhaigh@ukonline.co.uk > Subject: FW: [Bioperl-l] make test!! > > Nathan, > > Registry.t shouldn't fail if there's no $HOME set since it uses > $OBDA_SEARCH_PATH, it sets OBDA_SEARCH_PATH for its own use, and it also > supplies its own *ini file. To prove this to myself I just unset HOME on my > machine and Registry.t still works (and $OBDA_SEARCH_PATH was unset as well, > I never use it). > > So, I understand your point but the absence of $HOME shouldn't be the > problem. Registry.pm is part of the OBDA system so the user is responsible > for either seeing that $HOME is set or setting $OBDA_SEARCH_PATH, either > will work (and in UNIX you could put the *ini file in /etc/bioinformatics). > Questions: did this change you made in your local Registry.pm fix > Registry.t? What are the errors using the Registry.t I sent you last night? > > So you have both modules and the Berkeley DB library? There's goes my latest > hypothesis! > > The problem here is that I'm just guessing when it comes to ActiveState, and > you can see that my guesses aren't always on target. What would be great is > if someone using ActiveState would sit down with the Perl debugger and step > through the code line by line so we'd know _exactly_ where the failures are. > Can someone help us here? If you're not familiar with the debugger this > would be a good opportunity to learn about it, it's a fantastic tool (and > absolutely required if you want to improve your coding skills). I'm not just > talking about Registry but about the other errors that Nathan is showing us. > > Brian O. > > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > Sent: Friday, October 22, 2004 3:30 AM > To: 'Brian Osborne'; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > I have the following versions installed: > DB_File 1.810 > BerkeleyDB 0.25 > And I'm pretty sure I have the library (I remember using a BTree quite a > while back). > > Having just had a look at Bio::DB::Registry, _load_registry refers to the > ENV variable HOME. Windows doesn't have such a variable by > default, so the user must either set it themselves, and failing this, > Bio::DB::Registry should assume a default e.g. C:/ > > Therefore I've changed this sub to read: > sub _load_registry { > my ($self) = @_; > my $home; > > if (defined $ENV{"HOME"}) { $home = $ENV{"HOME"} } # use this if it's > set > elsif ($^O eq 'MSWin32') { $home = 'C:/' } # def windows home > if $ENV{HOME} isn't set > else { $home = (getpwuid($>))[7] } > > my @ini_files = _get_ini_files($home); > > unless (@ini_files) { > > etc etc > > > I don't know if you still need to test for failure of getpwuid, since you > should never get to this stage on windows - I can't think > of a reason why the c: drive is inaccessible! > > Nathan > > > -----Original Message----- > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > Sent: 22 October 2004 01:22 > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Nathan, > > > > OK, thank you. Some of the messages you're seeing from Registry.t are > > warnings, not errors, but at any rate there are still errors. So am I > > correct in assuming that you have the modules DB_File and BerkeleyDB > > installed, as well as the Berkeley DB library? > > > > I can't do more with Index.t, as I said I was just guessing there. My > first > > instinct is still to suspect something is wrong with Fcntl, Storable, or > > DB_File, these are used by DB/FileCache and the problem with Index.t lies > > with DB/InMemoryCache or DB/FileCache, most likely the latter. Someone > using > > ActiveState Perl is going to have to address this one. > > > > Brian O. > > > > -----Original Message----- > > From: Nathan Haigh [mailto:nathanhaigh@ukonline.co.uk] > > Sent: Thursday, October 21, 2004 7:59 AM > > To: 'Brian Osborne'; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Ok, I've done some more testing (with the latest CVS 9am GMT) and here is > > what I've found! I've run "namke test" with and without > > BIOPERLDEBUG, and running individual tests using " perl -I. -w > > t/test_name.t". > > > > Attached are 3 files with details of errors: > > Errors.txt - summary and details of failed tests, and other > > tests with peculiar warnings etc > > Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set > > Perl_test.txt - individual tests run with BIOPERLDEBUG set, > using > > "perl -I. -w t/test_name.t" > > > > My System: > > WinXP Pro > > ActiveState Perl 5.8.0 > > Nmake 6.00.8168.0 > > > > My Summary: > > ESEfinder.t - causes perl to crash on test 2 during "nmake test", but > ok > > in other tests! > > Biblio_biofetch.t - throws warning and exception when using > > BIOPERLDEBUG, but doesn't appear in summary! > > Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 > > ProtPsm.t - needs "plan tests" in test file changing to 5. When > > running the individual test can't locate > > Bio::Matrix::PSM::ProtMatrix > > Registry.t - several error including "No seqdatabase.ini file found", > " > > No database with name testflat in Registry" > > Primaryqual.t - Test returned status 255. and 'Can't locate object > method > > "header"' in individual test > > seqread_fail.t - gives an exception, is this supposed to happen? > > > > Hope this help to iron out bugs when running BioPerl on Windows! > > Nathan > > > > > > > -----Original Message----- > > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > > Sent: 20 October 2004 19:04 > > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > > Subject: RE: [Bioperl-l] make test!! > > > > > > Nathan, > > > > > > I noticed most of the Registry tests failing. I know what part of the > > > problem is (getpwuid() not implemented in Windows/Activestate Perl) and > I > > > think I've fixed at least that part. Can you install the most recent > > > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > > > > > >perl -w -I. t/Registry.t > > > > > > > > > Brian O. > > > > > > -----Original Message----- > > > From: bioperl-l-bounces@portal.open-bio.org > > > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > > > Sent: Wednesday, October 20, 2004 10:20 AM > > > To: 'Bioperl' > > > Subject: RE: [Bioperl-l] make test!! > > > > > > Apologise for all the pervious messages! I just wanted to get this onto > > the > > > mailing list: > > > > > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > > > > > System: WinXP Pro > > > ActiveState Perl 5.8.0 build 804 > > > Nmake v6.00.8168.0 > > > > > > A note beforehand: > > > The error message I had previously got, and heard others have also > > received > > > on other OS's. That contain a "line too long" error when > > > trying "make test", is due to the limitations of the particular OS. > > Versions > > > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > > > have got round this problem by splitting long command lines from > Makefiles > > > into a series of smaller commands. > > > > > > Test Summary: > > > Failed Test Stat Wstat Total Fail Failed List of Failed > > > > -------------------------------------------------------------------------- > > -- > > > --- > > > t\Index.t 22 5632 41 21 51.22% 21-41 > > > t\Registry.t 22 5632 11 9 81.82% 3-11 > > > t\seqread_fail.t 255 65280 13 0 0.00% ?? > > > 115 subtests skipped. > > > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > > > okay. > > > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' > : > > > return code '0xff' > > > Stop. > > > > > > Particulars: > > > t\Index......................NOK 21Can't call method "length" on an > > > undefined value at t\Index.t line 124, line > > > 54. > > > t\Index......................dubious > > > Test returned status 22 (wstat 5632, 0x1600) > > > DIED. FAILED tests 21-41 > > > Failed 21/41 tests, 48.78% okay > > > t\Registry...................ok 2/11The getpwuid function is > unimplemented > > > at K:\Downloads\FlashGet\Software\Bioinform > > > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > > > t\Registry...................dubious > > > Test returned status 22 (wstat 5632, 0x1600) > > > t\seqread_fail...............ok 1/13 > > > ------------- EXCEPTION: Bio::Root::Exception ------------- > > > MSG: BioFetch Error 4: ID [XXX111] not found in database > > > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > > > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > > > STACK: Error::throw > > > STACK: Bio::Root::Root::throw > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b/Bio/Root/R > > > oot.pm:328 > > > STACK: Bio::DB::BioFetch::postprocess_data > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > > > ib/Bio/DB/BioFetch.pm:406 > > > STACK: Bio::DB::WebDBSeqI::get_seq_stream > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b/Bio/DB/WebDBSeqI.pm:525 > > > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > > > lib/Bio/DB/WebDBSeqI.pm:287 > > > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b > > > /Bio/DB/WebDBSeqI.pm:153 > > > STACK: main::fetch t\seqread_fail.t:69 > > > STACK: t\seqread_fail.t:81 > > > ----------------------------------------------------------- > > > t\seqread_fail...............dubious > > > Test returned status 255 (wstat 65280, 0xff00) > > > after all the subtests completed successfully > > > > > > > > > Nathan > > > > > > > -----Original Message----- > > > > From: bioperl-l-bounces@portal.open-bio.org > > > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. > > Mackey > > > > Sent: 14 October 2004 21:27 > > > > To: Bioperl > > > > Subject: [Bioperl-l] make test!! > > > > Importance: High > > > > > > > > > > > > I've had only a very few people send me feedback about the current > > > > state of bioperl-live "make test" on your favorite > > > > old/crotchety/obscure platforms. I'm writing the Change log and > > > > thinking about branching, but I'm an experimentalist, I need data! > > > > > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > > > you have everything, "make distclean" if you've built from the cvs > > > > checkout before, and start from scratch with the usual litany: perl > > > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > > > about, not so much all the verbiage (unless there's specific verbiage > > > > related to the end result ...) > > > > > > > > Thanks, > > > > > > > > -Aaron > > > > > > > > _______________________________________________ > > > > Bioperl-l mailing list > > > > Bioperl-l@portal.open-bio.org > > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > --- > > > > avast! Antivirus: Inbound message clean. > > > > Virus Database (VPS): 0442-2, 14/10/2004 > > > > Tested on: 14/10/2004 21:59:20 > > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > > http://www.avast.com > > > > > > > > > > > > > > --- > > > avast! Antivirus: Outbound message clean. > > > Virus Database (VPS): 0442-3, 15/10/2004 > > > Tested on: 20/10/2004 15:20:04 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > > > > > > > > > _______________________________________________ > > > Bioperl-l mailing list > > > Bioperl-l@portal.open-bio.org > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > > > > > > --- > > > avast! Antivirus: Inbound message clean. > > > Virus Database (VPS): 0442-3, 15/10/2004 > > > Tested on: 21/10/2004 07:12:10 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > --- > > avast! Antivirus: Outbound message clean. > > Virus Database (VPS): 0443-1, 20/10/2004 > > Tested on: 21/10/2004 12:58:59 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > > > > > > > > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0443-2, 21/10/2004 > > Tested on: 22/10/2004 06:20:06 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0443-2, 21/10/2004 > Tested on: 22/10/2004 08:29:49 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0443-3, 22/10/2004 > Tested on: 23/10/2004 21:18:10 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0443-3, 22/10/2004 Tested on: 24/10/2004 09:36:56 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From brian_osborne at cognia.com Sun Oct 24 11:48:16 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Sun Oct 24 11:47:14 2004 Subject: [Bioperl-l] make test!! In-Reply-To: Message-ID: Nathan, >So what you are saying I that $ENV{HOME} should be set by the user? No, I said the opposite. I wrote that I tested my Registry.t by _unsetting_ HOME, it still works. Take a look at Registry.t, it's already doing the things you're mentioning, like setting up a temp directory. Registry.t has all the files it needs already, there's absolutely no need to write seqdatabase.ini to C:, or HOME, or any other directory. Do you see what I mean? The files used by Registry.t are already on your machine, in the t/ directory but ActiveState Perl can't find them. Your output, from a previous letter: > MSG: No seqdatabase.ini file found in ~/.bioinformatics/ > nor in /etc/bioinformatics/ nor in directory specified by > t/data/registry/flat;t/data/registry/bdb. Now, take a look at your t/data/registry/flat, there's a seqdatabase.ini file there, yes? So, what's the standard way of handling Unix and DOS filenames gracefully in Perl? Meaning, ActiveState presumably wants to see "t\data\registry\flat;t\data\registry\bdb", not "t/data/registry/flat;t/data/registry/bdb". Do you know the right way to do this? I think that one solution may lie in the use of File::Spec, I'm going to take a look at it, I'll tell you what I find... Brian O. -----Original Message----- From: Nathan Haigh [mailto:nathanhaigh@ukonline.co.uk] Sent: Sunday, October 24, 2004 4:42 AM To: 'Brian Osborne'; bioperl-l@bioperl.org Subject: RE: [Bioperl-l] make test!! Ok, here goes (with your test file, and without my patch)! So what you are saying I that $ENV{HOME} should be set by the user? But shouldn't this default to something in order for the test to work? If this isn't set in windows the test fails as follows: 1) In Registry.pm $home doesn't get set on window because by default there is not $ENV{"HOME"} (unless set by the user!) and getpwuid isn't implemented in ActiveState Perl for windows. 2) So _get_ini_files() doesn't get called. 3) try to retrieve ini file from web (successful) 4) try to store the ini file in $home.bioinformatics (not successful) a) the path $home/.bioinformatics is not a valid windows path ($home is not set so this becomes just /.bioinformatics) b) for some reason ActiveState perl doesn't see anything wrong with it when trying to create the dir, but when it tries to open it, perl dies with a 'permission denied' error. But no sign of the dir on my filesystem! I suppose it depends how you want to catch this. There are 3 options as far as I see If the env variable HOME should be set beforehand: 1) The test could just skip these tests if $ENV{HOME} isn't set 2) The test script set a temp dir for $ENV{HOME} if it isn't already set - to enable the test to complete in full, then cleanup after itself. 3) The registry.pm file should assume a default if $ENV{HOME} isn't set and can't be got at with getpwuid. (this is what my patch does, and works, but then it leaves the dir in c: which the user might not want cluttering up - especially if they doen't use the module and it was just created during the test) I would prefer either option 2, so that all tests can still be run, or 3) which assume a default $ENV{HOME} unless the user has specified something specific. Or some combination of 2 and 3; so that the test can create a tmp dir for the ini file and clean up the dir at the end to save clutter if the user never uses this module (and so doesn't have $ENV{HOME} set). Hope this clears things up a bit! Nathan > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: 22 October 2004 22:17 > To: bioperl-l@bioperl.org; nathanhaigh@ukonline.co.uk > Subject: FW: [Bioperl-l] make test!! > > Nathan, > > Registry.t shouldn't fail if there's no $HOME set since it uses > $OBDA_SEARCH_PATH, it sets OBDA_SEARCH_PATH for its own use, and it also > supplies its own *ini file. To prove this to myself I just unset HOME on my > machine and Registry.t still works (and $OBDA_SEARCH_PATH was unset as well, > I never use it). > > So, I understand your point but the absence of $HOME shouldn't be the > problem. Registry.pm is part of the OBDA system so the user is responsible > for either seeing that $HOME is set or setting $OBDA_SEARCH_PATH, either > will work (and in UNIX you could put the *ini file in /etc/bioinformatics). > Questions: did this change you made in your local Registry.pm fix > Registry.t? What are the errors using the Registry.t I sent you last night? > > So you have both modules and the Berkeley DB library? There's goes my latest > hypothesis! > > The problem here is that I'm just guessing when it comes to ActiveState, and > you can see that my guesses aren't always on target. What would be great is > if someone using ActiveState would sit down with the Perl debugger and step > through the code line by line so we'd know _exactly_ where the failures are. > Can someone help us here? If you're not familiar with the debugger this > would be a good opportunity to learn about it, it's a fantastic tool (and > absolutely required if you want to improve your coding skills). I'm not just > talking about Registry but about the other errors that Nathan is showing us. > > Brian O. > > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > Sent: Friday, October 22, 2004 3:30 AM > To: 'Brian Osborne'; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > I have the following versions installed: > DB_File 1.810 > BerkeleyDB 0.25 > And I'm pretty sure I have the library (I remember using a BTree quite a > while back). > > Having just had a look at Bio::DB::Registry, _load_registry refers to the > ENV variable HOME. Windows doesn't have such a variable by > default, so the user must either set it themselves, and failing this, > Bio::DB::Registry should assume a default e.g. C:/ > > Therefore I've changed this sub to read: > sub _load_registry { > my ($self) = @_; > my $home; > > if (defined $ENV{"HOME"}) { $home = $ENV{"HOME"} } # use this if it's > set > elsif ($^O eq 'MSWin32') { $home = 'C:/' } # def windows home > if $ENV{HOME} isn't set > else { $home = (getpwuid($>))[7] } > > my @ini_files = _get_ini_files($home); > > unless (@ini_files) { > > etc etc > > > I don't know if you still need to test for failure of getpwuid, since you > should never get to this stage on windows - I can't think > of a reason why the c: drive is inaccessible! > > Nathan > > > -----Original Message----- > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > Sent: 22 October 2004 01:22 > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Nathan, > > > > OK, thank you. Some of the messages you're seeing from Registry.t are > > warnings, not errors, but at any rate there are still errors. So am I > > correct in assuming that you have the modules DB_File and BerkeleyDB > > installed, as well as the Berkeley DB library? > > > > I can't do more with Index.t, as I said I was just guessing there. My > first > > instinct is still to suspect something is wrong with Fcntl, Storable, or > > DB_File, these are used by DB/FileCache and the problem with Index.t lies > > with DB/InMemoryCache or DB/FileCache, most likely the latter. Someone > using > > ActiveState Perl is going to have to address this one. > > > > Brian O. > > > > -----Original Message----- > > From: Nathan Haigh [mailto:nathanhaigh@ukonline.co.uk] > > Sent: Thursday, October 21, 2004 7:59 AM > > To: 'Brian Osborne'; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Ok, I've done some more testing (with the latest CVS 9am GMT) and here is > > what I've found! I've run "namke test" with and without > > BIOPERLDEBUG, and running individual tests using " perl -I. -w > > t/test_name.t". > > > > Attached are 3 files with details of errors: > > Errors.txt - summary and details of failed tests, and other > > tests with peculiar warnings etc > > Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set > > Perl_test.txt - individual tests run with BIOPERLDEBUG set, > using > > "perl -I. -w t/test_name.t" > > > > My System: > > WinXP Pro > > ActiveState Perl 5.8.0 > > Nmake 6.00.8168.0 > > > > My Summary: > > ESEfinder.t - causes perl to crash on test 2 during "nmake test", but > ok > > in other tests! > > Biblio_biofetch.t - throws warning and exception when using > > BIOPERLDEBUG, but doesn't appear in summary! > > Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 > > ProtPsm.t - needs "plan tests" in test file changing to 5. When > > running the individual test can't locate > > Bio::Matrix::PSM::ProtMatrix > > Registry.t - several error including "No seqdatabase.ini file found", > " > > No database with name testflat in Registry" > > Primaryqual.t - Test returned status 255. and 'Can't locate object > method > > "header"' in individual test > > seqread_fail.t - gives an exception, is this supposed to happen? > > > > Hope this help to iron out bugs when running BioPerl on Windows! > > Nathan > > > > > > > -----Original Message----- > > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > > Sent: 20 October 2004 19:04 > > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > > Subject: RE: [Bioperl-l] make test!! > > > > > > Nathan, > > > > > > I noticed most of the Registry tests failing. I know what part of the > > > problem is (getpwuid() not implemented in Windows/Activestate Perl) and > I > > > think I've fixed at least that part. Can you install the most recent > > > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > > > > > >perl -w -I. t/Registry.t > > > > > > > > > Brian O. > > > > > > -----Original Message----- > > > From: bioperl-l-bounces@portal.open-bio.org > > > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > > > Sent: Wednesday, October 20, 2004 10:20 AM > > > To: 'Bioperl' > > > Subject: RE: [Bioperl-l] make test!! > > > > > > Apologise for all the pervious messages! I just wanted to get this onto > > the > > > mailing list: > > > > > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > > > > > System: WinXP Pro > > > ActiveState Perl 5.8.0 build 804 > > > Nmake v6.00.8168.0 > > > > > > A note beforehand: > > > The error message I had previously got, and heard others have also > > received > > > on other OS's. That contain a "line too long" error when > > > trying "make test", is due to the limitations of the particular OS. > > Versions > > > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > > > have got round this problem by splitting long command lines from > Makefiles > > > into a series of smaller commands. > > > > > > Test Summary: > > > Failed Test Stat Wstat Total Fail Failed List of Failed > > > > -------------------------------------------------------------------------- > > -- > > > --- > > > t\Index.t 22 5632 41 21 51.22% 21-41 > > > t\Registry.t 22 5632 11 9 81.82% 3-11 > > > t\seqread_fail.t 255 65280 13 0 0.00% ?? > > > 115 subtests skipped. > > > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > > > okay. > > > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' > : > > > return code '0xff' > > > Stop. > > > > > > Particulars: > > > t\Index......................NOK 21Can't call method "length" on an > > > undefined value at t\Index.t line 124, line > > > 54. > > > t\Index......................dubious > > > Test returned status 22 (wstat 5632, 0x1600) > > > DIED. FAILED tests 21-41 > > > Failed 21/41 tests, 48.78% okay > > > t\Registry...................ok 2/11The getpwuid function is > unimplemented > > > at K:\Downloads\FlashGet\Software\Bioinform > > > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > > > t\Registry...................dubious > > > Test returned status 22 (wstat 5632, 0x1600) > > > t\seqread_fail...............ok 1/13 > > > ------------- EXCEPTION: Bio::Root::Exception ------------- > > > MSG: BioFetch Error 4: ID [XXX111] not found in database > > > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > > > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > > > STACK: Error::throw > > > STACK: Bio::Root::Root::throw > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b/Bio/Root/R > > > oot.pm:328 > > > STACK: Bio::DB::BioFetch::postprocess_data > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > > > ib/Bio/DB/BioFetch.pm:406 > > > STACK: Bio::DB::WebDBSeqI::get_seq_stream > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b/Bio/DB/WebDBSeqI.pm:525 > > > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > > > lib/Bio/DB/WebDBSeqI.pm:287 > > > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b > > > /Bio/DB/WebDBSeqI.pm:153 > > > STACK: main::fetch t\seqread_fail.t:69 > > > STACK: t\seqread_fail.t:81 > > > ----------------------------------------------------------- > > > t\seqread_fail...............dubious > > > Test returned status 255 (wstat 65280, 0xff00) > > > after all the subtests completed successfully > > > > > > > > > Nathan > > > > > > > -----Original Message----- > > > > From: bioperl-l-bounces@portal.open-bio.org > > > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. > > Mackey > > > > Sent: 14 October 2004 21:27 > > > > To: Bioperl > > > > Subject: [Bioperl-l] make test!! > > > > Importance: High > > > > > > > > > > > > I've had only a very few people send me feedback about the current > > > > state of bioperl-live "make test" on your favorite > > > > old/crotchety/obscure platforms. I'm writing the Change log and > > > > thinking about branching, but I'm an experimentalist, I need data! > > > > > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > > > you have everything, "make distclean" if you've built from the cvs > > > > checkout before, and start from scratch with the usual litany: perl > > > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > > > about, not so much all the verbiage (unless there's specific verbiage > > > > related to the end result ...) > > > > > > > > Thanks, > > > > > > > > -Aaron > > > > > > > > _______________________________________________ > > > > Bioperl-l mailing list > > > > Bioperl-l@portal.open-bio.org > > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > --- > > > > avast! Antivirus: Inbound message clean. > > > > Virus Database (VPS): 0442-2, 14/10/2004 > > > > Tested on: 14/10/2004 21:59:20 > > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > > http://www.avast.com > > > > > > > > > > > > > > --- > > > avast! Antivirus: Outbound message clean. > > > Virus Database (VPS): 0442-3, 15/10/2004 > > > Tested on: 20/10/2004 15:20:04 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > > > > > > > > > _______________________________________________ > > > Bioperl-l mailing list > > > Bioperl-l@portal.open-bio.org > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > > > > > > --- > > > avast! Antivirus: Inbound message clean. > > > Virus Database (VPS): 0442-3, 15/10/2004 > > > Tested on: 21/10/2004 07:12:10 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > --- > > avast! Antivirus: Outbound message clean. > > Virus Database (VPS): 0443-1, 20/10/2004 > > Tested on: 21/10/2004 12:58:59 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > > > > > > > > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0443-2, 21/10/2004 > > Tested on: 22/10/2004 06:20:06 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0443-2, 21/10/2004 > Tested on: 22/10/2004 08:29:49 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0443-3, 22/10/2004 > Tested on: 23/10/2004 21:18:10 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0443-3, 22/10/2004 Tested on: 24/10/2004 09:36:56 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From brian_osborne at cognia.com Sun Oct 24 11:48:17 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Sun Oct 24 11:47:25 2004 Subject: [Bioperl-l] make test!! In-Reply-To: Message-ID: Nathan, >2) So _get_ini_files() doesn't get called. You're right, that makes no sense, let's change that. _get_ini_files should be called regardless of whether there's a HOME or not. BIO -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh Sent: Sunday, October 24, 2004 4:42 AM To: 'Brian Osborne'; bioperl-l@bioperl.org Subject: RE: [Bioperl-l] make test!! Ok, here goes (with your test file, and without my patch)! So what you are saying I that $ENV{HOME} should be set by the user? But shouldn't this default to something in order for the test to work? If this isn't set in windows the test fails as follows: 1) In Registry.pm $home doesn't get set on window because by default there is not $ENV{"HOME"} (unless set by the user!) and getpwuid isn't implemented in ActiveState Perl for windows. 2) So _get_ini_files() doesn't get called. 3) try to retrieve ini file from web (successful) 4) try to store the ini file in $home.bioinformatics (not successful) a) the path $home/.bioinformatics is not a valid windows path ($home is not set so this becomes just /.bioinformatics) b) for some reason ActiveState perl doesn't see anything wrong with it when trying to create the dir, but when it tries to open it, perl dies with a 'permission denied' error. But no sign of the dir on my filesystem! I suppose it depends how you want to catch this. There are 3 options as far as I see If the env variable HOME should be set beforehand: 1) The test could just skip these tests if $ENV{HOME} isn't set 2) The test script set a temp dir for $ENV{HOME} if it isn't already set - to enable the test to complete in full, then cleanup after itself. 3) The registry.pm file should assume a default if $ENV{HOME} isn't set and can't be got at with getpwuid. (this is what my patch does, and works, but then it leaves the dir in c: which the user might not want cluttering up - especially if they doen't use the module and it was just created during the test) I would prefer either option 2, so that all tests can still be run, or 3) which assume a default $ENV{HOME} unless the user has specified something specific. Or some combination of 2 and 3; so that the test can create a tmp dir for the ini file and clean up the dir at the end to save clutter if the user never uses this module (and so doesn't have $ENV{HOME} set). Hope this clears things up a bit! Nathan > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: 22 October 2004 22:17 > To: bioperl-l@bioperl.org; nathanhaigh@ukonline.co.uk > Subject: FW: [Bioperl-l] make test!! > > Nathan, > > Registry.t shouldn't fail if there's no $HOME set since it uses > $OBDA_SEARCH_PATH, it sets OBDA_SEARCH_PATH for its own use, and it also > supplies its own *ini file. To prove this to myself I just unset HOME on my > machine and Registry.t still works (and $OBDA_SEARCH_PATH was unset as well, > I never use it). > > So, I understand your point but the absence of $HOME shouldn't be the > problem. Registry.pm is part of the OBDA system so the user is responsible > for either seeing that $HOME is set or setting $OBDA_SEARCH_PATH, either > will work (and in UNIX you could put the *ini file in /etc/bioinformatics). > Questions: did this change you made in your local Registry.pm fix > Registry.t? What are the errors using the Registry.t I sent you last night? > > So you have both modules and the Berkeley DB library? There's goes my latest > hypothesis! > > The problem here is that I'm just guessing when it comes to ActiveState, and > you can see that my guesses aren't always on target. What would be great is > if someone using ActiveState would sit down with the Perl debugger and step > through the code line by line so we'd know _exactly_ where the failures are. > Can someone help us here? If you're not familiar with the debugger this > would be a good opportunity to learn about it, it's a fantastic tool (and > absolutely required if you want to improve your coding skills). I'm not just > talking about Registry but about the other errors that Nathan is showing us. > > Brian O. > > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > Sent: Friday, October 22, 2004 3:30 AM > To: 'Brian Osborne'; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > I have the following versions installed: > DB_File 1.810 > BerkeleyDB 0.25 > And I'm pretty sure I have the library (I remember using a BTree quite a > while back). > > Having just had a look at Bio::DB::Registry, _load_registry refers to the > ENV variable HOME. Windows doesn't have such a variable by > default, so the user must either set it themselves, and failing this, > Bio::DB::Registry should assume a default e.g. C:/ > > Therefore I've changed this sub to read: > sub _load_registry { > my ($self) = @_; > my $home; > > if (defined $ENV{"HOME"}) { $home = $ENV{"HOME"} } # use this if it's > set > elsif ($^O eq 'MSWin32') { $home = 'C:/' } # def windows home > if $ENV{HOME} isn't set > else { $home = (getpwuid($>))[7] } > > my @ini_files = _get_ini_files($home); > > unless (@ini_files) { > > etc etc > > > I don't know if you still need to test for failure of getpwuid, since you > should never get to this stage on windows - I can't think > of a reason why the c: drive is inaccessible! > > Nathan > > > -----Original Message----- > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > Sent: 22 October 2004 01:22 > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Nathan, > > > > OK, thank you. Some of the messages you're seeing from Registry.t are > > warnings, not errors, but at any rate there are still errors. So am I > > correct in assuming that you have the modules DB_File and BerkeleyDB > > installed, as well as the Berkeley DB library? > > > > I can't do more with Index.t, as I said I was just guessing there. My > first > > instinct is still to suspect something is wrong with Fcntl, Storable, or > > DB_File, these are used by DB/FileCache and the problem with Index.t lies > > with DB/InMemoryCache or DB/FileCache, most likely the latter. Someone > using > > ActiveState Perl is going to have to address this one. > > > > Brian O. > > > > -----Original Message----- > > From: Nathan Haigh [mailto:nathanhaigh@ukonline.co.uk] > > Sent: Thursday, October 21, 2004 7:59 AM > > To: 'Brian Osborne'; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Ok, I've done some more testing (with the latest CVS 9am GMT) and here is > > what I've found! I've run "namke test" with and without > > BIOPERLDEBUG, and running individual tests using " perl -I. -w > > t/test_name.t". > > > > Attached are 3 files with details of errors: > > Errors.txt - summary and details of failed tests, and other > > tests with peculiar warnings etc > > Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set > > Perl_test.txt - individual tests run with BIOPERLDEBUG set, > using > > "perl -I. -w t/test_name.t" > > > > My System: > > WinXP Pro > > ActiveState Perl 5.8.0 > > Nmake 6.00.8168.0 > > > > My Summary: > > ESEfinder.t - causes perl to crash on test 2 during "nmake test", but > ok > > in other tests! > > Biblio_biofetch.t - throws warning and exception when using > > BIOPERLDEBUG, but doesn't appear in summary! > > Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 > > ProtPsm.t - needs "plan tests" in test file changing to 5. When > > running the individual test can't locate > > Bio::Matrix::PSM::ProtMatrix > > Registry.t - several error including "No seqdatabase.ini file found", > " > > No database with name testflat in Registry" > > Primaryqual.t - Test returned status 255. and 'Can't locate object > method > > "header"' in individual test > > seqread_fail.t - gives an exception, is this supposed to happen? > > > > Hope this help to iron out bugs when running BioPerl on Windows! > > Nathan > > > > > > > -----Original Message----- > > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > > Sent: 20 October 2004 19:04 > > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > > Subject: RE: [Bioperl-l] make test!! > > > > > > Nathan, > > > > > > I noticed most of the Registry tests failing. I know what part of the > > > problem is (getpwuid() not implemented in Windows/Activestate Perl) and > I > > > think I've fixed at least that part. Can you install the most recent > > > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > > > > > >perl -w -I. t/Registry.t > > > > > > > > > Brian O. > > > > > > -----Original Message----- > > > From: bioperl-l-bounces@portal.open-bio.org > > > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > > > Sent: Wednesday, October 20, 2004 10:20 AM > > > To: 'Bioperl' > > > Subject: RE: [Bioperl-l] make test!! > > > > > > Apologise for all the pervious messages! I just wanted to get this onto > > the > > > mailing list: > > > > > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > > > > > System: WinXP Pro > > > ActiveState Perl 5.8.0 build 804 > > > Nmake v6.00.8168.0 > > > > > > A note beforehand: > > > The error message I had previously got, and heard others have also > > received > > > on other OS's. That contain a "line too long" error when > > > trying "make test", is due to the limitations of the particular OS. > > Versions > > > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > > > have got round this problem by splitting long command lines from > Makefiles > > > into a series of smaller commands. > > > > > > Test Summary: > > > Failed Test Stat Wstat Total Fail Failed List of Failed > > > > -------------------------------------------------------------------------- > > -- > > > --- > > > t\Index.t 22 5632 41 21 51.22% 21-41 > > > t\Registry.t 22 5632 11 9 81.82% 3-11 > > > t\seqread_fail.t 255 65280 13 0 0.00% ?? > > > 115 subtests skipped. > > > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > > > okay. > > > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' > : > > > return code '0xff' > > > Stop. > > > > > > Particulars: > > > t\Index......................NOK 21Can't call method "length" on an > > > undefined value at t\Index.t line 124, line > > > 54. > > > t\Index......................dubious > > > Test returned status 22 (wstat 5632, 0x1600) > > > DIED. FAILED tests 21-41 > > > Failed 21/41 tests, 48.78% okay > > > t\Registry...................ok 2/11The getpwuid function is > unimplemented > > > at K:\Downloads\FlashGet\Software\Bioinform > > > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > > > t\Registry...................dubious > > > Test returned status 22 (wstat 5632, 0x1600) > > > t\seqread_fail...............ok 1/13 > > > ------------- EXCEPTION: Bio::Root::Exception ------------- > > > MSG: BioFetch Error 4: ID [XXX111] not found in database > > > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > > > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > > > STACK: Error::throw > > > STACK: Bio::Root::Root::throw > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b/Bio/Root/R > > > oot.pm:328 > > > STACK: Bio::DB::BioFetch::postprocess_data > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > > > ib/Bio/DB/BioFetch.pm:406 > > > STACK: Bio::DB::WebDBSeqI::get_seq_stream > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b/Bio/DB/WebDBSeqI.pm:525 > > > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > > > lib/Bio/DB/WebDBSeqI.pm:287 > > > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b > > > /Bio/DB/WebDBSeqI.pm:153 > > > STACK: main::fetch t\seqread_fail.t:69 > > > STACK: t\seqread_fail.t:81 > > > ----------------------------------------------------------- > > > t\seqread_fail...............dubious > > > Test returned status 255 (wstat 65280, 0xff00) > > > after all the subtests completed successfully > > > > > > > > > Nathan > > > > > > > -----Original Message----- > > > > From: bioperl-l-bounces@portal.open-bio.org > > > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. > > Mackey > > > > Sent: 14 October 2004 21:27 > > > > To: Bioperl > > > > Subject: [Bioperl-l] make test!! > > > > Importance: High > > > > > > > > > > > > I've had only a very few people send me feedback about the current > > > > state of bioperl-live "make test" on your favorite > > > > old/crotchety/obscure platforms. I'm writing the Change log and > > > > thinking about branching, but I'm an experimentalist, I need data! > > > > > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > > > you have everything, "make distclean" if you've built from the cvs > > > > checkout before, and start from scratch with the usual litany: perl > > > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > > > about, not so much all the verbiage (unless there's specific verbiage > > > > related to the end result ...) > > > > > > > > Thanks, > > > > > > > > -Aaron > > > > > > > > _______________________________________________ > > > > Bioperl-l mailing list > > > > Bioperl-l@portal.open-bio.org > > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > --- > > > > avast! Antivirus: Inbound message clean. > > > > Virus Database (VPS): 0442-2, 14/10/2004 > > > > Tested on: 14/10/2004 21:59:20 > > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > > http://www.avast.com > > > > > > > > > > > > > > --- > > > avast! Antivirus: Outbound message clean. > > > Virus Database (VPS): 0442-3, 15/10/2004 > > > Tested on: 20/10/2004 15:20:04 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > > > > > > > > > _______________________________________________ > > > Bioperl-l mailing list > > > Bioperl-l@portal.open-bio.org > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > > > > > > --- > > > avast! Antivirus: Inbound message clean. > > > Virus Database (VPS): 0442-3, 15/10/2004 > > > Tested on: 21/10/2004 07:12:10 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > --- > > avast! Antivirus: Outbound message clean. > > Virus Database (VPS): 0443-1, 20/10/2004 > > Tested on: 21/10/2004 12:58:59 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > > > > > > > > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0443-2, 21/10/2004 > > Tested on: 22/10/2004 06:20:06 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0443-2, 21/10/2004 > Tested on: 22/10/2004 08:29:49 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0443-3, 22/10/2004 > Tested on: 23/10/2004 21:18:10 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0443-3, 22/10/2004 Tested on: 24/10/2004 09:36:56 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l From brian_osborne at cognia.com Sun Oct 24 17:16:56 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Sun Oct 24 17:16:03 2004 Subject: [Bioperl-l] comparing data between hashes In-Reply-To: <865D5CD2-2563-11D9-A61F-000A956C4C82@mac.com> Message-ID: Michael, Perhaps instead of appending to a string ($class{$position} .