From jthornton at novaresearchonline.com  Fri Aug  1 01:18:44 2003
From: jthornton at novaresearchonline.com (Jennifer Thornton)
Date: Thu Jul 31 13:24:05 2003
Subject: [Bioperl-l] blastcl3
Message-ID: <9F4AFDC6-C3DF-11D7-81CB-000A95945DFE@novaresearchonline.com>


Does anyone know how to use this program?  I'm having trouble 
installing and running it.

From simon.andrews at bbsrc.ac.uk  Fri Aug  1 03:52:08 2003
From: simon.andrews at bbsrc.ac.uk (simon andrews (BI))
Date: Fri Aug  1 03:54:16 2003
Subject: [Bioperl-l] $_ assignment question
Message-ID: <2DC41140A89ED411989D00508BDCD9ED01E28AEB@bi-exsrv1.iapc.bbsrc.ac.uk>

 
> On Thu  16:08, Paul Edlefsen wrote:
> > My understanding has been that Bio::SeqIO->new(..) will 
> > surely use the correct method, while new Bio::SeqIO might 
> > use the new(..) method from the class that the code appears 
> > in, which would be incorrect.  Have I misunderstood the issue?
> > 

> From: Josh Lauricha 
> I've always been under the impression they are interchangable. 
> If they aren't, what would be an example of the wrong function 
> being called?

#!/usr/bin/perl -w
use strict;
use Bio::SeqIO;

my $name = 'Bio::SeqIO';

sub new {
  return ("Oops!\n");
}


my $indirect = new $name;
print "INDIRECT: $indirect\n";

my $direct = $name -> new();
print "DIRECT: $direct\n";
From KhanIA1 at Cardiff.ac.uk  Fri Aug  1 09:10:34 2003
From: KhanIA1 at Cardiff.ac.uk (Imtiaz KHAN)
Date: Fri Aug  1 04:10:44 2003
Subject: [Bioperl-l] Primer3
Message-ID: <3F2A2E89.18571.382802C@localhost>

Hello,

I am a new user of Bioperl. I was trying to write a program that will 
get the left and right primers from MIT's Primer3 web site, but in 
batch. 

I tried to use Bio::Tools::Primer3 but it did not work. Can any one 
help me in this regard please.

Thanks

Imtiaz
From Matthew.Betts at ii.uib.no  Fri Aug  1 04:33:51 2003
From: Matthew.Betts at ii.uib.no (Matthew Betts)
Date: Fri Aug  1 04:33:45 2003
Subject: [Bioperl-l] Errors generated from example code in HOW-TO section
Message-ID: <Pine.LNX.4.44.0308011026470.24542-100000@silkefuru.ii.uib.no>


Hi,

I recently ran up against the same warning, but was happy to see that perl 
did the comparison correctly anyway

eg. both of the following give the warning, but the first prints out 
$e and the second one doesn't.

  perl -we '$e = "e-169"; ($e < 1.0) and print "$e\n";'
  perl -we '$e = "e-169"; ($e > 1.0) and print "$e\n";'
  
Matt


> Message: 18
> Date: Fri, 01 Aug 2003 13:16:37 +1000
> From: Wes Barris <wes.barris@csiro.au>
> Subject: [Bioperl-l] Errors generated from example code in HOW-TO
>         section
> To: Bioperl Mailing List <bioperl-l@bioperl.org>
> Message-ID: <3F29DB95.10901@csiro.au>
> Content-Type: text/plain; charset=us-ascii; format=flowed
>
> The HOW-TO section http://www.bioperl.org/HOWTOs/html/Graphics-HOWTO.html
> shows examples using this code fragment:
>
> while( my $hit = $result->next_hit ) {
>    next unless $hit->significance < 1.0;
>    my $feature = Bio::SeqFeature::Generic->new(-score   => 
> $hit->raw_score,
>                                                -seq_id => $hit->name,
> 
> If warnings are turned on, then the 2nd line above produces these errors:
>
> Argument "e-171" isn't numeric in numeric lt (<) at blasttoimg.pl line 49, 
> <DATA> line 191.
> Argument "e-163" isn't numeric in numeric lt (<) at blasttoimg.pl line 49, 
> <DATA> line 191.
> Argument "e-160" isn't numeric in numeric lt (<) at blasttoimg.pl line 49, 
> <DATA> line 191.
> Argument "e-160" isn't numeric in numeric lt (<) at blasttoimg.pl line 49, 
> <DATA> line 191.
> Argument "e-160" isn't numeric in numeric lt (<) at blasttoimg.pl line 49, 
> <DATA> line 191.
>
> I would suggest that when parsing a blast file, if the evalue does not
> begin with a digit, a '1' (one) should be placed at the beginning of the
> reported evalue.

-- 
Matthew Betts, mailto:matthew.betts@ii.uib.no
Phone: (+47) 55 58 40 22
CBU, BCCS, UNIFOB / Universitetet i Bergen
Thormohlensgt. 55, N-5020 Bergen, Norway

From simon.andrews at bbsrc.ac.uk  Fri Aug  1 04:54:35 2003
From: simon.andrews at bbsrc.ac.uk (simon andrews (BI))
Date: Fri Aug  1 04:56:47 2003
Subject: [Bioperl-l] Errors generated from example code in HOW-TO sect ion
Message-ID: <2DC41140A89ED411989D00508BDCD9ED01E28AEC@bi-exsrv1.iapc.bbsrc.ac.uk>



> > Argument "e-171" isn't numeric in numeric lt (<) at 
> > blasttoimg.pl line 49, 

> From: Matthew Betts [mailto:Matthew.Betts@ii.uib.no]
>
> I recently ran up against the same warning, but was happy to 
> see that perl  did the comparison correctly anyway

Oh but it didn't!  Try this, then change $num to be 1e-169.  Perl guesses, and gets it wrong.

