[Bioperl-l] Fetching Fasta seqs from GenBank - Help request

[Sean Davis]

Alberto,

I would second that.  If are doing more with this than retrieving raw
sequence (if you care at all), maybe you could let Barry and I know what you
are trying to do more generally.  Bioperl is quite powerful, but it does
take some direction to get started.

Sean

On 3/25/04 12:43 PM, "Barry Moore" <barry.moore at genetics.utah.edu> wrote:

> Alberto-
> 
> You said, "the 'get_Stream_by_id' is returning me more than the
> 'sequence per se'".  I'm not sure if this is what your asking, but I'll
> take a shot.  Since your are retrieving your two sequences in EMBL
> format, you get all the associated information that you would see if you
> 
> downloaded that same file from the web interface.  Your sequences are
> stored by BioPerl as RichSeq objects which inherits a PrimarySeq
> objects.  So that EMBL file data is stored in the RichSeq object and the
> 
> associated PrimarySeq object it inherited.   Of course when you save
> that locally as a fasta file, that extra information is lost.  If you
> decide you need to use that data have a look at the documentation for
> Bio::Seq::RichSeq and Bio::PrimarySeq and the SeqIO and Feature
> Annotation HOW TOs to learn more.
> 
> Barry
> 
> Alberto Davila wrote:
> 
>> Thanks Jason,
>> 
>> I installed the IO::String, then it is working fine now. However I have
>> a doubt, the "get_Stream_by_id" is returning me more than the "sequence
>> per se", what is it ? My script and results are listed below. Finally I
>> would like to save (in my local disk) the retrieved sequences as fasta
>> files... is there any argument for that ?
>> 
>> Thanks again, Alberto
>> 
>> 
>> #!/usr/local/bin/perl -w
>> 
>> use lib "/usr/local/bioperl14";
>> use Bio::DB::BioFetch;
>> use strict;
>> use Bio::DB::WebDBSeqI;
>> use HTTP::Request::Common 'POST';
>> 
>> my $format_type='fasta';
>> my $stream;
>> 
>> 
>> my $bf = new Bio::DB::BioFetch(-format        =>$format_type,
>>                               -retrievaltype =>'tempfile',
>>       -db            =>'EMBL');
>>  
>> $stream = $bf->get_Stream_by_id(['BUM','J00231']);
>> while (my $s = $stream->next_seq) {
>>    print $s->seq,"\n\n\n";
>> }              
>>  
>>  
>>  exit;
>> 
>> 
>> 
>> 
>> [davila at tryps script]$ perl gb-fetch-1.pl
>> agtagtgtactaccaagtatagataacgtttaaatattaaagttttggatcaaagccaaagatgattcgca
> t
>> gctggtgctgattgtagttacagctgcaagcccagtgtatcagagatgtttccaagatggggctatagtga
> a
>> gcaaaacccatccaaagaggcagtcacagaagtgtccctaaaagatgatgttagca
>> 
> 
>> 
> 
>> cctggacctcctgtgcaagaacatgaaacanctgtggttcttccttctcctggtggcagctcccagatggg
> t
>> cctgtcccaggtgcacctgcaggagtcgggcccaggactggggaagcctccagagctcaaaaccccacttg
> g
>> tgacacaactcacacatgcccacggtgcccagagcccaaatcttgtgacacacctcccccgtgcccacggt
> g
>> cccagagcccaaatcttgtgacacacctcccccatgcccacggtgcccagagcccaaatcttgtgacacac
> c
>> tcccccgtgcccnnngtgcccagcacctgaactcttgggaggaccgtcagtcttcctcttccccccaaaac
> c
>> caaggatacccttatgatttcccggacccctgaggtcacgtgcgtggtggtggacgtgagccacgaagacc
> c
>> nnnngtccagttcaagtggtacgtggacggcgtggaggtgcataatgccaagacaaagctgcgggaggagc
> a
>> gtacaacagcacgttccgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaacggcaaggagt
> a
>> caagtgcaaggtctccaacaaagccctcccagcccccatcgagaaaaccatctccaaagccaaaggacagc
> c
>> cnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngaggagatgaccaagaaccaagtcagcctgacct
> g
>> cctggtcaaaggcttctaccccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaact
> a
>> caacaccacgcctcccatgctggactccgacggctccttcttcctctacagcaagctcaccgtggacaaga
> g
>> caggtggcagcaggggaacatcttctcatgctccgtgatgcatgaggctctgcacaaccgctacacgcaga
> a
>> gagcctctccctgtctccgggtaaatgagtgccatggccggcaagcccccgctccccgggctctcggggtc
> g
>> cgcgaggatgcttggcacgtaccccgtgtacatacttcccaggcacccagcatggaaataaagcacccagc
> g
>> ctgccctgg
>> 
>> 
>> 
>> 
>> On Tue, 2004-03-23 at 22:44, Jason Stajich wrote:
>>  
>> 
>>> You need an additional perl module.
>>> 
>>> 
>>> install IO::String from CPAN
>>> 
>>> There is a section on how to install additional perl modules in the
>>> INSTALL document.
>>> 
>>> -j
>>> 
>>> On Tue, 23 Mar 2004, Alberto Davila wrote:
>>> 
>>>    
>>> 
>>>> Hi,
>>>> 
>>>> May I ask for some help ?
>>>> 
>>>> I am trying to use the BioFetch module in order to download several
> seqs
>>>> (from specific Organisms) from GenBank in fasta format, but looks
> like I
>>>> am missing "IO/String.pm" and other things.. should I install
> additional
>>>> bioperl modules (I have the Bioperl Core 1.4 installed) ? or use a
>>>> different module for my purpose ?
>>>> 
>>>> My script and error msg are listed below.
>>>> 
>>>> Thanks and besr regards,
>>>> 
>>>> Alberto
>>>> 
>>>> ****
>>>> 
>>>> #!/usr/local/bin/perl -w
>>>> 
>>>> use lib "/usr/local/bioperl14";
>>>> package Bio::DB::BioFetch;
>>>> use strict;
>>>> use Bio::DB::WebDBSeqI;
>>>> use HTTP::Request::Common 'POST';
>>>> 
>>>> my $format_type='fasta';
>>>> my $stream;
>>>> 
>>>> 
>>>> my $bf = new Bio::DB::BioFetch(-format        =>$format_type',
>>>>                               -retrievaltype =>'tempfile',
>>>>                               -db            =>'EMBL');
>>>> 
>>>> $stream = $bf->get_Stream_by_id(['BUM','J00231']);
>>>> while (my $s = $stream->next_seq) {
>>>>    print $s->seq,"\n";
>>>>        }
>>>> 
>>>> 
>>>>          exit;
>>>> 
>>>> 
>>>> [davila at tryps script]$ perl gb-fetch-1.pl
>>>> Can't locate IO/String.pm in @INC (@INC contains:
>>>> /usr/local/bioperl14/i386-linux-thread-multi /usr/local/bioperl14
>>>> /usr/lib/perl5/5.8.3/i386-linux-thread-multi /usr/lib/perl5/5.8.3
>>>> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
>>>> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
>>>> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
>>>> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
>>>> /usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
>>>> /usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
>>>> /usr/lib/perl5/site_perl
>>>> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
>>>> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
>>>> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
>>>> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
>>>> /usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
>>>> /usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
>>>> /usr/lib/perl5/vendor_perl .) at
>>>> /usr/local/bioperl14/Bio/DB/WebDBSeqI.pm line 90.
>>>> BEGIN failed--compilation aborted at
>>>> /usr/local/bioperl14/Bio/DB/WebDBSeqI.pm line 90.
>>>> Compilation failed in require at gb-fetch-1.pl line 6.
>>>> BEGIN failed--compilation aborted at gb-fetch-1.pl line 6.
>>>>      
>>>> 
>> 
>> 
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at portal.open-bio.org
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>  
>>