= "$pos" . " ,") you could make each position a secondary key: $class{$position}{$pos} = 1; Then comparing 2 species is a matter of looping over the secondary keys and asking if a given key is defined in both species. Brian O. -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Michael S. Robeson II Sent: Saturday, October 23, 2004 10:22 PM To: bioperl-l@portal.open-bio.org Subject: [Bioperl-l] comparing data between hashes I have a several "hash of a hashes" that look like this (sorry if my formating is a little off): Human => { # HoH for human 1 => [1,32,54,67] # numbers in [ ] is a string delimited by commas not separate hash values 2 => [14,52,74,87] 5 => [33,44,64,107] } Chimp => { # HoH for Chimp 1 => [1,32,67] 2 => [14,74,87] 5 => [33,44] } Note: The numbers in between the [ ] is a STRING delimited by commas and NOT separate hash values. I already have a working script that appends these numbers to the appropriate hash separated by a comma or newline like this: $class{$position} .= "$pos" . " ,"; #to get: 5 => [33,44,64,107] And I am having trouble trying to compare data. I want to compare each number (i.e. 1, 2, & 5) and its data with e the same number in the other species. For example, I would like to print out a table (see below) that compares the data between the group "1" in each species. Alleles for set: 1 Allele: 1 32 54 67 Human 1 1 1 1 # 1 = present Chimp 1 1 0 1 # 0 = absent And so on for 2 and 5. I can most likely do the print formating for the table myself so I do not need help with that. I just need help with being able to compare the data within each Hash of a Hash (HoH). I do not know if I should read this data into yet another Hash (which would be very busy) or an array somehow? I have been trying to figure this out all week to no avail. Any ideas or suggestions? - Thanks - Mike _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l From popgen23 at mac.com Sun Oct 24 23:07:59 2004 From: popgen23 at mac.com (Michael Robeson) Date: Sun Oct 24 23:08:03 2004 Subject: [Bioperl-l] comparing data between hashes In-Reply-To: References: Message-ID: <1328EDCC-2633-11D9-8E3E-000393539070@mac.com> On Oct 24, 2004, at 3:16 PM, Brian Osborne wrote: > Michael, > > Perhaps instead of appending to a string ($class{$position} .= "$pos" > . " > ,") you could make each position a secondary key: > > $class{$position}{$pos} = 1; I am not sure I could with the way it's posted above because were you have a '1' would be a variable. So, I would have to rewrite my code to make another variable some how. This is why I did: $class{$position} .= "$pos" . " ,"; So, what would I enter in the place of a '1' if my $pos (a value) now becomes a key, as you've got posted above? > > Then comparing 2 species is a matter of looping over the secondary > keys and > asking if a given key is defined in both species. > > > Brian O. I guess I'll keep thinking about it. :-) -Mike From popgen23 at mac.com Mon Oct 25 00:15:41 2004 From: popgen23 at mac.com (Michael S. Robeson II) Date: Mon Oct 25 00:14:31 2004 Subject: [Bioperl-l] comparing data between hashes In-Reply-To: References: Message-ID: <8873ECE0-263C-11D9-82E1-000A956C4C82@mac.com> I guess then the next question is how do I dynamically add multiple values to a single key? -Mike On Oct 24, 2004, at 15:16, Brian Osborne wrote: > Michael, > > Perhaps instead of appending to a string ($class{$position} .= "$pos" > . " > ,") you could make each position a secondary key: > > $class{$position}{$pos} = 1; > > Then comparing 2 species is a matter of looping over the secondary > keys and > asking if a given key is defined in both species. > > > Brian O. > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Michael S. > Robeson II > Sent: Saturday, October 23, 2004 10:22 PM > To: bioperl-l@portal.open-bio.org > Subject: [Bioperl-l] comparing data between hashes > > I have a several "hash of a hashes" that look like this (sorry if my > formating is a little off): > > Human => { # HoH for human > 1 => [1,32,54,67] # numbers in [ ] is a string delimited > by > commas > not separate hash values > 2 => [14,52,74,87] > 5 => [33,44,64,107] > } > Chimp => { # HoH for Chimp > 1 => [1,32,67] > 2 => [14,74,87] > 5 => [33,44] > } > > Note: The numbers in between the [ ] is a STRING delimited by commas > and NOT separate hash values. I already have a working script that > appends these numbers to the appropriate hash separated by a comma or > newline like this: > $class{$position} .= "$pos" . " ,"; #to > get: 5 > => [33,44,64,107] > > And I am having trouble trying to compare data. I want to compare each > number (i.e. 1, 2, & 5) and its data with e the same number in the > other species. For example, I would like to print out a table (see > below) that compares the data between the group "1" in each species. > > Alleles for set: 1 > Allele: 1 32 54 67 > Human 1 1 1 1 # 1 = present > Chimp 1 1 0 1 # 0 = absent > > And so on for 2 and 5. > > I can most likely do the print formating for the table myself so I do > not need help with that. I just need help with being able to compare > the data within each Hash of a Hash (HoH). I do not know if I should > read this data into yet another Hash (which would be very busy) or an > array somehow? I have been trying to figure this out all week to no > avail. > > Any ideas or suggestions? > > - Thanks > - Mike > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > From nathanhaigh at ukonline.co.uk Mon Oct 25 03:06:55 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Mon Oct 25 03:06:11 2004 Subject: [Bioperl-l] make test!! In-Reply-To: Message-ID: <000901c4ba61$36d3a2d0$42f2cdd9@Desktop> Success!!!! These files seem to do the trick, what did you change - I overwrote the original .t and .pm files? However, (and I don't use this module, so don't know how likely this is to happen) the only time I can see something failing, is when using the module for real, the ini file might not be found by _get_ini_files because $home not being set on windows messes things up in that sub. I assume this could happen on Unix because there is a fall back to retrieve the ini file from the web. This would fail on windows due to the absence of $home and trying to create and open the ini file from $home/.bioinformatics (which would become just /.bioinformatics on windows - not a valid windows path). FYI: Windows natively uses backslashes ( \ ) as dir delimiters, however in my experience using forward slashes ( / ) in perl has no adverse effect, and saves time escaping the backslashes. The only problems I usually encounter in making Unix/windows compatible scripts are: 1) When paths contain spaces 2) When the complete path is used on Unix (from root) as /blah_blah is not valid on windows you need to start with './' 'or ../' or :/ It's actually surprisingly compatible with windows. 3) When sripts use /dev/null as this isn't compatible with windows Thanks for your help! Nathan > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: 24 October 2004 22:41 > To: nathanhaigh@ukonline.co.uk > Subject: RE: [Bioperl-l] make test!! > > Nathan, > > Let's try again! Please use the attached Registry.pm and Registry.t, same > test (minor change in Registry.pm, based on our discussion). If this doesn't > work then we probably have a "/" versus "\" problem. > > BIO > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > Sent: Saturday, October 23, 2004 4:23 PM > To: 'Brian Osborne'; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > I get the following error: > > > perl -w -I. t\Registry.t > 1..12 > ok 1 > ok 2 > ok 3 > This Perl doesn't implement function getpwuid(). Skipping... > > -------------------- WARNING --------------------- > MSG: No seqdatabase.ini file found in ~/.bioinformatics/ > nor in /etc/bioinformatics/ nor in directory specified by > t/data/registry/flat;t/data/registry/bdb. Using web to get database registry > from > http://www.open-bio.org/registry/seqdatabase.ini > --------------------------------------------------- > > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: can't connect: IO::Socket::INET: Bad hostname 'www.open-bio.org' > STACK: Error::throw > STACK: Bio::Root::Root::throw Bio/Root/Root.pm:328 > STACK: Bio::Root::HTTPget::getFH Bio/Root/HTTPget.pm:207 > STACK: Bio::DB::Registry::_load_registry Bio/DB/Registry.pm:128 > STACK: Bio::DB::Registry::new Bio/DB/Registry.pm:97 > STACK: t\Registry.t:57 > ----------------------------------------------------------- > > Nathan > > > -----Original Message----- > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > Sent: 22 October 2004 22:12 > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Nathan, > > > > Please replace your t/Registry.t with the attached Registry.t file and > tell > > me what happens after: > > > > >perl -w -I. t/Registry.t > > > > Brian O. > > > > -----Original Message----- > > From: Nathan Haigh [mailto:nathanhaigh@ukonline.co.uk] > > Sent: Thursday, October 21, 2004 7:59 AM > > To: 'Brian Osborne'; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Ok, I've done some more testing (with the latest CVS 9am GMT) and here is > > what I've found! I've run "namke test" with and without > > BIOPERLDEBUG, and running individual tests using " perl -I. -w > > t/test_name.t". > > > > Attached are 3 files with details of errors: > > Errors.txt - summary and details of failed tests, and other > > tests with peculiar warnings etc > > Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set > > Perl_test.txt - individual tests run with BIOPERLDEBUG set, > using > > "perl -I. -w t/test_name.t" > > > > My System: > > WinXP Pro > > ActiveState Perl 5.8.0 > > Nmake 6.00.8168.0 > > > > My Summary: > > ESEfinder.t - causes perl to crash on test 2 during "nmake test", but > ok > > in other tests! > > Biblio_biofetch.t - throws warning and exception when using > > BIOPERLDEBUG, but doesn't appear in summary! > > Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 > > ProtPsm.t - needs "plan tests" in test file changing to 5. When > > running the individual test can't locate > > Bio::Matrix::PSM::ProtMatrix > > Registry.t - several error including "No seqdatabase.ini file found", > " > > No database with name testflat in Registry" > > Primaryqual.t - Test returned status 255. and 'Can't locate object > method > > "header"' in individual test > > seqread_fail.t - gives an exception, is this supposed to happen? > > > > Hope this help to iron out bugs when running BioPerl on Windows! > > Nathan > > > > > > > -----Original Message----- > > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > > Sent: 20 October 2004 19:04 > > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > > Subject: RE: [Bioperl-l] make test!! > > > > > > Nathan, > > > > > > I noticed most of the Registry tests failing. I know what part of the > > > problem is (getpwuid() not implemented in Windows/Activestate Perl) and > I > > > think I've fixed at least that part. Can you install the most recent > > > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > > > > > >perl -w -I. t/Registry.t > > > > > > > > > Brian O. > > > > > > -----Original Message----- > > > From: bioperl-l-bounces@portal.open-bio.org > > > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > > > Sent: Wednesday, October 20, 2004 10:20 AM > > > To: 'Bioperl' > > > Subject: RE: [Bioperl-l] make test!! > > > > > > Apologise for all the pervious messages! I just wanted to get this onto > > the > > > mailing list: > > > > > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > > > > > System: WinXP Pro > > > ActiveState Perl 5.8.0 build 804 > > > Nmake v6.00.8168.0 > > > > > > A note beforehand: > > > The error message I had previously got, and heard others have also > > received > > > on other OS's. That contain a "line too long" error when > > > trying "make test", is due to the limitations of the particular OS. > > Versions > > > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > > > have got round this problem by splitting long command lines from > Makefiles > > > into a series of smaller commands. > > > > > > Test Summary: > > > Failed Test Stat Wstat Total Fail Failed List of Failed > > > > -------------------------------------------------------------------------- > > -- > > > --- > > > t\Index.t 22 5632 41 21 51.22% 21-41 > > > t\Registry.t 22 5632 11 9 81.82% 3-11 > > > t\seqread_fail.t 255 65280 13 0 0.00% ?? > > > 115 subtests skipped. > > > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > > > okay. > > > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' > : > > > return code '0xff' > > > Stop. > > > > > > Particulars: > > > t\Index......................NOK 21Can't call method "length" on an > > > undefined value at t\Index.t line 124, line > > > 54. > > > t\Index......................dubious > > > Test returned status 22 (wstat 5632, 0x1600) > > > DIED. FAILED tests 21-41 > > > Failed 21/41 tests, 48.78% okay > > > t\Registry...................ok 2/11The getpwuid function is > unimplemented > > > at K:\Downloads\FlashGet\Software\Bioinform > > > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > > > t\Registry...................dubious > > > Test returned status 22 (wstat 5632, 0x1600) > > > t\seqread_fail...............ok 1/13 > > > ------------- EXCEPTION: Bio::Root::Exception ------------- > > > MSG: BioFetch Error 4: ID [XXX111] not found in database > > > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > > > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > > > STACK: Error::throw > > > STACK: Bio::Root::Root::throw > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b/Bio/Root/R > > > oot.pm:328 > > > STACK: Bio::DB::BioFetch::postprocess_data > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > > > ib/Bio/DB/BioFetch.pm:406 > > > STACK: Bio::DB::WebDBSeqI::get_seq_stream > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b/Bio/DB/WebDBSeqI.pm:525 > > > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > > > lib/Bio/DB/WebDBSeqI.pm:287 > > > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b > > > /Bio/DB/WebDBSeqI.pm:153 > > > STACK: main::fetch t\seqread_fail.t:69 > > > STACK: t\seqread_fail.t:81 > > > ----------------------------------------------------------- > > > t\seqread_fail...............dubious > > > Test returned status 255 (wstat 65280, 0xff00) > > > after all the subtests completed successfully > > > > > > > > > Nathan > > > > > > > -----Original Message----- > > > > From: bioperl-l-bounces@portal.open-bio.org > > > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. > > Mackey > > > > Sent: 14 October 2004 21:27 > > > > To: Bioperl > > > > Subject: [Bioperl-l] make test!! > > > > Importance: High > > > > > > > > > > > > I've had only a very few people send me feedback about the current > > > > state of bioperl-live "make test" on your favorite > > > > old/crotchety/obscure platforms. I'm writing the Change log and > > > > thinking about branching, but I'm an experimentalist, I need data! > > > > > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > > > you have everything, "make distclean" if you've built from the cvs > > > > checkout before, and start from scratch with the usual litany: perl > > > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > > > about, not so much all the verbiage (unless there's specific verbiage > > > > related to the end result ...) > > > > > > > > Thanks, > > > > > > > > -Aaron > > > > > > > > _______________________________________________ > > > > Bioperl-l mailing list > > > > Bioperl-l@portal.open-bio.org > > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > --- > > > > avast! Antivirus: Inbound message clean. > > > > Virus Database (VPS): 0442-2, 14/10/2004 > > > > Tested on: 14/10/2004 21:59:20 > > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > > http://www.avast.com > > > > > > > > > > > > > > --- > > > avast! Antivirus: Outbound message clean. > > > Virus Database (VPS): 0442-3, 15/10/2004 > > > Tested on: 20/10/2004 15:20:04 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > > > > > > > > > _______________________________________________ > > > Bioperl-l mailing list > > > Bioperl-l@portal.open-bio.org > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > > > > > > --- > > > avast! Antivirus: Inbound message clean. > > > Virus Database (VPS): 0442-3, 15/10/2004 > > > Tested on: 21/10/2004 07:12:10 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > --- > > avast! Antivirus: Outbound message clean. > > Virus Database (VPS): 0443-1, 20/10/2004 > > Tested on: 21/10/2004 12:58:59 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > > > > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0443-3, 22/10/2004 > > Tested on: 23/10/2004 21:17:55 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0443-3, 22/10/2004 > Tested on: 23/10/2004 21:22:10 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l From pvh at egenetics.com Mon Oct 25 07:40:16 2004 From: pvh at egenetics.com (Peter van Heusden) Date: Mon Oct 25 07:39:00 2004 Subject: [Bioperl-l] Bio::Tools::SimpleAnalysisBase triggers Data::Dumper core dump on FreeBSD 4 Message-ID: <417CE620.9010708@egenetics.com> The run() method in Bio::Tools::SimpleAnalysisBase triggers a core dump in perl 5.8.5 on FreeBSD 4-STABLE. The core dump is coming from the usage of Data::Dumper's Dump method. Here's what run() looks like: sub run { my ($self, $args) = @_; $self->_process_arguments ($args) if $args; # check input $self->throw("Need a sequence object as an input") unless $self->seq; $self->debug(Data::Dumper->Dump([$self],[$self])); # internal run() $self->_run; return $self; } The ->debug line is where the core dump happens, in the Dump() method. I'm investigating further, since this presumably isn't Bioperl's fault, but thought I should should just report this for now. I found this while testing the t/Sopma.t test with BIOPERLDEBUG on. Peter P.S. the coredump goes away when I set Data::Dumper::Useperl to 1. From grossman at molgen.mpg.de Mon Oct 25 08:17:34 2004 From: grossman at molgen.mpg.de (Steffen Grossmann) Date: Mon Oct 25 08:16:43 2004 Subject: [Bioperl-l] Bug in Bio::FeatureIO::gff Message-ID: <417CEEDE.5010709@molgen.mpg.de> Dear all, there is a small problem in Bio::FeatureIO::gff, which prevents it from writing out gff3 lines previously read in by itself. The reason is that the 'source' annotation is treated differently in reading/writing. When reading in gff3 lines, the second column (the 'source') is stored via the Bio::SeqFeature::Annotated::source method. However, Bio::FeatureIO::gff::_write_feature_3 tries to retrieve it from the annotation via ($feature->annotation('source'))[0]->value which is then not present... I attached an example gff3 (example1.gff) file and an example script (Bio_FeatureIO_test.pl) which together show the problem. I also attached a patch (gff_patch.diff) for the bug which I also can check in directly as soon as I get an OK and a developer account... Steffen example1.gff ---8<---8<---8<---8<---8<---8<---8<---8<---cut here ##gff-version 3 ctg123 . gene 1000 9000 . + . ID=gene00001;Name=EDEN ctg123 scan TF_binding_site 1000 1012 . + . ID=tfbs00001;Parent=gene00001 ---8<---8<---8<---8<---8<---8<---8<---8<---cut here Bio_FeatureIO_test.pl ---8<---8<---8<---8<---8<---8<---8<---8<---cut here #!/bin/perl # use lib '/home/grossman/bioperl/bioperl-live'; # or whatever use strict; use Bio::FeatureIO; # Reading in a gff file, collect read in features in an array my $infile = 'example1.gff'; my $gff_in = Bio::FeatureIO->new(-file => $infile, -format => 'GFF', -version => 3); my @features; my $feature; while($feature = $gff_in->next_feature()) { push(@features, $feature); } # Writing out again my $outfile = 'example1_out.gff'; my $gff_out = Bio::FeatureIO->new(-file => ">$outfile", -format => 'GFF', -version => 3); foreach $feature (@features) { $gff_out->write_feature($feature); } ---8<---8<---8<---8<---8<---8<---8<---8<---cut here gff_patch.diff ---8<---8<---8<---8<---8<---8<---8<---8<---cut here *** bioperl-live/Bio/FeatureIO/gff.pm Mon Oct 25 11:08:18 2004 --- modified_bioperl-live/Bio/FeatureIO/gff.pm Mon Oct 25 13:06:38 2004 *************** *** 134,140 **** } my $seq = $feature->seq_id || '.'; ! my $source = ($feature->annotation->get_Annotations('source'))[0]->value; my $type = ($feature->annotation->get_Annotations('feature_type'))[0]->name; $type = 'EXON' if $type eq 'exon'; #a GTF peculiarity, incosistent with the sequence ontology. my $min = $feature->start || '.'; --- 134,145 ---- } my $seq = $feature->seq_id || '.'; ! my $source; ! if (my ($sa) = $feature->annotation->get_Annotations('source')) { ! $source = $sa->value; ! } else { ! $source = '.'; ! } my $type = ($feature->annotation->get_Annotations('feature_type'))[0]->name; $type = 'EXON' if $type eq 'exon'; #a GTF peculiarity, incosistent with the sequence ontology. my $min = $feature->start || '.'; *************** *** 160,167 **** sub _write_feature_3 { my($self,$feature) = @_; ! my $seq = $feature->seq_id || '.'; ! my $source = ($feature->annotation->get_Annotations('source'))[0]->value; my $type = ($feature->annotation->get_Annotations('feature_type'))[0]->name; my $min = $feature->start || '.'; my $max = $feature->end || '.'; --- 165,177 ---- sub _write_feature_3 { my($self,$feature) = @_; ! my $seq = $feature->seq_id || 'SEQ'; ! my $source; ! if (my ($sa) = $feature->annotation->get_Annotations('source')) { ! $source = $sa->value; ! } else { ! $source = '.'; ! } my $type = ($feature->annotation->get_Annotations('feature_type'))[0]->name; my $min = $feature->start || '.'; my $max = $feature->end || '.'; *************** *** 273,279 **** my($seq,$source,$type,$start,$end,$score,$strand,$phase,$attribute_string) = split /\t/, $feature_string; $feat->seq_id( uri_unescape($seq) ); ! $feat->source( uri_unescape($source) ); $feat->start($start) unless $start eq '.'; $feat->end($end) unless $end eq '.'; $feat->strand($strand eq '+' ? 1 : $strand eq '-' ? -1 : 0); --- 283,291 ---- my($seq,$source,$type,$start,$end,$score,$strand,$phase,$attribute_string) = split /\t/, $feature_string; $feat->seq_id( uri_unescape($seq) ); ! $ac->add_Annotation(Bio::Annotation::SimpleValue->new(-value => uri_unescape($source), ! -tagname => 'source') ! ) unless $source eq '.'; $feat->start($start) unless $start eq '.'; $feat->end($end) unless $end eq '.'; $feat->strand($strand eq '+' ? 1 : $strand eq '-' ? -1 : 0); *************** *** 297,302 **** --- 309,315 ---- $fta->term($feature_type); my %attr = (); + chomp $attribute_string; my @attributes = split ';', $attribute_string; foreach my $attribute (@attributes){ my($key,$values) = split '=', $attribute; ---8<---8<---8<---8<---8<---8<---8<---8<---cut here -- %---------------------------------------------% % Steffen Grossmann % % % % Max Planck Institute for Molecular Genetics % % Computational Molecular Biology % %---------------------------------------------% % Ihnestrasse 73 % % 14195 Berlin % % Germany % %---------------------------------------------% % Tel: (++49 +30) 8413-1167 % % Fax: (++49 +30) 8413-1152 % %---------------------------------------------% From brian_osborne at cognia.com Mon Oct 25 09:41:32 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Mon Oct 25 09:41:07 2004 Subject: [Bioperl-l] make test!! In-Reply-To: <000901c4ba61$36d3a2d0$42f2cdd9@Desktop> Message-ID: Nathan, I just followed up on your observation that _get_ini_files wasn't being called since $home didn't exist. The script shouldn't have been relying on $home being defined. You're right about the fallback situation, Web retrieval, also being doomed to failure on Win, I'll look into that as well but for the moment we're OK. Thanks for your help and your observations, Brian O. -----Original Message----- From: Nathan Haigh [mailto:nathanhaigh@ukonline.co.uk] Sent: Monday, October 25, 2004 3:07 AM To: 'Brian Osborne'; bioperl-l@bioperl.org Subject: RE: [Bioperl-l] make test!! Success!!!! These files seem to do the trick, what did you change - I overwrote the original .t and .pm files? However, (and I don't use this module, so don't know how likely this is to happen) the only time I can see something failing, is when using the module for real, the ini file might not be found by _get_ini_files because $home not being set on windows messes things up in that sub. I assume this could happen on Unix because there is a fall back to retrieve the ini file from the web. This would fail on windows due to the absence of $home and trying to create and open the ini file from $home/.bioinformatics (which would become just /.bioinformatics on windows - not a valid windows path). FYI: Windows natively uses backslashes ( \ ) as dir delimiters, however in my experience using forward slashes ( / ) in perl has no adverse effect, and saves time escaping the backslashes. The only problems I usually encounter in making Unix/windows compatible scripts are: 1) When paths contain spaces 2) When the complete path is used on Unix (from root) as /blah_blah is not valid on windows you need to start with './' 'or ../' or :/ It's actually surprisingly compatible with windows. 3) When sripts use /dev/null as this isn't compatible with windows Thanks for your help! Nathan > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: 24 October 2004 22:41 > To: nathanhaigh@ukonline.co.uk > Subject: RE: [Bioperl-l] make test!! > > Nathan, > > Let's try again! Please use the attached Registry.pm and Registry.t, same > test (minor change in Registry.pm, based on our discussion). If this doesn't > work then we probably have a "/" versus "\" problem. > > BIO > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > Sent: Saturday, October 23, 2004 4:23 PM > To: 'Brian Osborne'; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > I get the following error: > > > perl -w -I. t\Registry.t > 1..12 > ok 1 > ok 2 > ok 3 > This Perl doesn't implement function getpwuid(). Skipping... > > -------------------- WARNING --------------------- > MSG: No seqdatabase.ini file found in ~/.bioinformatics/ > nor in /etc/bioinformatics/ nor in directory specified by > t/data/registry/flat;t/data/registry/bdb. Using web to get database registry > from > http://www.open-bio.org/registry/seqdatabase.ini > --------------------------------------------------- > > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: can't connect: IO::Socket::INET: Bad hostname 'www.open-bio.org' > STACK: Error::throw > STACK: Bio::Root::Root::throw Bio/Root/Root.pm:328 > STACK: Bio::Root::HTTPget::getFH Bio/Root/HTTPget.pm:207 > STACK: Bio::DB::Registry::_load_registry Bio/DB/Registry.pm:128 > STACK: Bio::DB::Registry::new Bio/DB/Registry.pm:97 > STACK: t\Registry.t:57 > ----------------------------------------------------------- > > Nathan > > > -----Original Message----- > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > Sent: 22 October 2004 22:12 > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Nathan, > > > > Please replace your t/Registry.t with the attached Registry.t file and > tell > > me what happens after: > > > > >perl -w -I. t/Registry.t > > > > Brian O. > > > > -----Original Message----- > > From: Nathan Haigh [mailto:nathanhaigh@ukonline.co.uk] > > Sent: Thursday, October 21, 2004 7:59 AM > > To: 'Brian Osborne'; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Ok, I've done some more testing (with the latest CVS 9am GMT) and here is > > what I've found! I've run "namke test" with and without > > BIOPERLDEBUG, and running individual tests using " perl -I. -w > > t/test_name.t". > > > > Attached are 3 files with details of errors: > > Errors.txt - summary and details of failed tests, and other > > tests with peculiar warnings etc > > Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set > > Perl_test.txt - individual tests run with BIOPERLDEBUG set, > using > > "perl -I. -w t/test_name.t" > > > > My System: > > WinXP Pro > > ActiveState Perl 5.8.0 > > Nmake 6.00.8168.0 > > > > My Summary: > > ESEfinder.t - causes perl to crash on test 2 during "nmake test", but > ok > > in other tests! > > Biblio_biofetch.t - throws warning and exception when using > > BIOPERLDEBUG, but doesn't appear in summary! > > Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 > > ProtPsm.t - needs "plan tests" in test file changing to 5. When > > running the individual test can't locate > > Bio::Matrix::PSM::ProtMatrix > > Registry.t - several error including "No seqdatabase.ini file found", > " > > No database with name testflat in Registry" > > Primaryqual.t - Test returned status 255. and 'Can't locate object > method > > "header"' in individual test > > seqread_fail.t - gives an exception, is this supposed to happen? > > > > Hope this help to iron out bugs when running BioPerl on Windows! > > Nathan > > > > > > > -----Original Message----- > > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > > Sent: 20 October 2004 19:04 > > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > > Subject: RE: [Bioperl-l] make test!! > > > > > > Nathan, > > > > > > I noticed most of the Registry tests failing. I know what part of the > > > problem is (getpwuid() not implemented in Windows/Activestate Perl) and > I > > > think I've fixed at least that part. Can you install the most recent > > > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > > > > > >perl -w -I. t/Registry.t > > > > > > > > > Brian O. > > > > > > -----Original Message----- > > > From: bioperl-l-bounces@portal.open-bio.org > > > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > > > Sent: Wednesday, October 20, 2004 10:20 AM > > > To: 'Bioperl' > > > Subject: RE: [Bioperl-l] make test!! > > > > > > Apologise for all the pervious messages! I just wanted to get this onto > > the > > > mailing list: > > > > > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > > > > > System: WinXP Pro > > > ActiveState Perl 5.8.0 build 804 > > > Nmake v6.00.8168.0 > > > > > > A note beforehand: > > > The error message I had previously got, and heard others have also > > received > > > on other OS's. That contain a "line too long" error when > > > trying "make test", is due to the limitations of the particular OS. > > Versions > > > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > > > have got round this problem by splitting long command lines from > Makefiles > > > into a series of smaller commands. > > > > > > Test Summary: > > > Failed Test Stat Wstat Total Fail Failed List of Failed > > > > -------------------------------------------------------------------------- > > -- > > > --- > > > t\Index.t 22 5632 41 21 51.22% 21-41 > > > t\Registry.t 22 5632 11 9 81.82% 3-11 > > > t\seqread_fail.t 255 65280 13 0 0.00% ?? > > > 115 subtests skipped. > > > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > > > okay. > > > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' > : > > > return code '0xff' > > > Stop. > > > > > > Particulars: > > > t\Index......................NOK 21Can't call method "length" on an > > > undefined value at t\Index.t line 124, line > > > 54. > > > t\Index......................dubious > > > Test returned status 22 (wstat 5632, 0x1600) > > > DIED. FAILED tests 21-41 > > > Failed 21/41 tests, 48.78% okay > > > t\Registry...................ok 2/11The getpwuid function is > unimplemented > > > at K:\Downloads\FlashGet\Software\Bioinform > > > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > > > t\Registry...................dubious > > > Test returned status 22 (wstat 5632, 0x1600) > > > t\seqread_fail...............ok 1/13 > > > ------------- EXCEPTION: Bio::Root::Exception ------------- > > > MSG: BioFetch Error 4: ID [XXX111] not found in database > > > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > > > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > > > STACK: Error::throw > > > STACK: Bio::Root::Root::throw > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b/Bio/Root/R > > > oot.pm:328 > > > STACK: Bio::DB::BioFetch::postprocess_data > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > > > ib/Bio/DB/BioFetch.pm:406 > > > STACK: Bio::DB::WebDBSeqI::get_seq_stream > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b/Bio/DB/WebDBSeqI.pm:525 > > > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > > > lib/Bio/DB/WebDBSeqI.pm:287 > > > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > > > > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > > b > > > /Bio/DB/WebDBSeqI.pm:153 > > > STACK: main::fetch t\seqread_fail.t:69 > > > STACK: t\seqread_fail.t:81 > > > ----------------------------------------------------------- > > > t\seqread_fail...............dubious > > > Test returned status 255 (wstat 65280, 0xff00) > > > after all the subtests completed successfully > > > > > > > > > Nathan > > > > > > > -----Original Message----- > > > > From: bioperl-l-bounces@portal.open-bio.org > > > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. > > Mackey > > > > Sent: 14 October 2004 21:27 > > > > To: Bioperl > > > > Subject: [Bioperl-l] make test!! > > > > Importance: High > > > > > > > > > > > > I've had only a very few people send me feedback about the current > > > > state of bioperl-live "make test" on your favorite > > > > old/crotchety/obscure platforms. I'm writing the Change log and > > > > thinking about branching, but I'm an experimentalist, I need data! > > > > > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > > > you have everything, "make distclean" if you've built from the cvs > > > > checkout before, and start from scratch with the usual litany: perl > > > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > > > about, not so much all the verbiage (unless there's specific verbiage > > > > related to the end result ...) > > > > > > > > Thanks, > > > > > > > > -Aaron > > > > > > > > _______________________________________________ > > > > Bioperl-l mailing list > > > > Bioperl-l@portal.open-bio.org > > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > --- > > > > avast! Antivirus: Inbound message clean. > > > > Virus Database (VPS): 0442-2, 14/10/2004 > > > > Tested on: 14/10/2004 21:59:20 > > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > > http://www.avast.com > > > > > > > > > > > > > > --- > > > avast! Antivirus: Outbound message clean. > > > Virus Database (VPS): 0442-3, 15/10/2004 > > > Tested on: 20/10/2004 15:20:04 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > > > > > > > > > _______________________________________________ > > > Bioperl-l mailing list > > > Bioperl-l@portal.open-bio.org > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > > > > > > --- > > > avast! Antivirus: Inbound message clean. > > > Virus Database (VPS): 0442-3, 15/10/2004 > > > Tested on: 21/10/2004 07:12:10 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > --- > > avast! Antivirus: Outbound message clean. > > Virus Database (VPS): 0443-1, 20/10/2004 > > Tested on: 21/10/2004 12:58:59 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > > > > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0443-3, 22/10/2004 > > Tested on: 23/10/2004 21:17:55 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0443-3, 22/10/2004 > Tested on: 23/10/2004 21:22:10 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l From hlapp at gmx.net Mon Oct 25 12:28:35 2004 From: hlapp at gmx.net (Hilmar Lapp) Date: Mon Oct 25 12:27:27 2004 Subject: [Bioperl-l] Re: Bioperl-DB question In-Reply-To: Message-ID: Michael, the location of the error suggests that a statement handle was returned undef and hence failed to prepare. Is it the very first term that fails or do several terms succeed until one fails? If you supply --printerror as a command-line argument a preceding DBI error should become visible. If so, please copy&paste verbatim and post it. When you say you instantiated the Oracle schema and view, does this mean you instantiated the view-based API for strict Biosql compliance, or did you install the alias-based API? I.e., did you run BS-create-Biosql-API.sql (alias-based) or BS-create-Biosql-API2.sql (view-based). Bioperl-db can't deal with the view-based yet due to column naming. If that is the API you need though (instead of the alias-based) then it is relatively easy to add; it will become another driver. Alternatively, as an immediate fix install the alias-based API under a different user, after prefixing the referenced tables with the schema owner (and of course then you need to grant access to the tables which is not pretty). If you instantiated the alias-based API and --printerror does not cause a preceding DBI error to be printed, supply --debug, capture the output (extensive!) in a file, and send it to me. Also, please use the unaltered distribution for this. -hilmar On Monday, October 25, 2004, at 07:55 AM, michael.g.moore@gsk.com wrote: > > Hi, > > We've instantiated the Oracle schema and view for the BioPerl-DB tree > (latest CVS checkout ~1 week old and using ) and I am having some > problems > > I've managed to get the NCBI taxonomy to load. > > When I try the Gene Ontology data I use the following program > > ./load_ontology --dbname USTST240 --driver=Oracle --dbuser=biosql > --dbpass=biosql --safe --updobsolete --namespace "Gene Ontology" > --format go --fmtargs "-def_file,GO.defs" function.ontology > component.ontology process.ontology > > I get a > > 'Cant call method 'bind_param" on an undefined value at > /blah-blah-blah/BasePersistenceAdaptor.pm line (in mine its 948 but I > added some debugging so I think its around 942 in the original code) > > One of the pieces of SQL that is being constructed from this part of > the module does not seem to make sense > > select > term.term_oid,term.indetifier,term.name,term,definition,term.is_obsolet > e,term.ont_oid > from term > where indentifier = ? > > The reason that this seems wrong is that the columns names are from > the SYMGENE schema and should not be available to the biosql view that > was constructed ?on the SYMGENE schema. > > Any help would be appreciated. > > Mike > > > > > Mike Moore > > BioInformatics Engineering and Integration > GlaxoSmithKline -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- From ajm226 at cam.ac.uk Mon Oct 18 07:37:04 2004 From: ajm226 at cam.ac.uk (Andrew McArdle) Date: Mon Oct 25 15:21:05 2004 Subject: [Bioperl-l] Aligning BLAST results Message-ID: Hello, Quick note... this is a long message. If you don't want to read it all, then here's a summary: what is the best program/module to use for aligning the DNA sequences of different lengths, coming from the same cDNA, in order to get the longest possible contig? Longer version: I am currently using BioPerl to automate a laborious task. I have a set of 125 contigs (originally assembled from available Schistosome EST data some years ago). These contigs are those that were unidentified after BlastX homology searching. In order to improve our chances of getting relevant homology results, we want to extend the known sequence of these contigs using newer EST data. I have managed to get a basic Perl program working, which takes each contig, locally blasts it against an EST file I have, then takes the best results and assembles them together with the contig, in the hope of getting a longer sequence. This longer sequence is then remotely blasted at the NCBI on BlastX, and the results stored. My question is, what is the best program to use for aligning the BLAST results. When I did this manually (I gave up very quickly in favour of automation!), I used EditSeq from DNAStar to align the sequences. Not knowing much about alignments, in my program I opted to used ClustalW. This has given me alignments, but the percentage idenity values are usually very poor (circa 50% - which I would imagine is little better than what you could get by chance by arranging random sequences). I then discovered that ClustalW is a global alignment program, and I really need a local alignment program. I then tried using the dpAlign module, and this gave worse results. I have since found something which suggests that dpAlign is only for protein, and I should be using pSW. Anyhow, dpAlign definitely appeared to be doing a global alignment, since the ends were flush. I then tried using TCoffee, but have not, as of yet been able to get good results. I have considered creating the alignments from the BLAST data (since this gives the start/end base numbers of the alignments, and the sense), but I wouldn't be able to account for gaps etc. Apologies for the long message, but can anyone suggest which program/module I should be using to align these BLAST results. Thanks very much, Andrew McArdle From ajm226 at cam.ac.uk Wed Oct 20 07:27:12 2004 From: ajm226 at cam.ac.uk (Andrew McArdle) Date: Mon Oct 25 15:21:11 2004 Subject: [Bioperl-l] RE: Installing BioPerl under Mac OS X In-Reply-To: <225C6409-2286-11D9-8BBB-000A95B139D2@bioinfo.ca> Message-ID: Dear Madeleine, Thank you very much for your valuable advice. You were right, I was trying to install BioPerl under MacOS, but I was hampered by an insufficient understanding of Linux, and even less knowledge of Mac OS X. I did follow some of Steve Cannon's instructions, and they helped for some of the way. Unfortunately, I am only running Mac OS 10.2.6, so I had to download the XCode tools. Each obstacle I have navigated so far with regard to the installation seems to have revealed a new problem. I did try Fink (it was not preinstalled with Mac OS 10.2 I don't think), but maybe due to lack of perseverance couldn't even really manage using that. Ultimately, I decided to be antisocial and work from home, since I have a dual-boot Windows XP/Mandrake Linux box. The BioPerl installation using CPAN on Linux was a relative doddle, and then I installed MySQL (again very simple) and DBI as the Perl adaptor, and everything is working fine. It would still be nice to have the applications working on Max OS though, since it is nicer to work in the lab, and when it comes to running scripts that take several hours or more to complete I would rather have it on the lab computer! Thanks again for all the information. It may still be necessary at some point for me to set everything up in the lab. Andrew -----Original Message----- From: Madeleine Lemieux [mailto:mlemieux@bioinfo.ca] Sent: 20 October 2004 11:52 To: ajm226@cam.ac.uk Cc: bioperl-l@portal.open-bio.org Subject: Re: Installing BioPerl under Mac OS X Andrew, I've just finished installing the latest BioPerl release (1.4) under Mac OS X 10.3 (10.3.4 when I started but now 10.3.5). Like you, I'm fairly new at this. You refer to being a Linux newbie. Are you installing BioPerl under Linux or OS X? If the former, I can't help since my experience is with OS X; otherwise, read on. I found Steve Cannon's instructions useful as a starting point (http://www.tc.umn.edu/~cann0010/Bioperl_OSX_install.html). Xcode tools are pre-installed with OS X 10.3 so I didn't need to do the first step. You may want to create /usr/local/bin, /usr/local/lib, /usr/local/share and /usr/local/src directories for your installations since many programs use this a default locations. Make sure they show up in your $PATH in ~/.bash_profile (Terminal) or ~/.bashrc (Xterm). That's also where you need to put some of the environment variables for blast, amongst others. Before starting, you might want to do a "fink selfupdate" to get this very nice package manager up to date. It comes pre-installed with Panther, I believe, but if not, you can get it from http://fink.sourceforge.net/. If you use fink to install, it usually put things under /sw in its own little world which is actually nice if you're unsure of yourself since it removes the risk of trashing things in /usr/bin or /usr/lib. Just remember to add /sw/bin to your search path. I used fink to install libwww-pm581 and GD. I then forced the installation of the BioPerl bundle using CPAN. This was necessary as quite a few of the tests failed but not on things I cared about especially. I then downloaded the latest BioPerl release and followed the installation instructions. Worked fine. I have also installed (following each package's installation instructions) wwwBlast (latest OS X version from NCBI), t-coffee (the Unix version, not the Mac one), clustalw (the OS X version) and EMBOSS. These were all straightforward installations as per instructions. I never successfully compiled the NCBI C++ Toolbox - my suspicion is that there are some assumptions made about paths that are incorrect on my machine and no amount of fiddling with the configure settings helped - but the C Toolkit (for Unix not Mac) compiled and installed like a charm, according to instructions in readme.unx. If you want to go through bptutorial.pl with the graphical debugger (I've started doing this and I think it's great), you'll need to install pTk (I downloaded TK800.024 from CPAN.) and then ptkdb (also from CPAN). I had problems compiling pTk but eventually got it working (see below). After pTk was up and running, the ptkdb installation went seamlessly. If you use this, remember: ptkdb has to be run in an xterm window, not a terminal :-) (I can't remember whether I had to install X11 but if so it was from the disks that shipped with my iBook.) 1. Tk looks for perl under /usr/local/bin/perl but it's in /usr/bin/perl. ln -s /usr/bin/perl /usr/local/bin/perl takes care of that problem. 2. Make reported the following: LeMeiLin:~/BioPerl/Tk800.024 $ make cd pTk && make DEFINE="" cc -c -I.. -I/usr/X11R6/include -I. -Ibitmaps -I/usr/X11R6/include -g -pipe -pipe -fno-common -DPERL_DARWIN -no-cpp-precomp -fno-strict-aliasing -I/usr/ local/include -Os -DVERSION=\"800.024\" -DXS_VERSION=\"800.024\" "-I/ System/Library/Perl/5.8.1/darwin-thread-multi-2level/CORE" -Wall -Wno- implicit-int -Wno-comment -Wno-unused -D__USE_FIXED_PROTOTYPES__ Xlib_f.c In file included from /usr/include/sys/event.h:154, from /usr/include/sys/select.h:71, from tkUnixPort.h:56, from tkPort.h:42, from Xlib_f.c:1: /usr/include/mach/mach.h:79: error: parse error before '->' token make[1]: *** [Xlib_f.o] Error 1 make: *** [pTk/libpTk.a] Error 2 My fix: commented out line 1615 of Lang.h (#define panic Tcl_panic) 3. Make then reported: --center not a valid option My fix: changed POD2MAN_EXE switches --center and --release to -c and -r, respectively, in Tk/MMutil.pm line 335 4. I also changed line 5 in demos/widget ("use Tk 800.000") to ("use Tk 800.024") since that's my version. Sorry! I guess my --verbose switch was on :-) Good luck, Madeleine From brian_osborne at cognia.com Fri Oct 22 17:11:55 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Mon Oct 25 15:21:20 2004 Subject: [Bioperl-l] make test!! In-Reply-To: <000901c4b765$5d2b8690$3cf4cdd9@Desktop> Message-ID: Nathan, Please replace your t/Registry.t with the attached Registry.t file and tell me what happens after: >perl -w -I. t/Registry.t Brian O. -----Original Message----- From: Nathan Haigh [mailto:nathanhaigh@ukonline.co.uk] Sent: Thursday, October 21, 2004 7:59 AM To: 'Brian Osborne'; 'Bioperl' Subject: RE: [Bioperl-l] make test!! Ok, I've done some more testing (with the latest CVS 9am GMT) and here is what I've found! I've run "namke test" with and without BIOPERLDEBUG, and running individual tests using " perl -I. -w t/test_name.t". Attached are 3 files with details of errors: Errors.txt - summary and details of failed tests, and other tests with peculiar warnings etc Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set Perl_test.txt - individual tests run with BIOPERLDEBUG set, using "perl -I. -w t/test_name.t" My System: WinXP Pro ActiveState Perl 5.8.0 Nmake 6.00.8168.0 My Summary: ESEfinder.t - causes perl to crash on test 2 during "nmake test", but ok in other tests! Biblio_biofetch.t - throws warning and exception when using BIOPERLDEBUG, but doesn't appear in summary! Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 ProtPsm.t - needs "plan tests" in test file changing to 5. When running the individual test can't locate Bio::Matrix::PSM::ProtMatrix Registry.t - several error including "No seqdatabase.ini file found", " No database with name testflat in Registry" Primaryqual.t - Test returned status 255. and 'Can't locate object method "header"' in individual test seqread_fail.t - gives an exception, is this supposed to happen? Hope this help to iron out bugs when running BioPerl on Windows! Nathan > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: 20 October 2004 19:04 > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Nathan, > > I noticed most of the Registry tests failing. I know what part of the > problem is (getpwuid() not implemented in Windows/Activestate Perl) and I > think I've fixed at least that part. Can you install the most recent > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > >perl -w -I. t/Registry.t > > > Brian O. > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > Sent: Wednesday, October 20, 2004 10:20 AM > To: 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Apologise for all the pervious messages! I just wanted to get this onto the > mailing list: > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > System: WinXP Pro > ActiveState Perl 5.8.0 build 804 > Nmake v6.00.8168.0 > > A note beforehand: > The error message I had previously got, and heard others have also received > on other OS's. That contain a "line too long" error when > trying "make test", is due to the limitations of the particular OS. Versions > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > have got round this problem by splitting long command lines from Makefiles > into a series of smaller commands. > > Test Summary: > Failed Test Stat Wstat Total Fail Failed List of Failed > -------------------------------------------------------------------------- -- > --- > t\Index.t 22 5632 41 21 51.22% 21-41 > t\Registry.t 22 5632 11 9 81.82% 3-11 > t\seqread_fail.t 255 65280 13 0 0.00% ?? > 115 subtests skipped. > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > okay. > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : > return code '0xff' > Stop. > > Particulars: > t\Index......................NOK 21Can't call method "length" on an > undefined value at t\Index.t line 124, line > 54. > t\Index......................dubious > Test returned status 22 (wstat 5632, 0x1600) > DIED. FAILED tests 21-41 > Failed 21/41 tests, 48.78% okay > t\Registry...................ok 2/11The getpwuid function is unimplemented > at K:\Downloads\FlashGet\Software\Bioinform > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > t\Registry...................dubious > Test returned status 22 (wstat 5632, 0x1600) > t\seqread_fail...............ok 1/13 > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: BioFetch Error 4: ID [XXX111] not found in database > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > STACK: Error::throw > STACK: Bio::Root::Root::throw > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b/Bio/Root/R > oot.pm:328 > STACK: Bio::DB::BioFetch::postprocess_data > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > ib/Bio/DB/BioFetch.pm:406 > STACK: Bio::DB::WebDBSeqI::get_seq_stream > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b/Bio/DB/WebDBSeqI.pm:525 > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > lib/Bio/DB/WebDBSeqI.pm:287 > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b > /Bio/DB/WebDBSeqI.pm:153 > STACK: main::fetch t\seqread_fail.t:69 > STACK: t\seqread_fail.t:81 > ----------------------------------------------------------- > t\seqread_fail...............dubious > Test returned status 255 (wstat 65280, 0xff00) > after all the subtests completed successfully > > > Nathan > > > -----Original Message----- > > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. Mackey > > Sent: 14 October 2004 21:27 > > To: Bioperl > > Subject: [Bioperl-l] make test!! > > Importance: High > > > > > > I've had only a very few people send me feedback about the current > > state of bioperl-live "make test" on your favorite > > old/crotchety/obscure platforms. I'm writing the Change log and > > thinking about branching, but I'm an experimentalist, I need data! > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > you have everything, "make distclean" if you've built from the cvs > > checkout before, and start from scratch with the usual litany: perl > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > about, not so much all the verbiage (unless there's specific verbiage > > related to the end result ...) > > > > Thanks, > > > > -Aaron > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l@portal.open-bio.org > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0442-2, 14/10/2004 > > Tested on: 14/10/2004 21:59:20 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0442-3, 15/10/2004 > Tested on: 20/10/2004 15:20:04 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0442-3, 15/10/2004 > Tested on: 21/10/2004 07:12:10 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0443-1, 20/10/2004 Tested on: 21/10/2004 12:58:59 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com -------------- next part -------------- A non-text attachment was scrubbed... Name: Registry.t Type: application/octet-stream Size: 2922 bytes Desc: not available Url : http://portal.open-bio.org/pipermail/bioperl-l/attachments/20041022/dc60f931/Registry.obj From cmlarota at vbi.vt.edu Tue Oct 19 11:09:02 2004 From: cmlarota at vbi.vt.edu (Carlos Mauricio La Rota) Date: Mon Oct 25 15:21:44 2004 Subject: [Bioperl-l] problems with bioperl's Bio::SeqIO::qual Message-ID: Hello friends (and Chad Matsalla) I am having problems with the method (function) "write_seq()" implemented in Bio::SeqIO::qual . I have an output stream: __ $QualOUT = Bio::SeqIO->new(-fh => \*QUALOUT, '-format' =>'qual'); __ that I am trying to print into with preformed PrimaryQual objects. These objects have been loaded with Id(), quality values, and a description (the rest of the fasta sequence header that is not part of its id). However, the method that writes the object to the OUT stream does not care to print the description if there is one available. So I tried instead to manually override the id in the $source object by giving it a header description when printing like this: print $QualOUT->write_seq(-source => $outQualObj , -header => $SeqHeader); where $SeqHeader had been predefined as the concatenation of the id and the description (basically a string). However, method write_seq() continues to use the objects id, even though I am telling it to use my text defined in the "-header" flag. I basically want to print out a quality file that contain the exact same headers as the corresponding fasta file (which is the way Phred prints them). Thanks. ======================== C.Mauricio La Rota Lawrence Lab Virginia Bioinformatics Institute From danielmt at fiocruz.br Tue Oct 19 11:06:57 2004 From: danielmt at fiocruz.br (Daniel Mascarenhas) Date: Mon Oct 25 15:22:19 2004 Subject: [Bioperl-l] Bio::SearchIO TFASTX parsing bug Message-ID: <41752D91.1020303@fiocruz.br> Hello, we've been using $hit->logical_length('query') on TFASTX reports and noticed that it corresponds to $result->query_length divided by 3. That is exactly what we would expect for TBLASTX, where both the query and hit sequences are translated into aminoacid sequences, however, TFASTX compares a protein sequence to a DNA sequence database and therefore just the hit logical length makes sense. So, everything else that depends on the $hit->logical_length('query') is miscalculated. We're using bioperl-live from cvs (updated almost daily). Cheers, Daniel From dna88880 at yahoo.com Thu Oct 21 14:17:24 2004 From: dna88880 at yahoo.com (ted Huang) Date: Mon Oct 25 15:22:41 2004 Subject: [Bioperl-l] How to check if a file exists in a large directory Message-ID: <20041021181724.84352.qmail@web54410.mail.yahoo.com> Hi, there, I use the following codes to check if a file exists. It works fine if the directory contains less than ca. 20000 files. But if the directory contains more than 20000 files. It fails. Any idea? Thanks. Sally if (-e $dnaFile){ push(@num,$i); } _______________________________ Do you Yahoo!? Declare Yourself - Register online to vote today! http://vote.yahoo.com From dna88880 at yahoo.com Mon Oct 25 09:59:37 2004 From: dna88880 at yahoo.com (ted Huang) Date: Mon Oct 25 15:22:43 2004 Subject: [Bioperl-l] Fwd: How to check if a file exists in a large directory Message-ID: <20041025135937.79554.qmail@web54401.mail.yahoo.com> Skipped content of type multipart/alternative-------------- next part -------------- An embedded message was scrubbed... From: ted Huang Subject: How to check if a file exists in a large directory Date: Thu, 21 Oct 2004 11:17:24 -0700 (PDT) Size: 813 Url: http://portal.open-bio.org/pipermail/bioperl-l/attachments/20041025/35804816/attachment.eml From Frigerio at pierroton.inra.fr Tue Oct 19 07:18:18 2004 From: Frigerio at pierroton.inra.fr (Jean-Marc Frigerio) Date: Mon Oct 25 15:23:07 2004 Subject: [Bioperl-l] RandomSeqIO Message-ID: <200410191318.18824.Frigerio@pierroton.inra.fr> Hi, I wrote and use the following module, which inherits from Bio::SeqIO and adds 2 methods : get_by_id, and first_seq. The idea is to index the sequence file 'in memory' to gain random access to the sequences. I wonder if it could be of any use for other bioperl users. --- Jean-Marc # BioPerl module for RandomSeqIO # # Cared for by Jean-Marc Frigerio # # # Copyright Jean-Marc Frigerio # # You may distribute this module under the same terms as perl itself # # _history # October 18, 2004 # POD documentation - main docs before the code =head1 NAME RandomSeqIO inherits from Bio::SeqIO =head1 SYNOPSIS use RandomSeqIO; my $file = shift; my $fh = IO::File->new($file) or die "open failed: $!\n"; my $seqio = RandomSeqIO->new(' -format' => 'fasta', -fh => $fh); =head1 DESCRIPTION RandomSeqIO adds the get_by_id and first_seq methods to Bio::SeqIO =cut package RandomSeqIO; use strict; use vars qw(@ISA); use Bio::SeqIO; @ISA = qw(Bio::SeqIO); =head1 OVERRIDEN METHOD =head1 next_seq Title : next_seq Usage : $seqio->RandomSeqIO::next_seq; Args : none Returns : A Bio::Seq =cut sub next_seq { my $self = shift; my $pos = $self->RandomSeqIO::_position; my $next = $self->next_seq; if ($next) { $self->RandomSeqIO::_push($next->id,$pos); return $next; } } =head1 NEW METHODS =head1 first_seq Title : first_seq Usage : $seqio->RandomSeqIO::first_seq; Functions : "Rewind" the filehandle to the beginning of the file Args : none Returns : A Bio::Seq =cut sub first_seq { my $self = shift; seek($self->_fh,0,0); return $self->RandomSeqIO::next_seq; } =head1 get_by_id Title : get_by_id Usage : $seqio->RandomSeqIO::get_by_id('077F05'); Args : EST id Returns : A Bio::Seq =cut sub get_by_id { my $self = shift; my $id = shift; if (defined $self->{LIST}{$id} ) { $self->RandomSeqIO::_position($id); return $self->next_seq; } else { while (my $seq = $self->RandomSeqIO::next_seq) { return $seq if $seq->id eq $id; } } } =head1 PRIVATE METHODS =head1 _position Title : _position Usage : $self->RandomSeqIO::_position(); Function : Set/get the position in the file Example : $self->RandomSeqIO::_position($id); Args : id (optional) Returns : the current position in the file =cut sub _position { my $self = shift; my $fh = $self->_fh; if (@_) { my $id = shift; seek($fh,$self->{LIST}{$id},0); } return tell $fh; } =head1 _push Title : _push Usage : $self->RandomSeqIO::_push; Function : Stores id and position in the hash $self->{LIST} Example : $self->RandomSeqIO::_push($next->id,$pos); Args : none Returns : none =cut sub _push { my $self = shift; my ($id,$pos) = @_; $self->{LIST}{$id} = $pos; } =head1 _pop_all Title : _pop_all Usage : $self->RandomSeqIO::_pop_all; Function : print the content of $self->{LIST} Example : $self->RandomSeqIO::__pop_all; Args : none Returns : none =cut sub _pop_all { my $self = shift; for (keys %{$self->{LIST}}) { print "$_ : $self->{LIST}{$_}\n"; } } 1; From gabriele.bucci at ifom-ieo-campus.it Fri Oct 22 11:08:16 2004 From: gabriele.bucci at ifom-ieo-campus.it (Gabriele Bucci) Date: Mon Oct 25 15:23:40 2004 Subject: [Bioperl-l] Glyph Bump bug Message-ID: <6.1.0.6.2.20041022165744.01f2cc10@pop.ieo-research.it> In Bio::Graphics::Panel the "-bump" default value is supposed to be zero (according to documentation). But when glyphs are closer than 9 pixel (don't ask me why 9 sharp!)even if not colliding, they bump downward as if the -bump flag was set to 1 or -1. I have had to explicit the -bump => 0 in order to see my glyph on the same line. Is this happened to some one else, or is it just me worldwide? Gab From gabrieljl at moeba.at Thu Oct 21 05:42:30 2004 From: gabrieljl at moeba.at (Tammie Gabriel) Date: Mon Oct 25 15:24:02 2004 Subject: [Bioperl-l] V`icodin, free shipping Message-ID: <7f0f01c4b752$6ef31222$c48e7521@mod.co.za> An HTML attachment was scrubbed... URL: http://portal.open-bio.org/pipermail/bioperl-l/attachments/20041021/13dcc94e/attachment.htm From grossman at molgen.mpg.de Sun Oct 17 12:05:19 2004 From: grossman at molgen.mpg.de (Steffen Grossmann) Date: Mon Oct 25 15:24:38 2004 Subject: [Bioperl-l] Re: [SO-devel] GFF3 - Bioperl - SO In-Reply-To: References: <416A88AF.1020705@molgen.mpg.de> <416BCB4A.8060303@molgen.mpg.de> <416EA051.7050308@molgen.mpg.de> Message-ID: <4172983F.3030807@molgen.mpg.de> Ok, ok, if you really want to convince me that Bio::FeatureIO::gff is the technology of the future... (although I would also like to hear Chris Mungall's opinion on this point...) So let's get back to the technicalities. There is something which prevents the use of Bio::SeqFeature::Tools::IDHandler with Bio::FeatureIO::gff, namely the extensive use of the tag/value annotation system in the former. On one hand, this comes from repeated calls of Bio::SeqFeatureI's 'primary_id' method, on the other hand there are calls of 'get_tagset_values'. I am not completely sure, but I think that compliance of Bio::SeqFeature::Tools::IDHandler with both concepts can be achieved by two changes: 1) Bio::SeqFeatureI::primary_id and Bio::SeqFeature::Annotated have to be made compatible. Just create a Bio::SeqFeature::Annotated object and try to call 'primary_id' on it to see that it isn't at the moment. In principle this can be done by storing the ID in the AnnotationCollectionI object when the tag/value system is not present. The problem is that the tag/value system is present in Bio::SeqFeature::Annotated (it has to be, because it implements Bio::SeqFeatureI), but it is not functional. Any suggestions? 2) Bio::SeqFeature::Tools::IDHandler can be made compatible with both annotation systems by using the Bio::SeqFeature::AnnotationAdaptor module. This should not cause any problems... Steffen Allen Day wrote: >On Thu, 14 Oct 2004, Steffen Grossmann wrote: > > > >>Dear Allen, >> >>I meanwhile understood that Bio::Tools::GFF in connection with >>Bio::SeqFeature::Tools::IDHandler is doing a lot of the stuff I'd like >>to have. Somehow, Bio::FeatureIO::gff seems to be a parallel development >>to the first alternative. I don't know in how far there are plans to >> >> > >I don't see from a quick look at the source how Bio::Tools::GFF is related >to Bio::SeqFeature::Tools::IDHandler. There's nothing preventing use of >the IDHandler in Bio::FeatureIO::gff, in fact it sounds like what you've >proposed to add so part of your work is already done. > > > >>bring the two approaches together, but at the moment that seems to be >>more complicated than just bringing one approach to an acceptable state. >>Since the Bio::Tools::GFF approach seems to be ahead, I will focus on it >>at the moment. >> >> > >I would advise against adding more features into Bio::Tools::GFF. I can't >speak for all others, but my future development will not use it, and I'm >in the process of converting code which does use it to depend on >Bio::FeatureIO::gff. > >-Allen > > > -- %---------------------------------------------% % Steffen Grossmann % % % % Max Planck Institute for Molecular Genetics % % Computational Molecular Biology % %---------------------------------------------% % Ihnestrasse 73 % % 14195 Berlin % % Germany % %---------------------------------------------% % Tel: (++49 +30) 8413-1167 % % Fax: (++49 +30) 8413-1152 % %---------------------------------------------% From grossman at molgen.mpg.de Mon Oct 18 09:13:39 2004 From: grossman at molgen.mpg.de (Steffen Grossmann) Date: Mon Oct 25 15:24:44 2004 Subject: [Bioperl-l] Re: [SO-devel] GFF3 - Bioperl - SO In-Reply-To: References: <416A88AF.1020705@molgen.mpg.de> <416BCB4A.8060303@molgen.mpg.de> <416EA051.7050308@molgen.mpg.de> <4172983F.3030807@molgen.mpg.de> Message-ID: <4173C183.7070708@molgen.mpg.de> Allen, it might be understandable that you don't want to use the tag/value annotation system, but it is then problematic to let Bio::SeqFeature::Annotated inherit from Bio::SeqFeatureI which requires to implement the tag/value scheme. This is some kind of indirect deprecation of functionality, which I don't think helps in making things clearer. Moreover, Bio::FeatureIO::gff is only able to write out features of the type Bio::SeqFeature::Annotated, so I think that the discussion about deprecating Bio::Tools::GFF and replacing it with Bio::FeatureIO::gff is dangerous, since Bio::SeqFeature::Generic is of widespread use and GFF output of such features should be maintained. These are just some thoughts about the structure, I'd be curious to learn about your and other people's opinions about it. By the way, also Bio::SeqFeature::AnnotationAdaptor does not work together with Bio::SeqFeature::Annotated, so the workaround proposed below does not work. Steffen Allen Day wrote: >On Sun, 17 Oct 2004, Steffen Grossmann wrote: > > > >>Ok, ok, if you really want to convince me that Bio::FeatureIO::gff is >>the technology of the future... (although I would also like to hear >>Chris Mungall's opinion on this point...) >> >> > >I'd like to hear Chris weigh in as well. > > > >>So let's get back to the technicalities. >> >>There is something which prevents the use of >>Bio::SeqFeature::Tools::IDHandler with Bio::FeatureIO::gff, namely the >>extensive use of the tag/value annotation system in the former. On one >>hand, this comes from repeated calls of Bio::SeqFeatureI's 'primary_id' >>method, on the other hand there are calls of 'get_tagset_values'. >> >> > >We can map Bio::SeqFeature::Annotated::primary_id to something reasonable >in the AnnotationCollection, but my guess is that avoiding the tagset will >be more difficult. > >I'd prefer not to add SeqFeatureI compliance as far as tagset methods go >-- one of the main reasons I added SeqFeature::Annotated was to get rid of >this "feature". I haven't looked at the AnnotationAdaptor you mention >below, but it sounds like a reasonable approach. > >Regarding your earlier mail about returning unflattened features, we can >do this pretty easily by implementing GFF3 '###' tag handling. I don't >remember if I mentioned this before. > >-Allen > > > >>I am not completely sure, but I think that compliance of >>Bio::SeqFeature::Tools::IDHandler with both concepts can be achieved by >>two changes: >> >>1) Bio::SeqFeatureI::primary_id and Bio::SeqFeature::Annotated have to >>be made compatible. Just create a Bio::SeqFeature::Annotated object and >>try to call 'primary_id' on it to see that it isn't at the moment. In >>principle this can be done by storing the ID in the >>AnnotationCollectionI object when the tag/value system is not present. >>The problem is that the tag/value system is present in >>Bio::SeqFeature::Annotated (it has to be, because it implements >>Bio::SeqFeatureI), but it is not functional. Any suggestions? >> >>2) Bio::SeqFeature::Tools::IDHandler can be made compatible with both >>annotation systems by using the Bio::SeqFeature::AnnotationAdaptor >>module. This should not cause any problems... >> >>Steffen >> >> >> >>Allen Day wrote: >> >> >> >>>On Thu, 14 Oct 2004, Steffen Grossmann wrote: >>> >>> >>> >>> >>> >>>>Dear Allen, >>>> >>>>I meanwhile understood that Bio::Tools::GFF in connection with >>>>Bio::SeqFeature::Tools::IDHandler is doing a lot of the stuff I'd like >>>>to have. Somehow, Bio::FeatureIO::gff seems to be a parallel development >>>>to the first alternative. I don't know in how far there are plans to >>>> >>>> >>>> >>>> >>>I don't see from a quick look at the source how Bio::Tools::GFF is related >>>to Bio::SeqFeature::Tools::IDHandler. There's nothing preventing use of >>>the IDHandler in Bio::FeatureIO::gff, in fact it sounds like what you've >>>proposed to add so part of your work is already done. >>> >>> >>> >>> >>> >>>>bring the two approaches together, but at the moment that seems to be >>>>more complicated than just bringing one approach to an acceptable state. >>>>Since the Bio::Tools::GFF approach seems to be ahead, I will focus on it >>>>at the moment. >>>> >>>> >>>> >>>> >>>I would advise against adding more features into Bio::Tools::GFF. I can't >>>speak for all others, but my future development will not use it, and I'm >>>in the process of converting code which does use it to depend on >>>Bio::FeatureIO::gff. >>> >>>-Allen >>> >>> >>> >>> >>> >> >> >> >_______________________________________________ >Bioperl-l mailing list >Bioperl-l@portal.open-bio.org >http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > -- %---------------------------------------------% % Steffen Grossmann % % % % Max Planck Institute for Molecular Genetics % % Computational Molecular Biology % %---------------------------------------------% % Ihnestrasse 73 % % 14195 Berlin % % Germany % %---------------------------------------------% % Tel: (++49 +30) 8413-1167 % % Fax: (++49 +30) 8413-1152 % %---------------------------------------------% From grossman at molgen.mpg.de Wed Oct 20 08:30:43 2004 From: grossman at molgen.mpg.de (Steffen Grossmann) Date: Mon Oct 25 15:24:47 2004 Subject: [Bioperl-l] Test Message In-Reply-To: <000701c4b698$d655fbe0$3cf4cdd9@Desktop> References: <000701c4b698$d655fbe0$3cf4cdd9@Desktop> Message-ID: <41765A73.4090106@molgen.mpg.de> There seems to be a problem with all kinds of non-member messages. Two of mine are still waiting to be posted to the list (I swear that they deserve to be posted)... Steffen Nathan Haigh wrote: >Sorry about this, my messages don't seem to be getting through to the >mailing list! > >Just trying a bog standard plain text e-mail > >Here's hoping! > >_______________________________________________ >Bioperl-l mailing list >Bioperl-l@portal.open-bio.org >http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > -- %---------------------------------------------% % Steffen Grossmann % % % % Max Planck Institute for Molecular Genetics % % Computational Molecular Biology % %---------------------------------------------% % Ihnestrasse 73 % % 14195 Berlin % % Germany % %---------------------------------------------% % Tel: (++49 +30) 8413-1167 % % Fax: (++49 +30) 8413-1152 % %---------------------------------------------% From grossman at molgen.mpg.de Thu Oct 21 04:09:36 2004 From: grossman at molgen.mpg.de (Steffen Grossmann) Date: Mon Oct 25 15:24:51 2004 Subject: [Bioperl-l] Re: [SO-devel] GFF3 - Bioperl - SO In-Reply-To: References: <416A88AF.1020705@molgen.mpg.de> <416BCB4A.8060303@molgen.mpg.de> <416EA051.7050308@molgen.mpg.de> Message-ID: <41776EC0.1000504@molgen.mpg.de> Ok, ok, if you really want to convince me that Bio::FeatureIO::gff is the technology of the future... (although I would also like to hear Chris Mungall's opinion on this point...) So let's get back to the technicalities. There is something which prevents the use of Bio::SeqFeature::Tools::IDHandler with Bio::FeatureIO::gff, namely the extensive use of the tag/value annotation system in the former. On one hand, this comes from repeated calls of Bio::SeqFeatureI's 'primary_id' method, on the other hand there are calls of 'get_tagset_values'. I am not completely sure, but I think that compliance of Bio::SeqFeature::Tools::IDHandler with both concepts can be achieved by two changes: 1) Bio::SeqFeatureI::primary_id and Bio::SeqFeature::Annotated have to be made compatible. Just create a Bio::SeqFeature::Annotated object and try to call 'primary_id' on it to see that it isn't at the moment. In principle this can be done by storing the ID in the AnnotationCollectionI object when the tag/value system is not present. The problem is that the tag/value system is present in Bio::SeqFeature::Annotated (it has to be, because it implements Bio::SeqFeatureI), but it is not functional. Any suggestions? 