#!/usr/bin/perl -w
use strict;

my $num = 'e-169';

$num += 0;

print "Number is $num\n";

if ($num == 1e-169) {
  print "OK they match\n";
}

else {
  print "Oops, no match\n";
}
From Matthew.Betts at ii.uib.no  Fri Aug  1 05:20:14 2003
From: Matthew.Betts at ii.uib.no (Matthew Betts)
Date: Fri Aug  1 05:20:06 2003
Subject: [Bioperl-l] Errors generated from example code in HOW-TO sect ion
In-Reply-To: <2DC41140A89ED411989D00508BDCD9ED01E28AEC@bi-exsrv1.iapc.bbsrc.ac.uk>
Message-ID: <Pine.LNX.4.44.0308011117290.24542-100000@silkefuru.ii.uib.no>


Whoops, thanks Simon, so it's just treating 'e-169' as zero... I guess it 
almost is, and hopefully nothing like 'e-2' ever appears in blast 
output...

Matt

On Fri, 1 Aug 2003, simon andrews (BI) wrote:

> 
> 
> > > Argument "e-171" isn't numeric in numeric lt (<) at 
> > > blasttoimg.pl line 49, 
> 
> > From: Matthew Betts [mailto:Matthew.Betts@ii.uib.no]
> >
> > I recently ran up against the same warning, but was happy to 
> > see that perl  did the comparison correctly anyway
> 
> Oh but it didn't!  Try this, then change $num to be 1e-169.  Perl guesses, and gets it wrong.
> 
> #!/usr/bin/perl -w
> use strict;
> 
> my $num = 'e-169';
> 
> $num += 0;
> 
> print "Number is $num\n";
> 
> if ($num == 1e-169) {
>   print "OK they match\n";
> }
> 
> else {
>   print "Oops, no match\n";
> }
> 

-- 
Matthew Betts, mailto:matthew.betts@ii.uib.no
Phone: (+47) 55 58 40 22
CBU, BCCS, UNIFOB / Universitetet i Bergen
Thormohlensgt. 55, N-5020 Bergen, Norway

From shawnh at fugu-sg.org  Fri Aug  1 12:28:04 2003
From: shawnh at fugu-sg.org (Shawn Hoon)
Date: Fri Aug  1 05:26:35 2003
Subject: [Bioperl-l] Primer3
In-Reply-To: <3F2A2E89.18571.382802C@localhost>
References: <3F2A2E89.18571.382802C@localhost>
Message-ID: <20757E62-C43D-11D7-A2ED-000A95783436@fugu-sg.org>


On Friday, August 1, 2003, at 9:10 AM, Imtiaz KHAN wrote:

> Hello,
>
> I am a new user of Bioperl. I was trying to write a program that will
> get the left and right primers from MIT's Primer3 web site, but in
> batch.
>
> I tried to use Bio::Tools::Primer3 but it did not work. Can any one
> help me in this regard please.
>


You will want to use Bio::Tools::Run::Primer3 from the bioperl-run 
package. It's
not available in bioperl-run-1.2.2 so you will need to checkout the 
live version of bioperl and bioperl-run
to work with Primer3

CVS info here:

http://cvs.bioperl.org/

shawn

> Thanks
>
> Imtiaz
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-shawn

From ajm6q at virginia.edu  Fri Aug  1 06:46:51 2003
From: ajm6q at virginia.edu (Aaron J Mackey)
Date: Fri Aug  1 06:46:45 2003
Subject: [Bioperl-l] Errors generated from example code in HOW-TO section
In-Reply-To: <Pine.LNX.4.44.0308011026470.24542-100000@silkefuru.ii.uib.no>
Message-ID: <Pine.OSF.4.33.0308010645540.21073-100000@alpha10.bioch.virginia.edu>


Ahem, not so fast:

perl -wle '$e = "e-100"; print $e < "e-10" ? 1 : 0;'
Argument "e-10" isn't numeric in numeric lt (<) at -e line 1.
Argument "e-100" isn't numeric in numeric lt (<) at -e line 1.
0
perl -wle '$e = "e-100"; print $e == "e-10" ? 1 : 0;'
Argument "e-10" isn't numeric in numeric eq (==) at -e line 1.
Argument "e-100" isn't numeric in numeric eq (==) at -e line 1.
1

e-100 (or e-10, or e-anything) is getting turned into 0, since "e-"
doesn't look like a number, the number parsing stops, and you get 0.

-Aaron

On Fri, 1 Aug 2003, Matthew Betts wrote:

