[Bioperl-l] Forward of moderated message

[Heikki Lehvaslaiho]

Ruifang,

The code works. See this example:
 
######################################
use  Bio::Tools::RestrictionEnzyme;
use Bio::PrimarySeq;

$seqobj = new Bio::PrimarySeq(-seq=>'GTACTTTTAGAGGATGAAACCT');
$re2 = new Bio::Tools::RestrictionEnzyme(-NAME =>'MnlI--CC^TC', 
                                         -MAKE =>'custom');
@fragments = $re2->cut_seq($seqobj);
print scalar @fragments, "\n";
######################################

However, you should notice that Bio:Tools::RestrictionEnzyme class is 
deprecated and not really supported any more. You should have a look at 
Bio::Restriction classes.

Yours,
		-Heikki

On Monday 08 Mar 2004 16:43, bioperl-guts-l-bounces at portal.open-bio.org wrote:
> Dear,
>
> I am a graduate student in National Lab of Medical Genetics of China.
>
> I am using Bioperl Module: RestrictionEnzyme.pm and I have encountered a
> question about this code.
>
> I found  the restriction enzymes could not recognize the DAN sequence
> which is reverse complement to the enzymes sequence.
> For example, the enzyme: MnlI, the recognize sequence :CCTC, the DNA
> sequence: GTACTTTTAGAGGATGAAACCT
> the DAN sequence include  GAGG , which is reverse complement to CCTC,
> and the MnlI should cut this sequence, but the code could not give this
> result.
>
> May I could have answer from you soon!
>
> Thanks!
> Best Wishes!
>
> Ruifang

-- 
______ _/      _/_____________________________________________________
      _/      _/                      http://www.ebi.ac.uk/mutations/
     _/  _/  _/  Heikki Lehvaslaiho    heikki_at_ebi ac uk
    _/_/_/_/_/  EMBL Outstation, European Bioinformatics Institute
   _/  _/  _/  Wellcome Trust Genome Campus, Hinxton
  _/  _/  _/  Cambs. CB10 1SD, United Kingdom
     _/      Phone: +44 (0)1223 494 644   FAX: +44 (0)1223 494 468
___ _/_/_/_/_/________________________________________________________