2) Bio::SeqFeature::Tools::IDHandler can be made compatible with both annotation systems by using the Bio::SeqFeature::AnnotationAdaptor module. This should not cause any problems... Steffen Allen Day wrote: >On Thu, 14 Oct 2004, Steffen Grossmann wrote: > > > >>Dear Allen, >> >>I meanwhile understood that Bio::Tools::GFF in connection with >>Bio::SeqFeature::Tools::IDHandler is doing a lot of the stuff I'd like >>to have. Somehow, Bio::FeatureIO::gff seems to be a parallel development >>to the first alternative. I don't know in how far there are plans to >> >> > >I don't see from a quick look at the source how Bio::Tools::GFF is related >to Bio::SeqFeature::Tools::IDHandler. There's nothing preventing use of >the IDHandler in Bio::FeatureIO::gff, in fact it sounds like what you've >proposed to add so part of your work is already done. > > > >>bring the two approaches together, but at the moment that seems to be >>more complicated than just bringing one approach to an acceptable state. >>Since the Bio::Tools::GFF approach seems to be ahead, I will focus on it >>at the moment. >> >> > >I would advise against adding more features into Bio::Tools::GFF. I can't >speak for all others, but my future development will not use it, and I'm >in the process of converting code which does use it to depend on >Bio::FeatureIO::gff. > >-Allen > > > -- %---------------------------------------------% % Steffen Grossmann % % % % Max Planck Institute for Molecular Genetics % % Computational Molecular Biology % %---------------------------------------------% % Ihnestrasse 73 % % 14195 Berlin % % Germany % %---------------------------------------------% % Tel: (++49 +30) 8413-1167 % % Fax: (++49 +30) 8413-1152 % %---------------------------------------------% From grossman at molgen.mpg.de Thu Oct 21 04:09:49 2004 From: grossman at molgen.mpg.de (Steffen Grossmann) Date: Mon Oct 25 15:24:55 2004 Subject: [Bioperl-l] Re: [SO-devel] GFF3 - Bioperl - SO In-Reply-To: References: <416A88AF.1020705@molgen.mpg.de> <416BCB4A.8060303@molgen.mpg.de> <416EA051.7050308@molgen.mpg.de> <4172983F.3030807@molgen.mpg.de> Message-ID: <41776ECD.3090203@molgen.mpg.de> Allen, it might be understandable that you don't want to use the tag/value annotation system, but it is then problematic to let Bio::SeqFeature::Annotated inherit from Bio::SeqFeatureI which requires to implement the tag/value scheme. This is some kind of indirect deprecation of functionality, which I don't think helps in making things clearer. Moreover, Bio::FeatureIO::gff is only able to write out features of the type Bio::SeqFeature::Annotated, so I think that the discussion about deprecating Bio::Tools::GFF and replacing it with Bio::FeatureIO::gff is dangerous, since Bio::SeqFeature::Generic is of widespread use and GFF output of such features should be maintained. These are just some thoughts about the structure, I'd be curious to learn about your and other people's opinions about it. By the way, also Bio::SeqFeature::AnnotationAdaptor does not work together with Bio::SeqFeature::Annotated, so the workaround proposed below does not work. Steffen Allen Day wrote: >On Sun, 17 Oct 2004, Steffen Grossmann wrote: > > > >>Ok, ok, if you really want to convince me that Bio::FeatureIO::gff is >>the technology of the future... (although I would also like to hear >>Chris Mungall's opinion on this point...) >> >> > >I'd like to hear Chris weigh in as well. > > > >>So let's get back to the technicalities. >> >>There is something which prevents the use of >>Bio::SeqFeature::Tools::IDHandler with Bio::FeatureIO::gff, namely the >>extensive use of the tag/value annotation system in the former. On one >>hand, this comes from repeated calls of Bio::SeqFeatureI's 'primary_id' >>method, on the other hand there are calls of 'get_tagset_values'. >> >> > >We can map Bio::SeqFeature::Annotated::primary_id to something reasonable >in the AnnotationCollection, but my guess is that avoiding the tagset will >be more difficult. > >I'd prefer not to add SeqFeatureI compliance as far as tagset methods go >-- one of the main reasons I added SeqFeature::Annotated was to get rid of >this "feature". I haven't looked at the AnnotationAdaptor you mention >below, but it sounds like a reasonable approach. > >Regarding your earlier mail about returning unflattened features, we can >do this pretty easily by implementing GFF3 '###' tag handling. I don't >remember if I mentioned this before. > >-Allen > > > >>I am not completely sure, but I think that compliance of >>Bio::SeqFeature::Tools::IDHandler with both concepts can be achieved by >>two changes: >> >>1) Bio::SeqFeatureI::primary_id and Bio::SeqFeature::Annotated have to >>be made compatible. Just create a Bio::SeqFeature::Annotated object and >>try to call 'primary_id' on it to see that it isn't at the moment. In >>principle this can be done by storing the ID in the >>AnnotationCollectionI object when the tag/value system is not present. >>The problem is that the tag/value system is present in >>Bio::SeqFeature::Annotated (it has to be, because it implements >>Bio::SeqFeatureI), but it is not functional. Any suggestions? >> >>2) Bio::SeqFeature::Tools::IDHandler can be made compatible with both >>annotation systems by using the Bio::SeqFeature::AnnotationAdaptor >>module. This should not cause any problems... >> >>Steffen >> >> >> >>Allen Day wrote: >> >> >> >>>On Thu, 14 Oct 2004, Steffen Grossmann wrote: >>> >>> >>> >>> >>> >>>>Dear Allen, >>>> >>>>I meanwhile understood that Bio::Tools::GFF in connection with >>>>Bio::SeqFeature::Tools::IDHandler is doing a lot of the stuff I'd like >>>>to have. Somehow, Bio::FeatureIO::gff seems to be a parallel development >>>>to the first alternative. I don't know in how far there are plans to >>>> >>>> >>>> >>>> >>>I don't see from a quick look at the source how Bio::Tools::GFF is related >>>to Bio::SeqFeature::Tools::IDHandler. There's nothing preventing use of >>>the IDHandler in Bio::FeatureIO::gff, in fact it sounds like what you've >>>proposed to add so part of your work is already done. >>> >>> >>> >>> >>> >>>>bring the two approaches together, but at the moment that seems to be >>>>more complicated than just bringing one approach to an acceptable state. >>>>Since the Bio::Tools::GFF approach seems to be ahead, I will focus on it >>>>at the moment. >>>> >>>> >>>> >>>> >>>I would advise against adding more features into Bio::Tools::GFF. I can't >>>speak for all others, but my future development will not use it, and I'm >>>in the process of converting code which does use it to depend on >>>Bio::FeatureIO::gff. >>> >>>-Allen >>> >>> >>> >>> >>> >> >> >> >_______________________________________________ >Bioperl-l mailing list >Bioperl-l@portal.open-bio.org >http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > -- %---------------------------------------------% % Steffen Grossmann % % % % Max Planck Institute for Molecular Genetics % % Computational Molecular Biology % %---------------------------------------------% % Ihnestrasse 73 % % 14195 Berlin % % Germany % %---------------------------------------------% % Tel: (++49 +30) 8413-1167 % % Fax: (++49 +30) 8413-1152 % %---------------------------------------------% From nathanhaigh at ukonline.co.uk Sun Oct 17 18:15:46 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Mon Oct 25 15:25:15 2004 Subject: [Bioperl-l] nmake - windows Message-ID: I think I have located the problem with trying to run "nmake install" on Windows. The version of ExtUtils::MakeMaker is < 6.06. Versions later or equal to 6.06 deal with long command line params in the makefile by splitting them into multiple commands executed by nmake; thereby getting round the limitations of the number of chars allowed on the command line (128 chars for windows). Therefore, bioperl will need to have ExtUtils::MakeMaker 6.06 or later in order to run the nmake test. There may also be limitations on other OS's (I also read about VMS), so should this version of ExtUtils::MakeMaker be a dependency of BioPerl? However, I'm having problems getting XML::Parser to install after something crashed! Not sure if it is something gone wrong when a program crashed, if it's ExtUtils::MakeMaker (6.21) that I installed to get round the problem above. Does anyone know if XML::Parser is required for ppm or cpan to run? As both don't seem to want to work after the crash! Anyway, as soon as I manage to get everything installed ok, I'll run the BioPerl-live tests!! Nathan --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 17/10/2004 23:13:52 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From nathanhaigh at ukonline.co.uk Mon Oct 18 08:28:47 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Mon Oct 25 15:25:18 2004 Subject: [Bioperl-l] make test!! In-Reply-To: <5712C9C6-1E1F-11D9-AF00-000A9577009E@pcbi.upenn.edu> Message-ID: <000a01c4b50e$0c709190$ccf3cdd9@Desktop> I have managed to do a "nmake test" (WinXP) on bioperl-live. System: WinXP Pro ActiveState Perl 5.8.0 build 804 Nmake v6.00.8168.0 A note beforehand: The error message I had previously got, and heard others have also received on other OS's. That contain a "line too long" error when trying "make test", is due to the limitations of the particular OS. Versions of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) have got round this problem by splitting long command lines from Makefiles into a series of smaller commands. Test Summary: Failed Test Stat Wstat Total Fail Failed List of Failed ---------------------------------------------------------------------------- --- t\BlastIndex.t 255 65280 13 12 92.31% 2-13 t\Index.t 22 5632 41 21 51.22% 21-41 t\Registry.t 22 5632 11 9 81.82% 3-11 t\RestrictionIO.t 255 65280 14 8 57.14% 7-14 t\seqread_fail.t 255 65280 13 0 0.00% ?? 115 subtests skipped. Failed 5/192 test scripts, 97.40% okay. 50/8791 subtests failed, 99.43% okay. NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : return code '0xff' Stop. Nathan > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l- > bounces@portal.open-bio.org] On Behalf Of Aaron J. Mackey > Sent: 14 October 2004 21:27 > To: Bioperl > Subject: [Bioperl-l] make test!! > > > I've had only a very few people send me feedback about the current > state of bioperl-live "make test" on your favorite > old/crotchety/obscure platforms. I'm writing the Change log and > thinking about branching, but I'm an experimentalist, I need data! > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > you have everything, "make distclean" if you've built from the cvs > checkout before, and start from scratch with the usual litany: perl > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > about, not so much all the verbiage (unless there's specific verbiage > related to the end result ...) > > Thanks, > > -Aaron > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0442-2, 14/10/2004 > Tested on: 14/10/2004 21:59:20 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 18/10/2004 13:28:42 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com -------------- next part -------------- A non-text attachment was scrubbed... Name: winmail.dat Type: application/ms-tnef Size: 5816 bytes Desc: not available Url : http://portal.open-bio.org/pipermail/bioperl-l/attachments/20041018/8dd3ae37/winmail-0001.bin From nathanhaigh at ukonline.co.uk Mon Oct 18 16:47:39 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Mon Oct 25 15:25:26 2004 Subject: [Bioperl-l] make test!! In-Reply-To: <5712C9C6-1E1F-11D9-AF00-000A9577009E@pcbi.upenn.edu> Message-ID: <000801c4b553$b5e84e30$66f3cdd9@Desktop> I have managed to do a "nmake test" (WinXP) on bioperl-live. System: WinXP Pro ActiveState Perl 5.8.0 build 804 Nmake v6.00.8168.0 A note beforehand: The error message I had previously got, and heard others have also received on other OS's. That contain a "line too long" error when trying "make test", is due to the limitations of the particular OS. Versions of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) have got round this problem by splitting long command lines from Makefiles into a series of smaller commands. Test Summary: Failed Test Stat Wstat Total Fail Failed List of Failed ---------------------------------------------------------------------------- --- t\Index.t 22 5632 41 21 51.22% 21-41 t\Registry.t 22 5632 11 9 81.82% 3-11 t\seqread_fail.t 255 65280 13 0 0.00% ?? 115 subtests skipped. Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% okay. NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : return code '0xff' Stop. Particulars: t\Index......................NOK 21Can't call method "length" on an undefined value at t\Index.t line 124, line 54. t\Index......................dubious Test returned status 22 (wstat 5632, 0x1600) DIED. FAILED tests 21-41 Failed 21/41 tests, 48.78% okay t\Registry...................ok 2/11The getpwuid function is unimplemented at K:\Downloads\FlashGet\Software\Bioinform atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. t\Registry...................dubious Test returned status 22 (wstat 5632, 0x1600) t\seqread_fail...............ok 1/13 ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: BioFetch Error 4: ID [XXX111] not found in database [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. STACK: Error::throw STACK: Bio::Root::Root::throw K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li b/Bio/Root/R oot.pm:328 STACK: Bio::DB::BioFetch::postprocess_data K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l ib/Bio/DB/BioFetch.pm:406 STACK: Bio::DB::WebDBSeqI::get_seq_stream K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li b/Bio/DB/WebDBSeqI.pm:525 STACK: Bio::DB::WebDBSeqI::get_Stream_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ lib/Bio/DB/WebDBSeqI.pm:287 STACK: Bio::DB::WebDBSeqI::get_Seq_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li b /Bio/DB/WebDBSeqI.pm:153 STACK: main::fetch t\seqread_fail.t:69 STACK: t\seqread_fail.t:81 ----------------------------------------------------------- t\seqread_fail...............dubious Test returned status 255 (wstat 65280, 0xff00) after all the subtests completed successfully Nathan > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l- > bounces@portal.open-bio.org] On Behalf Of Aaron J. Mackey > Sent: 14 October 2004 21:27 > To: Bioperl > Subject: [Bioperl-l] make test!! > > > I've had only a very few people send me feedback about the current > state of bioperl-live "make test" on your favorite > old/crotchety/obscure platforms. I'm writing the Change log and > thinking about branching, but I'm an experimentalist, I need data! > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > you have everything, "make distclean" if you've built from the cvs > checkout before, and start from scratch with the usual litany: perl > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > about, not so much all the verbiage (unless there's specific verbiage > related to the end result ...) > > Thanks, > > -Aaron > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0442-2, 14/10/2004 > Tested on: 14/10/2004 21:59:20 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 18/10/2004 13:28:42 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 18/10/2004 21:47:35 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com -------------- next part -------------- A non-text attachment was scrubbed... Name: winmail.dat Type: application/ms-tnef Size: 6932 bytes Desc: not available Url : http://portal.open-bio.org/pipermail/bioperl-l/attachments/20041018/5b887950/winmail-0001.bin From nathanhaigh at ukonline.co.uk Wed Oct 20 08:08:42 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Mon Oct 25 15:25:33 2004 Subject: [Bioperl-l] Another test - form my ne defaults Message-ID: Another test Ok, that last one worked, so here's another test to check my new default mail settings! Nathan --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 20/10/2004 13:05:36 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 20/10/2004 13:08:37 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From nathanhaigh at ukonline.co.uk Wed Oct 20 08:16:45 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Mon Oct 25 15:25:36 2004 Subject: [Bioperl-l] Another test - form my new defaults Message-ID: <000c01c4b69e$ab43c5d0$3cf4cdd9@Desktop> Another test Ok, that last one worked, so here's another test to check my new default mail settings! Nathan --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 20/10/2004 13:16:26 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 20/10/2004 13:16:43 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From nathanhaigh at ukonline.co.uk Wed Oct 20 08:19:13 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Mon Oct 25 15:25:39 2004 Subject: [Bioperl-l] Another test - form my new defaults Message-ID: <001101c4b69f$064f92b0$3cf4cdd9@Desktop> Another test, to see if I can get my message through without help from the moderator. Ok, that last one worked, so here's another test to check my new default mail settings! Nathan --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 20/10/2004 13:19:11 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From nathanhaigh at ukonline.co.uk Wed Oct 20 08:22:46 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Mon Oct 25 15:25:42 2004 Subject: [Bioperl-l] Another test - form my new defaults Message-ID: <001601c4b69f$825f5e80$3cf4cdd9@Desktop> Another test, to see if I can get my message through without help from the moderator. Ok, that last one worked, so here's another test to check my new default mail settings! Nathan --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 20/10/2004 13:22:29 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From nathanhaigh at ukonline.co.uk Wed Oct 20 08:59:00 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Mon Oct 25 15:25:46 2004 Subject: [Bioperl-l] last test! Message-ID: Hopefully this is the last test! Nathan --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 20/10/2004 13:59:00 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com -------------- next part -------------- A non-text attachment was scrubbed... Name: smime.p7s Type: application/x-pkcs7-signature Size: 3095 bytes Desc: not available Url : http://portal.open-bio.org/pipermail/bioperl-l/attachments/20041020/b05d0400/smime-0001.bin From nathanhaigh at ukonline.co.uk Wed Oct 20 09:06:03 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Mon Oct 25 15:25:49 2004 Subject: [Bioperl-l] last test Message-ID: Last test Nathan From nathanhaigh at ukonline.co.uk Wed Oct 20 09:37:43 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Mon Oct 25 15:25:57 2004 Subject: [Bioperl-l] last test 4 Message-ID: Another test --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 20/10/2004 14:37:40 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From nathanhaigh at ukonline.co.uk Wed Oct 20 09:39:36 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Mon Oct 25 15:26:05 2004 Subject: [Bioperl-l] last test 5 Message-ID: Another test --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 20/10/2004 14:37:40 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0442-3, 15/10/2004 Tested on: 20/10/2004 14:39:34 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From nathanhaigh at ukonline.co.uk Wed Oct 20 10:15:27 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Mon Oct 25 15:26:08 2004 Subject: [Bioperl-l] make test!! In-Reply-To: <5712C9C6-1E1F-11D9-AF00-000A9577009E@pcbi.upenn.edu> Message-ID: <005401c4b6af$472733a0$3cf4cdd9@Desktop> Apologise for all the pervious messages! I just wanted to get this onto the mailing list: I have managed to do a "nmake test" (WinXP) on bioperl-live. System: WinXP Pro ActiveState Perl 5.8.0 build 804 Nmake v6.00.8168.0 A note beforehand: The error message I had previously got, and heard others have also received on other OS's. That contain a "line too long" error when trying "make test", is due to the limitations of the particular OS. Versions of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) have got round this problem by splitting long command lines from Makefiles into a series of smaller commands. Test Summary: Failed Test Stat Wstat Total Fail Failed List of Failed ------------------------------------------------------------------------------- t\Index.t 22 5632 41 21 51.22% 21-41 t\Registry.t 22 5632 11 9 81.82% 3-11 t\seqread_fail.t 255 65280 13 0 0.00% ?? 115 subtests skipped. Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% okay. NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : return code '0xff' Stop. Particulars: t\Index......................NOK 21Can't call method "length" on an undefined value at t\Index.t line 124, line 54. t\Index......................dubious Test returned status 22 (wstat 5632, 0x1600) DIED. FAILED tests 21-41 Failed 21/41 tests, 48.78% okay t\Registry...................ok 2/11The getpwuid function is unimplemented at K:\Downloads\FlashGet\Software\Bioinform atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. t\Registry...................dubious Test returned status 22 (wstat 5632, 0x1600) t\seqread_fail...............ok 1/13 ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: BioFetch Error 4: ID [XXX111] not found in database [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. STACK: Error::throw STACK: Bio::Root::Root::throw K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\lib/Bio/Root/R oot.pm:328 STACK: Bio::DB::BioFetch::postprocess_data K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l ib/Bio/DB/BioFetch.pm:406 STACK: Bio::DB::WebDBSeqI::get_seq_stream K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li b/Bio/DB/WebDBSeqI.pm:525 STACK: Bio::DB::WebDBSeqI::get_Stream_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ lib/Bio/DB/WebDBSeqI.pm:287 STACK: Bio::DB::WebDBSeqI::get_Seq_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\lib /Bio/DB/WebDBSeqI.pm:153 STACK: main::fetch t\seqread_fail.t:69 STACK: t\seqread_fail.t:81 ----------------------------------------------------------- t\seqread_fail...............dubious Test returned status 255 (wstat 65280, 0xff00) after all the subtests completed successfully Nathan > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. Mackey > Sent: 14 October 2004 21:27 > To: Bioperl > Subject: [Bioperl-l] make test!! > Importance: High > > > I've had only a very few people send me feedback about the current > state of bioperl-live "make test" on your favorite > old/crotchety/obscure platforms. I'm writing the Change log and > thinking about branching, but I'm an experimentalist, I need data! > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > you have everything, "make distclean" if you've built from the cvs > checkout before, and start from scratch with the usual litany: perl > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > about, not so much all the verbiage (unless there's specific verbiage > related to the end result ...) > > Thanks, > > -Aaron > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0442-2, 14/10/2004 > Tested on: 14/10/2004 21:59:20 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > From nathanhaigh at ukonline.co.uk Thu Oct 21 07:59:04 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Mon Oct 25 15:26:12 2004 Subject: [Bioperl-l] make test!! In-Reply-To: Message-ID: <000901c4b765$5d2b8690$3cf4cdd9@Desktop> Ok, I've done some more testing (with the latest CVS 9am GMT) and here is what I've found! I've run "namke test" with and without BIOPERLDEBUG, and running individual tests using " perl -I. -w t/test_name.t". Attached are 3 files with details of errors: Errors.txt - summary and details of failed tests, and other tests with peculiar warnings etc Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set Perl_test.txt - individual tests run with BIOPERLDEBUG set, using "perl -I. -w t/test_name.t" My System: WinXP Pro ActiveState Perl 5.8.0 Nmake 6.00.8168.0 My Summary: ESEfinder.t - causes perl to crash on test 2 during "nmake test", but ok in other tests! Biblio_biofetch.t - throws warning and exception when using BIOPERLDEBUG, but doesn't appear in summary! Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 ProtPsm.t - needs "plan tests" in test file changing to 5. When running the individual test can't locate Bio::Matrix::PSM::ProtMatrix Registry.t - several error including "No seqdatabase.ini file found", " No database with name testflat in Registry" Primaryqual.t - Test returned status 255. and 'Can't locate object method "header"' in individual test seqread_fail.t - gives an exception, is this supposed to happen? Hope this help to iron out bugs when running BioPerl on Windows! Nathan > -----Original Message----- > From: Brian Osborne [mailto:brian_osborne@cognia.com] > Sent: 20 October 2004 19:04 > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Nathan, > > I noticed most of the Registry tests failing. I know what part of the > problem is (getpwuid() not implemented in Windows/Activestate Perl) and I > think I've fixed at least that part. Can you install the most recent > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > >perl -w -I. t/Registry.t > > > Brian O. > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > Sent: Wednesday, October 20, 2004 10:20 AM > To: 'Bioperl' > Subject: RE: [Bioperl-l] make test!! > > Apologise for all the pervious messages! I just wanted to get this onto the > mailing list: > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > System: WinXP Pro > ActiveState Perl 5.8.0 build 804 > Nmake v6.00.8168.0 > > A note beforehand: > The error message I had previously got, and heard others have also received > on other OS's. That contain a "line too long" error when > trying "make test", is due to the limitations of the particular OS. Versions > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > have got round this problem by splitting long command lines from Makefiles > into a series of smaller commands. > > Test Summary: > Failed Test Stat Wstat Total Fail Failed List of Failed > ---------------------------------------------------------------------------- > --- > t\Index.t 22 5632 41 21 51.22% 21-41 > t\Registry.t 22 5632 11 9 81.82% 3-11 > t\seqread_fail.t 255 65280 13 0 0.00% ?? > 115 subtests skipped. > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > okay. > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : > return code '0xff' > Stop. > > Particulars: > t\Index......................NOK 21Can't call method "length" on an > undefined value at t\Index.t line 124, line > 54. > t\Index......................dubious > Test returned status 22 (wstat 5632, 0x1600) > DIED. FAILED tests 21-41 > Failed 21/41 tests, 48.78% okay > t\Registry...................ok 2/11The getpwuid function is unimplemented > at K:\Downloads\FlashGet\Software\Bioinform > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > t\Registry...................dubious > Test returned status 22 (wstat 5632, 0x1600) > t\seqread_fail...............ok 1/13 > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: BioFetch Error 4: ID [XXX111] not found in database > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > STACK: Error::throw > STACK: Bio::Root::Root::throw > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b/Bio/Root/R > oot.pm:328 > STACK: Bio::DB::BioFetch::postprocess_data > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > ib/Bio/DB/BioFetch.pm:406 > STACK: Bio::DB::WebDBSeqI::get_seq_stream > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b/Bio/DB/WebDBSeqI.pm:525 > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > lib/Bio/DB/WebDBSeqI.pm:287 > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > b > /Bio/DB/WebDBSeqI.pm:153 > STACK: main::fetch t\seqread_fail.t:69 > STACK: t\seqread_fail.t:81 > ----------------------------------------------------------- > t\seqread_fail...............dubious > Test returned status 255 (wstat 65280, 0xff00) > after all the subtests completed successfully > > > Nathan > > > -----Original Message----- > > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. Mackey > > Sent: 14 October 2004 21:27 > > To: Bioperl > > Subject: [Bioperl-l] make test!! > > Importance: High > > > > > > I've had only a very few people send me feedback about the current > > state of bioperl-live "make test" on your favorite > > old/crotchety/obscure platforms. I'm writing the Change log and > > thinking about branching, but I'm an experimentalist, I need data! > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > you have everything, "make distclean" if you've built from the cvs > > checkout before, and start from scratch with the usual litany: perl > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > about, not so much all the verbiage (unless there's specific verbiage > > related to the end result ...) > > > > Thanks, > > > > -Aaron > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l@portal.open-bio.org > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0442-2, 14/10/2004 > > Tested on: 14/10/2004 21:59:20 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0442-3, 15/10/2004 > Tested on: 20/10/2004 15:20:04 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > --- > avast! Antivirus: Inbound message clean. > Virus Database (VPS): 0442-3, 15/10/2004 > Tested on: 21/10/2004 07:12:10 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0443-1, 20/10/2004 Tested on: 21/10/2004 12:58:59 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com -------------- next part -------------- Failed Test Stat Wstat Total Fail Failed List of Failed ------------------------------------------------------------------------------- t\ESEfinder.t 5 1280 12 10 83.33% 3-12 t\Index.t 22 5632 41 21 51.22% 21-41 t\ProtPsm.t 1 ?? % ?? t\Registry.t 255 65280 11 8 72.73% 4-11 t\primaryqual.t 255 65280 31 0 0.00% ?? t\seqread_fail.t 255 65280 13 0 0.00% ?? 2 subtests skipped. Failed 6/193 test scripts, 96.89% okay. 35/8919 subtests failed, 99.61% okay. NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : return code '0xff' Stop. NOTES: ------ ESEfinder.t causes my perl to crash Particulars: ------------ t\Biblio_biofetch............ok 1/11Warning: Couldn't connect to BioFetch server with Bio::DB::Medline.pm! ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: retrieval type pipeline unsupported STACK: Error::throw STACK: Bio::Root::Root::throw K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\bl ib\lib/Bio/Root/Root.pm:328 STACK: Bio::DB::Biblio::biofetch::get_seq_stream K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbi operl-live-debug\blib\lib/Bio/DB/Biblio/biofetch.pm:237 STACK: Bio::DB::DBFetch::get_Stream_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-l ive-debug\blib\lib/Bio/DB/DBFetch.pm:194 STACK: Bio::DB::Biblio::biofetch::get_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl -live-debug\blib\lib/Bio/DB/Biblio/biofetch.pm:153 STACK: t\Biblio_biofetch.t:71 ----------------------------------------------------------- t\ESEfinder..................dubious Test returned status 5 (wstat 1280, 0x500) DIED. FAILED tests 3-12 Failed 10/12 tests, 16.67% okay t\Index......................NOK 21Can't call method "length" on an undefined value at t\Index.t line 126, line 54. t\Index......................dubious Test returned status 22 (wstat 5632, 0x1600) DIED. FAILED tests 21-41 Failed 21/41 tests, 48.78% okay t\primaryqual................dubious Test returned status 255 (wstat 65280, 0xff00) after all the subtests completed successfully t\ProtPsm....................ok 5/1Don't know which tests failed: got 5 ok, expected 1 t\Registry...................ok 2/11This Perl doesn't implement function getpwuid(). Skipping... -------------------- WARNING --------------------- MSG: No seqdatabase.ini file found in ~/.bioinformatics/ nor in /etc/bioinformatics/ nor in directory specified by t/data/registry/flat;t/data/registry/bdb. Using web to get database registry from http://www.open-bio.org/registry/seqdatabase.ini --------------------------------------------------- -------------------- WARNING --------------------- MSG: Stored the default registry configuration in /.bioinformatics/seqdatabase.ini --------------------------------------------------- t\Registry...................NOK 5 -------------------- WARNING --------------------- MSG: No database with name testflat in Registry --------------------------------------------------- Can't call method "get_Seq_by_id" on an undefined value at t\Registry.t line 66, line 11. t\Registry...................dubious Test returned status 255 (wstat 65280, 0xff00) DIED. FAILED tests 4-11 Failed 8/11 tests, 27.27% okay t\SeqIO......................ok 196/284 -------------------- WARNING --------------------- MSG: Bio::PrimarySeq=HASH(0x2a9363c) is not a SeqI compliant sequence object! STACK Bio::SeqIO::embl::write_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu g\blib\lib/Bio\SeqIO\embl.pm:410 STACK toplevel t\SeqIO.t:527 t\SeqIO......................ok 198/284 t\SeqIO......................ok 199/284-------------------- WARNING --------------------- MSG: test is not a SeqI compliant sequence object! STACK Bio::SeqIO::embl::write_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu g\blib\lib/Bio\SeqIO\embl.pm:410 STACK (eval) t\SeqIO.t:530 STACK toplevel t\SeqIO.t:529 t\SeqIO......................ok 253/284Location parse, processing 1..105 Location parse, processing <1..>105 Location parse, processing 69^70 Location parse, processing 103^102 t\SeqIO......................ok 259/284 -------------------- WARNING --------------------- MSG: When building a location, start (103) is expected to be less than end (102), however it was not. Switching start and end and setting strand to -1 STACK Bio::Location::Atomic::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug \blib\lib/Bio/Location/Atomic.pm:104 STACK Bio::Location::Simple::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug \blib\lib/Bio\Location\Simple.pm:91 STACK Bio::Factory::FTLocationFactory::_parse_location K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218 t\SeqIO......................ok 262/284STACK Bio::Factory::FTLocationFactory::from_string K:\Downloads\FlashGet\Softwa re\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157 STACK (eval) K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/ FTHelper.pm:124 STACK Bio::SeqIO::FTHelper::_generic_seqfeature K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123 STACK Bio::SeqIO::genbank::next_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-de bug\blib\lib/Bio\SeqIO\genbank.pm:488 STACK (eval) t\SeqIO.t:681 STACK toplevel t\SeqIO.t:680 t\seqread_fail...............ok 1/13 ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: BioFetch Error 4: ID [XXX111] not found in database [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. STACK: Error::throw STACK: Bio::Root::Root::throw K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\bl ib\lib/Bio/Root/Root.pm:328 STACK: Bio::DB::BioFetch::postprocess_data K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl- live-debug\blib\lib/Bio/DB/BioFetch.pm:406 STACK: Bio::DB::WebDBSeqI::get_seq_stream K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-l ive-debug\blib\lib/Bio/DB/WebDBSeqI.pm:525 STACK: Bio::DB::WebDBSeqI::get_Stream_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl -live-debug\blib\lib/Bio/DB/WebDBSeqI.pm:287 STACK: Bio::DB::WebDBSeqI::get_Seq_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-li ve-debug\blib\lib/Bio/DB/WebDBSeqI.pm:153 STACK: main::fetch t\seqread_fail.t:69 STACK: t\seqread_fail.t:81 ----------------------------------------------------------- t\seqread_fail...............dubious Test returned status 255 (wstat 65280, 0xff00) after all the subtests completed successfully t\Swiss......................ok 2/5Location parse, processing 1..? -------------------- WARNING --------------------- MSG: could not find a valid fuzzy encoding for ? STACK Bio::Location::Fuzzy::_fuzzypointdecode K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554 STACK Bio::Location::Fuzzy::end K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ blib\lib/Bio\Location\Fuzzy.pm:254 STACK Bio::Location::Atomic::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug \blib\lib/Bio/Location/Atomic.pm:101 STACK Bio::Location::Fuzzy::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ blib\lib/Bio/Location/Fuzzy.pm:139 STACK Bio::Factory::FTLocationFactory::_parse_location K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218 STACK Bio::Factory::FTLocationFactory::from_string K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157 STACK (eval) K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/ FTHelper.pm:124 STACK Bio::SeqIO::FTHelper::_generic_seqfeature K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123 STACK Bio::SeqIO::swiss::next_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu g\blib\lib/Bio\SeqIO\swiss.pm:326 STACK toplevel t\Swiss.t:47 Location parse, processing ?..409 -------------------- WARNING --------------------- MSG: could not find a valid fuzzy encoding for ? STACK Bio::Location::Fuzzy::_fuzzypointdecode K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554 STACK Bio::Location::Fuzzy::start K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu g\blib\lib/Bio\Location\Fuzzy.pm:229 STACK Bio::Location::Atomic::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug \blib\lib/Bio/Location/Atomic.pm:100 STACK Bio::Location::Fuzzy::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ blib\lib/Bio\Location\Fuzzy.pm:139 STACK Bio::Factory::FTLocationFactory::_parse_location K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218 STACK Bio::Factory::FTLocationFactory::from_string K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157 STACK (eval) K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/ FTHelper.pm:124 STACK Bio::SeqIO::FTHelper::_generic_seqfeature K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123 STACK Bio::SeqIO::swiss::next_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu g\blib\lib/Bio\SeqIO\swiss.pm:326 STACK toplevel t\Swiss.t:47 Location parse, processing 388..388 Location parse, processing 1..? -------------------- WARNING --------------------- MSG: could not find a valid fuzzy encoding for ? STACK Bio::Location::Fuzzy::_fuzzypointdecode K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554 STACK Bio::Location::Fuzzy::end K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ blib\lib/Bio\Location\Fuzzy.pm:254 STACK Bio::Location::Atomic::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug \blib\lib/Bio/Location/Atomic.pm:101 STACK Bio::Location::Fuzzy::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ blib\lib/Bio\Location\Fuzzy.pm:139 STACK Bio::Factory::FTLocationFactory::_parse_location K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218 STACK Bio::Factory::FTLocationFactory::from_string K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157 STACK (eval) K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/ FTHelper.pm:124 STACK Bio::SeqIO::FTHelper::_generic_seqfeature K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123 STACK Bio::SeqIO::swiss::next_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu g\blib\lib/Bio\SeqIO\swiss.pm:326 STACK toplevel t\Swiss.t:62 Location parse, processing ?..409 -------------------- WARNING --------------------- MSG: could not find a valid fuzzy encoding for ? STACK Bio::Location::Fuzzy::_fuzzypointdecode K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554 STACK Bio::Location::Fuzzy::start K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu g\blib\lib/Bio\Location\Fuzzy.pm:229 STACK Bio::Location::Atomic::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug \blib\lib/Bio/Location/Atomic.pm:100 STACK Bio::Location::Fuzzy::new K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ blib\lib/Bio\Location\Fuzzy.pm:139 STACK Bio::Factory::FTLocationFactory::_parse_location K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218 STACK Bio::Factory::FTLocationFactory::from_string K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157 STACK (eval) K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/ FTHelper.pm:124 STACK Bio::SeqIO::FTHelper::_generic_seqfeature K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123 STACK Bio::SeqIO::swiss::next_seq K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu g\blib\lib/Bio\SeqIO\swiss.pm:326 STACK toplevel t\Swiss.t:62 Location parse, processing 388..388 t\Swiss......................ok -------------- next part -------------- Failed Test Stat Wstat Total Fail Failed List of Failed ------------------------------------------------------------------------------- t\Index.t 22 5632 41 21 51.22% 21-41 t\ProtPsm.t 1 ?? % ?? t\Registry.t 255 65280 11 8 72.73% 4-11 t\primaryqual.t 255 65280 31 0 0.00% ?? t\seqread_fail.t 255 65280 13 0 0.00% ?? 