>
> Hi,
>
> I recently ran up against the same warning, but was happy to see that perl
> did the comparison correctly anyway
>
> eg. both of the following give the warning, but the first prints out
> $e and the second one doesn't.
>
>   perl -we '$e = "e-169"; ($e < 1.0) and print "$e\n";'
>   perl -we '$e = "e-169"; ($e > 1.0) and print "$e\n";'
>
> Matt
>
>
> > Message: 18
> > Date: Fri, 01 Aug 2003 13:16:37 +1000
> > From: Wes Barris <wes.barris@csiro.au>
> > Subject: [Bioperl-l] Errors generated from example code in HOW-TO
> >         section
> > To: Bioperl Mailing List <bioperl-l@bioperl.org>
> > Message-ID: <3F29DB95.10901@csiro.au>
> > Content-Type: text/plain; charset=us-ascii; format=flowed
> >
> > The HOW-TO section http://www.bioperl.org/HOWTOs/html/Graphics-HOWTO.html
> > shows examples using this code fragment:
> >
> > while( my $hit = $result->next_hit ) {
> >    next unless $hit->significance < 1.0;
> >    my $feature = Bio::SeqFeature::Generic->new(-score   =>
> > $hit->raw_score,
> >                                                -seq_id => $hit->name,
> >
> > If warnings are turned on, then the 2nd line above produces these errors:
> >
> > Argument "e-171" isn't numeric in numeric lt (<) at blasttoimg.pl line 49,
> > <DATA> line 191.
> > Argument "e-163" isn't numeric in numeric lt (<) at blasttoimg.pl line 49,
> > <DATA> line 191.
> > Argument "e-160" isn't numeric in numeric lt (<) at blasttoimg.pl line 49,
> > <DATA> line 191.
> > Argument "e-160" isn't numeric in numeric lt (<) at blasttoimg.pl line 49,
> > <DATA> line 191.
> > Argument "e-160" isn't numeric in numeric lt (<) at blasttoimg.pl line 49,
> > <DATA> line 191.
> >
> > I would suggest that when parsing a blast file, if the evalue does not
> > begin with a digit, a '1' (one) should be placed at the beginning of the
> > reported evalue.
>
>

-- 
 Aaron J Mackey
 Pearson Laboratory
 University of Virginia
 (434) 924-2821
 amackey@virginia.edu


From jon at compbio.dundee.ac.uk  Fri Aug  1 07:31:11 2003
From: jon at compbio.dundee.ac.uk (Jonathan Barber)
Date: Fri Aug  1 07:31:00 2003
Subject: [Bioperl-l] $_ assignment question
In-Reply-To: <Pine.OSF.4.33.0307311542450.15649-100000@alpha10.bioch.virginia.edu>
References: <028452FC-C386-11D7-8186-000A959EB4C4@gnf.org>
	<Pine.OSF.4.33.0307311542450.15649-100000@alpha10.bioch.virginia.edu>
Message-ID: <20030801113111.GI24938@flea.compbio.dundee.ac.uk>

On Thu, Jul 31, 2003 at 04:01:51PM -0400, Aaron J Mackey wrote:
> 
> Uhh, let me put in my usual snobby and grumpy two cents and say that this
> form of code Nazi-ism is really annoying, and introduces massively
> difficult to follow CVS changes.  Next we'll need to change all
> occurrences of:
> 
>   $obj->dosomething unless $dont;
> 
> to:
> 
>   if(!$dont)
>   {
>     $obj->dosomething();
>   }
> 
> so that some Java programmers don't get confused.  I think this is wasted
> effort.  Indirect object method syntax is not evil when the method is a
> well understood and used "keyword" type of thing like "new", "open",
> "connect", etc.  Many of us use it to mentally differentiate between
> constructors and class methods:
> 
> Net::SMTP->debug(1);
> my $smtp = new Net::SMTP @args;
> 
> Yes, I know a constructor is a class method, but (at least to me), it's a
> different flavor that is very often seen written with indirect syntax in
> Perl.  On the flip side, you don't typically see:
> 
>   debug Net::SMTP 1;
> 
> If *that* is the type of usage you'd like to get rid of, I have less
> of a complaint.

Fair enough.

> Re: localized $_, I think you're barking up another pedantical tree.  If
> you'd like to do this cleanly, then I'd rather see you change this:
> 
> while ($_ = $self->_readline) {
>   if (m/foobar/) {
>     # ...
> 
> Into:
> 
> while (my $line = $self->_readline) {
>   if ($line =~ m/foobar/) {
>     # ...
> 
> Rather than:
> 
> while (local $_ = $self->_readline) {
>   if(m/foobar/) {
>     # ...

Agreed. But that's a lot harder to fix than sticking a local in front of
the offending assignment, as the whole method call has to be checked for
core functions that use $_, and ATM I just want to stop Bioperl messing
around with $_ and giving me strange bugs.

> Of course, this particular brand of pedanticness would indicate that this
> construct:
> 
> while(<FH>) {
>   # ...
> }
> 
> ... should also never be used.

Yep. At least not in a module. The reason being if I do this:

for (qw(different sequence filehandes)) {
    $Bioperl_object->random_method($_); # method assigns to $_
    do_something_else_with_fh($_);
}

then do_something_else() is not getting what I expect it to get. Now I
could put a "my $fh" after the for, but why should I have too, I should
expect the modules to play nicely.

If this is intended to be the default behavour for Bioperl, then fine,
but it needs to stated at the top of all the Bioperl docs in big
letters.

Either way, patches are required.

> But I (grumpily) consent that the various ways Perl can perform actions
> at a distance can in some cases cause frustrating problems for others.
> 
> -Aaron
> 
> P.S. The Conway book is great, but it's not <i>ta biblia</i>.
-- 
Jon
From jason at cgt.duhs.duke.edu  Fri Aug  1 08:15:41 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Fri Aug  1 08:02:15 2003
Subject: [Bioperl-l] Errors generated from example code in HOW-TO section
In-Reply-To: <3F29DB95.10901@csiro.au>
References: <3F29DB95.10901@csiro.au>
Message-ID: <Pine.LNX.4.50.0308010814560.30113-100000@tenero.duhs.duke.edu>

http://bugzilla.bioperl.org/show_bug.cgi?id=1474
It is already fixed on the main trunk - I don't think we intend to a
1.2.3 release.

