[Bioperl-l] mis-match position in HSP

[Jason Stajich]

Try the seq_inds method -- it allows you to get the positions where 
certain characters are matches, gaps,mismatches.

I can't remember if they are returned in sequence coordinates or HSP 
coordinates, I think the latter though.  You can use 
Bio::Coordinate::Utils to do coordinate mapping from one system to 
another based on an alignment.

-jason
On Nov 2, 2004, at 8:35 PM, Sucheta Tripathy wrote:

>
> Hi,
>
> Just a quick question, is there a method to get the mis match position
> from a blast output using Bio::Search::HSP::HSPI.
>
> For example if I have an HSP like this:
>
>  5 atgaataggatagggataggtagata 26
>    ||| ||||||||||||||||||||||
> 23 atgtataggatagggataggtagata 44
>
> Then the mismatch position is 4.
>
> Thanks in advance
>
> --Sucheta
>
>
> -- 
> Sucheta Tripathy
> Virginia Bioinformatics Institute Phase-I
> Washington street.
> Virginia Tech.
> Blacksburg,VA 24061-0447
> phone:(540)231-8138
> Fax:  (540) 231-2606
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
--
Jason Stajich
jason.stajich at duke.edu
http://www.duke.edu/~jes12/