115 subtests skipped. Failed 5/193 test scripts, 97.41% okay. 25/8919 subtests failed, 99.72% okay. NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : return code '0xff' Stop. NOTES: ------ plan tests in ProtPsm needs to be changed to 5? Particulars: ------------ t\Index......................NOK 21Can't call method "length" on an undefined value at t\Index.t line 126, line 54. t\Index......................dubious Test returned status 22 (wstat 5632, 0x1600) DIED. FAILED tests 21-41 Failed 21/41 tests, 48.78% okay t\primaryqual................dubious Test returned status 255 (wstat 65280, 0xff00) after all the subtests completed successfully t\ProtPsm....................ok 5/1Don't know which tests failed: got 5 ok, expected 1 t\Registry...................ok 2/11This Perl doesn't implement function getpwuid(). Skipping... -------------------- WARNING --------------------- MSG: No seqdatabase.ini file found in ~/.bioinformatics/ nor in /etc/bioinformatics/ nor in directory specified by t/data/registry/flat;t/data/registry/bdb. Using web to get database registry from http://www.open-bio.org/registry/seqdatabase.ini --------------------------------------------------- -------------------- WARNING --------------------- MSG: Stored the default registry configuration in /.bioinformatics/seqdatabase.ini --------------------------------------------------- t\Registry...................ok 3/11 t\Registry...................NOK 5-------------------- WARNING --------------------- MSG: No database with name testflat in Registry --------------------------------------------------- Can't call method "get_Seq_by_id" on an undefined value at t\Registry.t line 66, line 11. t\Registry...................dubious Test returned status 255 (wstat 65280, 0xff00) DIED. FAILED tests 4-11 t\seqread_fail...............ok 1/13 ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: BioFetch Error 4: ID [XXX111] not found in database [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. STACK: Error::throw STACK: Bio::Root::Root::throw K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live\blib\lib /Bio/Root/Root.pm:328 STACK: Bio::DB::BioFetch::postprocess_data K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl- live\blib\lib/Bio/DB/BioFetch.pm:406 STACK: Bio::DB::WebDBSeqI::get_seq_stream K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-l ive\blib\lib/Bio/DB/WebDBSeqI.pm:525 STACK: Bio::DB::WebDBSeqI::get_Stream_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl -live\blib\lib/Bio/DB/WebDBSeqI.pm:287 STACK: Bio::DB::WebDBSeqI::get_Seq_by_id K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-li ve\blib\lib/Bio/DB/WebDBSeqI.pm:153 STACK: main::fetch t\seqread_fail.t:69 STACK: t\seqread_fail.t:81 ----------------------------------------------------------- t\seqread_fail...............dubious Test returned status 255 (wstat 65280, 0xff00) after all the subtests completed successfully -------------- next part -------------- perl -I. -w t/ESEfinder.t ------------------------- 1..12 error is 0 ok 1 ok 2 $Bio::Tools::Analysis::DNA::ESEfinder=HASH(0x1db571c) = bless( { 'max_redirect' => 7, 'protocols_forbidden' => undef, 'no_proxy' => [], '_RESULT_SPEC' => { '' => 'bulk', 'Bio::SeqFeatureI' => 'ARRAY of B io::SeqFeature::Generic', 'all' => 'Bio::Seq::Meta::Array o bject', 'raw' => 'Array of [ SRprotein, p osition , motif,score]' }, '_url' => 'http://exon.cshl.org/cgi-bin/ESE/esefinder .cgi', '_ANALYSIS_NAME' => 'ESEfinder', '_INPUT_SPEC' => [ { 'name' => 'sequence', 'type' => 'Bio::PrimarySeqI', 'mandatory' => 'true' } ], 'protocols_allowed' => undef, '_ANALYSIS_SPEC' => { 'supplier' => 'Krainer lab, Col d Spring Harbor Laboratory, POBOX100, Bungtown Rd, COld Spring Harbor, NY, USA', 'version' => '2.0', 'name' => 'ESEfinder', 'type' => 'DNA', 'description' => 'to identify e xonic splicing elements in human transcripts' }, '_seq' => bless( { 'display_id' => 'bioperl', '_seq_length' => undef, '_root_verbose' => 0, 'seq' => 'atcgatgctatgcatgctatgggt gtgattcgatgcgactgttcatcgtagccccccccccccccctttt', 'alphabet' => 'dna' }, 'Bio::PrimarySeq' ), 'use_eval' => 1, 'requests_redirectable' => [ 'GET', 'HEAD' ], 'from' => undef, 'timeout' => 180, 'agent' => 'libwww-perl/5.800', '_root_verbose' => '1', 'def_headers' => undef, 'parse_head' => 1, 'proxy' => undef, 'max_size' => undef }, 'Bio::Tools::Analysis::DNA::ESEfinder' ); >bioperl atcgatgctatgcatgctatgggtgtgattcgatgcgactgttcatcgtagccccccccc cccccctttt ok 3 Subroutine new redefined at Bio\Location\Simple.pm line 89, line 31. Subroutine start redefined at Bio\Location\Simple.pm line 111, line 31. Subroutine end redefined at Bio\Location\Simple.pm line 137, line 31. Subroutine length redefined at Bio\Location\Simple.pm line 174, line 31. Subroutine location_type redefined at Bio\Location\Simple.pm line 265, line 31. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 312, line 31. Subroutine trunc redefined at Bio\Location\Simple.pm line 343, line 31. ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 perl -I. -w t/Index.t --------------------- 1..41 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 Subroutine new redefined at Bio\Location\Simple.pm line 89, line 87. Subroutine start redefined at Bio\Location\Simple.pm line 111, line 87. Subroutine end redefined at Bio\Location\Simple.pm line 137, line 87. Subroutine length redefined at Bio\Location\Simple.pm line 174, line 87. Subroutine location_type redefined at Bio\Location\Simple.pm line 265, line 87. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 312, line 87. Subroutine trunc redefined at Bio\Location\Simple.pm line 343, line 87. Subroutine new redefined at Bio\Location\Fuzzy.pm line 137, line 92. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 164, line 92. Subroutine start redefined at Bio\Location\Fuzzy.pm line 226, line 92. Subroutine end redefined at Bio\Location\Fuzzy.pm line 251, line 92. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 276, line 92. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 295, line 92. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 315, line 92. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 344, line 92. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 363, line 92. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 383, line 92. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 450, line 92. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 537, line 92. ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 not ok 21 # Failed test 21 in t/Index.t at line 118 not ok 22 # Failed test 22 in t/Index.t at line 125 Can't call method "length" on an undefined value at t/Index.t line 126, line 54. perl -I. -w t/ProtPsm.t ----------------------- 1..1 Can't locate package Bio::Matrix::PSM::ProtMatrix for @Bio::Matrix::PSM::ProtPsm::ISA at t/ProtPsm.t line 22. ok 1 ok 2 ok 3 ok 4 ok 5 perl -I. -w t/Registry.t ------------------------ 1..11 ok 1 ok 2 This Perl doesn't implement function getpwuid(). Skipping... -------------------- WARNING --------------------- MSG: No seqdatabase.ini file found in ~/.bioinformatics/ nor in /etc/bioinformatics/ nor in directory specified by t/data/registry/flat;t/data/registry/bdb. Using web to get database registry from http://www.open-bio.org/registry/seqdatabase.ini --------------------------------------------------- -------------------- WARNING --------------------- MSG: Stored the default registry configuration in /.bioinformatics/seqdatabase.ini --------------------------------------------------- ok 3 not ok 4 # Failed test 4 in t/Registry.t at line 61 not ok 5 # Failed test 5 in t/Registry.t at line 63 -------------------- WARNING --------------------- MSG: No database with name testflat in Registry --------------------------------------------------- not ok 6 # Failed test 6 in t/Registry.t at line 65 Can't call method "get_Seq_by_id" on an undefined value at t/Registry.t line 66, line 11. perl -I. -w t/primaryqual.t --------------------------- # lots of output then: Can't locate object method "header" via package "Bio::Seq::SeqWithQuality" at Bio\SeqIO\qual.pm line 211, line 1. From nathanhaigh at ukonline.co.uk Fri Oct 22 06:12:11 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Mon Oct 25 15:26:16 2004 Subject: [Bioperl-l] Bioblio_biofetch.t failure on windows Message-ID: When running nmake I get an exception error "retrieval type pipeline unsupported" I have narrowed down the bug to Bio::DB::WebDBSeqI.pm which sets the default retrieval_type to pipeline. Needless to say pipes and forks are not well implemented on windows (if at all)! I've notice in the CVS that has been several attempts to fix bug such as this - I don't know if they were to address this particular problem. But as far as I see, there seems to be several attempts at a workaround in the get_seq_stream. Could the line: $self->retrieval_type('io_string') if $self->retrieval_type =~ /pipeline/ && $^O =~ /^MSWin/; be simply moved into the "new" sub after setting the retrieval type or would this break something else? For the time being copying the line into the "new" sub fixes things in the Biblio_biofetch test; except for reporting inconsistence between the actual and expected identifier numbers (but this loos like it's due to the comparison between two different id's . So that it reads: $params && $self->url_params($params); $db && $self->db($db); $ret_type && $self->retrieval_type($ret_type); # workaround for MSWin systems $self->retrieval_type('io_string') if $self->retrieval_type =~ /pipeline/ && $^O =~ /^MSWin/; $delay = $self->delay_policy unless defined $delay; --- avast! Antivirus: Outbound message clean. Virus Database (VPS): 0443-2, 21/10/2004 Tested on: 22/10/2004 11:12:11 avast! is copyright (c) 2000-2003 ALWIL Software. http://www.avast.com From skirov at utk.edu Sat Oct 16 11:54:05 2004 From: skirov at utk.edu (Stefan Kirov) Date: Mon Oct 25 15:26:29 2004 Subject: [Bioperl-l] Deprecating In-Reply-To: References: Message-ID: <4171441D.6030502@utk.edu> Here is the meme file with strand data this time. Enjoy :-), Stefan Brian Osborne wrote: >Stefan, > >I took a look at AlignIO/meme.pm and fixed some obvious problems but I think >it's possible that the file used in the tests, t/data/meme.dat, may not have >all the information I need to debug the module (and I don't have meme >myself). Question: is "strand" ever stipulated in the meme output file? >There's no "+" or "-" indicated in meme.dat. This file is the result of an >analysis of DNA, so I'm a bit surprised not to see some indication of strand >(and the code, before I modified it, was using a regexp that attempted to >capture strand information). Can you enlighten me here? Here's one of the >relevant sections: > > >Sequence name Start P-value Site >------------- ----- --------- ----------------------- >-- >6603 1311 2.59e-15 GGCGCATTGA >CAGAAAAATTGAATTCCCACCCCCC AATGAGGAGG >83796 1284 2.59e-15 GGAGGATTGA >CAGAAAAATTGAATTCCCACCCCCC AACGAGGAGG >20218 938 6.34e-12 TTTTTGGTAA >CCTTAAAATAAAATCCCCACCACCA CTTTTAAAAA >10657 1685 8.70e-12 GGCCCGCGCG >CAGACAAAGACATTCCACAGCTCCC GCCCCCTCCA > >Perhaps when one runs meme with DNA one can tell it to just do 1 strand, >rather than both? This would explain the absence of strand information, but >it means the regexp changes depending on this mode. Again, I don't have meme >or use meme, so you're going to have to tell me, or send me output files >with and without strand stipulation. > >Brian O. > >-----Original Message----- >From: Stefan Kirov [mailto:skirov@utk.edu] >Sent: Friday, October 15, 2004 6:33 PM >To: Brian Osborne >Cc: bioperl-l@bioperl.org >Subject: Re: [Bioperl-l] Deprecating > >I wonder if anyone uses *Bio::AlignIO::meme*. Last time (year ago) it >did not work for me and I have not seen anyone committing changes.... >Stefan > >Brian Osborne wrote: > > > >>Bioperl-l, >> >>Any objections to my adding Bio::Tools::RestrictionEnzyme to the DEPRECATED >>file? It was replaced by Bio::Restriction a while ago. >> >>Along the same lines, is there anything else that should be deprecated? >>Bio::Tools::GFF? >> >>Brian O. >> >> >> >> >>_______________________________________________ >>Bioperl-l mailing list >>Bioperl-l@portal.open-bio.org >>http://portal.open-bio.org/mailman/listinfo/bioperl-l >> >> >> >> > >-- >Stefan Kirov, Ph.D. >University of Tennessee/Oak Ridge National Laboratory >5700 bldg, PO BOX 2008 MS6164 >Oak Ridge TN 37831-6164 >USA >tel +865 576 5120 >fax +865-576-5332 >e-mail: skirov@utk.edu >sao@ornl.gov > >"And the wars go on with brainwashed pride >For the love of God and our human rights >And all these things are swept aside" > > >_______________________________________________ >Bioperl-l mailing list >Bioperl-l@portal.open-bio.org >http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- Stefan Kirov, Ph.D. University of Tennessee/Oak Ridge National Laboratory 5700 bldg, PO BOX 2008 MS6164 Oak Ridge TN 37831-6164 USA tel +865 576 5120 fax +865-576-5332 e-mail: skirov@utk.edu sao@ornl.gov "And the wars go on with brainwashed pride For the love of God and our human rights And all these things are swept aside" -------------- next part -------------- ******************************************************************************** MEME - Motif discovery tool ******************************************************************************** MEME version 3.0 (Release date: 2002/04/02 00:11:59) For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.sdsc.edu. This file may be used as input to the MAST algorithm for searching sequence databases for matches to groups of motifs. MAST is available for interactive use and downloading at http://meme.sdsc.edu. ******************************************************************************** ******************************************************************************** REFERENCE ******************************************************************************** If you use this program in your research, please cite: Timothy L. Bailey and Charles Elkan, "Fitting a mixture model by expectation maximization to discover motifs in biopolymers", Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press, Menlo Park, California, 1994. ******************************************************************************** ******************************************************************************** TRAINING SET ******************************************************************************** DATAFILE= test.fasta ALPHABET= ACGT Sequence name Weight Length Sequence name Weight Length ------------- ------ ------ ------------- ------ ------ 68723 1.0000 2000 16939 1.0000 2001 20754 1.0000 2001 6707 1.0000 2000 20755 1.0000 2000 6700 1.0000 2002 20760 1.0000 2000 20761 1.0000 2000 20762 1.0000 2000 ******************************************************************************** ******************************************************************************** COMMAND LINE SUMMARY ******************************************************************************** This information can also be useful in the event you wish to report a problem with the MEME software. command: meme test.fasta -dna -nostatus -nmotifs 2 -minsites 8 -maxw 20 -revcomp model: mod= zoops nmotifs= 2 evt= inf object function= E-value of product of p-values width: minw= 8 maxw= 20 minic= 0.00 width: wg= 11 ws= 1 endgaps= yes nsites: minsites= 8 maxsites= 9 wnsites= 0.8 theta: prob= 1 spmap= uni spfuzz= 0.5 em: prior= dirichlet b= 0.01 maxiter= 50 distance= 1e-05 data: n= 18004 N= 9 strands: + - sample: seed= 0 seqfrac= 1 Letter frequencies in dataset: A 0.295 C 0.205 G 0.205 T 0.295 Background letter frequencies (from dataset with add-one prior applied): A 0.295 C 0.205 G 0.205 T 0.295 ******************************************************************************** ******************************************************************************** MOTIF 1 width = 20 sites = 8 llr = 147 E-value = 1.3e-002 ******************************************************************************** -------------------------------------------------------------------------------- Motif 1 Description -------------------------------------------------------------------------------- Simplified A ::a1::931:6:348:1::1 pos.-specific C aa:::8:11841:331:139 probability G :::9::::63::84::3:8: matrix T ::::a3161::9:::969:: bits 2.3 ** 2.1 ** 1.8 *** * 1.6 ***** * Information 1.4 ****** * ** * *** content 1.1 ******* * ** ** *** (26.5 bits) 0.9 ******* **** ** *** 0.7 ******* ***** ****** 0.5 ******************** 0.2 ******************** 0.0 -------------------- Multilevel CCAGTCATGCATGAATTTGC consensus T A GC AGC G C sequence C -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif 1 sites sorted by position p-value -------------------------------------------------------------------------------- Sequence name Strand Start P-value Site ------------- ------ ----- --------- -------------------- 20761 + 1879 6.50e-13 TCTGATTAAG CCAGTCATGCATGGATTTGC ATTTTGGTTG 20760 + 1875 6.50e-13 CCCAGTCACG CCAGTCATGCATGGATTTGC ATTTTGATTG 6700 + 1100 2.27e-10 CCTGCTCATG CCAGTCATGGATAAATTTGC ATCTGGCTTA 20755 + 1478 5.08e-10 CCCTGTCAGG CCAGTTATGGATGAATGTGC ACTTAANNNN 6707 + 1431 6.11e-09 TCACACAGAT CCAGTCAATCCTGCCTGTCC ATCTCAATGA 20762 + 1878 1.89e-08 CCTGGTTAGG CCAGTTAAACACAGATTTGC ATTTTGGTTA 16939 - 914 2.01e-08 ACTTTTCCTT CCAATCATGCCTGCCCTTGA ACCCTATTGG 20754 + 1175 6.73e-08 GCTCACCTTG CCAGTCTCCCCTGAATACCC TACATGCCCT -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif 1 block diagrams -------------------------------------------------------------------------------- SEQUENCE NAME POSITION P-VALUE MOTIF DIAGRAM ------------- ---------------- ------------- 20761 6.5e-13 1878_[+1]_102 20760 6.5e-13 1874_[+1]_106 6700 2.3e-10 1099_[+1]_883 20755 5.1e-10 1477_[+1]_503 6707 6.1e-09 1430_[+1]_550 20762 1.9e-08 1877_[+1]_103 16939 2e-08 913_[-1]_1068 20754 6.7e-08 1174_[+1]_807 -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif 1 in BLOCKS format -------------------------------------------------------------------------------- BL MOTIF 1 width=20 seqs=8 20761 ( 1879) CCAGTCATGCATGGATTTGC 1 20760 ( 1875) CCAGTCATGCATGGATTTGC 1 6700 ( 1100) CCAGTCATGGATAAATTTGC 1 20755 ( 1478) CCAGTTATGGATGAATGTGC 1 6707 ( 1431) CCAGTCAATCCTGCCTGTCC 1 20762 ( 1878) CCAGTTAAACACAGATTTGC 1 16939 ( 914) CCAATCATGCCTGCCCTTGA 1 20754 ( 1175) CCAGTCTCCCCTGAATACCC 1 // -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif 1 position-specific scoring matrix -------------------------------------------------------------------------------- log-odds matrix: alength= 4 w= 20 n= 17833 bayes= 11.1216 E= 1.3e-002 -965 229 -965 -965 -965 229 -965 -965 176 -965 -965 -965 -124 -965 210 -965 -965 -965 -965 176 -965 187 -965 -24 157 -965 -965 -124 -24 -71 -965 108 -124 -71 161 -124 -965 187 29 -965 108 87 -965 -965 -965 -71 -965 157 -24 -965 187 -965 34 29 87 -965 134 29 -965 -965 -965 -71 -965 157 -124 -965 29 108 -965 -71 -965 157 -965 29 187 -965 -124 210 -965 -965 -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif 1 position-specific probability matrix -------------------------------------------------------------------------------- letter-probability matrix: alength= 4 w= 20 n= 17833 E= 1.3e-002 0.000369 0.999007 0.000255 0.000369 0.000369 0.999007 0.000255 0.000369 0.999120 0.000255 0.000255 0.000369 0.125213 0.000255 0.874163 0.000369 0.000369 0.000255 0.000255 0.999120 0.000369 0.749319 0.000255 0.250057 0.874276 0.000255 0.000255 0.125213 0.250057 0.125099 0.000255 0.624589 0.125213 0.125099 0.624475 0.125213 0.000369 0.749319 0.249943 0.000369 0.624589 0.374787 0.000255 0.000369 0.000369 0.125099 0.000255 0.874276 0.250057 0.000255 0.749319 0.000369 0.374901 0.249943 0.374787 0.000369 0.749432 0.249943 0.000255 0.000369 0.000369 0.125099 0.000255 0.874276 0.125213 0.000255 0.249943 0.624589 0.000369 0.125099 0.000255 0.874276 0.000369 0.249943 0.749319 0.000369 0.125213 0.874163 0.000255 0.000369 -------------------------------------------------------------------------------- Time 75.70 secs. ******************************************************************************** ******************************************************************************** MOTIF 2 width = 15 sites = 8 llr = 117 E-value = 1.2e+003 ******************************************************************************** -------------------------------------------------------------------------------- Motif 2 Description -------------------------------------------------------------------------------- Simplified A :1a39:::::18::: pos.-specific C ::::1:::8a::::: probability G 96:3::1:::::4:: matrix T 13:5:a9a3:936aa bits 2.3 * 2.1 * 1.8 * * * * ** 1.6 * * * * * ** Information 1.4 * * ****** ** content 1.1 * * ******* ** (21.0 bits) 0.9 * * *********** 0.7 *** *********** 0.5 *************** 0.2 *************** 0.0 --------------- Multilevel GGATATTTCCTATTT consensus T A T TG sequence G -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif 2 sites sorted by position p-value -------------------------------------------------------------------------------- Sequence name Strand Start P-value Site ------------- ------ ----- --------- --------------- 20762 + 1845 2.62e-09 TCCAGGAACA GGATATTTCCTATTT TTGAGAGTCC 6700 + 1068 2.62e-09 TTTCAGAACA GGATATTTCCTATTT TGAGTATCCT 20755 + 1445 2.84e-08 GCCAAGGGTG GGATATTTTCTATTT TGTAGAGTCC 20754 - 664 5.62e-08 TTTCTTAGAA GGAAATTTCCTTGTT CTCTTTCTAT 20761 + 670 1.06e-07 GAAGAAAAAG GAAGATTTCCTAGTT AACAATTCAA 68723 - 1925 5.26e-07 TTGCTTTCTT TGAGATGTCCTAGTT CACTCCTAAA 20760 - 651 5.56e-07 TTTAAACTTG GTAAATTTTCTTTTT CTTCACATTT 16939 - 1616 6.78e-07 TAGTTCAGTT GTATCTTTCCAATTT TGATGTTTGG -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif 2 block diagrams -------------------------------------------------------------------------------- SEQUENCE NAME POSITION P-VALUE MOTIF DIAGRAM ------------- ---------------- ------------- 20762 2.6e-09 1844_[+2]_141 6700 2.6e-09 1067_[+2]_920 20755 2.8e-08 1444_[+2]_541 20754 5.6e-08 663_[-2]_1323 20761 1.1e-07 669_[+2]_1316 68723 5.3e-07 1924_[-2]_61 20760 5.6e-07 650_[-2]_1335 16939 6.8e-07 1615_[-2]_371 -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif 2 in BLOCKS format -------------------------------------------------------------------------------- BL MOTIF 2 width=15 seqs=8 20762 ( 1845) GGATATTTCCTATTT 1 6700 ( 1068) GGATATTTCCTATTT 1 20755 ( 1445) GGATATTTTCTATTT 1 20754 ( 664) GGAAATTTCCTTGTT 1 20761 ( 670) GAAGATTTCCTAGTT 1 68723 ( 1925) TGAGATGTCCTAGTT 1 20760 ( 651) GTAAATTTTCTTTTT 1 16939 ( 1616) GTATCTTTCCAATTT 1 // -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif 2 position-specific scoring matrix -------------------------------------------------------------------------------- log-odds matrix: alength= 4 w= 15 n= 17878 bayes= 11.1253 E= 1.2e+003 -965 -965 210 -124 -124 -965 161 -24 176 -965 -965 -965 -24 -965 29 76 157 -71 -965 -965 -965 -965 -965 176 -965 -965 -71 157 -965 -965 -965 176 -965 187 -965 -24 -965 229 -965 -965 -124 -965 -965 157 134 -965 -965 -24 -965 -965 87 108 -965 -965 -965 176 -965 -965 -965 176 -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif 2 position-specific probability matrix -------------------------------------------------------------------------------- letter-probability matrix: alength= 4 w= 15 n= 17878 E= 1.2e+003 0.000369 0.000255 0.874163 0.125213 0.125213 0.000255 0.624475 0.250057 0.999120 0.000255 0.000255 0.000369 0.250057 0.000255 0.249943 0.499745 0.874276 0.125099 0.000255 0.000369 0.000369 0.000255 0.000255 0.999120 0.000369 0.000255 0.125099 0.874276 0.000369 0.000255 0.000255 0.999120 0.000369 0.749319 0.000255 0.250057 0.000369 0.999007 0.000255 0.000369 0.125213 0.000255 0.000255 0.874276 0.749432 0.000255 0.000255 0.250057 0.000369 0.000255 0.374787 0.624589 0.000369 0.000255 0.000255 0.999120 0.000369 0.000255 0.000255 0.999120 -------------------------------------------------------------------------------- Time 152.20 secs. ******************************************************************************** ******************************************************************************** SUMMARY OF MOTIFS ******************************************************************************** -------------------------------------------------------------------------------- Combined block diagrams: non-overlapping sites with p-value < 0.0001 -------------------------------------------------------------------------------- SEQUENCE NAME COMBINED P-VALUE MOTIF DIAGRAM ------------- ---------------- ------------- 68723 2.83e-04 473_[-1(8.43e-06)]_[+1(1.38e-05)]_[+1(1.38e-05)]_35_[-1(3.15e-06)]_[+1(1.38e-05)]_9_[-1(7.89e-05)]_63_[-1(2.97e-06)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_26_[+2(4.37e-06)]_46_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_6_[-1(7.97e-06)]_24_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_1_[-2(5.92e-05)]_279_[-1(8.43e-06)]_[+1(1.38e-05)]_[+2(5.60e-05)]_157_[-2(5.26e-07)]_61 16939 3.50e-06 913_[-1(2.01e-08)]_682_[-2(6.78e-07)]_205_[+1(5.80e-05)]_146 20754 1.05e-06 39_[-2(1.78e-05)]_4_[+1(4.78e-06)]_564_[-2(7.42e-05)]_6_[-2(5.62e-08)]_146_[+2(3.98e-05)]_335_[+1(6.73e-08)]_93_[+1(5.54e-05)]_694 6707 2.26e-05 173_[+1(4.46e-05)]_655_[-2(5.60e-05)]_3_[+1(3.06e-06)]_12_[+1(4.78e-06)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.93e-05)]_181_[-1(3.26e-05)]_251_[+1(6.11e-09)]_329_[+1(6.34e-05)]_201 20755 5.26e-09 160_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_3_[+1(6.41e-06)]_219_[-1(4.80e-05)]_962_[+2(2.84e-08)]_18_[+1(5.08e-10)]_6_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_14_[+1(7.97e-06)]_83 6700 2.48e-10 48_[+1(7.97e-06)]_267_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_129_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_3_[+1(4.41e-06)]_280_[+2(2.62e-09)]_17_[+1(2.27e-10)]_101_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+2(7.29e-05)]_[+1(6.41e-06)]_604_[-1(8.43e-06)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_3 20760 1.53e-10 259_[-1(6.20e-05)]_339_[-2(3.17e-05)]_17_[-2(5.56e-07)]_436_[-2(4.06e-05)]_7_[+1(2.95e-07)]_6_[-1(1.12e-05)]_705_[+1(6.50e-13)]_106 20761 3.10e-11 397_[-2(1.10e-06)]_257_[+2(1.06e-07)]_382_[-2(5.60e-05)]_[+2(7.29e-05)]_[-1(3.24e-06)]_[+1(1.38e-05)]_[+1(1.38e-05)]_722_[+1(6.50e-13)]_102 20762 1.72e-08 134_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_[+1(1.38e-05)]_92_[+2(9.22e-05)]_517_[+1(7.97e-06)]_7_[-1(4.78e-06)]_439_[+2(2.62e-09)]_18_[+1(1.89e-08)]_103 -------------------------------------------------------------------------------- ******************************************************************************** ******************************************************************************** Stopped because nmotifs = 2 reached. ******************************************************************************** CPU: crick ******************************************************************************** From ssri12 at yahoo.com Wed Oct 20 23:03:35 2004 From: ssri12 at yahoo.com (Sudha S) Date: Mon Oct 25 15:26:38 2004 Subject: [Bioperl-l] Problems installing Bio::DB Message-ID: <20041021030335.78467.qmail@web41212.mail.yahoo.com> Hi, I have been trying to install the Bio::DB for a week now and I need some help in this badly. I keep getting the error : 'Error: no suitable installation target found for package bioperl-db.' I remember that i was prompted to give path for /usr/lib directory and I do not have this folder on my machine which is running Windows XP. What should be done to get over this problem? Thank you, Sudha _______________________________ Do you Yahoo!? Declare Yourself - Register online to vote today! http://vote.yahoo.com From Ying.Sun at ebc.uu.se Mon Oct 25 10:40:22 2004 From: Ying.Sun at ebc.uu.se (Ying Sun) Date: Mon Oct 25 15:26:56 2004 Subject: [Bioperl-l] bioperl problem Message-ID: <003301c4baa0$8e93ef90$bc9aee82@home> Dear there: Thank you for take time to see my problem in Bioperl.My problem is as follows: I use the Cygwin to run the Bioperl programme. In my programme, I use module Bio::Perl and function get_sequence. But when I run this programme, I got error report: Your system does not have one of LWP, HTTP::Request::Common, IO::String installed so the DB retrieval method is not available. Becusue the LWP in another pathway(my Bio::Perl module in /home/myhome/.cpan/build/bioperl-1.4), so I add this script like that use lib "/home/myhome/.cpan/build/libwww-perl-5.800/lib"; But it does not work. So,I have no idea of how to use the modules and solve the problems.Could someone give me a help? Thanks a lot. Best, Ying From gyang at plantbio.uga.edu Mon Oct 25 16:38:25 2004 From: gyang at plantbio.uga.edu (Guojun Yang) Date: Mon Oct 25 16:37:11 2004 Subject: [Bioperl-l] Bio::Index::Fasta difficulty Message-ID: <20041025163825.ce56116f@dogwood.plantbio.uga.edu> Hi, everybody, I encountered a difficulty when I am trying to index a database and retrieve items. The following is the sub: $ENV{BIOPERL_INDEX_TYPE}="SDBM_File"; $ENV{BIOPERL_INDEX}="."; ... sub getseq { use Bio::Index::Fasta; use strict; my $name=$_[0]; my $file_name=$_[1]; my $inx=Bio::Index::Fasta->new (-filename=>$file_name.".idx", -write_flag=>1); $inx->id_parser(\&get_id); $inx->make_index($file_name); my $seq =$inx->fetch($name); return $seq; } sub get_id { my $header=shift; $header=~ /^>(.*)/i; $1; } when the script was run in windows 2000, it produced two files with .idx.pag (fairly big file) and .idx.dir (relatively small file). Everything went perfect. However, when I try to move the same code to a linux system (either ReadHat or Suse). There is only one .idx file produced and is significantly smaller than the .idx.pag from windows. It does not return a valid $seq object in Linux. I tried to change some thing and tried the bioperl /scripts/index/bp_index.PLS, nothing seems to work in linux. Is there any idea about what is happening in this situation? Thank you, Yang From amackey at pcbi.upenn.edu Mon Oct 25 20:11:13 2004 From: amackey at pcbi.upenn.edu (Aaron J. Mackey) Date: Mon Oct 25 20:12:07 2004 Subject: [Bioperl-l] Bio::SearchIO TFASTX parsing bug In-Reply-To: <41752D91.1020303@fiocruz.br> References: <41752D91.1020303@fiocruz.br> Message-ID: <417D9621.9080902@pcbi.upenn.edu> Fixed, thanks for the report. Your daily CVS update should get the patch soon. -Aaron Daniel Mascarenhas wrote: > Hello, > > we've been using $hit->logical_length('query') on TFASTX reports and > noticed that it corresponds to $result->query_length divided by 3. That > is exactly what we would expect for TBLASTX, where both the query and > hit sequences are translated into aminoacid sequences, however, TFASTX > compares a protein sequence to a DNA sequence database and therefore > just the hit logical length makes sense. So, everything else that > depends on the $hit->logical_length('query') is miscalculated. > > We're using bioperl-live from cvs (updated almost daily). > > Cheers, > Daniel > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l From brian_osborne at cognia.com Mon Oct 25 21:58:23 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Mon Oct 25 21:57:05 2004 Subject: [Bioperl-l] problems with bioperl's Bio::SeqIO::qual In-Reply-To: Message-ID: Carlos, I've committed a change to qual.pm in bioperl-live that seems to fix this (and a test for the fix in t/primaryqual.t), take a look. Brian O. -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Carlos Mauricio La Rota Sent: Tuesday, October 19, 2004 11:09 AM To: bioperl-l@bioperl.org Subject: [Bioperl-l] problems with bioperl's Bio::SeqIO::qual Hello friends (and Chad Matsalla) I am having problems with the method (function) "write_seq()" implemented in Bio::SeqIO::qual . I have an output stream: __ $QualOUT = Bio::SeqIO->new(-fh => \*QUALOUT, '-format' =>'qual'); __ that I am trying to print into with preformed PrimaryQual objects. These objects have been loaded with Id(), quality values, and a description (the rest of the fasta sequence header that is not part of its id). However, the method that writes the object to the OUT stream does not care to print the description if there is one available. So I tried instead to manually override the id in the $source object by giving it a header description when printing like this: print $QualOUT->write_seq(-source => $outQualObj , -header => $SeqHeader); where $SeqHeader had been predefined as the concatenation of the id and the description (basically a string). However, method write_seq() continues to use the objects id, even though I am telling it to use my text defined in the "-header" flag. I basically want to print out a quality file that contain the exact same headers as the corresponding fasta file (which is the way Phred prints them). Thanks. ======================== C.Mauricio La Rota Lawrence Lab Virginia Bioinformatics Institute _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l From hlapp at gmx.net Tue Oct 26 02:11:50 2004 From: hlapp at gmx.net (Hilmar Lapp) Date: Tue Oct 26 02:11:15 2004 Subject: [Bioperl-l] Problems installing Bio::DB In-Reply-To: <20041021030335.78467.qmail@web41212.mail.yahoo.com> Message-ID: Sorry I can't help here since I've never tried to install bioperl-db on Windows. Can anyone out there who is on the same platform help? -hilmar On Wednesday, October 20, 2004, at 08:03 PM, Sudha S wrote: > > Hi, > > I have been trying to install the Bio::DB for a week > now and I need some help in this badly. > I keep getting the error : > > 'Error: no suitable installation target found for > package bioperl-db.' > > I remember that i was prompted to give path for > /usr/lib directory and I do not have this folder on my > machine which is running Windows XP. What should be > done to get over this problem? > > Thank you, > Sudha > > > > _______________________________ > Do you Yahoo!? > Declare Yourself - Register online to vote today! > http://vote.yahoo.com > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- From brian_osborne at cognia.com Tue Oct 26 08:15:26 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Tue Oct 26 08:14:49 2004 Subject: [Bioperl-l] Bio::Index::Fasta difficulty In-Reply-To: <20041025163825.ce56116f@dogwood.plantbio.uga.edu> Message-ID: Yang, Any error messages? Brian O. -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Guojun Yang Sent: Monday, October 25, 2004 4:38 PM To: bioperl-l@portal.open-bio.org Subject: [Bioperl-l] Bio::Index::Fasta difficulty Hi, everybody, I encountered a difficulty when I am trying to index a database and retrieve items. The following is the sub: $ENV{BIOPERL_INDEX_TYPE}="SDBM_File"; $ENV{BIOPERL_INDEX}="."; ... sub getseq { use Bio::Index::Fasta; use strict; my $name=$_[0]; my $file_name=$_[1]; my $inx=Bio::Index::Fasta->new (-filename=>$file_name.".idx", -write_flag=>1); $inx->id_parser(\&get_id); $inx->make_index($file_name); my $seq =$inx->fetch($name); return $seq; } sub get_id { my $header=shift; $header=~ /^>(.*)/i; $1; } when the script was run in windows 2000, it produced two files with .idx.pag (fairly big file) and .idx.dir (relatively small file). Everything went perfect. However, when I try to move the same code to a linux system (either ReadHat or Suse). There is only one .idx file produced and is significantly smaller than the .idx.pag from windows. It does not return a valid $seq object in Linux. I tried to change some thing and tried the bioperl /scripts/index/bp_index.PLS, nothing seems to work in linux. Is there any idea about what is happening in this situation? Thank you, Yang _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l From brian_osborne at cognia.com Tue Oct 26 08:15:26 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Tue Oct 26 08:19:21 2004 Subject: [Bioperl-l] Problems installing Bio::DB In-Reply-To: Message-ID: Sudha, If you want bioperl-db and you must use Windows then you might consider Cygwin, it's a Unix emulator. Very easy to install, and I've installed and tested bioperl-db in Cygwin using both Mysql and Postgres (and Postgres comes with Cygwin, simplifying matters). Brian O. -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Hilmar Lapp Sent: Tuesday, October 26, 2004 2:12 AM To: Sudha S Cc: bioperl-l@bioperl.org Subject: Re: [Bioperl-l] Problems installing Bio::DB Sorry I can't help here since I've never tried to install bioperl-db on Windows. Can anyone out there who is on the same platform help? -hilmar On Wednesday, October 20, 2004, at 08:03 PM, Sudha S wrote: > > Hi, > > I have been trying to install the Bio::DB for a week > now and I need some help in this badly. > I keep getting the error : > > 'Error: no suitable installation target found for > package bioperl-db.' > > I remember that i was prompted to give path for > /usr/lib directory and I do not have this folder on my > machine which is running Windows XP. What should be > done to get over this problem? > > Thank you, > Sudha > > > > _______________________________ > Do you Yahoo!? > Declare Yourself - Register online to vote today! > http://vote.yahoo.com > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- _______________________________________________ Bioperl-l mailing list Bioperl-l@portal.open-bio.org http://portal.open-bio.org/mailman/listinfo/bioperl-l From gyang at plantbio.uga.edu Tue Oct 26 10:03:23 2004 From: gyang at plantbio.uga.edu (Guojun Yang) Date: Tue Oct 26 10:02:07 2004 Subject: [Bioperl-l] Bio::Index::Fasta difficulty In-Reply-To: Message-ID: <20041026100323.df793949@dogwood.plantbio.uga.edu> Hi, Brian, I tried Bio::DB::Fasta, it does not work either on Linux or Windows 2000. No error messages, but not $seq object. Currently, the only working system is Bio::Index::Fasta on Windows 2000. I really need to make it working on Linux. Appreciate you help! Yang Hi, Brian, Thank you for your reply. There is no error message when the idx file was made. No error message when retrieving. But there is no result, so the continuing operation(not included in my script shown) of $seq->length() returned error saying "can't call method length() on an undefined data. Apparently, there is nothing return for $seq. My feeling is that the indexing is not working. BTW, by database file contains a single word such as ">protein1" as the header for each entry. It worked perfectly in Windows! I will also try Bio::DB::FASTA. I look forward to hearing more from you. Yang ----- Original Message ----- From: Brian Osborne To: Guojun Yang , bioperl-l@portal.open-bio.org Sent: Tue, 26 Oct 2004 08:15:26 -0400 Subject: RE: [Bioperl-l] Bio::Index::Fasta difficulty > Yang, > > Any error messages? > > Brian O. > > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Guojun Yang > Sent: Monday, October 25, 2004 4:38 PM > To: bioperl-l@portal.open-bio.org > Subject: [Bioperl-l] Bio::Index::Fasta difficulty > > Hi, everybody, > I encountered a difficulty when I am trying to index a database and retrieve > items. The following is the sub: > > $ENV{BIOPERL_INDEX_TYPE}="SDBM_File"; > $ENV{BIOPERL_INDEX}="."; > > ... > > sub getseq { > use Bio::Index::Fasta; > use strict; > my $name=$_[0]; > my $file_name=$_[1]; > my $inx=Bio::Index::Fasta->new (-filename=>$file_name.".idx", > -write_flag=>1); > $inx->id_parser(\&get_id); > $inx->make_index($file_name); > my $seq =$inx->fetch($name); > return $seq; > } > > sub get_id { > my $header=shift; > $header=~ /^>(.