-jason
On Fri, 1 Aug 2003, Wes Barris wrote:

> The HOW-TO section http://www.bioperl.org/HOWTOs/html/Graphics-HOWTO.html
> shows examples using this code fragment:
>
> while( my $hit = $result->next_hit ) {
>    next unless $hit->significance < 1.0;
>    my $feature = Bio::SeqFeature::Generic->new(-score   => $hit->raw_score,
>                                                -seq_id => $hit->name,
>
> If warnings are turned on, then the 2nd line above produces these errors:
>
> Argument "e-171" isn't numeric in numeric lt (<) at blasttoimg.pl line 49, <DATA> line 191.
> Argument "e-163" isn't numeric in numeric lt (<) at blasttoimg.pl line 49, <DATA> line 191.
> Argument "e-160" isn't numeric in numeric lt (<) at blasttoimg.pl line 49, <DATA> line 191.
> Argument "e-160" isn't numeric in numeric lt (<) at blasttoimg.pl line 49, <DATA> line 191.
> Argument "e-160" isn't numeric in numeric lt (<) at blasttoimg.pl line 49, <DATA> line 191.
>
> I would suggest that when parsing a blast file, if the evalue does not
> begin with a digit, a '1' (one) should be placed at the beginning of the
> reported evalue.
>
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From Richard.Adams at ed.ac.uk  Fri Aug  1 07:04:27 2003
From: Richard.Adams at ed.ac.uk (Richard Adams)
Date: Fri Aug  1 08:24:27 2003
Subject: [Bioperl-l]more  inheritance
Message-ID: <3F2A493B.629B3BF2@ed.ac.uk>

Just while people are talking about inheritance:
    I'm writing some Bio::Tools:Analysis modules (they're in the CVS)
which run remote sequence analyses, and parse the results
into a variety of formats, including  Bio::Seq::Meta::Array objects
(which hold residue specific data)and Bio::SeqFeature objects (which
usually just hold significant results).

            e.g., my $tool =
Bio::Tools::Analysis::Protein::Domcut->new(-seq =>$seq);#predicts domain
boundaries in proteins
                    $tool->run; #submits query and retrieves result
                    my $meta = $tool->result('all');
                    my @fts = $tool->result(Bio::SeqFeatureI');

    The problem iswhether $seq  needs to be a PrimarySeq object (needed
for Bio::Seq::Meta::Array methods to work as it extends from
Bio::LocatableSeq, which ISA PrimarySeq ) or a Seq object (needed as
input if you want to  hangs SeqFeatures onto it), but what if you want
both?.

My  work around (implementing a suggestion by Heikki) at the moment is
to have Bio::Seq::Meta::Array inheriting from Bio::LocatableSeq by
default, but if the constructor
receives a -baseclass = Bio::Seq entry in its argument list it alters
@ISA to  inherit from Bio::Seq. This works (i.e., you can get meta
sequence methodsAND SeqFeature methods  now after a submitting a
Bio::Seq object to the analysis), but I'm not sure that dynamically
altering inheritance is  a good idea.

    So in this case might it be better for LocatableSeq or Seq objects
to <have> meta sequence methods by aggregation,
rather than <become> meta sequences?
Or alternatively just make the problem clear in the documentation aand
let the user deal with it?
Would be grateful for any suggestions - I have several of Analysis
modules to submit but would like to get this sorted out before
committing them.

Cheers

Richard






--
Dr Richard Adams
Bioinformatician,
Psychiatric Genetics Group,
Medical Genetics,
Molecular Medicine Centre,
Western General Hospital,
Crewe Rd West,
Edinburgh UK
EH4 2XU

Tel: 44 131 651 1084
richard.adams@ed.ac.uk


From dhoworth at mrc-lmb.cam.ac.uk  Fri Aug  1 08:45:11 2003
From: dhoworth at mrc-lmb.cam.ac.uk (Dave Howorth)
Date: Fri Aug  1 08:45:06 2003
Subject: [Bioperl-l] $_ assignment question
References: <028452FC-C386-11D7-8186-000A959EB4C4@gnf.org>	<Pine.OSF.4.33.0307311542450.15649-100000@alpha10.bioch.virginia.edu>
	<20030801113111.GI24938@flea.compbio.dundee.ac.uk>
Message-ID: <3F2A60D7.50403@mrc-lmb.cam.ac.uk>

Jonathan Barber wrote:
> On Thu, Jul 31, 2003 at 04:01:51PM -0400, Aaron J Mackey wrote:
>>Of course, this particular brand of pedanticness would indicate that this
>>construct:
>>
>>while(<FH>) {
>>  # ...
>>}
>>
>>... should also never be used.
> 
> Yep. At least not in a module. The reason being if I do this:
> 
> for (qw(different sequence filehandes)) {
>     $Bioperl_object->random_method($_); # method assigns to $_
>     do_something_else_with_fh($_);
> }
> 
> then do_something_else() is not getting what I expect it to get.

I was interested by this, so I ran the code (Perl 5.6.1). Turns out it 
won't run. Perl says:

   Modification of a read-only value attempted at Test.pm line 14.

It does this even with warnings and strict OFF. I'd say this was strong 
supporting evidence that Jonathan is right :) It also seems that:
  (i)  problems of this kind will show up pretty quickly and
  (ii) they can be isolated by putting:

for ('once') { ... }

around the tests of any (all!) method calls.

