[Bioperl-l] TCoffee question?

[Vesko Baev]

Hi,
I have some ERROR MESAGES that I don't understand that they mean?
The sctipt using TCoffee (I've got the run::al.::Tcoffee module, but I do not know if it wants any TCoffee external program ot something like that?!
there is a script & ERR.messages:



#!/usr/bin/perl
use Bio::Seq;
use Bio::Tools::Run::Alignment::TCoffee;


#Build a Bio::Seq obj1
  $seqobj1 = Bio::Seq->new(-seq      => "gatgggtataataggtggactta");
#Build a Bio::Seq obj2
  $gene_seqobj2 = Bio::Seq->new(-seq => "gacgggtatctttaggcggacttag");

  
  # Build a tcoffee alignment factory
  @params = ('ktuple' => 2,
             'matrix' => 'BLOSUM',
             'output' => 'clustalw',
             'outfile'=> 'coffee.out');
  $factory = new Bio::Tools::Run::Alignment::TCoffee (@params);

#  WAY ONE with file
#  $aln = $factory->align('el.fa');

#  WAY TWO with 2 seq obj
   my @seq_array =();

   push (@seq_array, $seqobj1);
   push (@seq_array, $gene_seqobj2);

   $seq_array_ref = \@seq_array;
   $aln = $factory->align($seq_array_ref);
   my $s1_perid = $aln->average_percentage_identity;
   print $s1_perid;

in the way with fasta file I've got:
------------- EXCEPTION  -------------
MSG: TCoffee call crashed: 0 [command  -in=el.fa,XBLOSUM,Mlalign_id_pair,Mclusta
lw_pair  -ktuple=2 -outfile=coffee.out -output=clustalw]

STACK Bio::Tools::Run::Alignment::TCoffee::_run D:/Perl/site/lib/Bio/Tools/Run/A
lignment/TCoffee.pm:814
STACK Bio::Tools::Run::Alignment::TCoffee::align D:/Perl/site/lib/Bio/Tools/Run/
Alignment/TCoffee.pm:719
STACK toplevel coffee.pl:21

--------------------------------------
in the WAY 2 (with the 2 seqobj) the ERROR MESSAGE i telling me that in my array there is less then 2 seq obj (but I pushed 2 obj!)

THANKS!! AGAIN!


-----------------------------------------------------------------
http://nova.GBG.bg - Направи си сайт! Лесно, бързо и професионално.