*)/i; > $1; > } > > > when the script was run in windows 2000, it produced two files with .idx.pag > (fairly big file) and .idx.dir (relatively small file). Everything went > perfect. However, when I try to move the same code to a linux system (either > ReadHat or Suse). There is only one .idx file produced and is significantly > smaller than the .idx.pag from windows. It does not return a valid $seq > object in Linux. I tried to change some thing and tried the bioperl > /scripts/index/bp_index.PLS, nothing seems to work in linux. Is there any > idea about what is happening in this situation? > Thank you, > Yang > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > From cjfields at uiuc.edu Tue Oct 26 11:08:00 2004 From: cjfields at uiuc.edu (Chris Fields) Date: Tue Oct 26 11:09:02 2004 Subject: [Bioperl-l] Problems installing Bio::DB In-Reply-To: References: <20041021030335.78467.qmail@web41212.mail.yahoo.com> Message-ID: <6.1.1.1.2.20041026091722.01a10290@express.cites.uiuc.edu> At 01:11 AM 10/26/2004, you wrote: >Sorry I can't help here since I've never tried to install bioperl-db on >Windows. Can anyone out there who is on the same platform help? > > -hilmar I have installed bioperl-db on Windows XP without a problem (although I plan on switching over to MacOSX within a year!). Basically, here's what I did: 1) Install Activestate's free Perl package (the latest version of Perl 5.8). 2) Using PPM, install Bioperl. There are installation instructions for this on the website, and I think Sudha has progressed at least this far. 3) Install your database of choice. I installed MySQL (which has a Windows installer). 4) Install the database interface modules (DBI and DBD-MySQL, both available through PPM). Adding Randy Kobe's repository in PPM helps here, although it isn't necessary (it does help if you want other modules for bioperl, like GD). 5) Get BioSQL schema. Judging by the error, you may be missing this or bioperl-db (which operates with BioSQL). a) Go to the CVS repository and download the bioperl-db package as tarball. b) Decompress the tarball and view the installation instructions. This will tell you where to get BioSQL (hint: it's in the same CVS repository as well as the CVS mentioned in the installation files). c) Get the particular schema for your database. This is located in biosql-schema/sql. 6) Install bioperl-db using nmake. This worked well for me, although nmake is notoriously buggy sometimes. a) Using a shell (or command prompt for Windows users), migrate to the bioperl-db folder (which you decompressed above). b) Type the following: perl Makefile.PL nmake nmake install c) You might get some errors here with nmake. Don't panic (and remember your towel). Okay, bad Douglas Adams humor... d) You don't have nmake?!? get the old nmake here: http://download.microsoft.com/download/vc15/Patch/1.52/W95/EN-US/Nmake15.exe e) nmake also comes with MSVC++. You don't have MSVC++?!? Don't panic yet, because... f) I've heard reports that make also works (using MinGW or other windows-ported tools), but I haven't tried these, so be warned. 7) create you database. mysqladmin -u root create bioseqdb 8) load the schema into your database. mysql -u root bioseqdb < biosqldb-mysql.sql 9) load the taxonomy database if needed (I think it's recommended). The script is in the biosql-schema/scripts folder. Anything I'm missing? I think I've listed almost everything. I do think Cygwin is a good alternative (the installation is exactly like the instructions). Chris >On Wednesday, October 20, 2004, at 08:03 PM, Sudha S wrote: > >> >>Hi, >> >>I have been trying to install the Bio::DB for a week >>now and I need some help in this badly. >>I keep getting the error : >> >>'Error: no suitable installation target found for >>package bioperl-db.' >> >>I remember that i was prompted to give path for >>/usr/lib directory and I do not have this folder on my >>machine which is running Windows XP. What should be >>done to get over this problem? >> >>Thank you, >>Sudha >> >> >> >>_______________________________ >>Do you Yahoo!? >>Declare Yourself - Register online to vote today! >>http://vote.yahoo.com >>_______________________________________________ >>Bioperl-l mailing list >>Bioperl-l@portal.open-bio.org >>http://portal.open-bio.org/mailman/listinfo/bioperl-l >> >-- >------------------------------------------------------------- >Hilmar Lapp email: lapp at gnf.org >GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 >------------------------------------------------------------- > > >_______________________________________________ >Bioperl-l mailing list >Bioperl-l@portal.open-bio.org >http://portal.open-bio.org/mailman/listinfo/bioperl-l __________________________________ Chris Fields - Postdoctoral Researcher Lab of Dr. Robert Switzer Address: University of Illinois at Urbana-Champaign Dept. of Biochemistry - 323 RAL 600 S. Mathews Ave. Urbana, IL 61801 Phone : (217) 333-7098 Fax : (217) 244-5858 From brian_osborne at cognia.com Tue Oct 26 14:14:51 2004 From: brian_osborne at cognia.com (Brian Osborne) Date: Tue Oct 26 14:14:25 2004 Subject: [Bioperl-l] bioperl problem In-Reply-To: <003301c4baa0$8e93ef90$bc9aee82@home> Message-ID: Ying, A directory like "/home/myhome/.cpan/build/libwww-perl-5.800/lib" is a build directory, but it's not where the modules are installed after you issue the "install" command in the CPAN shell. Where are your LWP modules after the installation step? Example install: cpan> install M/MK/MKHRAPOV/Chemistry-MolecularMass-0.1.tar.gz Running make for M/MK/MKHRAPOV/Chemistry-MolecularMass-0.1.tar.gz Fetching with LWP: ftp://ftp.orst.edu/pub/CPAN/authors/id/M/MK/MKHRAPOV/Chemistry-MolecularMass -0 .1.tar.gz CPAN: Digest::MD5 loaded ok Fetching with LWP: ftp://ftp.orst.edu/pub/CPAN/authors/id/M/MK/MKHRAPOV/CHECKSUMS Checksum for /home/bosborne/.cpan/sources/authors/id/M/MK/MKHRAPOV/Chemistry-Mol ecularMass-0.1.tar.gz ok Scanning cache /home/bosborne/.cpan/build for sizes Chemistry/ Chemistry/MolecularMass/ Chemistry/MolecularMass/MolecularMass.xs Chemistry/MolecularMass/MolecularMass.pm Chemistry/MolecularMass/Makefile.PL Chemistry/MolecularMass/test.pl Chemistry/MolecularMass/Changes Chemistry/MolecularMass/MANIFEST Chemistry/MolecularMass/README CPAN.pm: Going to build M/MK/MKHRAPOV/Chemistry-MolecularMass-0.1.tar.gz Checking if your kit is complete... Looks good Writing Makefile for Chemistry::MolecularMass Writing Makefile for Chemistry make[1]: Entering directory `/home/bosborne/.cpan/build/Chemistry/MolecularMass' cp MolecularMass.pm ../blib/lib/Chemistry/MolecularMass.pm /bin/perl.exe /usr/lib/perl5/5.8.2/ExtUtils/xsubpp -typemap /usr/lib/perl5/5.8. 2/ExtUtils/typemap MolecularMass.xs > MolecularMass.xsc && mv MolecularMass.xsc MolecularMass.c Please specify prototyping behavior for MolecularMass.xs (see perlxs manual) gcc -c -DPERL_USE_SAFE_PUTENV -fno-strict-aliasing -DUSEIMPORTLIB -O2 -D VERS ION=\"0.1\" -DXS_VERSION=\"0.1\" "-I/usr/lib/perl5/5.8.2/cygwin-thread-multi-64 int/CORE" MolecularMass.c Running Mkbootstrap for Chemistry::MolecularMass () chmod 644 MolecularMass.bs rm -f ../blib/arch/auto/Chemistry/MolecularMass/MolecularMass.dll LD_RUN_PATH="" ld2 -s -L/usr/local/lib MolecularMass.o -o ../blib/arch/auto/Ch emistry/MolecularMass/MolecularMass.dll /usr/lib/perl5/5.8.2/cygwin-thread-mult i-64int/CORE/libperl.dll.a gcc -shared -o MolecularMass.dll -Wl,--out-implib=libMolecularMass.dll.a -Wl,-- export-all-symbols -Wl,--enable-auto-import -Wl,--stack,8388608 \ -s -L/usr/local/lib MolecularMass.o /usr/lib/perl5/5.8.2/cygwin-thread-multi-64 int/CORE/libperl.dll.a Creating library file: libMolecularMass.dll.a mv MolecularMass.dll libMolecularMass.dll.a ../blib/arch/auto/Chemistry/Molecula rMass/ chmod 755 ../blib/arch/auto/Chemistry/MolecularMass/MolecularMass.dll cp MolecularMass.bs ../blib/arch/auto/Chemistry/MolecularMass/MolecularMass.bs chmod 644 ../blib/arch/auto/Chemistry/MolecularMass/MolecularMass.bs make[1]: Leaving directory `/home/bosborne/.cpan/build/Chemistry/MolecularMass' /usr/bin/make -- OK Running make test make[1]: Entering directory `/home/bosborne/.cpan/build/Chemistry/MolecularMass' make[1]: Leaving directory `/home/bosborne/.cpan/build/Chemistry/MolecularMass' make[1]: Entering directory `/home/bosborne/.cpan/build/Chemistry/MolecularMass' /bin/perl.exe "-I../blib/lib" "-I../blib/arch" test.pl 1..10 ok 1 Parentheses don't match ok 2 Parentheses don't match ok 3 No such element: Nosuchelement ok 4 Forbidden chars ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 make[1]: Leaving directory `/home/bosborne/.cpan/build/Chemistry/MolecularMass' /usr/bin/make test -- OK Running make install make[1]: Entering directory `/home/bosborne/.cpan/build/Chemistry/MolecularMass' make[1]: Leaving directory `/home/bosborne/.cpan/build/Chemistry/MolecularMass' Installing /usr/lib/perl5/site_perl/5.8.2/cygwin-thread-multi-64int/auto/Chemist ry/MolecularMass/libMolecularMass.dll.a Installing /usr/lib/perl5/site_perl/5.8.2/cygwin-thread-multi-64int/auto/Chemist ry/MolecularMass/MolecularMass.bs Installing /usr/lib/perl5/site_perl/5.8.2/cygwin-thread-multi-64int/auto/Chemist ry/MolecularMass/MolecularMass.dll Files found in blib/arch: installing files in blib/lib into architecture depende nt library tree Installing /usr/lib/perl5/site_perl/5.8.2/cygwin-thread-multi-64int/Chemistry/Mo lecularMass.pm Writing /usr/lib/perl5/site_perl/5.8.2/cygwin-thread-multi-64int/auto/Chemistry/ .packlist Appending installation info to /usr/lib/perl5/5.8.2/cygwin-thread-multi-64int/pe rllocal.pod /usr/bin/make install -- OK cpan> Brian O. -----Original Message----- From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Ying Sun Sent: Monday, October 25, 2004 10:40 AM To: bioperl-l@bioperl.org Subject: [Bioperl-l] bioperl problem Dear there: Thank you for take time to see my problem in Bioperl.My problem is as follows: I use the Cygwin to run the Bioperl programme. In my programme, I use module Bio::Perl and function get_sequence. But when I run this programme, I got error report: Your system does not have one of LWP, HTTP::Request::Common, IO::String installed so the DB retrieval method is not available. Becusue the LWP in another pathway(my Bio::Perl module in /home/myhome/.cpan/build/bioperl-1.4), so I add this script like that use lib "/home/myhome/.cpan/build/libwww-perl-5.800/lib"; But it does not work. So,I have no idea of how to use the modules and solve the problems.Could someone give me a help? Thanks a lot. Best, Ying From smontgom at bcgsc.ca Mon Oct 25 23:33:06 2004 From: smontgom at bcgsc.ca (smontgom@bcgsc.ca) Date: Tue Oct 26 22:25:29 2004 Subject: [Bioperl-l] update to Bio::Tools::Run::EMBOSSacd Message-ID: <32789.154.20.41.204.1098761586.squirrel@webx440.bcgsc.bc.ca> Yo - Can I pass on this code snippet for a CVS commit? The newer version of EMBOSS removes the acdc parameter -acdtable. So the Bio::Tools::Run::EMBOSSacd module needs this snippet added at line 158 (after the reset of the hash %OPT) my $version = `embossversion`; my $file; if ($version lt "2.8.0") { # reading from EMBOSS program acdc stdout (previous to version 2.8.0) $file = `acdc $prog -help -verbose -acdtable 2>&1`; } else { # reading from EMBOSS program acdtable stdout (equal to after 2.8.0) $file = `acdtable $prog -help -verbose 2>&1`; } Cheers, Stephen From smontgom at bcgsc.ca Tue Oct 26 00:45:48 2004 From: smontgom at bcgsc.ca (smontgom@bcgsc.ca) Date: Tue Oct 26 22:25:32 2004 Subject: [Bioperl-l] total_combos addition for Bio::Tools::IUPAC Message-ID: <32834.154.20.41.204.1098765948.squirrel@webx440.bcgsc.bc.ca> Hi Aaron/Bioperl - Can I send over this code for Bio::Tools::IUPAC in bioperl-live. to be committed to CVS? If it is cool that is. Feel free to change the subroutine name (or anything else) Cheers, Stephen =head2 total_combos Title : total_combos Usage : my $total_combos = $iupac->total_combos; Function: Calculates the total number of sequence combinations that can be made using this IUPAC sequence Return : int Args : none =cut sub total_combos{ my ($self) = @_; my $total_combos = 1; foreach my $alpha (@{$self->{'_alpha'}}) { $total_combos *= scalar (@$alpha); } return $total_combos; } From bioperlanand at yahoo.com Wed Oct 27 00:44:47 2004 From: bioperlanand at yahoo.com (Anand Venkatraman) Date: Wed Oct 27 00:43:27 2004 Subject: [Bioperl-l] Having problems with parsing SwissProt Records Message-ID: <20041027044447.73401.qmail@web61102.mail.yahoo.com> Hi, I am using Bioperl to parse SwissProt Records. The bioperl version is 1.4. I am having 2 problems : Problem 1: I am unable to get all the accession numbers from the line starting with AC on the SwissProt Record. i.e.,in some SwissProt records there are multiple accession numbers whereas in some there is only 1 Accession Number. My code (see below) is getting only the 1st accession number it encounters. Problem 2: I am also trying to get the associated EMBL and GO cross-references fro a given Swissprot entry. The problem I am having is that [a]: I am only getting the Nucleotide Id and Not the Protein Id from the EMBL tag and [b]: In some cases, I am unable to get the GO ids. For example, from the code below, I am only getting the GO id for some records, and missing it for some. Also, if a particular record has 3 or 4 lines of GO, the code just captures the 1st occurence of the GO Id(if and when it does so). This is the code ------------------------------------------------------- #!/usr/bin/perl -w use strict; use Bio::SeqIO; my $sp_file = shift @ARGV or die$!; my $seqio_object = Bio::SeqIO->new(-file => $sp_file, -format => "swiss"); while (my $seq_object = $seqio_object->next_seq) { if ($seq_object->species->binomial =~ m/Homo sapiens/) { print "Accession: ",$seq_object->accession_number(), "\t"; my $annotation = $seq_object->annotation(); foreach my $dblink ( $annotation->get_all_Annotations('dblink') ) { if ( ( $dblink->database eq "EMBL" ) || ( $dblink->database eq "GO" ) ) { print "\t",$dblink->database, ":", $dblink->primary_id, "\t"; } } } print "\n"; } ------------------------------------------------------- Any suggestions, Thanks in advance for the help. Anand __________________________________ Do you Yahoo!? Yahoo! Mail - You care about security. So do we. http://promotions.yahoo.com/new_mail From hlapp at gmx.net Wed Oct 27 03:36:20 2004 From: hlapp at gmx.net (Hilmar Lapp) Date: Wed Oct 27 03:35:07 2004 Subject: [Bioperl-l] Having problems with parsing SwissProt Records In-Reply-To: <20041027044447.73401.qmail@web61102.mail.yahoo.com> Message-ID: On Tuesday, October 26, 2004, at 09:44 PM, Anand Venkatraman wrote: > Hi, > > I am using Bioperl to parse SwissProt Records. > > The bioperl version is 1.4. > > I am having 2 problems : > > Problem 1: I am unable to get all the accession > numbers from the line starting with AC on the > SwissProt Record. Other accessions than the first are available via $seq->get_secondary_accessions(). > > Problem 2: I am also trying to get the associated > EMBL and GO cross-references fro a given Swissprot > entry. The problem I am having is that > [a]: I am only getting the Nucleotide Id and Not the > Protein Id from the EMBL tag and What do you mean by EMBL tag? Dbxrefs to EMBL? > [b]: In some cases, I am unable to get the GO ids. This should not happen. Can you send the accession numbers for those sequences, or better yet, the swissprot-formatted file with those (or a selection thereof) that fail? -hilmar > For > example, from the code below, I am only getting the GO > id for some records, and missing it for some. Also, if > a particular record has 3 or 4 lines of GO, the code > just captures the 1st occurence of the GO Id(if and > when it does so). > > > > This is the code > ------------------------------------------------------- > #!/usr/bin/perl -w > use strict; > use Bio::SeqIO; > > my $sp_file = shift @ARGV or die$!; > my $seqio_object = Bio::SeqIO->new(-file => $sp_file, > -format => "swiss"); > > while (my $seq_object = $seqio_object->next_seq) { > if ($seq_object->species->binomial =~ m/Homo > sapiens/) { > print "Accession: > ",$seq_object->accession_number(), "\t"; > my $annotation = $seq_object->annotation(); > > foreach my $dblink ( > $annotation->get_all_Annotations('dblink') ) { > > if ( ( $dblink->database eq "EMBL" ) || ( > $dblink->database eq "GO" ) ) { > print "\t",$dblink->database, ":", > $dblink->primary_id, "\t"; > } > } > } > print "\n"; > > } > > ------------------------------------------------------- > > Any suggestions, > > Thanks in advance for the help. > > Anand > > > > > __________________________________ > Do you Yahoo!? > Yahoo! Mail - You care about security. So do we. > http://promotions.yahoo.com/new_mail > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- From sam.kalat at gmail.com Wed Oct 27 10:31:05 2004 From: sam.kalat at gmail.com (Sam Kalat) Date: Wed Oct 27 10:29:47 2004 Subject: [Bioperl-l] SCF file get_header call Message-ID: <9d86df2b04102707316388afe5@mail.gmail.com> Hi folks. I have a couple of scripts that generate PNG graphics from SCF files: one for looking at traces, and the other for browsing sequence and quality data (especially for auditing how well our basecalling, screening, and trimming has performed). Knowing that people are likely to lose track of what graphic goes with what chromatogram if they are left to their own devices, I decided to embed a lot of file header information directly in the image. I got this all working and somewhere along the line updated my bioperl package (without even noticing, as part of a debian system update) and the scripts broke. Part of the problem was I was using the get_trace() function in Bio::SeqIO::scf (I think), which I see now was deprecated in favor of the SequenceTrace object. Fair enough, that was a small fix. What I cannot seem to repair is that header info, which looks like it is supposed to work but doesn't. I get a hash with keys but no values. Code looks like so: my %header = %{$scf_input_file->get_header()}; my $info = $scf_input_file->{'comments'}->{'NAME'}." "; $info .= "Nucleotides: ".$header{'bases'}." "; if ( $scf_input_file->{'comments'}->{'MACH'} ) { $info .= "Machine: ".$scf_input_file->{'comments'}->{'MACH'}." ";} if ( $scf_input_file->{'comments'}->{'SIGN'} ) { $info .= "Signal strength: ".$scf_input_file->{'comments'}->{'SIGN'}." ";} $img->string(gdSmallFont,5,0,$info,$black); $info = "SCF version: ".$header{'version'}." "; if ( $scf_input_file->{'comments'}->{'CONV'} ) { $info .= "Converted by: ".$scf_input_file->{'comments'}->{'CONV'}." ";} if ( $scf_input_file->{'comments'}->{'BCSW'} ) { $info .= "Base called by: ".$scf_input_file->{'comments'}->{'BCSW'}." ";} if ( $scf_input_file->{'comments'}->{'DYEP'} ) { $info .= "Dye: ".$scf_input_file->{'comments'}->{'DYEP'}." ";} if ( $scf_input_file->{'comments'}->{'LANE'} ) { $info .= "Lane: ".$scf_input_file->{'comments'}->{'LANE'}." ";} $img->string(gdSmallFont,5,10,$info,$black); Is there a different, preferred way of extracting this kind of information from an SCF file? I don't know specifically which fields are likely to be important in the long run, but I figure the more, the merrier. Thanks, Sam Kalat From bioperlanand at yahoo.com Wed Oct 27 11:47:57 2004 From: bioperlanand at yahoo.com (Anand Venkatraman) Date: Wed Oct 27 15:09:53 2004 Subject: [Bioperl-l] Reply to Hilmar Lapp's solution -- parsing SwissProt Records In-Reply-To: Message-ID: <20041027154757.85652.qmail@web61101.mail.yahoo.com> Hi, Thanks a lot for the response. Some clarifications from my side: [1] Yes, by the EMBL tag, I catually meant the DbXREFto EMBL for the specific SwissProt accession number. Sorry for the confusion. Lets say we have this line from a SwsisProt record: DR EMBL; X57346; CAA40621.1; -. By the method outlined in my code, I am able to pull up only the EMBL nucleotide accession number (X57346) , but I am unable to get to the Protein Accession Number (CAA40621.1). [2] Problems with GO cross-references: I can send you a small portion of the SwissProt file -- do you want me to send it as an attachment or within the text of the message. Can we send file attachments to the mailing list? Thanks a lot. Anand Hilmar Lapp wrote: On Tuesday, October 26, 2004, at 09:44 PM, Anand Venkatraman wrote: > Hi, > > I am using Bioperl to parse SwissProt Records. > > The bioperl version is 1.4. > > I am having 2 problems : > > Problem 1: I am unable to get all the accession > numbers from the line starting with AC on the > SwissProt Record. Other accessions than the first are available via $seq->get_secondary_accessions(). > > Problem 2: I am also trying to get the associated > EMBL and GO cross-references fro a given Swissprot > entry. The problem I am having is that > [a]: I am only getting the Nucleotide Id and Not the > Protein Id from the EMBL tag and What do you mean by EMBL tag? Dbxrefs to EMBL? > [b]: In some cases, I am unable to get the GO ids. This should not happen. Can you send the accession numbers for those sequences, or better yet, the swissprot-formatted file with those (or a selection thereof) that fail? -hilmar > For > example, from the code below, I am only getting the GO > id for some records, and missing it for some. Also, if > a particular record has 3 or 4 lines of GO, the code > just captures the 1st occurence of the GO Id(if and > when it does so). > > > > This is the code > ------------------------------------------------------- > #!/usr/bin/perl -w > use strict; > use Bio::SeqIO; > > my $sp_file = shift @ARGV or die$!; > my $seqio_object = Bio::SeqIO->new(-file => $sp_file, > -format => "swiss"); > > while (my $seq_object = $seqio_object->next_seq) { > if ($seq_object->species->binomial =~ m/Homo > sapiens/) { > print "Accession: > ",$seq_object->accession_number(), "\t"; > my $annotation = $seq_object->annotation(); > > foreach my $dblink ( > $annotation->get_all_Annotations('dblink') ) { > > if ( ( $dblink->database eq "EMBL" ) || ( > $dblink->database eq "GO" ) ) { > print "\t",$dblink->database, ":", > $dblink->primary_id, "\t"; > } > } > } > print "\n"; > > } > > ------------------------------------------------------- > > Any suggestions, > > Thanks in advance for the help. > > Anand > > > > > __________________________________ > Do you Yahoo!? > Yahoo! Mail - You care about security. So do we. > http://promotions.yahoo.com/new_mail > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- --------------------------------- Do you Yahoo!? Yahoo! Mail Address AutoComplete - You start. We finish. From jason at cgt.duhs.duke.edu Wed Oct 27 15:24:39 2004 From: jason at cgt.duhs.duke.edu (Jason Stajich) Date: Wed Oct 27 15:23:06 2004 Subject: [Bioperl-l] Reply to Hilmar Lapp's solution -- parsing SwissProt Records In-Reply-To: <20041027154757.85652.qmail@web61101.mail.yahoo.com> References: <20041027154757.85652.qmail@web61101.mail.yahoo.com> Message-ID: The protein ID is stored in $dblink->optional_id This is the code which does the parsing work in Bio::SeqIO::swiss to make a DBlink Xref. elsif (/^DR\s+(\S+)\;\s+(\S+)\;\s+([^;]+)[\;\.](.*)$/) { my $dblinkobj = Bio::Annotation::DBLink->new(); $dblinkobj->database($1); $dblinkobj->primary_id($2); $dblinkobj->optional_id($3); my $comment = $4; if(length($comment) > 0) { # edit comment to get rid of leading space and trailing dot if( $comment =~ /^\s*(\S+)\./ ) { $dblinkobj->comment($1); } else { $dblinkobj->comment($comment); } } $annotation->add_Annotation('dblink',$dblinkobj); } -jason On Oct 27, 2004, at 11:47 AM, Anand Venkatraman wrote: > Hi, > > Thanks a lot for the response. > > Some clarifications from my side: > > [1] Yes, by the EMBL tag, I catually meant the DbXREFto EMBL for the > specific SwissProt accession number. Sorry for the confusion. Lets > say we have this line from a SwsisProt record: > > DR EMBL; X57346; CAA40621.1; -. > > By the method outlined in my code, I am able to pull up only the EMBL > nucleotide accession number (X57346) , but I am unable to get to the > Protein Accession Number (CAA40621.1). > > [2] Problems with GO cross-references: > > I can send you a small portion of the SwissProt file -- do you want me > to send it as an attachment or within the text of the message. Can we > send file attachments to the mailing list? > > > Thanks a lot. > > Anand > > Hilmar Lapp wrote: > > On Tuesday, October 26, 2004, at 09:44 PM, Anand Venkatraman wrote: > >> Hi, >> >> I am using Bioperl to parse SwissProt Records. >> >> The bioperl version is 1.4. >> >> I am having 2 problems : >> >> Problem 1: I am unable to get all the accession >> numbers from the line starting with AC on the >> SwissProt Record. > > Other accessions than the first are available via > $seq->get_secondary_accessions(). > >> >> Problem 2: I am also trying to get the associated >> EMBL and GO cross-references fro a given Swissprot >> entry. The problem I am having is that >> [a]: I am only getting the Nucleotide Id and Not the >> Protein Id from the EMBL tag and > > What do you mean by EMBL tag? Dbxrefs to EMBL? > >> [b]: In some cases, I am unable to get the GO ids. > > This should not happen. Can you send the accession numbers for those > sequences, or better yet, the swissprot-formatted file with those (or a > selection thereof) that fail? > > -hilmar > > >> For >> example, from the code below, I am only getting the GO >> id for some records, and missing it for some. Also, if >> a particular record has 3 or 4 lines of GO, the code >> just captures the 1st occurence of the GO Id(if and >> when it does so). >> >> >> >> This is the code >> ------------------------------------------------------- >> #!/usr/bin/perl -w >> use strict; >> use Bio::SeqIO; >> >> my $sp_file = shift @ARGV or die$!; >> my $seqio_object = Bio::SeqIO->new(-file => $sp_file, >> -format => "swiss"); >> >> while (my $seq_object = $seqio_object->next_seq) { >> if ($seq_object->species->binomial =~ m/Homo >> sapiens/) { >> print "Accession: >> ",$seq_object->accession_number(), "\t"; >> my $annotation = $seq_object->annotation(); >> >> foreach my $dblink ( >> $annotation->get_all_Annotations('dblink') ) { >> >> if ( ( $dblink->database eq "EMBL" ) || ( >> $dblink->database eq "GO" ) ) { >> print "\t",$dblink->database, ":", >> $dblink->primary_id, "\t"; >> } >> } >> } >> print "\n"; >> >> } >> >> ------------------------------------------------------- >> >> Any suggestions, >> >> Thanks in advance for the help. >> >> Anand >> >> >> >> >> __________________________________ >> Do you Yahoo!? >> Yahoo! Mail - You care about security. So do we. >> http://promotions.yahoo.com/new_mail >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l@portal.open-bio.org >> http://portal.open-bio.org/mailman/listinfo/bioperl-l >> >> > -- > ------------------------------------------------------------- > Hilmar Lapp email: lapp at gnf.org > GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 > ------------------------------------------------------------- > > > > > --------------------------------- > Do you Yahoo!? > Yahoo! Mail Address AutoComplete - You start. We > finish._______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l -- Jason Stajich Duke University jason at cgt.mc.duke.edu From jason at cgt.duhs.duke.edu Wed Oct 27 15:30:39 2004 From: jason at cgt.duhs.duke.edu (Jason Stajich) Date: Wed Oct 27 15:28:58 2004 Subject: [Bioperl-l] failing tests on OS X Message-ID: On OS X 10.2, perl 5.6.0 these tests fail - but do not on perl 5.8.0 Failed Test Status Wstat Total Fail Failed List of failed ------------------------------------------------------------------------ ------- t/RestrictionIO 14 1 7.14% 10 t/SiteMatrix.t 15 1 6.67% 8 % perl -I. -w t/RestrictionIO.t [snip] ok 9 not ok 10 # Test 10 got: '9' (t/RestrictionIO.t at line 53) # Expected: '11' ok 11 ok 12 ok 13 ok 14 % perl -I. -w t/SiteMatrix.t 1..15 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 not ok 8 # Test 8 got: '9/16' (t/SiteMatrix.t at line 49) # Expected: '5/8' ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 -- Jason Stajich Duke University jason at cgt.mc.duke.edu From jason at cgt.duhs.duke.edu Wed Oct 27 18:13:45 2004 From: jason at cgt.duhs.duke.edu (Jason Stajich) Date: Wed Oct 27 18:13:11 2004 Subject: [Bioperl-l] Reply to Hilmar Lapp's solution -- parsing SwissProt Records In-Reply-To: <20041027204220.36448.qmail@web61107.mail.yahoo.com> References: <20041027204220.36448.qmail@web61107.mail.yahoo.com> Message-ID: <77D3B5B7-2865-11D9-95BB-000393C44276@cgt.mc.duke.edu> I didn't try to answer that - not sure about the GO stuff. You might want to walk through the swiss.pm SeqIO code to figure out whether or not that the regular expressions are parsing out the data correctly for DR lines for GO terms. Or else something is getting overwritten perhaps. -jason On Oct 27, 2004, at 4:42 PM, Anand Venkatraman wrote: > Hi, > > Thanks a lot. > > I tried the code with the $dblink->optional_id. It > works. > > But whats puzzling is that the code is behaving > weirdly when it comes to extracting the GO > cross-refences. > > As stated in my earlier mail, it is extracting it in > some cases & fails in other cases. And when it does > work & extract the GO cross-reference, it does so only > for the 1st occurence of the GO cross-reference. > > There are no warnings or errors. > > I could send a small SwissProt file as an attachment > if you would like to have a look at. > > Thanks once again. > > Anand > > --- Jason Stajich wrote: > >> The protein ID is stored in $dblink->optional_id >> >> This is the code which does the parsing work in >> Bio::SeqIO::swiss to >> make a DBlink Xref. >> elsif >> (/^DR\s+(\S+)\;\s+(\S+)\;\s+([^;]+)[\;\.](.*)$/) { >> my $dblinkobj = >> Bio::Annotation::DBLink->new(); >> $dblinkobj->database($1); >> $dblinkobj->primary_id($2); >> $dblinkobj->optional_id($3); >> my $comment = $4; >> if(length($comment) > 0) { >> # edit comment to get rid of leading >> space and trailing >> dot >> if( $comment =~ /^\s*(\S+)\./ ) { >> $dblinkobj->comment($1); >> } else { >> $dblinkobj->comment($comment); >> } >> } >> >> $annotation->add_Annotation('dblink',$dblinkobj); >> } >> >> -jason >> On Oct 27, 2004, at 11:47 AM, Anand Venkatraman >> wrote: >> >>> Hi, >>> >>> Thanks a lot for the response. >>> >>> Some clarifications from my side: >>> >>> [1] Yes, by the EMBL tag, I catually meant the >> DbXREFto EMBL for the >>> specific SwissProt accession number. Sorry for the >> confusion. Lets >>> say we have this line from a SwsisProt record: >>> >>> DR EMBL; X57346; CAA40621.1; -. >>> >>> By the method outlined in my code, I am able to >> pull up only the EMBL >>> nucleotide accession number (X57346) , but I am >> unable to get to the >>> Protein Accession Number (CAA40621.1). >>> >>> [2] Problems with GO cross-references: >>> >>> I can send you a small portion of the SwissProt >> file -- do you want me >>> to send it as an attachment or within the text of >> the message. Can we >>> send file attachments to the mailing list? >>> >>> >>> Thanks a lot. >>> >>> Anand >>> >>> Hilmar Lapp wrote: >>> >>> On Tuesday, October 26, 2004, at 09:44 PM, Anand >> Venkatraman wrote: >>> >>>> Hi, >>>> >>>> I am using Bioperl to parse SwissProt Records. >>>> >>>> The bioperl version is 1.4. >>>> >>>> I am having 2 problems : >>>> >>>> Problem 1: I am unable to get all the accession >>>> numbers from the line starting with AC on the >>>> SwissProt Record. >>> >>> Other accessions than the first are available via >>> $seq->get_secondary_accessions(). >>> >>>> >>>> Problem 2: I am also trying to get the associated >>>> EMBL and GO cross-references fro a given >> Swissprot >>>> entry. The problem I am having is that >>>> [a]: I am only getting the Nucleotide Id and Not >> the >>>> Protein Id from the EMBL tag and >>> >>> What do you mean by EMBL tag? Dbxrefs to EMBL? >>> >>>> [b]: In some cases, I am unable to get the GO >> ids. >>> >>> This should not happen. Can you send the accession >> numbers for those >>> sequences, or better yet, the swissprot-formatted >> file with those (or a >>> selection thereof) that fail? >>> >>> -hilmar >>> >>> >>>> For >>>> example, from the code below, I am only getting >> the GO >>>> id for some records, and missing it for some. >> Also, if >>>> a particular record has 3 or 4 lines of GO, the >> code >>>> just captures the 1st occurence of the GO Id(if >> and >>>> when it does so). >>>> >>>> >>>> >>>> This is the code >>>> >> > ------------------------------------------------------- >>>> #!/usr/bin/perl -w >>>> use strict; >>>> use Bio::SeqIO; >>>> >>>> my $sp_file = shift @ARGV or die$!; >>>> my $seqio_object = Bio::SeqIO->new(-file => >> $sp_file, >>>> -format => "swiss"); >>>> >>>> while (my $seq_object = $seqio_object->next_seq) >> { >>>> if ($seq_object->species->binomial =~ m/Homo >>>> sapiens/) { >>>> print "Accession: >>>> ",$seq_object->accession_number(), "\t"; >>>> my $annotation = $seq_object->annotation(); >>>> >>>> foreach my $dblink ( >>>> $annotation->get_all_Annotations('dblink') ) { >>>> >>>> if ( ( $dblink->database eq "EMBL" ) || ( >>>> $dblink->database eq "GO" ) ) { >>>> print "\t",$dblink->database, ":", >>>> $dblink->primary_id, "\t"; >>>> } >>>> } >>>> } >>>> print "\n"; >>>> >>>> } >>>> >>>> >> > ------------------------------------------------------- >>>> >>>> Any suggestions, >>>> >>>> Thanks in advance for the help. >>>> >>>> Anand >>>> >>>> >>>> >>>> >>>> __________________________________ >>>> Do you Yahoo!? >>>> Yahoo! Mail - You care about security. So do we. >>>> http://promotions.yahoo.com/new_mail >>>> _______________________________________________ >>>> Bioperl-l mailing list >>>> Bioperl-l@portal.open-bio.org >>>> >> > http://portal.open-bio.org/mailman/listinfo/bioperl-l >>>> >>>> >>> -- >>> >> > ------------------------------------------------------------- >>> Hilmar Lapp email: lapp at gnf.org >>> GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 >>> >> > ------------------------------------------------------------- >>> >>> >>> >>> >>> --------------------------------- >>> Do you Yahoo!? >>> Yahoo! Mail Address AutoComplete - You start. We >>> >> > finish._______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l@portal.open-bio.org >>> >> > http://portal.open-bio.org/mailman/listinfo/bioperl-l >> -- >> Jason Stajich >> Duke University >> jason at cgt.mc.duke.edu >> > === message truncated === > > > > > __________________________________ > Do you Yahoo!? > Read only the mail you want - Yahoo! Mail SpamGuard. > http://promotions.yahoo.com/new_mail > > -- Jason Stajich Duke University jason at cgt.mc.duke.edu From nathanhaigh at ukonline.co.uk Thu Oct 28 06:03:31 2004 From: nathanhaigh at ukonline.co.uk (Nathan Spencer Haigh) Date: Thu Oct 28 06:05:37 2004 Subject: [Bioperl-l] make test!! In-Reply-To: <000d01c4b76c$5bb3fd90$3cf4cdd9@Desktop> References: <000d01c4b76c$5bb3fd90$3cf4cdd9@Desktop> Message-ID: <1098957811.4180c3f3998a1@webmail.ukonline.net> Ignore this old message, all these have now been fixed! Nathan Quoting Nathan Haigh : > Ok, I've done some more testing (with the latest CVS 9am GMT) and here is > what I've found! I've run "namke test" with and without > BIOPERLDEBUG, and running individual tests using " perl -I. -w > t/test_name.t". > > Below are the contents of 3 files with details of errors, if you would like > me to e-mail the files directly directly to you, let me > know: > Errors.txt - summary and details of failed tests, and other tests with > peculiar warnings etc > Errors_debug.txt - same as errors.txt but with BIOPERLDEBUG set > Perl_test.txt - individual tests run with BIOPERLDEBUG set, using "perl -I. > -w t/test_name.t" > > My System: > WinXP Pro > ActiveState Perl 5.8.0 > Nmake 6.00.8168.0 > > My Summary: > ESEfinder.t - causes perl to crash on test 2 during "nmake test", but ok in > other tests! > Biblio_biofetch.t - throws warning and exception when using BIOPERLDEBUG, but > doesn't appear in summary! > Index.t - fails get_Seq_by_id ('AI129902') on lines 118 and 124 > ProtPsm.t - needs "plan tests" in test file changing to 5. When running the > individual test can't locate > Bio::Matrix::PSM::ProtMatrix > Registry.t - several error including "No seqdatabase.ini file found", " No > database with name testflat in Registry" > Primaryqual.t - Test returned status 255. and 'Can't locate object method > "header"' in individual test > seqread_fail.t - gives an exception, is this supposed to happen? > > Hope this help to iron out bugs when running BioPerl on Windows! > Nathan > > > Errors_debug.txt > ############## > Failed Test Stat Wstat Total Fail Failed List of Failed > ------------------------------------------------------------------------------- > t\ESEfinder.t 5 1280 12 10 83.33% 3-12 > t\Index.t 22 5632 41 21 51.22% 21-41 > t\ProtPsm.t 1 ?? % ?? > t\Registry.t 255 65280 11 8 72.73% 4-11 > t\primaryqual.t 255 65280 31 0 0.00% ?? > t\seqread_fail.t 255 65280 13 0 0.00% ?? > 2 subtests skipped. > Failed 6/193 test scripts, 96.89% okay. 35/8919 subtests failed, 99.61% > okay. > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : > return code '0xff' > Stop. > > Particulars: > ------------ > t\Biblio_biofetch............ok 1/11Warning: Couldn't connect to BioFetch > server with Bio::DB::Medline.pm! > > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: retrieval type pipeline unsupported > > STACK: Error::throw > STACK: Bio::Root::Root::throw > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\bl > ib\lib/Bio/Root/Root.pm:328 > STACK: Bio::DB::Biblio::biofetch::get_seq_stream > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbi > operl-live-debug\blib\lib/Bio/DB/Biblio/biofetch.pm:237 > STACK: Bio::DB::DBFetch::get_Stream_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-l > ive-debug\blib\lib/Bio/DB/DBFetch.pm:194 > STACK: Bio::DB::Biblio::biofetch::get_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl > -live-debug\blib\lib/Bio/DB/Biblio/biofetch.pm:153 > STACK: t\Biblio_biofetch.t:71 > ----------------------------------------------------------- > > t\ESEfinder..................dubious > Test returned status 5 (wstat 1280, 0x500) > DIED. FAILED tests 3-12 > Failed 10/12 tests, 16.67% okay > > t\Index......................NOK 21Can't call method "length" on an undefined > value at t\Index.t line 126, line > 54. > t\Index......................dubious > Test returned status 22 (wstat 5632, 0x1600) > DIED. FAILED tests 21-41 > Failed 21/41 tests, 48.78% okay > > t\primaryqual................dubious > Test returned status 255 (wstat 65280, 0xff00) > after all the subtests completed successfully > > t\ProtPsm....................ok 5/1Don't know which tests failed: got 5 ok, > expected 1 > > t\Registry...................ok 2/11This Perl doesn't implement function > getpwuid(). Skipping... > > -------------------- WARNING --------------------- > MSG: No seqdatabase.ini file found in ~/.bioinformatics/ > nor in /etc/bioinformatics/ nor in directory specified by > t/data/registry/flat;t/data/registry/bdb. Using web to get database registry > from > http://www.open-bio.org/registry/seqdatabase.ini > --------------------------------------------------- > > -------------------- WARNING --------------------- > MSG: Stored the default registry configuration in > /.bioinformatics/seqdatabase.ini > --------------------------------------------------- > t\Registry...................NOK 5 > -------------------- WARNING --------------------- > MSG: No database with name testflat in Registry > --------------------------------------------------- > Can't call method "get_Seq_by_id" on an undefined value at t\Registry.t line > 66, line 11. > t\Registry...................dubious > Test returned status 255 (wstat 65280, 0xff00) > DIED. FAILED tests 4-11 > Failed 8/11 tests, 27.27% okay > > t\SeqIO......................ok 196/284 > -------------------- WARNING --------------------- > MSG: Bio::PrimarySeq=HASH(0x2a9363c) is not a SeqI compliant sequence > object! > STACK Bio::SeqIO::embl::write_seq > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu > g\blib\lib/Bio\SeqIO\embl.pm:410 > STACK toplevel t\SeqIO.t:527 > t\SeqIO......................ok 198/284 > t\SeqIO......................ok 199/284-------------------- WARNING > --------------------- > MSG: test is not a SeqI compliant sequence object! > STACK Bio::SeqIO::embl::write_seq > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu > g\blib\lib/Bio\SeqIO\embl.pm:410 > STACK (eval) t\SeqIO.t:530 > STACK toplevel t\SeqIO.t:529 > t\SeqIO......................ok 253/284Location parse, processing 1..105 > Location parse, processing <1..