Cheers, Dave


test.pl
=======
#!/usr/bin/perl

use lib ('.');
use Test;

for (qw(hello world)) {
  print "\nA $_\n\n";
  Test::g();
  print "\nB $_\n";
}

Test.pm
=======
#!/usr/bin/perl

package Test;

require Exporter;

our @ISA       = qw(Exporter);
our @EXPORT    = qw();
our $VERSION   = 1.00;

sub g
{
  open FH, '<', 'test.pl';
  while (<FH>) {
   print $_;
  }
}


-- 
Dave Howorth
MRC Centre for Protein Engineering
Hills Road, Cambridge, CB2 2QH
01223 252960

From djoubert at mail.mcg.edu  Fri Aug  1 08:56:10 2003
From: djoubert at mail.mcg.edu (Douglas Joubert)
Date: Fri Aug  1 08:58:40 2003
Subject: [Bioperl-l] Installation question
Message-ID: <sf2a2bcc.043@mail.mcg.edu>

Hello,

Fairly new to this group, and I have a question concerning installation, so please bear with me

Following the instructions for WIN install via http://bioperl.org/core/latest/install.win -------->1.3.2. ActiveState for Perl 5.8.0

Everything installed correct (I think) but the last comment in the command prompt is "Successfully installed bioperl version 1.2.1 in ActivePerl 5.8.0.806"

I thought 1.2.2 was the latest version?

Cheers

Doug (librarian, not a programmer)

Douglas Joubert, M.L.I.S.
Instructor and Digital Information Librarian
Robert B. Greenblatt M.D. Library
Medical College of Georgia
Augusta, GA 30912-4400


From ajm6q at virginia.edu  Fri Aug  1 09:06:04 2003
From: ajm6q at virginia.edu (Aaron J Mackey)
Date: Fri Aug  1 09:05:58 2003
Subject: [Bioperl-l] $_ assignment question
In-Reply-To: <3F2A60D7.50403@mrc-lmb.cam.ac.uk>
Message-ID: <Pine.OSF.4.33.0308010904290.21073-100000@alpha10.bioch.virginia.edu>


You got caught by lists vs. arrays:

perl -wle 'for(qw(a b)) { $_ = "b"; print; }'
Modification of a read-only value attempted at -e line 1.

perl -wle '@a = qw(a b); for(@a) { $_ = "b"; print; }'
b
b

So problems with reassigning to $_ that might arise in the second case are
quite silent and insidious.

-Aaron

On Fri, 1 Aug 2003, Dave Howorth wrote:

> Jonathan Barber wrote:
> > On Thu, Jul 31, 2003 at 04:01:51PM -0400, Aaron J Mackey wrote:
> >>Of course, this particular brand of pedanticness would indicate that this
> >>construct:
> >>
> >>while(<FH>) {
> >>  # ...
> >>}
> >>
> >>... should also never be used.
> >
> > Yep. At least not in a module. The reason being if I do this:
> >
> > for (qw(different sequence filehandes)) {
> >     $Bioperl_object->random_method($_); # method assigns to $_
> >     do_something_else_with_fh($_);
> > }
> >
> > then do_something_else() is not getting what I expect it to get.
>
> I was interested by this, so I ran the code (Perl 5.6.1). Turns out it
> won't run. Perl says:
>
>    Modification of a read-only value attempted at Test.pm line 14.
>
> It does this even with warnings and strict OFF. I'd say this was strong
> supporting evidence that Jonathan is right :) It also seems that:
>   (i)  problems of this kind will show up pretty quickly and
>   (ii) they can be isolated by putting:
>
> for ('once') { ... }
>
> around the tests of any (all!) method calls.
>
> Cheers, Dave
>
>
> test.pl
> =======
> #!/usr/bin/perl
>
> use lib ('.');
> use Test;
>
> for (qw(hello world)) {
>   print "\nA $_\n\n";
>   Test::g();
>   print "\nB $_\n";
> }
>
> Test.pm
> =======
> #!/usr/bin/perl
>
> package Test;
>
> require Exporter;
>
> our @ISA       = qw(Exporter);
> our @EXPORT    = qw();
> our $VERSION   = 1.00;
>
> sub g
> {
>   open FH, '<', 'test.pl';
>   while (<FH>) {
>    print $_;
>   }
> }
>
>
>

-- 
 Aaron J Mackey
 Pearson Laboratory
 University of Virginia
 (434) 924-2821
 amackey@virginia.edu


From madismetsis at hotmail.com  Fri Aug  1 09:08:53 2003
From: madismetsis at hotmail.com (Madis Metsis)
Date: Fri Aug  1 09:08:43 2003
Subject: [Bioperl-l] problems with installing Bioperl on OSX
Message-ID: <Law14-F616sJ9amqkhq0001ddcd@hotmail.com>

Hi!

I am installing Bioperl on a OSX machine and get this message:
*****
Error: Unable to locate installed Perl libraries or Perl source code.

It is recommended that you install perl in a standard location before
building extensions. Some precompiled versions of perl do not contain
these header files, so you cannot build extensions. In such a case,
please build and install your perl from a fresh perl distribution. It
usually solves this kind of problem.

(You get this message, because MakeMaker could not find 
"/System/Library/Perl/darwin/CORE/perl.h")
****

Thats true, perl.h is not in right place, since both Apple preinstalled and 
current Serverlogistics installer are not placing it in that place.

How do I get around it. To install Perl AGAIN having 2 copies already on 
machine sounds....
Is there a line in Makefile.pl that could be modified to "show" to location 
of perl.h and the rest of perl.