>105 > Location parse, processing 69^70 > Location parse, processing 103^102 > t\SeqIO......................ok 259/284 > -------------------- WARNING --------------------- > MSG: When building a location, start (103) is expected to be less than end > (102), however it was not. Switching start > and end and setting strand to -1 > STACK Bio::Location::Atomic::new > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug > \blib\lib/Bio/Location/Atomic.pm:104 > STACK Bio::Location::Simple::new > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug > \blib\lib/Bio\Location\Simple.pm:91 > STACK Bio::Factory::FTLocationFactory::_parse_location > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co > pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218 > t\SeqIO......................ok 262/284STACK > Bio::Factory::FTLocationFactory::from_string K:\Downloads\FlashGet\Softwa > re\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157 > STACK (eval) > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/ > FTHelper.pm:124 > STACK Bio::SeqIO::FTHelper::_generic_seqfeature > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio > perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123 > STACK Bio::SeqIO::genbank::next_seq > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-de > bug\blib\lib/Bio\SeqIO\genbank.pm:488 > STACK (eval) t\SeqIO.t:681 > STACK toplevel t\SeqIO.t:680 > > t\seqread_fail...............ok 1/13 > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: BioFetch Error 4: ID [XXX111] not found in database > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > STACK: Error::throw > STACK: Bio::Root::Root::throw > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\bl > ib\lib/Bio/Root/Root.pm:328 > STACK: Bio::DB::BioFetch::postprocess_data > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl- > live-debug\blib\lib/Bio/DB/BioFetch.pm:406 > STACK: Bio::DB::WebDBSeqI::get_seq_stream > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-l > ive-debug\blib\lib/Bio/DB/WebDBSeqI.pm:525 > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl > -live-debug\blib\lib/Bio/DB/WebDBSeqI.pm:287 > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-li > ve-debug\blib\lib/Bio/DB/WebDBSeqI.pm:153 > STACK: main::fetch t\seqread_fail.t:69 > STACK: t\seqread_fail.t:81 > ----------------------------------------------------------- > t\seqread_fail...............dubious > Test returned status 255 (wstat 65280, 0xff00) > after all the subtests completed successfully > > t\Swiss......................ok 2/5Location parse, processing 1..? > > -------------------- WARNING --------------------- > MSG: could not find a valid fuzzy encoding for ? > STACK Bio::Location::Fuzzy::_fuzzypointdecode > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope > rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554 > STACK Bio::Location::Fuzzy::end > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ > blib\lib/Bio\Location\Fuzzy.pm:254 > STACK Bio::Location::Atomic::new > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug > \blib\lib/Bio/Location/Atomic.pm:101 > STACK Bio::Location::Fuzzy::new > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ > blib\lib/Bio/Location/Fuzzy.pm:139 > STACK Bio::Factory::FTLocationFactory::_parse_location > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co > pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218 > STACK Bio::Factory::FTLocationFactory::from_string > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof > bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157 > STACK (eval) > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/ > FTHelper.pm:124 > STACK Bio::SeqIO::FTHelper::_generic_seqfeature > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio > perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123 > STACK Bio::SeqIO::swiss::next_seq > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu > g\blib\lib/Bio\SeqIO\swiss.pm:326 > STACK toplevel t\Swiss.t:47 > Location parse, processing ?..409 > > -------------------- WARNING --------------------- > MSG: could not find a valid fuzzy encoding for ? > STACK Bio::Location::Fuzzy::_fuzzypointdecode > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope > rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554 > STACK Bio::Location::Fuzzy::start > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu > g\blib\lib/Bio\Location\Fuzzy.pm:229 > STACK Bio::Location::Atomic::new > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug > \blib\lib/Bio/Location/Atomic.pm:100 > STACK Bio::Location::Fuzzy::new > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ > blib\lib/Bio\Location\Fuzzy.pm:139 > STACK Bio::Factory::FTLocationFactory::_parse_location > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co > pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218 > STACK Bio::Factory::FTLocationFactory::from_string > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof > bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157 > STACK (eval) > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/ > FTHelper.pm:124 > STACK Bio::SeqIO::FTHelper::_generic_seqfeature > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio > perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123 > STACK Bio::SeqIO::swiss::next_seq > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu > g\blib\lib/Bio\SeqIO\swiss.pm:326 > STACK toplevel t\Swiss.t:47 > Location parse, processing 388..388 > Location parse, processing 1..? > > -------------------- WARNING --------------------- > MSG: could not find a valid fuzzy encoding for ? > STACK Bio::Location::Fuzzy::_fuzzypointdecode > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope > rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554 > STACK Bio::Location::Fuzzy::end > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ > blib\lib/Bio\Location\Fuzzy.pm:254 > STACK Bio::Location::Atomic::new > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug > \blib\lib/Bio/Location/Atomic.pm:101 > STACK Bio::Location::Fuzzy::new > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ > blib\lib/Bio\Location\Fuzzy.pm:139 > STACK Bio::Factory::FTLocationFactory::_parse_location > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co > pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218 > STACK Bio::Factory::FTLocationFactory::from_string > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof > bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157 > STACK (eval) > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/ > FTHelper.pm:124 > STACK Bio::SeqIO::FTHelper::_generic_seqfeature > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio > perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123 > STACK Bio::SeqIO::swiss::next_seq > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu > g\blib\lib/Bio\SeqIO\swiss.pm:326 > STACK toplevel t\Swiss.t:62 > Location parse, processing ?..409 > > -------------------- WARNING --------------------- > MSG: could not find a valid fuzzy encoding for ? > STACK Bio::Location::Fuzzy::_fuzzypointdecode > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbiope > rl-live-debug\blib\lib/Bio\Location\Fuzzy.pm:554 > STACK Bio::Location::Fuzzy::start > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu > g\blib\lib/Bio\Location\Fuzzy.pm:229 > STACK Bio::Location::Atomic::new > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug > \blib\lib/Bio/Location/Atomic.pm:100 > STACK Bio::Location::Fuzzy::new > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\ > blib\lib/Bio\Location\Fuzzy.pm:139 > STACK Bio::Factory::FTLocationFactory::_parse_location > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Co > pyofbioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:218 > STACK Bio::Factory::FTLocationFactory::from_string > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyof > bioperl-live-debug\blib\lib/Bio/Factory/FTLocationFactory.pm:157 > STACK (eval) > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debug\blib\lib/Bio/SeqIO/ > FTHelper.pm:124 > STACK Bio::SeqIO::FTHelper::_generic_seqfeature > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbio > perl-live-debug\blib\lib/Bio/SeqIO/FTHelper.pm:123 > STACK Bio::SeqIO::swiss::next_seq > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live-debu > g\blib\lib/Bio\SeqIO\swiss.pm:326 > STACK toplevel t\Swiss.t:62 > Location parse, processing 388..388 > t\Swiss......................ok > > > errors.txt > ####### > Failed Test Stat Wstat Total Fail Failed List of Failed > ------------------------------------------------------------------------------- > t\Index.t 22 5632 41 21 51.22% 21-41 > t\ProtPsm.t 1 ?? % ?? > t\Registry.t 255 65280 11 8 72.73% 4-11 > t\primaryqual.t 255 65280 31 0 0.00% ?? > t\seqread_fail.t 255 65280 13 0 0.00% ?? > 115 subtests skipped. > Failed 5/193 test scripts, 97.41% okay. 25/8919 subtests failed, 99.72% > okay. > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : > return code '0xff' > Stop. > > Particulars: > ------------ > t\Index......................NOK 21Can't call method "length" on an undefined > value at t\Index.t line 126, line > 54. > t\Index......................dubious > Test returned status 22 (wstat 5632, 0x1600) > DIED. FAILED tests 21-41 > Failed 21/41 tests, 48.78% okay > > t\primaryqual................dubious > Test returned status 255 (wstat 65280, 0xff00) > after all the subtests completed successfully > > t\ProtPsm....................ok 5/1Don't know which tests failed: got 5 ok, > expected 1 > > t\Registry...................ok 2/11This Perl doesn't implement function > getpwuid(). Skipping... > > -------------------- WARNING --------------------- > MSG: No seqdatabase.ini file found in ~/.bioinformatics/ > nor in /etc/bioinformatics/ nor in directory specified by > t/data/registry/flat;t/data/registry/bdb. Using web to get database registry > from > http://www.open-bio.org/registry/seqdatabase.ini > --------------------------------------------------- > > -------------------- WARNING --------------------- > MSG: Stored the default registry configuration in > /.bioinformatics/seqdatabase.ini > --------------------------------------------------- > t\Registry...................ok 3/11 > t\Registry...................NOK 5-------------------- WARNING > --------------------- > MSG: No database with name testflat in Registry > --------------------------------------------------- > Can't call method "get_Seq_by_id" on an undefined value at t\Registry.t line > 66, line 11. > t\Registry...................dubious > Test returned status 255 (wstat 65280, 0xff00) > DIED. FAILED tests 4-11 > > > t\seqread_fail...............ok 1/13 > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: BioFetch Error 4: ID [XXX111] not found in database > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > STACK: Error::throw > STACK: Bio::Root::Root::throw > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-live\blib\lib > /Bio/Root/Root.pm:328 > STACK: Bio::DB::BioFetch::postprocess_data > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl- > live\blib\lib/Bio/DB/BioFetch.pm:406 > STACK: Bio::DB::WebDBSeqI::get_seq_stream > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-l > ive\blib\lib/Bio/DB/WebDBSeqI.pm:525 > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl > -live\blib\lib/Bio/DB/WebDBSeqI.pm:287 > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\211004\Copyofbioperl-li > ve\blib\lib/Bio/DB/WebDBSeqI.pm:153 > STACK: main::fetch t\seqread_fail.t:69 > STACK: t\seqread_fail.t:81 > ----------------------------------------------------------- > t\seqread_fail...............dubious > Test returned status 255 (wstat 65280, 0xff00) > after all the subtests completed successfully > > > perl_tests.txt > ########### > perl -I. -w t/ESEfinder.t > ------------------------- > 1..12 > error is 0 > ok 1 > ok 2 > $Bio::Tools::Analysis::DNA::ESEfinder=HASH(0x1db571c) = bless( { > > # verbose stuff here removed > > >bioperl > atcgatgctatgcatgctatgggtgtgattcgatgcgactgttcatcgtagccccccccc > cccccctttt > ok 3 > Subroutine new redefined at Bio\Location\Simple.pm line 89, line 31. > Subroutine start redefined at Bio\Location\Simple.pm line 111, line > 31. > Subroutine end redefined at Bio\Location\Simple.pm line 137, line 31. > Subroutine length redefined at Bio\Location\Simple.pm line 174, line > 31. > Subroutine location_type redefined at Bio\Location\Simple.pm line 265, > line 31. > Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 312, > line 31. > Subroutine trunc redefined at Bio\Location\Simple.pm line 343, line > 31. > ok 4 > ok 5 > ok 6 > ok 7 > ok 8 > ok 9 > ok 10 > ok 11 > ok 12 > > > perl -I. -w t/Index.t > --------------------- > 1..41 > ok 1 > ok 2 > ok 3 > ok 4 > ok 5 > ok 6 > ok 7 > ok 8 > ok 9 > ok 10 > ok 11 > ok 12 > ok 13 > ok 14 > Subroutine new redefined at Bio\Location\Simple.pm line 89, line 87. > Subroutine start redefined at Bio\Location\Simple.pm line 111, line > 87. > Subroutine end redefined at Bio\Location\Simple.pm line 137, line 87. > Subroutine length redefined at Bio\Location\Simple.pm line 174, line > 87. > Subroutine location_type redefined at Bio\Location\Simple.pm line 265, > line 87. > Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 312, > line 87. > Subroutine trunc redefined at Bio\Location\Simple.pm line 343, line > 87. > Subroutine new redefined at Bio\Location\Fuzzy.pm line 137, line 92. > Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 164, > line 92. > Subroutine start redefined at Bio\Location\Fuzzy.pm line 226, line > 92. > Subroutine end redefined at Bio\Location\Fuzzy.pm line 251, line 92. > Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 276, line > 92. > Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 295, line > 92. > Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 315, > line 92. > Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 344, line > 92. > Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 363, line > 92. > Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 383, > line 92. > Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 450, > line 92. > Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 537, > line 92. > ok 15 > ok 16 > ok 17 > ok 18 > ok 19 > ok 20 > not ok 21 > # Failed test 21 in t/Index.t at line 118 > not ok 22 > # Failed test 22 in t/Index.t at line 125 > Can't call method "length" on an undefined value at t/Index.t line 126, > line 54. > > > perl -I. -w t/ProtPsm.t > ----------------------- > 1..1 > Can't locate package Bio::Matrix::PSM::ProtMatrix for > @Bio::Matrix::PSM::ProtPsm::ISA at t/ProtPsm.t line 22. > ok 1 > ok 2 > ok 3 > ok 4 > ok 5 > > > perl -I. -w t/Registry.t > ------------------------ > 1..11 > ok 1 > ok 2 > This Perl doesn't implement function getpwuid(). Skipping... > > -------------------- WARNING --------------------- > MSG: No seqdatabase.ini file found in ~/.bioinformatics/ > nor in /etc/bioinformatics/ nor in directory specified by > t/data/registry/flat;t/data/registry/bdb. Using web to get database registry > from > http://www.open-bio.org/registry/seqdatabase.ini > --------------------------------------------------- > > -------------------- WARNING --------------------- > MSG: Stored the default registry configuration in > /.bioinformatics/seqdatabase.ini > --------------------------------------------------- > ok 3 > not ok 4 > # Failed test 4 in t/Registry.t at line 61 > not ok 5 > # Failed test 5 in t/Registry.t at line 63 > > -------------------- WARNING --------------------- > MSG: No database with name testflat in Registry > --------------------------------------------------- > not ok 6 > # Failed test 6 in t/Registry.t at line 65 > Can't call method "get_Seq_by_id" on an undefined value at t/Registry.t line > 66, line 11. > > > perl -I. -w t/primaryqual.t > --------------------------- > # lots of output then: > Can't locate object method "header" via package "Bio::Seq::SeqWithQuality" at > Bio\SeqIO\qual.pm line 211, line > 1. > > > > > -----Original Message----- > > From: Brian Osborne [mailto:brian_osborne@cognia.com] > > Sent: 20 October 2004 19:04 > > To: nathanhaigh@ukonline.co.uk; 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Nathan, > > > > I noticed most of the Registry tests failing. I know what part of the > > problem is (getpwuid() not implemented in Windows/Activestate Perl) and I > > think I've fixed at least that part. Can you install the most recent > > Bio/DB/Registry.pm from bioperl-live and run t/Registry.t again? > > > > >perl -w -I. t/Registry.t > > > > > > Brian O. > > > > -----Original Message----- > > From: bioperl-l-bounces@portal.open-bio.org > > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Nathan Haigh > > Sent: Wednesday, October 20, 2004 10:20 AM > > To: 'Bioperl' > > Subject: RE: [Bioperl-l] make test!! > > > > Apologise for all the pervious messages! I just wanted to get this onto > the > > mailing list: > > > > I have managed to do a "nmake test" (WinXP) on bioperl-live. > > > > System: WinXP Pro > > ActiveState Perl 5.8.0 build 804 > > Nmake v6.00.8168.0 > > > > A note beforehand: > > The error message I had previously got, and heard others have also > received > > on other OS's. That contain a "line too long" error when > > trying "make test", is due to the limitations of the particular OS. > Versions > > of ExtUtils::MakeMaker >= 6.06 (current version: 6.21) > > have got round this problem by splitting long command lines from Makefiles > > into a series of smaller commands. > > > > Test Summary: > > Failed Test Stat Wstat Total Fail Failed List of Failed > > > ---------------------------------------------------------------------------- > > --- > > t\Index.t 22 5632 41 21 51.22% 21-41 > > t\Registry.t 22 5632 11 9 81.82% 3-11 > > t\seqread_fail.t 255 65280 13 0 0.00% ?? > > 115 subtests skipped. > > Failed 3/192 test scripts, 98.44% okay. 30/8816 subtests failed, 99.66% > > okay. > > NMAKE : fatal error U1077: 'I:\Programming\Perl\Perl5.8.0\bin\perl.exe' : > > return code '0xff' > > Stop. > > > > Particulars: > > t\Index......................NOK 21Can't call method "length" on an > > undefined value at t\Index.t line 124, line > > 54. > > t\Index......................dubious > > Test returned status 22 (wstat 5632, 0x1600) > > DIED. FAILED tests 21-41 > > Failed 21/41 tests, 48.78% okay > > t\Registry...................ok 2/11The getpwuid function is unimplemented > > at K:\Downloads\FlashGet\Software\Bioinform > > atics\BioPerl\1\bioperl-live\blib\lib/Bio/DB/Registry.pm line 116. > > t\Registry...................dubious > > Test returned status 22 (wstat 5632, 0x1600) > > t\seqread_fail...............ok 1/13 > > ------------- EXCEPTION: Bio::Root::Exception ------------- > > MSG: BioFetch Error 4: ID [XXX111] not found in database > > [embl][http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-e+[embl-id: > > XXX111]|[embl-acc:XXX111]+-ascii+-vn+2+-noSession]. > > STACK: Error::throw > > STACK: Bio::Root::Root::throw > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > b/Bio/Root/R > > oot.pm:328 > > STACK: Bio::DB::BioFetch::postprocess_data > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\l > > ib/Bio/DB/BioFetch.pm:406 > > STACK: Bio::DB::WebDBSeqI::get_seq_stream > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > b/Bio/DB/WebDBSeqI.pm:525 > > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\ > > lib/Bio/DB/WebDBSeqI.pm:287 > > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > > > K:\Downloads\FlashGet\Software\Bioinformatics\BioPerl\1\bioperl-live\blib\li > > b > > /Bio/DB/WebDBSeqI.pm:153 > > STACK: main::fetch t\seqread_fail.t:69 > > STACK: t\seqread_fail.t:81 > > ----------------------------------------------------------- > > t\seqread_fail...............dubious > > Test returned status 255 (wstat 65280, 0xff00) > > after all the subtests completed successfully > > > > > > Nathan > > > > > -----Original Message----- > > > From: bioperl-l-bounces@portal.open-bio.org > > [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Aaron J. > Mackey > > > Sent: 14 October 2004 21:27 > > > To: Bioperl > > > Subject: [Bioperl-l] make test!! > > > Importance: High > > > > > > > > > I've had only a very few people send me feedback about the current > > > state of bioperl-live "make test" on your favorite > > > old/crotchety/obscure platforms. I'm writing the Change log and > > > thinking about branching, but I'm an experimentalist, I need data! > > > > > > Get a bioperl-live HEAD checkout, do a "cvs update -PAd" to make sure > > > you have everything, "make distclean" if you've built from the cvs > > > checkout before, and start from scratch with the usual litany: perl > > > Makefile.PL; make; [setenv BIOPERLDEBUG 1;] make test; email Aaron. > > > > > > Setting BIOPERLDEBUG is very noisy, but it's the end result I care > > > about, not so much all the verbiage (unless there's specific verbiage > > > related to the end result ...) > > > > > > Thanks, > > > > > > -Aaron > > > > > > _______________________________________________ > > > Bioperl-l mailing list > > > Bioperl-l@portal.open-bio.org > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > --- > > > avast! Antivirus: Inbound message clean. > > > Virus Database (VPS): 0442-2, 14/10/2004 > > > Tested on: 14/10/2004 21:59:20 > > > avast! is copyright (c) 2000-2003 ALWIL Software. > > > http://www.avast.com > > > > > > > > > > --- > > avast! Antivirus: Outbound message clean. > > Virus Database (VPS): 0442-3, 15/10/2004 > > Tested on: 20/10/2004 15:20:04 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > > > > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l@portal.open-bio.org > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > > > --- > > avast! Antivirus: Inbound message clean. > > Virus Database (VPS): 0442-3, 15/10/2004 > > Tested on: 21/10/2004 07:12:10 > > avast! is copyright (c) 2000-2003 ALWIL Software. > > http://www.avast.com > > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0443-1, 20/10/2004 > Tested on: 21/10/2004 12:58:59 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > --- > avast! Antivirus: Outbound message clean. > Virus Database (VPS): 0443-1, 20/10/2004 > Tested on: 21/10/2004 13:46:01 > avast! is copyright (c) 2000-2003 ALWIL Software. > http://www.avast.com > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > -- ---------------------------------------------- This mail sent through http://www.ukonline.net From michael.watson at bbsrc.ac.uk Thu Oct 28 09:11:18 2004 From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C)) Date: Thu Oct 28 09:10:50 2004 Subject: [Bioperl-l] Bioperl 1.4 - Can't locate object method "start" via package "Bio::Seq::RichSeq" Message-ID: <8975119BCD0AC5419D61A9CF1A923E95E8966E@iahce2knas1.iah.bbsrc.reserved> Hi I know this seems to have been dealt with in previous releases and posts, but I honestly couldn't see how the fixes previously proposed (in March 2003) fit in with this problem (if I appear stupid, blame my parents). The example script render_sequence.pl in examples/biographics/ produces this error: ./render_sequence.pl CEF58D5 fetching... rendering... Can't locate object method "start" via package Bio::Seq::RichSeq at ./render_sequence.pl line 55 In another script, one which I wrote myself based on the above script, I get: Can't locate object method "start" via package Bio::Seq::RichSeq at bioperl-1.4/Bio/Graphics/Feature.pm line 269 Which makes me worry that maybe my entire bioperl dist is littered with calls to this "start" method which no longer exists.... Ideas on how to fix/patch this welcome. I'm running bioperl-1.4, SuSe Linux. Thanks Mick From cjfields at uiuc.edu Thu Oct 28 10:53:56 2004 From: cjfields at uiuc.edu (Chris Fields) Date: Thu Oct 28 10:54:42 2004 Subject: [Bioperl-l] (no subject) Message-ID: <6.1.1.1.2.20041028095223.01a26cc0@express.cites.uiuc.edu> For some reason I didn't see this pop up on the weblist, so I'm sending it again. At 01:11 AM 10/26/2004, you wrote: >Sorry I can't help here since I've never tried to install bioperl-db on >Windows. Can anyone out there who is on the same platform help? > > -hilmar I have installed bioperl-db on Windows XP without a problem (although I plan on switching over to MacOSX within a year!). Basically, here's what I did: 1) Install Activestate's free Perl package (the latest version of Perl 5.8). 2) Using PPM, install Bioperl. There are installation instructions for this on the website, and I think Sudha has progressed at least this far. 3) Install your database of choice. I installed MySQL (which has a Windows installer). 4) Install the database interface modules (DBI and DBD-MySQL, both available through PPM). Adding Randy Kobe's repository in PPM helps here, although it isn't necessary (it does help if you want other modules for bioperl, like GD). 5) Get BioSQL schema. Judging by the error, you may be missing this or bioperl-db (which operates with BioSQL). a) Go to the CVS repository and download the bioperl-db package as tarball. b) Decompress the tarball and view the installation instructions. This will tell you where to get BioSQL (hint: it's in the same CVS repository as well as the CVS mentioned in the installation files). c) Get the particular schema for your database. This is located in biosql-schema/sql. 6) Install bioperl-db using nmake. This worked well for me, although nmake is notoriously buggy sometimes. a) Using a shell (or command prompt for Windows users), migrate to the bioperl-db folder (which you decompressed above). b) Type the following: perl Makefile.PL nmake nmake install c) You might get some errors here with nmake. Don't panic (and remember your towel). Okay, bad Douglas Adams humor... d) You don't have nmake?!? get the old nmake here: http://download.microsoft.com/download/vc15/Patch/1.52/W95/EN-US/Nmake15.exe e) nmake also comes with MSVC++. You don't have MSVC++?!? Don't panic yet, because... f) I've heard reports that make also works (using MinGW or other windows-ported tools), but I haven't tried these, so be warned. 7) create you database. mysqladmin -u root create bioseqdb 8) load the schema into your database. mysql -u root bioseqdb < biosqldb-mysql.sql 9) load the taxonomy database if needed (I think it's recommended). The script is in the biosql-schema/scripts folder. Anything I'm missing? I think I've listed almost everything. I do think Cygwin is a good alternative (the installation is exactly like the instructions). Chris >On Wednesday, October 20, 2004, at 08:03 PM, Sudha S wrote: > >> >>Hi, >> >>I have been trying to install the Bio::DB for a week >>now and I need some help in this badly. >>I keep getting the error : >> >>'Error: no suitable installation target found for >>package bioperl-db.' >> >>I remember that i was prompted to give path for >>/usr/lib directory and I do not have this folder on my >>machine which is running Windows XP. What should be >>done to get over this problem? >> >>Thank you, >>Sudha >> >> >> >>_______________________________ >>Do you Yahoo!? >>Declare Yourself - Register online to vote today! >>http://vote.yahoo.com >>_______________________________________________ >>Bioperl-l mailing list >>Bioperl-l@portal.open-bio.org >>http://portal.open-bio.org/mailman/listinfo/bioperl-l >-- >------------------------------------------------------------- >Hilmar Lapp email: lapp at gnf.org >GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 >------------------------------------------------------------- > > >_______________________________________________ >Bioperl-l mailing list >Bioperl-l@portal.open-bio.org >http://portal.open-bio.org/mailman/listinfo/bioperl-l __________________________________ Chris Fields - Postdoctoral Researcher Lab of Dr. Robert Switzer Address: University of Illinois at Urbana-Champaign Dept. of Biochemistry - 323 RAL 600 S. Mathews Ave. Urbana, IL 61801 Phone : (217) 333-7098 Fax : (217) 244-5858 From cjfields at uiuc.edu Thu Oct 28 10:56:29 2004 From: cjfields at uiuc.edu (Chris Fields) Date: Thu Oct 28 10:57:12 2004 Subject: [Bioperl-l] Problems installing Bio::DB Message-ID: <6.1.1.1.2.20041028095521.01a290b0@express.cites.uiuc.edu> For some reason I didn't see this pop up on the weblist, so I'm sending it again. At 01:11 AM 10/26/2004, you wrote: >Sorry I can't help here since I've never tried to install bioperl-db on >Windows. Can anyone out there who is on the same platform help? > > -hilmar I have installed bioperl-db on Windows XP without a problem (although I plan on switching over to MacOSX within a year!). Basically, here's what I did: 1) Install Activestate's free Perl package (the latest version of Perl 5.8). 2) Using PPM, install Bioperl. There are installation instructions for this on the website, and I think Sudha has progressed at least this far. 3) Install your database of choice. I installed MySQL (which has a Windows installer). 4) Install the database interface modules (DBI and DBD-MySQL, both available through PPM). Adding Randy Kobe's repository in PPM helps here, although it isn't necessary (it does help if you want other modules for bioperl, like GD). 5) Get BioSQL schema. Judging by the error, you may be missing this or bioperl-db (which operates with BioSQL). a) Go to the CVS repository and download the bioperl-db package as tarball. b) Decompress the tarball and view the installation instructions. This will tell you where to get BioSQL (hint: it's in the same CVS repository as well as the CVS mentioned in the installation files). c) Get the particular schema for your database. This is located in biosql-schema/sql. 6) Install bioperl-db using nmake. This worked well for me, although nmake is notoriously buggy sometimes. a) Using a shell (or command prompt for Windows users), migrate to the bioperl-db folder (which you decompressed above). b) Type the following: perl Makefile.PL nmake nmake install c) You might get some errors here with nmake. Don't panic (and remember your towel). Okay, bad Douglas Adams humor... d) You don't have nmake?!? get the old nmake here: http://download.microsoft.com/download/vc15/Patch/1.52/W95/EN-US/Nmake15.exe e) nmake also comes with MSVC++. You don't have MSVC++?!? Don't panic yet, because... f) I've heard reports that make also works (using MinGW or other windows-ported tools), but I haven't tried these, so be warned. 7) create you database. mysqladmin -u root create bioseqdb 8) load the schema into your database. mysql -u root bioseqdb < biosqldb-mysql.sql 9) load the taxonomy database if needed (I think it's recommended). The script is in the biosql-schema/scripts folder. Anything I'm missing? I think I've listed almost everything. I do think Cygwin is a good alternative (the installation is exactly like the instructions). Chris >On Wednesday, October 20, 2004, at 08:03 PM, Sudha S wrote: > >> >>Hi, >> >>I have been trying to install the Bio::DB for a week >>now and I need some help in this badly. >>I keep getting the error : >> >>'Error: no suitable installation target found for >>package bioperl-db.' >> >>I remember that i was prompted to give path for >>/usr/lib directory and I do not have this folder on my >>machine which is running Windows XP. What should be >>done to get over this problem? >> >>Thank you, >>Sudha >> >> >> >>_______________________________ >>Do you Yahoo!? >>Declare Yourself - Register online to vote today! >>http://vote.yahoo.com >>_______________________________________________ >>Bioperl-l mailing list >>Bioperl-l@portal.open-bio.org >>http://portal.open-bio.org/mailman/listinfo/bioperl-l >-- >------------------------------------------------------------- >Hilmar Lapp email: lapp at gnf.org >GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 >------------------------------------------------------------- > > >_______________________________________________ >Bioperl-l mailing list >Bioperl-l@portal.open-bio.org >http://portal.open-bio.org/mailman/listinfo/bioperl-l __________________________________ Chris Fields - Postdoctoral Researcher Lab of Dr. Robert Switzer Address: University of Illinois at Urbana-Champaign Dept. of Biochemistry - 323 RAL 600 S. Mathews Ave. Urbana, IL 61801 Phone : (217) 333-7098 Fax : (217) 244-5858 __________________________________ Chris Fields - Postdoctoral Researcher Lab of Dr. Robert Switzer Address: University of Illinois at Urbana-Champaign Dept. of Biochemistry - 323 RAL 600 S. Mathews Ave. Urbana, IL 61801 Phone : (217) 333-7098 Fax : (217) 244-5858 From bioperlanand at yahoo.com Thu Oct 28 14:03:49 2004 From: bioperlanand at yahoo.com (Anand Venkatraman) Date: Thu Oct 28 14:02:27 2004 Subject: [Bioperl-l] Obtaining GO cross-references from SwissProt Records --reply to Jason Stajich's solution In-Reply-To: <77D3B5B7-2865-11D9-95BB-000393C44276@cgt.mc.duke.edu> Message-ID: <20041028180350.65286.qmail@web61101.mail.yahoo.com> Hi, I looked at the swiss.pm IO code, the regular expression parsing looks fine. I even changed the code and tried to print out all the cross-reference lines. The script finds and prints only some GO lines and fails to find others. But, it works well (prints) for all other cross-reference lines . When it does find GO lines for a particular SwissProt reord, it only prints the 1st of those GO lines. Here is the relevant section of the code ----------------------------------------------------- my $seqio_object = Bio::SeqIO->new(-file => $sp_file, -format => "swiss"); while (my $seq_object = $seqio_object->next_seq) { if ($seq_object->species->binomial =~ m/Homo sapiens/){ print "Accession: ", $seq_object->accession_number(),"\t"; my $annotation = $seq_object->annotation(); foreach my $dblink ($annotation->get_all_Annotations('dblink') ) { print "\t", $dblink->database, ":", $dblink->primary_id, "\t"; } } } ------------------------------------------------------- Anand --- Jason Stajich wrote: > I didn't try to answer that - not sure about the GO > stuff. You might > want to walk through the swiss.pm SeqIO code to > figure out whether or > not that the regular expressions are parsing out the > data correctly for > DR lines for GO terms. Or else something is > getting overwritten > perhaps. > > -jason > > On Oct 27, 2004, at 4:42 PM, Anand Venkatraman > wrote: > > > Hi, > > > > Thanks a lot. > > > > I tried the code with the $dblink->optional_id. It > > works. > > > > But whats puzzling is that the code is behaving > > weirdly when it comes to extracting the GO > > cross-refences. > > > > As stated in my earlier mail, it is extracting it > in > > some cases & fails in other cases. And when it > does > > work & extract the GO cross-reference, it does so > only > > for the 1st occurence of the GO cross-reference. > > > > There are no warnings or errors. > > > > I could send a small SwissProt file as an > attachment > > if you would like to have a look at. > > > > Thanks once again. > > > > Anand > > > > --- Jason Stajich wrote: > > > >> The protein ID is stored in $dblink->optional_id > >> > >> This is the code which does the parsing work in > >> Bio::SeqIO::swiss to > >> make a DBlink Xref. > >> elsif > >> (/^DR\s+(\S+)\;\s+(\S+)\;\s+([^;]+)[\;\.](.*)$/) > { > >> my $dblinkobj = > >> Bio::Annotation::DBLink->new(); > >> $dblinkobj->database($1); > >> $dblinkobj->primary_id($2); > >> $dblinkobj->optional_id($3); > >> my $comment = $4; > >> if(length($comment) > 0) { > >> # edit comment to get rid of > leading > >> space and trailing > >> dot > >> if( $comment =~ /^\s*(\S+)\./ ) { > >> $dblinkobj->comment($1); > >> } else { > >> > $dblinkobj->comment($comment); > >> } > >> } > >> > >> $annotation->add_Annotation('dblink',$dblinkobj); > >> } > >> > >> -jason > >> On Oct 27, 2004, at 11:47 AM, Anand Venkatraman > >> wrote: > >> > >>> Hi, > >>> > >>> Thanks a lot for the response. > >>> > >>> Some clarifications from my side: > >>> > >>> [1] Yes, by the EMBL tag, I catually meant the > >> DbXREFto EMBL for the > >>> specific SwissProt accession number. Sorry for > the > >> confusion. Lets > >>> say we have this line from a SwsisProt record: > >>> > >>> DR EMBL; X57346; CAA40621.1; -. > >>> > >>> By the method outlined in my code, I am able to > >> pull up only the EMBL > >>> nucleotide accession number (X57346) , but I am > >> unable to get to the > >>> Protein Accession Number (CAA40621.1). > >>> > >>> [2] Problems with GO cross-references: > >>> > >>> I can send you a small portion of the SwissProt > >> file -- do you want me > >>> to send it as an attachment or within the text > of > >> the message. Can we > >>> send file attachments to the mailing list? > >>> > >>> > >>> Thanks a lot. > >>> > >>> Anand > >>> > >>> Hilmar Lapp wrote: > >>> > >>> On Tuesday, October 26, 2004, at 09:44 PM, Anand > >> Venkatraman wrote: > >>> > >>>> Hi, > >>>> > >>>> I am using Bioperl to parse SwissProt Records. > >>>> > >>>> The bioperl version is 1.4. > >>>> > >>>> I am having 2 problems : > >>>> > >>>> Problem 1: I am unable to get all the accession > >>>> numbers from the line starting with AC on the > >>>> SwissProt Record. > >>> > >>> Other accessions than the first are available > via > >>> $seq->get_secondary_accessions(). > >>> > >>>> > >>>> Problem 2: I am also trying to get the > associated > >>>> EMBL and GO cross-references fro a given > >> Swissprot > >>>> entry. The problem I am having is that > >>>> [a]: I am only getting the Nucleotide Id and > Not > >> the > >>>> Protein Id from the EMBL tag and > >>> > >>> What do you mean by EMBL tag? Dbxrefs to EMBL? > >>> > >>>> [b]: In some cases, I am unable to get the GO > >> ids. > >>> > >>> This should not happen. Can you send the > accession > >> numbers for those > >>> sequences, or better yet, the > swissprot-formatted > >> file with those (or a > >>> selection thereof) that fail? > >>> > >>> -hilmar > >>> > >>> > >>>> For > >>>> example, from the code below, I am only getting > >> the GO > >>>> id for some records, and missing it for some. > >> Also, if > >>>> a particular record has 3 or 4 lines of GO, the > >> code > >>>> just captures the 1st occurence of the GO Id(if > >> and > >>>> when it does so). > >>>> > >>>> > >>>> > >>>> This is the code > >>>> > >> > > > __________________________________________________ Do You Yahoo!? Tired of spam? Yahoo! Mail has the best spam protection around http://mail.yahoo.com From samkalat at sneakrets.com Thu Oct 28 14:51:29 2004 From: samkalat at sneakrets.com (samkalat@sneakrets.com) Date: Thu Oct 28 14:51:08 2004 Subject: [Bioperl-l] SCF get_header stopped working Message-ID: <200410281851.NAA18296@mocha.propagation.net> (Apologies in advance if this is a duplicate; this is my third time sending the message. The first was rejected as sent from an unregistered email address, and the second time I'm not so sure what went wrong.) Hi folks. I have a couple of scripts that generate PNG graphics from SCF files: one for looking at traces, and the other for browsing sequence and quality data (especially for auditing how well our basecalling, screening, and trimming has performed). Knowing that people are likely to lose track of what graphic goes with what chromatogram if they are left to their own devices, I decided to embed a lot of file header information directly in the image. I got this all working and somewhere along the line updated my bioperl package (without even noticing, as part of a debian system update) and the scripts broke. Part of the problem was I was using the get_trace() function in Bio::SeqIO::scf (I think), which I see now was deprecated in favor of the SequenceTrace object. Fair enough, that was a small fix. What I cannot seem to repair is that header info, which looks like it is supposed to work but doesn't. I get a hash with keys but no values. Code looks like so: my %header = %{$scf_input_file->get_header()}; my $info = $scf_input_file->{'comments'}->{'NAME'}." "; $info .= "Nucleotides: ".$header{'bases'}." "; if ( $scf_input_file->{'comments'}->{'MACH'} ) { $info .= "Machine: ".$scf_input_file->{'comments'}->{'MACH'}." ";} if ( $scf_input_file->{'comments'}->{'SIGN'} ) { $info .= "Signal strength: ".$scf_input_file->{'comments'}->{'SIGN'}." ";} $img->string(gdSmallFont,5,0,$info,$black); $info = "SCF version: ".$header{'version'}." "; if ( $scf_input_file->{'comments'}->{'CONV'} ) { $info .= "Converted by: ".$scf_input_file->{'comments'}->{'CONV'}." ";} if ( $scf_input_file->{'comments'}->{'BCSW'} ) { $info .= "Base called by: ".$scf_input_file->{'comments'}->{'BCSW'}." ";} if ( $scf_input_file->{'comments'}->{'DYEP'} ) { $info .= "Dye: ".$scf_input_file->{'comments'}->{'DYEP'}." ";} if ( $scf_input_file->{'comments'}->{'LANE'} ) { $info .= "Lane: ".$scf_input_file->{'comments'}->{'LANE'}." ";} $img->string(gdSmallFont,5,10,$info,$black); Is there a different, preferred way of extracting this kind of information from an SCF file? I don't know specifically which fields are likely to be important in the long run, but I figure the more, the merrier. Thanks, Sam Kalat _______________________________________________________ From awoolfe at rfcgr.mrc.ac.uk Thu Oct 28 11:36:01 2004 From: awoolfe at rfcgr.mrc.ac.uk (Adam Woolfe) Date: Thu Oct 28 15:04:24 2004 Subject: [Bioperl-l] Reconstructing BLAST output Message-ID: Hi, I was just wondering if there was any module in bioperl that can reconstruct BLAST output from the constituent data. I have parsed BLAST output using SeqIO into a relational database (so I have all the constituent data), but now i need to print that data back out to look like BLAST output. I know it sounds crazy but thats what i need. cheers adam From ediths at unizh.ch Thu Oct 28 09:44:30 2004 From: ediths at unizh.ch (Edith Schlagenhauf) Date: Thu Oct 28 15:04:42 2004 Subject: [Bioperl-l] Parsing Blast reports: Length of sequence of a hit ? Message-ID: Hi, 1) with the deprecated Bio::Tools::Blast module one could get the total length of the hit sequence as given in the Genbank (and in the Blast report) file by using the length() method ($hit->length()). Is there any equivalent functionality in Bio::SearchIO ? 2) I use the GenBank.pm module to get from hit accession as given in a Blast report to gi number, ie: ------------------------------------------------------- use strict; use Bio::DB::GenBank; my $gb_hit_accession = "AF091802"; my $ref_hit_accession = "XM_480600"; # get PID for NCBI ENTREZ my $seq_obj = $gb->get_Seq_by_acc($ref_hit_accession); my $primary_id = $seq_obj->primary_id(); print STDOUT "\$primary_id is: $primary_id\n"; ------------------------------------------------------- a) RefSeq sequences exit with : -------------------- WARNING --------------------- MSG: acc (gb|XM_480600) does not exist --------------------------------------------------- Can't call method "primary_id" on an undefined value at ./gbTest.pl line 23. the reason being that ref| is replaced with gb|. when I changed the following line of code in GenBank.pm sub get_Seq_by_acc { my ($self,$seqid) = @_; $self->SUPER::get_Seq_by_acc("gb|$seqid"); } to : sub get_Seq_by_acc { my ($self,$seqid) = @_; $self->SUPER::get_Seq_by_acc("$seqid"); } ie, omitting the "gb|" string, the script proceeded for all seqs (also for gb| seqs) without problems. Thus, what for is this "gb|" added? b) is there a more convenient way to get gi numbers from accession numbers using Bioperl? Thanks for your input, Edith ****************************************** Dr Edith Schlagenhauf Bioinformatics Institute of Plant Biology University of Zurich Zollikerstrasse 107 CH-8008 Zurich SWITZERLAND e-mail: ediths AT botinst DOT unizh DOT ch Tel.: +41 1 634 82 78 Fax : +41 1 634 82 04 ****************************************** From jason.stajich at duke.edu Thu Oct 28 15:15:55 2004 From: jason.stajich at duke.edu (Jason Stajich) Date: Thu Oct 28 15:14:41 2004 Subject: [Bioperl-l] Reconstructing BLAST output In-Reply-To: References: Message-ID: See Bio::SearchIO::Writer::TextResultWriter and HTMLResultWriter which reconstitute a report based on Bio::Search objects. You will need to build Bio::Search objects however from the DB - something that I am sure has been done in part somewhere already. Ensembl also has their own way to store this data but I don't think are using Bio::Search type object for it at the moment. If someone gets this bit of to-from RDMBS code working for would be really nice to have it in bioperl as just a simple component. I know lots of people have their own store-similarity-search-results schemas out there, happy to see a Bio::Search serializiation layer written to talk to these. -jason On Oct 28, 2004, at 11:36 AM, Adam Woolfe wrote: > Hi, > > I was just wondering if there was any module in bioperl that can > reconstruct BLAST output from the constituent data. I have parsed BLAST > output using SeqIO into a relational database (so I have all the > constituent data), but now i need to print > that data back out to look like BLAST output. I know it sounds crazy > but > thats what i need. > > cheers > > adam > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- Jason Stajich jason.stajich at duke.edu http://www.duke.edu/~jes12/ From jason.stajich at duke.edu Thu Oct 28 15:27:14 2004 From: jason.stajich at duke.edu (Jason Stajich) Date: Thu Oct 28 15:25:50 2004 Subject: [Bioperl-l] Parsing Blast reports: Length of sequence of a hit ? In-Reply-To: References: Message-ID: <5F437992-2917-11D9-8BD3-000393C44276@duke.edu> On Oct 28, 2004, at 9:44 AM, Edith Schlagenhauf wrote: > Hi, > > 1) with the deprecated Bio::Tools::Blast module one could get > the total length of the hit sequence as given in the Genbank > (and in the Blast report) file by using the length() method > ($hit->length()). > > Is there any equivalent functionality in Bio::SearchIO ? > $hit->length() does this. See the SearchIO HOWTO for an explanation - http://www.bioperl.org/HOWTOs/ > > 2) I use the GenBank.pm module to get from hit accession as > given in a Blast report to gi number, > ie: > > ------------------------------------------------------- > use strict; > use Bio::DB::GenBank; > > my $gb_hit_accession = "AF091802"; > my $ref_hit_accession = "XM_480600"; > > # get PID for NCBI ENTREZ > > my $seq_obj = $gb->get_Seq_by_acc($ref_hit_accession); > my $primary_id = $seq_obj->primary_id(); > > print STDOUT "\$primary_id is: $primary_id\n"; > ------------------------------------------------------- > > > a) RefSeq sequences exit with : > > -------------------- WARNING --------------------- > MSG: acc (gb|XM_480600) does not exist > --------------------------------------------------- > Can't call method "primary_id" on an undefined value at ./gbTest.pl > line > 23. > > the reason being that ref| is replaced with gb|. > > when I changed the following line of code in GenBank.pm > > sub get_Seq_by_acc { > my ($self,$seqid) = @_; > $self->SUPER::get_Seq_by_acc("gb|$seqid"); > } > to : > > sub get_Seq_by_acc { > my ($self,$seqid) = @_; > $self->SUPER::get_Seq_by_acc("$seqid"); > } > > ie, omitting the "gb|" string, the script proceeded for all seqs > (also for gb| seqs) without problems. > Thus, what for is this "gb|" added? > NCBI required to specify that we are looking for an accession number it if I remember correctly, don't really remember though to be honest. Perhaps this hack can be removed now, not sure... > > b) is there a more convenient way to get gi numbers from accession > numbers using Bioperl? Well NCBI provides the resource so would be their call. you can generate a accession to gi lookup table by grepping through your blast db and pulling out the gi number and accession, save this in a file and build a persistent lookup DB with DB_File or something equivalent. That is what I'd do if I am doing lots of these lookups. Of course if you are trying to do this for BLAST results you can have the GI number in the report if you specify just add the -I T option in your blastall command -- from the blastall docs: -I Show GI's in deflines [T/F] > Thanks for your input, > Edith > > > > ****************************************** > Dr Edith Schlagenhauf > Bioinformatics > Institute of Plant Biology > University of Zurich > Zollikerstrasse 107 > CH-8008 Zurich > SWITZERLAND > > e-mail: ediths AT botinst DOT unizh DOT ch > Tel.: +41 1 634 82 78 > Fax : +41 1 634 82 04 > ****************************************** > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- Jason Stajich jason.stajich at duke.edu http://www.duke.edu/~jes12/ From kchoi2 at unity.ncsu.edu Thu Oct 28 22:09:33 2004 From: kchoi2 at unity.ncsu.edu (Kwangbom Choi) Date: Thu Oct 28 22:08:56 2004 Subject: [Bioperl-l] making msf file from the array of sequence string Message-ID: Given that the aligned sequences are available in the form of string array, how can I make it an msf file? My current idea is ... (1) make each aligned sequence string to be an object of Bio::LocatableSeq (2) add_seq each LocatableSeq object to the Bio::Align::AlignI object (3) initiate msf format output filehandler using Bio::AlignIO (4) use write_aln in Bio::AlignIO::msf But my problem in this scheme is that I do not know how to initiate an empty Bio::Align::AlignI object to which my aligned sequences are added (step 2 above). Thank you in advance. -- Sincerely, Kwangbom Choi From nathanhaigh at ukonline.co.uk Fri Oct 29 02:07:07 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Fri Oct 29 02:06:05 2004 Subject: [Bioperl-l] making msf file from the array of sequence string In-Reply-To: Message-ID: <001101c4bd7d$86e12440$19f1cdd9@Desktop> After creating your Bio::LocatableSeq object you need to add it to a Bio::SimpleAlign object not Bio::Align::AlignI. Something along the lines of this should work: my $aln = new Bio::SimpleAlign(); # you will probably want to loop over this section for each of your seqs my $seq = new Bio::LocatableSeq(-seq => "CAGT-GGT", -id => "seq1", -start => 1, -end => 7); $aln->add_seq($seq); my $out_msf = Bio::AlignIO->new(-file => ">out.aln.msf", -format => 'msf'); $out_msf->write_aln($aln); Nathan > -----Original Message----- > From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Kwangbom Choi > Sent: 29 October 2004 03:10 > To: bioperl-l@portal.open-bio.org > Subject: [Bioperl-l] making msf file from the array of sequence string > > > Given that the aligned sequences are available in the form of string > array, how can I make it an msf file? My current idea is ... > > (1) make each aligned sequence string to be an object of Bio::LocatableSeq > (2) add_seq each LocatableSeq object to the Bio::Align::AlignI object > (3) initiate msf format output filehandler using Bio::AlignIO > (4) use write_aln in Bio::AlignIO::msf > > But my problem in this scheme is that I do not know how to initiate > an empty Bio::Align::AlignI object to which my aligned sequences are > added (step 2 above). Thank you in advance. > > -- > Sincerely, > Kwangbom Choi > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l From sharma.animesh at gmail.com Fri Oct 29 04:13:51 2004 From: sharma.animesh at gmail.com (ani) Date: Fri Oct 29 04:19:18 2004 Subject: [Bioperl-l] help on pdb Message-ID: <156674e60410290113135d245e@mail.gmail.com> I have installed Bioperl 1.4 on my windows system. Now I want to use it to read pdb file and extract the sequence base on their secondary structure label. I would also like to have the coordinate of the c-alpha of these residues. I was trying to read the PDB.pm file but couldnt get the exact methods to do what I want. (http://doc.bioperl.org/releases/bioperl-1.4/Bio/Structure/IO/pdb.html) A web pointer/reference will do. Regards, Ani -- ______________________"The Answer Lies in Genome"______________________ From m.claesson at student.ucc.ie Fri Oct 29 05:17:46 2004 From: m.claesson at student.ucc.ie (Marcus Claesson) Date: Fri Oct 29 05:16:41 2004 Subject: [Bioperl-l] how to create Graphics object from home-made SQL table with parsed blast data? Message-ID: <1099041466.15432.1363.camel@morpheus.ucc.ie> Hi there, My apologies if this already has been adressed in this list. I have a number of mysql tables with blast data that I parsed using Bio::SearchIO (see below). I now want to use that data to create graphics overviews in png-format with the Bio::Graphics module. I guess the normal way for doing this is by implementing Bio::SeqFeature to the Bio::Graphics::Panel class. However, all blast-outputs are already parsed and put into a table and I would like to use that format. Is there any way of using these tables instead of the Bio::SeqFeature module? Here is how it was parsed and put into the table: $in = new Bio::SearchIO(-format => 'blast', -file => 'blast_output.txt'); $dbh->do("CREATE TABLE $table(format TEXT NOT NULL,sbj_name TEXT NOT NULL,sbj_count INTEGER,hsp_count INTEGER,hsp_length INTEGER,E_value DOUBLE PRECISION,score INTEGER,bits REAL,percent_id REAL,query_begin INTEGER,query_end INTEGER,sbj_length INTEGER,sbj_begin INTEGER,sbj_end INTEGER,frame CHAR(3),alignment TEXT)") unless ($add eq "yes"); $sth = $dbh->prepare("INSERT INTO $table VALUES (?,?,?,?,?,?,?,?,?,?,?,?,?,?,?,?)"); while($result = $in->next_result) { $sbj_count = 0; while($hit = $result->next_hit) { $sbj_count++; my $hsp_count = 0; my $sbj_name = $hit->name." ".$hit->description; $sbj_name =~ s/'/\\'/gi; my $sbj_length = $hit->length('query'); while($hsp = $hit->next_hsp ) { $hsp_count++; if ($format eq "blast") { $frame_value = ($hsp->query->frame + 1) * $hsp->query->strand; } elsif ($format eq "fasta") { $frame_value = "+" if ($hsp->query->strand eq "1"); $frame_value = "-" if ($hsp->query->strand eq "-1"); } my $align = "Query -->\n". $hsp->query_string."\n". $hsp->homology_string."\n". $hsp->hit_string."\n". "Subject -->\n"; my $evalue = $hsp->evalue; $evalue =~ s/^e/1e/gi; my $score = $hsp->score; my $bits = $hsp->bits; my $percent_id = $hsp->percent_identity; my $hsp_length = $hsp->length('total'); my $query_begin = $hsp->query->start + $offset; my $query_end = $hsp->query->end + $offset; my $sbj_begin = $hsp->hit->start; my $sbj_end = $hsp->hit->end; $sth->execute($format,$sbj_name,$sbj_count,$hsp_count,$hsp_length,$evalue,$score,$bits,$percent_id,$query_begin,$query_end,$sbj_length,$sbj_begin,$sbj_end,$frame_value,$align); } } Many thanks in advance! Marcus From Mikko.Arvas at vtt.fi Fri Oct 29 05:44:17 2004 From: Mikko.Arvas at vtt.fi (Mikko Arvas) Date: Fri Oct 29 05:42:50 2004 Subject: [Bioperl-l] load_ontology.pl crashes In-Reply-To: <200410201439.i9KEcNKu003899@portal.open-bio.org> Message-ID: <4.3.2.7.2.20041029094643.00cc2bb8@vttmail.vtt.fi> Hi, I am running Suse8.1, bioperl 1.4 w/ ontology modules updated from cvs, couple weeks old bioperl-db from cvs and mysql 3.23.52 on a desktop (2.4Ghz, 756Mb). I got NCBI taxon database and a few genomes inside biosql. Otherwise things work fine, but when I am trying to load interpro the system crashes. for example: >nice -n 19 load_ontology --format interpro interpro.xml .... 10900 and crashes. How to proceed now, I am doing something stupid or is this just a too big job for my machine or is there a way to spilt the file somehow and feed it in pieces or can I somehow filter the interpro.xml file I actually need only fungi related data out of there? Cheers, mikko Mikko Arvas VTT Biotechnology e-mail: mikko.arvas@vtt.fi tel: +358-(0)9-456 5827 mobile: +358-(0)44-381 0502 fax: +358-(0)9-455 2103 mail: Tietotie 2, Espoo P.O. Box 1500 FIN-02044 VTT, Finland From jan.aerts at wur.nl Fri Oct 29 06:01:53 2004 From: jan.aerts at wur.nl (Jan Aerts) Date: Fri Oct 29 05:59:38 2004 Subject: [Bioperl-l] how to create Graphics object from home-made SQL table with parsed blast data? In-Reply-To: <1099041466.15432.1363.camel@morpheus.ucc.ie> References: <1099041466.15432.1363.camel@morpheus.ucc.ie> Message-ID: <1099044113.6498.8.camel@condor.local> Hi Marcus, I would start creating a GFF file based on your database, and visualize that using either gbrowse (http://www.gmod.org/ggb/gbrowse.shtml) or a custom script. A step-by-step procedure to write such a script using the bioperl package is available at http://bioperl.org/HOWTOs/Graphics-HOWTO/index.html. jan. On Fri, 2004-10-29 at 05:17, Marcus Claesson wrote: > Hi there, > > My apologies if this already has been adressed in this list. I have a > number of mysql tables with blast data that I parsed using Bio::SearchIO > (see below). I now want to use that data to create graphics overviews in > png-format with the Bio::Graphics module. I guess the normal way for > doing this is by implementing Bio::SeqFeature to the > Bio::Graphics::Panel class. However, all blast-outputs are already > parsed and put into a table and I would like to use that format. Is > there any way of using these tables instead of the Bio::SeqFeature > module? > > Here is how it was parsed and put into the table: > > $in = new Bio::SearchIO(-format => 'blast', > -file => 'blast_output.txt'); > > $dbh->do("CREATE TABLE $table(format TEXT NOT NULL,sbj_name TEXT NOT > NULL,sbj_count INTEGER,hsp_count INTEGER,hsp_length INTEGER,E_value > DOUBLE PRECISION,score INTEGER,bits REAL,percent_id REAL,query_begin > INTEGER,query_end INTEGER,sbj_length INTEGER,sbj_begin INTEGER,sbj_end > INTEGER,frame CHAR(3),alignment TEXT)") unless ($add eq "yes"); > $sth = $dbh->prepare("INSERT INTO $table VALUES > (?,?,?,?,?,?,?,?,?,?,?,?,?,?,?,?)"); > while($result = $in->next_result) { > $sbj_count = 0; > while($hit = $result->next_hit) { > $sbj_count++; > my $hsp_count = 0; > my $sbj_name = $hit->name." ".$hit->description; > $sbj_name =~ s/'/\\'/gi; > my $sbj_length = $hit->length('query'); > while($hsp = $hit->next_hsp ) { > $hsp_count++; > if ($format eq "blast") { > $frame_value = ($hsp->query->frame + 1) * $hsp->query->strand; > } elsif ($format eq "fasta") { > $frame_value = "+" if ($hsp->query->strand eq "1"); > $frame_value = "-" if ($hsp->query->strand eq "-1"); > } > my $align = "Query -->\n". > $hsp->query_string."\n". > $hsp->homology_string."\n". > $hsp->hit_string."\n". > "Subject -->\n"; > my $evalue = $hsp->evalue; > $evalue =~ s/^e/1e/gi; > my $score = $hsp->score; > my $bits = $hsp->bits; > my $percent_id = $hsp->percent_identity; > my $hsp_length = $hsp->length('total'); > my $query_begin = $hsp->query->start + $offset; > my $query_end = $hsp->query->end + $offset; > my $sbj_begin = $hsp->hit->start; > my $sbj_end = $hsp->hit->end; > > $sth->execute($format,$sbj_name,$sbj_count,$hsp_count,$hsp_length,$evalue,$score,$bits,$percent_id,$query_begin,$query_end,$sbj_length,$sbj_begin,$sbj_end,$frame_value,$align); > } > } > > > Many thanks in advance! > > Marcus > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l From sdavis2 at mail.nih.gov Fri Oct 29 06:18:59 2004 From: sdavis2 at mail.nih.gov (Sean Davis) Date: Fri Oct 29 06:17:16 2004 Subject: [Bioperl-l] how to create Graphics object from home-made SQL table with parsed blast data? In-Reply-To: <1099041466.15432.1363.camel@morpheus.ucc.ie> References: <1099041466.15432.1363.camel@morpheus.ucc.ie> Message-ID: Marcus, The following was NOT!!! meant for public consumption, but it does show a script that I use for generating graphics from BLAT output (it is in a CGI content, so sorry about that part of things). You could likely munge it to something useful to you. In particular, look at how I set up the Panel and how I generate seqfeatures on the fly from DB query results. Perl Gurus can use this as fodder for the critique mill. Sean sub return_graphical_results { my $self = shift; # Get Query Object my $q = $self->query(); my $template = $self->load_tmpl('mode4.html'); my $oligoid = $q->param('name'); # Get database handles my $probedbh = $self->param('probedbh'); my $ensdbh = $self->param('ensdbh'); $template->param(OLIGOID => $oligoid); my ($fh,$filename)=tempfile(DIR=>'/Library/WebServer/Documents/ oligodir',SUFFIX=>'.png'); my $sth=$probedbh->prepare("select length from oligo where oligo='$oligoid'"); eval { $sth->execute(); }; if ($@) { carp "Database error: $DBI::errstr\n"; $probedbh->rollback; } my ($Qsize)=$sth->fetchrow_array; my $panel=Bio::Graphics::Panel->new(-key_style=>'between', -length => $Qsize, -width => 800, -pad_left => 10, -pad_right => 10, ); my $full_length = Bio::SeqFeature::Generic->new(-start=>1,-end=>$Qsize); my $track=$panel->add_track($full_length, -glyph => 'arrow', -tick => 2, -fgcolor => 'black', -double => 1, ); my %track; my @db=qw/ ensGene knownGene H-inv RefSeq genomic dbEST /; foreach my $dbname (@db) { $track{$dbname}=$panel->add_track(-key => $dbname, -glyph => 'graded_segments', -label => 1, -min_score => 100, -max_score => 140, -bgcolor => 'blue', -font2color=> 'red', -description => sub { my $feat=shift; return("score=" . $feat->score); }, ); } my $sql=q{select db,matches,mismatch,strand,Qstart,Qend, target_id,Tstart,Tend,block_sizes,block_count,Qstarts from hit,oligo,db,analysis where oligo.oligo=? and oligo.oligo_id=hit.oligo_id AND hit.analysis_id=analysis.analysis_id AND db.db_id=analysis.db_id }; $sth=$probedbh->prepare($sql); eval { $sth->execute($oligoid); }; if ($@) { carp "Database error: $DBI::errstr\n"; $probedbh->rollback; } # LOOP OVER THE HITS AND GENERATE GRAPHICS while (my ($db,$match,$mismatch,$strand,$Qstart,$Qend,$target_id,$Tstart, $Tend,$block_sizes,$block_count,$Qstarts) = $sth->fetchrow_array) { my $score = 2*$match-$mismatch; my $feature = Bio::SeqFeature::Generic->new(-display_name => $target_id, -start => $Qstart+1, -end => $Qend, -tstart => $Tstart, -tend => $Tend, -score => $score, ); my @Qstarts=split(',',$Qstarts); my @block_sizes=split(',',$block_sizes); for (my $i=0;$i<=$#Qstarts;$i++) { if ($strand eq '+') { my $subfeature = Bio::SeqFeature::Generic->new( -score => $score, -start => $Qstarts[$i]+1, -end => $Qstarts[$i]+$block_sizes[$i], ); $feature->add_sub_SeqFeature($subfeature); } else { # negative strand! my $subfeature = Bio::SeqFeature::Generic->new( -score => $score, -end => $Qsize-$Qstarts[$i], -start => $Qsize-$block_sizes[$i]-$Qstarts[$i]+1 ); $feature->add_sub_SeqFeature($subfeature); } } $track{$db}->add_feature($feature); } print $fh $panel->png; $panel->finished; $fh->close; $filename=~s/\/Library\/WebServer\/Documents//; $template->param(FILENAME => $filename); return $template->output; } From whs at ebi.ac.uk Fri Oct 29 06:19:36 2004 From: whs at ebi.ac.uk (Will Spooner) Date: Fri Oct 29 06:18:44 2004 Subject: [Bioperl-l] Reconstructing BLAST output In-Reply-To: Message-ID: The way that the Ensembl system works is as follows; - Run the search (Bio::Tools::Run::Search, not yet in BioPerl), - Parse the report (Bio::SearchIO), - Save the parsed Bio::Search::Result objects to a MySQL database. For the final step I needed to; - Write a Bio::Root::Storable class that provides inheritable methods for serialising BioPerl objects. This is in BioPerl, but an updated version will be added, - Create a Bio::Search::Result::StorableResult that inherets Storable, and similar modules for Hit and HSP, - Write a Bio::Root::Storable compliant adaptor to connect to the MySQL database. Implementation code looks a bit like this; # Storing my $adaptor = Bio::EnsEMBL::External::BlastAdaptor->new( @args ); my $result = $searchio->next_result(); my $ticket = $result->store( $adaptor ); ... # Retrieving my $result = Bio::Root::Storable->retrieve( $ticket, $adaptor ); For different schemas you would simply need a customised adaptor module. Does this tie in with your ideas Jason? All the code is in Ensembl/BioPerl CVS. An overview document is available from; http://www.ensembl.org/Docs/linked_docs/BlastView_search_api.pdf (caveat - quite old, some differences from current system) Will On Thu, 28 Oct 2004, Jason Stajich wrote: > See Bio::SearchIO::Writer::TextResultWriter and HTMLResultWriter which > reconstitute a report based on Bio::Search objects. You will need to > build Bio::Search objects however from the DB - something that I am > sure has been done in part somewhere already. Ensembl also has their > own way to store this data but I don't think are using Bio::Search type > object for it at the moment. > > If someone gets this bit of to-from RDMBS code working for would be > really nice to have it in bioperl as just a simple component. I know > lots of people have their own store-similarity-search-results schemas > out there, happy to see a Bio::Search serializiation layer written to > talk to these. > > -jason > On Oct 28, 2004, at 11:36 AM, Adam Woolfe wrote: > > > Hi, > > > > I was just wondering if there was any module in bioperl that can > > reconstruct BLAST output from the constituent data. I have parsed BLAST > > output using SeqIO into a relational database (so I have all the > > constituent data), but now i need to print > > that data back out to look like BLAST output. I know it sounds crazy > > but > > thats what i need. > > > > cheers > > > > adam > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l@portal.open-bio.org > > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > > > > -- > Jason Stajich > jason.stajich at duke.edu > http://www.duke.edu/~jes12/ > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > From Mikko.Arvas at vtt.fi Fri Oct 29 09:04:31 2004 From: Mikko.Arvas at vtt.fi (Mikko Arvas) Date: Fri Oct 29 09:03:00 2004 Subject: [Bioperl-l] Cont: load_ontology.pl crashes Message-ID: <4.3.2.7.2.20041029140129.00cafa30@vttmail.vtt.fi> >Date: Fri, 29 Oct 2004 10:44:17 +0100 >To: bioperl-l@portal.open-bio.org >From: Mikko Arvas >Subject: load_ontology.pl crashes > >Hi, > >I am running Suse8.1, bioperl 1.4 w/ ontology modules updated from cvs, >couple weeks old bioperl-db from cvs and mysql 3.23.52 >on a desktop (2.4Ghz, 756Mb). I got NCBI taxon database and a few genomes >inside biosql. > >Otherwise things work fine, but when I am trying to load interpro the >system crashes. for example: > >nice -n 19 load_ontology --format interpro interpro.xml >.... >10900 >and crashes. > >How to proceed now, I am doing something stupid or is this just a too big >job for my machine or is there a way to spilt the file somehow and feed it >in pieces or can I somehow filter the interpro.xml file I actually need >only fungi related data out of there? > >Cheers, >mikko I got it working fine though on a machine with much less resources, but which has a MySql 4.0.21 could that just be it? cheers, mikko Mikko Arvas VTT Biotechnology e-mail: mikko.arvas@vtt.fi tel: +358-(0)9-456 5827 mobile: +358-(0)44-381 0502 fax: +358-(0)9-455 2103 mail: Tietotie 2, Espoo P.O. Box 1500 FIN-02044 VTT, Finland From hlapp at gmx.net Fri Oct 29 11:46:41 2004 From: hlapp at gmx.net (Hilmar Lapp) Date: Fri Oct 29 11:45:17 2004 Subject: [Bioperl-l] load_ontology.pl crashes In-Reply-To: <4.3.2.7.2.20041029094643.00cc2bb8@vttmail.vtt.fi> Message-ID: Use --format interprosax. This will use the SAX-based parser in bioperl which consumes only a constant amount of memory. The older-generation interpro parser will consume huge amounts of memory and therefore crash on many systems. -hilmar On Friday, October 29, 2004, at 02:44 AM, Mikko Arvas wrote: > Hi, > > I am running Suse8.1, bioperl 1.4 w/ ontology modules updated from > cvs, couple weeks old bioperl-db from cvs and mysql 3.23.52 > on a desktop (2.4Ghz, 756Mb). I got NCBI taxon database and a few > genomes inside biosql. > > Otherwise things work fine, but when I am trying to load interpro the > system crashes. for example: > >nice -n 19 load_ontology --format interpro interpro.xml > .... > 10900 > and crashes. > > How to proceed now, I am doing something stupid or is this just a too > big job for my machine or is there a way to spilt the file somehow and > feed it in pieces or can I somehow filter the interpro.xml file I > actually need only fungi related data out of there? > > Cheers, > mikko > Mikko Arvas > VTT Biotechnology > > e-mail: mikko.arvas@vtt.fi > tel: +358-(0)9-456 5827 > mobile: +358-(0)44-381 0502 > fax: +358-(0)9-455 2103 > mail: Tietotie 2, Espoo > P.O. Box 1500 > FIN-02044 VTT, Finland > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l@portal.open-bio.org > http://portal.open-bio.org/mailman/listinfo/bioperl-l > > -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- From hlapp at gmx.net Fri Oct 29 11:52:40 2004 From: hlapp at gmx.net (Hilmar Lapp) Date: Fri Oct 29 11:51:16 2004 Subject: [Bioperl-l] Cont: load_ontology.pl crashes In-Reply-To: <4.3.2.7.2.20041029140129.00cafa30@vttmail.vtt.fi> Message-ID: <9059017C-29C2-11D9-96AA-000A959EB4C4@gmx.net> On Friday, October 29, 2004, at 06:04 AM, Mikko Arvas wrote: >> mysql 3.23.52 >> on a desktop (2.4Ghz, 756Mb). I got NCBI taxon database and a few >> genomes inside biosql. >> > > I got it working fine though on a machine with much less resources, > but which has a MySql 4.0.21 could that just be it? > That's the opposite of what I would have expected. 3.23.52 is border-line though for compatibility because earlier versions have a foreign-key bug. There might be another bug with memory management. As I said, the traditional interpro parser will consume on the order of a gigabyte or more memory for reading interpro in its entirety, at least according to what Juguang reported. -hilmar -- ------------------------------------------------------------- Hilmar Lapp email: lapp at gnf.org GNF, San Diego, Ca. 92121 phone: +1-858-812-1757 ------------------------------------------------------------- From ed at compbio.berkeley.edu Fri Oct 29 15:04:29 2004 From: ed at compbio.berkeley.edu (Ed Green) Date: Fri Oct 29 15:03:15 2004 Subject: [Bioperl-l] help on pdb In-Reply-To: <156674e60410290113135d245e@mail.gmail.com> References: <156674e60410290113135d245e@mail.gmail.com> Message-ID: <4182943D.9060303@compbio.berkeley.edu> Dear Ani- May I make a few suggestions? You may want to extract the sequence based on their secondary structure labels by running a secondary structure calling program like STRIDE or DSSP on the PDB file first. There are bioperl modules for handling this output, which I wrote (Bio::Structure::SecStr::*). This may be better for your purpose because the secondary structure annotations in the PDB files themselves are author contributed and are not based on a standard definition of secondary structure element characteristics. On the other hand, this may not matter for you. Also be aware that missing data (failure of ths structure solution to resolve atoms or residues) may yield false "breaks" in secondary structure. Good luck! Ed Green ani wrote: > I have installed Bioperl 1.4 on my windows system. Now I want to use it to > read pdb file and extract the sequence base on their secondary structure > label. I would also like to have the coordinate of the c-alpha of these > residues. > I was trying to read the PDB.pm file but couldnt get the exact methods to do > what I want. > (http://doc.bioperl.org/releases/bioperl-1.4/Bio/Structure/IO/pdb.html) > A web pointer/reference will do. > Regards, > Ani > > From kchoi2 at unity.ncsu.edu Sat Oct 30 01:33:09 2004 From: kchoi2 at unity.ncsu.edu (Kwangbom Choi) Date: Sat Oct 30 01:31:41 2004 Subject: [Bioperl-l] TCoffee In-Reply-To: References: Message-ID: In my code, TCoffee is executed as shown below. my $infile = shift; my @params = ( 'out_lib' => "my.lib", ## I want to reuse the library data 'output' => 'msf' ); my $factory = new Bio::Tools::Run::Alignment::TCoffee(@params); my $tc_align = $factory->align($infile); But it seems that the library file is not complete. It only contains the id, length, and the sequence itself. Is this a bug? Or do you see any mistake in my code snippet? Thank you in advance. -- Kwangbom Choi From sharma.animesh at gmail.com Sun Oct 31 03:47:43 2004 From: sharma.animesh at gmail.com (ani) Date: Sun Oct 31 03:46:12 2004 Subject: [Bioperl-l] help on pdb In-Reply-To: <156674e6041031014576c73474@mail.gmail.com> References: <156674e60410290113135d245e@mail.gmail.com> <4182943D.9060303@compbio.berkeley.edu> <156674e6041031014576c73474@mail.gmail.com> Message-ID: <156674e604103101476f62d147@mail.gmail.com> Hey Ed, Thanks alot for the reply. I was wondering how accurate these programs are? I thought the PDB files have experimentaly determined secondary structure prediction and will me more accurate. Or it is the other way? I am downloading DSSP and STRIDE and try your suggestion. Best regards, Ani On Fri, 29 Oct 2004 12:04:29 -0700, Ed Green wrote: > Dear Ani- > May I make a few suggestions? You may want to extract the sequence > based on their secondary structure labels by running a secondary > structure calling program like STRIDE or DSSP on the PDB file first. > There are bioperl modules for handling this output, which I wrote > (Bio::Structure::SecStr::*). This may be better for your purpose > because the secondary structure annotations in the PDB files themselves > are author contributed and are not based on a standard definition of > secondary structure element characteristics. On the other hand, this > may not matter for you. > > Also be aware that missing data (failure of ths structure solution to > resolve atoms or residues) may yield false "breaks" in secondary structure. > > Good luck! > > Ed Green > > > > ani wrote: > > I have installed Bioperl 1.4 on my windows system. Now I want to use it to > > read pdb file and extract the sequence base on their secondary structure > > label. I would also like to have the coordinate of the c-alpha of these > > residues. > > I was trying to read the PDB.pm file but couldnt get the exact methods to do > > what I want. > > (http://doc.bioperl.org/releases/bioperl-1.4/Bio/Structure/IO/pdb.html) > > A web pointer/reference will do. > > Regards, > > Ani > > > > > -- ______________________"The Answer Lies in Genome"______________________ Dr. Animesh Sharma Visiting Scientist, Indian Statistical Institute +91 33 25752910 / 2577-7695, 2577-8085 (Room No. 904) -- ______________________"The Answer Lies in Genome"______________________ Dr. Animesh Sharma Visiting Scientist, Indian Statistical Institute +91 33 25752910 / 2577-7695, 2577-8085 (Room No. 904) From nathanhaigh at ukonline.co.uk Sun Oct 31 06:36:28 2004 From: nathanhaigh at ukonline.co.uk (Nathan Haigh) Date: Sun Oct 31 06:35:04 2004 Subject: [Bioperl-l] nmake test Message-ID: Hi, just to let you know the latest BioPerl from CVS is now giving the following errors on WinXP, and I am trying to debug them: ? Failed Test?? Stat Wstat Total Fail? Failed? List of Failed ----------------------------------------------------------- t\Index.t????? 255 65280??? 41??? 0?? 0.00%? ?? t\Pictogram.t? 255 65280???? 3??? 3 100.00%? 1-3 t\ProtPsm.t??? 255 65280???? 5??? 5 100.00%? 1-5 t\flat.t?????? 255 65280??? 16??? 3? 18.75%? 14-16 t\psm.t??????? 255 65280??? 48?? 48 100.00%? 1-48 2 subtests skipped. ? Nathan