Thanks in advance for any kind of help

Madis Metsis

Center for Genomics and Bioinformatics
Karolinska Institute
Stockholm
Sweden

_________________________________________________________________
Help STOP SPAM with the new MSN 8 and get 2 months FREE*  
http://join.msn.com/?page=features/junkmail

From yaofx at xymu.net  Fri Aug  1 09:39:18 2003
From: yaofx at xymu.net (yaofx)
Date: Fri Aug  1 09:39:18 2003
Subject: [Bioperl-l] About Bio::DB::GenBank!
Message-ID: <3F2A6D86.9040006@xymu.net>

Hello,

I have installed Perl 5.6.1 for WIN32, and Bioperl  version 1.2.1.
The following is the script ,which can retrieve data from GenBank by 
sequences' gi,
but can not get the results by accession number.
I  replace "get_Stream_by_id"  with ""get_Stream_by_acc", also failed.

The error message is :

------------- EXCEPTION  -------------
MSG: WebDBSeqI Error - check query sequences!

STACK Bio::DB::WebDBSeqI::get_seq_stream 
c:/Perl/site/lib/Bio/DB/WebDBSeqI.pm:46
4
STACK Bio::DB::WebDBSeqI::get_Stream_by_id 
c:/Perl/site/lib/Bio/DB/WebDBSeqI.pm:
259
STACK toplevel web_gi2seq_vi.pl:50

--------------------------------------

BTW, I don't change any code about Bioperl package.
What's matter with it? and how will i do next?

Thanks in advance for any kind of help

Fengxia


#!/usr/bin/perl

$idlist = $ARGV[0];

if (@ARGV != 1){
    print "USAGE: perl web_id2seq.pl <ID list file>\n";
    exit(1);
}

$faoutfile = $idlist."_fa.txt";
(unlink $faoutfile) if (-e $faoutfile);

open (INPUT,$idlist);

while ($line = <INPUT>){
    chomp ($line);
    $line =~ s/\r//;
    push (@querylist,$line);
}
$list = join ",",@querylist;
close INPUT;

use Bio::SeqIO;
use Bio::DB::GenBank;
my $gb = new Bio::DB::GenBank;

my $seqout = new Bio::SeqIO(-file => ">$faoutfile", -format => 'fasta');
my $seqio = $gb->get_Stream_by_id([$list]);
 
while($seq = $seqio->next_seq ) {
        $seqout->write_seq($seq);
}


From dhoworth at mrc-lmb.cam.ac.uk  Fri Aug  1 10:04:51 2003
From: dhoworth at mrc-lmb.cam.ac.uk (Dave Howorth)
Date: Fri Aug  1 10:04:45 2003
Subject: [Bioperl-l] $_ assignment question
References: <Pine.OSF.4.33.0308010904290.21073-100000@alpha10.bioch.virginia.edu>
Message-ID: <3F2A7383.6050804@mrc-lmb.cam.ac.uk>

Aaron J Mackey wrote:
> You got caught by lists vs. arrays:

Well, I got caught but it wasn't by lists vs arrays. The for() statement 
takes a list, so the array is turned into a list by being used in the 
for statement. What I didn't realize is that for(list) aliases to the 
list members so that they're r/w access.  Now there's a whole new bag of 
tricks I can use :)

So I retract my
 >> (i) problems of this kind will show up pretty quickly
and agree with you when you say:
> So problems with reassigning to $_ that might arise in the second case are
> quite silent and insidious.

but I think it's still correct to say:
>>  (ii) they can be isolated by putting:
>>for ('once') { ... }
>>around the tests of any (all!) method calls.

Cheers, Dave
-- 
Dave Howorth
MRC Centre for Protein Engineering
Hills Road, Cambridge, CB2 2QH
01223 252960

From jason at cgt.duhs.duke.edu  Fri Aug  1 10:22:49 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Fri Aug  1 10:09:19 2003
Subject: [Bioperl-l] problems with installing Bioperl on OSX
In-Reply-To: <Law14-F616sJ9amqkhq0001ddcd@hotmail.com>
References: <Law14-F616sJ9amqkhq0001ddcd@hotmail.com>
Message-ID: <Pine.LNX.4.50.0308011021190.30517-100000@tenero.duhs.duke.edu>

no idea - this is question for perl installation gurus.

What does
% perl -V

I assume you get the message when you try and do
% perl Makefile.PL

Are you sure that the version in your path is the version you want to run?


I've installed perl 5.8.0 in /usr/local/bin on OSX and have not had
problems.

-jason
On Fri, 1 Aug 2003, Madis Metsis wrote:

> Hi!
>
> I am installing Bioperl on a OSX machine and get this message:
> *****
> Error: Unable to locate installed Perl libraries or Perl source code.
>
> It is recommended that you install perl in a standard location before
> building extensions. Some precompiled versions of perl do not contain
> these header files, so you cannot build extensions. In such a case,
> please build and install your perl from a fresh perl distribution. It
> usually solves this kind of problem.
>
> (You get this message, because MakeMaker could not find
> "/System/Library/Perl/darwin/CORE/perl.h")
> ****
>
> Thats true, perl.h is not in right place, since both Apple preinstalled and
> current Serverlogistics installer are not placing it in that place.
>
> How do I get around it. To install Perl AGAIN having 2 copies already on
> machine sounds....
> Is there a line in Makefile.pl that could be modified to "show" to location
> of perl.h and the rest of perl.
>
> Thanks in advance for any kind of help
>
> Madis Metsis
>
> Center for Genomics and Bioinformatics
> Karolinska Institute
> Stockholm
> Sweden
>
> _________________________________________________________________
> Help STOP SPAM with the new MSN 8 and get 2 months FREE*
> http://join.msn.com/?page=features/junkmail
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From brian_osborne at cognia.com  Fri Aug  1 12:40:58 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Fri Aug  1 12:44:53 2003
Subject: [Bioperl-l] problems with installing Bioperl on OSX
In-Reply-To: <Pine.LNX.4.50.0308011021190.30517-100000@tenero.duhs.duke.edu>
Message-ID: <GAEDKMGOKFBLJPKCLKCCIEDKDAAA.brian_osborne@cognia.com>

Madis,

For installation in "non-standard" locations you need to do something like
this (from the INSTALL file):

INSTALLING BIOPERL IN A PERSONAL OR PRIVATE MODULE AREA

 If you lack permission to install perl modules into the
 standard site_perl/ system area you can configure bioperl to
 install itself anywhere you choose. Ideally this would
 be a personal perl directory or standard place where you
 plan to put all your 'local' or personal perl modules.

 Note: you _must_ have write permission to this area.

 Simply pass a parameter to perl as it builds your system
 specific makefile.

 Example:

   perl Makefile.PL  LIB=/home/dag/My_Local_Perl_Modules
   make
   make test
   make install

 This tells perl to install bioperl in the desired place, e.g.:

  /home/dag/My_Perl_Modules/Bio/Seq.pm

 Then in your Bioperl script you would write:

  use lib "/home/dag/My_Local_Perl_Modules";
  use Bio::Seq;

 The man pages will probably be installed in $LIB/man. For more
 information on these sorts of custom installs see the documentation
 for ExtUtils::MakeMaker.

 See below for how to use modules that are not installed in the
 standard Perl5 location.


BIO





-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jason Stajich
Sent: Friday, August 01, 2003 10:23 AM
To: Madis Metsis
Cc: bioperl-l@bioperl.org
Subject: Re: [Bioperl-l] problems with installing Bioperl on OSX

no idea - this is question for perl installation gurus.

What does
% perl -V

I assume you get the message when you try and do
% perl Makefile.PL

Are you sure that the version in your path is the version you want to run?


I've installed perl 5.8.0 in /usr/local/bin on OSX and have not had
problems.

-jason
On Fri, 1 Aug 2003, Madis Metsis wrote:

> Hi!
>
> I am installing Bioperl on a OSX machine and get this message:
> *****
> Error: Unable to locate installed Perl libraries or Perl source code.
>
> It is recommended that you install perl in a standard location before
> building extensions. Some precompiled versions of perl do not contain
> these header files, so you cannot build extensions. In such a case,
> please build and install your perl from a fresh perl distribution. It
> usually solves this kind of problem.
>
> (You get this message, because MakeMaker could not find
> "/System/Library/Perl/darwin/CORE/perl.h")
> ****
>
> Thats true, perl.h is not in right place, since both Apple preinstalled
and
> current Serverlogistics installer are not placing it in that place.
>
> How do I get around it. To install Perl AGAIN having 2 copies already on
> machine sounds....
> Is there a line in Makefile.pl that could be modified to "show" to
location
> of perl.h and the rest of perl.
>
> Thanks in advance for any kind of help
>
> Madis Metsis
>
> Center for Genomics and Bioinformatics
> Karolinska Institute
> Stockholm
> Sweden
>
> _________________________________________________________________
> Help STOP SPAM with the new MSN 8 and get 2 months FREE*
> http://join.msn.com/?page=features/junkmail
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From ccavnor at systemsbiology.org  Fri Aug  1 13:03:47 2003
From: ccavnor at systemsbiology.org (Christopher Cavnor)
Date: Fri Aug  1 13:03:35 2003
Subject: [Bioperl-l] problems with installing Bioperl on OSX
Message-ID: <64B351282A4BBA4A9EBB264DA6FDBC28A6185C@exchange.systemsbiology.net>



I am installing Bioperl on a OSX machine and get this message:
*****
Error: Unable to locate installed Perl libraries or Perl source code.

It is recommended that you install perl in a standard location before
building extensions. Some precompiled versions of perl do not contain
these header files, so you cannot build extensions. In such a case,
please build and install your perl from a fresh perl distribution. It
usually solves this kind of problem.

(You get this message, because MakeMaker could not find 
"/System/Library/Perl/darwin/CORE/perl.h")
****

Thats true, perl.h is not in right place, since both Apple preinstalled and 
current Serverlogistics installer are not placing it in that place.

How do I get around it. To install Perl AGAIN having 2 copies already on 
machine sounds....

>> not so bad - check out: http://developer.apple.com/internet/macosx/perl.html

Is there a line in Makefile.pl that could be modified to "show" to location 
of perl.h and the rest of perl.

>> % perl -V will do that. You can also append to the beginning of the @INC array by doing (C shell syntax):

% setenv PERL5LIB /where/to/look

Thanks in advance for any kind of help

Madis Metsis

Center for Genomics and Bioinformatics
Karolinska Institute
Stockholm
Sweden

_________________________________________________________________
Help STOP SPAM with the new MSN 8 and get 2 months FREE*  
http://join.msn.com/?page=features/junkmail

_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l




From jmanning at genome.wi.mit.edu  Fri Aug  1 13:18:22 2003
From: jmanning at genome.wi.mit.edu (Jonathan Manning)
Date: Fri Aug  1 13:18:10 2003
Subject: [Bioperl-l] About Bio::DB::GenBank!
In-Reply-To: <3F2A6D86.9040006@xymu.net>
References: <3F2A6D86.9040006@xymu.net>
Message-ID: <3F2AA0DE.4010605@genome.wi.mit.edu>

I just encountered the same error. It looks like both Bio::DB::GenBank 
and Bio::DB::GenPept search the protein database. So, Bio::DB::GenBank 
is not returning anything when you query for an accession.

To verify this, change:
my $gb = new Bio::DB::GenBank;
to:
my $gb = new Bio::DB::GenBank(-format => 'fasta',
				-verbose => 1);

For me, this prints:
url is 
http://www.ncbi.nih.gov/entrez/eutils/efetch.fcgi?rettype=fasta&db=protein&id=AC068609&tool=bioperl&retmode=text&usehistory=n

Sure enough, visiting this gives me a blank page. However, if I 
substitute 'db=nucleotide' for 'db=protein' in that url, it works.

This bug seems to exist in 1.2 and 1.2.1, but I think is fixed in 1.2.2. 
(at least in the CVS head I checked...)

Either upgrade to 1.2.2 or edit Bio/DB/GenBank.pm and change 'protein' 
to 'nucleotide' in the BEGIN block.

~Jonathan


yaofx wrote:

> Hello,
> 
> I have installed Perl 5.6.1 for WIN32, and Bioperl  version 1.2.1.
> The following is the script ,which can retrieve data from GenBank by 
> sequences' gi,
> but can not get the results by accession number.
> I  replace "get_Stream_by_id"  with ""get_Stream_by_acc", also failed.
> 
> The error message is :
> 
> ------------- EXCEPTION  -------------
> MSG: WebDBSeqI Error - check query sequences!
> 
> STACK Bio::DB::WebDBSeqI::get_seq_stream 
> c:/Perl/site/lib/Bio/DB/WebDBSeqI.pm:46
> 4
> STACK Bio::DB::WebDBSeqI::get_Stream_by_id 
> c:/Perl/site/lib/Bio/DB/WebDBSeqI.pm:
> 259
> STACK toplevel web_gi2seq_vi.pl:50
> 
> --------------------------------------
> 
> BTW, I don't change any code about Bioperl package.
> What's matter with it? and how will i do next?
> 
> Thanks in advance for any kind of help
> 
> Fengxia
> 
> 
> #!/usr/bin/perl
> 
> $idlist = $ARGV[0];
> 
> if (@ARGV != 1){
>    print "USAGE: perl web_id2seq.pl <ID list file>\n";
>    exit(1);
> }
> 
> $faoutfile = $idlist."_fa.txt";
> (unlink $faoutfile) if (-e $faoutfile);
> 
> open (INPUT,$idlist);
> 
> while ($line = <INPUT>){
>    chomp ($line);
>    $line =~ s/\r//;
>    push (@querylist,$line);
> }
> $list = join ",",@querylist;
> close INPUT;
> 
> use Bio::SeqIO;
> use Bio::DB::GenBank;
> my $gb = new Bio::DB::GenBank;
> 
> my $seqout = new Bio::SeqIO(-file => ">$faoutfile", -format => 'fasta');
> my $seqio = $gb->get_Stream_by_id([$list]);
> 
> while($seq = $seqio->next_seq ) {
>        $seqout->write_seq($seq);
> }
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


-- 
Jonathan Manning <jmanning@genome.wi.mit.edu>
Whitehead Institute Center for Genome Research
Finishing Process Analyst / Data Analyst

From hlapp at gnf.org  Fri Aug  1 15:53:43 2003
From: hlapp at gnf.org (Hilmar Lapp)
Date: Fri Aug  1 15:53:32 2003
Subject: [Bioperl-l] Errors generated from example code in HOW-TO section
In-Reply-To: <Pine.LNX.4.50.0308010814560.30113-100000@tenero.duhs.duke.edu>
Message-ID: <DACB0852-C459-11D7-9E33-000A959EB4C4@gnf.org>


On Friday, August 1, 2003, at 05:15  AM, Jason Stajich wrote:

> I don't think we intend to a
> 1.2.3 release.

Why not? We should really release more often (and given the lack of 
releases from biosql and bioperl-db this is admittedly the blackest 
sheep speaking).

	-hilmar
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From hlapp at gnf.org  Fri Aug  1 16:04:09 2003
From: hlapp at gnf.org (Hilmar Lapp)
Date: Fri Aug  1 16:03:57 2003
Subject: [Bioperl-l] About Bio::DB::GenBank!
In-Reply-To: <3F2AA0DE.4010605@genome.wi.mit.edu>
Message-ID: <4FE2ABEE-C45B-11D7-9E33-000A959EB4C4@gnf.org>


On Friday, August 1, 2003, at 10:18  AM, Jonathan Manning wrote:

> This bug seems to exist in 1.2 and 1.2.1, but I think is fixed in 
> 1.2.2. (at least in the CVS head I checked...)
>

Jason fixed it on the branch and the main trunk. It's in 1.2.2. -hilmar

-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From yaofx at xymu.net  Fri Aug  1 22:54:43 2003
From: yaofx at xymu.net (yaofx)
Date: Fri Aug  1 22:55:02 2003
Subject: [Bioperl-l] About Bio::DB::GenBank!
References: <3F2A6D86.9040006@xymu.net> <3F2AA0DE.4010605@genome.wi.mit.edu>
Message-ID: <3F2B27F3.2000309@xymu.net>

Upgrade to 1.2.2 and it works well.

Thanks a lot!!!

Fengxia


Jonathan Manning wrote:

> I just encountered the same error. It looks like both Bio::DB::GenBank 
> and Bio::DB::GenPept search the protein database. So, Bio::DB::GenBank 
> is not returning anything when you query for an accession.
>
> To verify this, change:
> my $gb = new Bio::DB::GenBank;
> to:
> my $gb = new Bio::DB::GenBank(-format => 'fasta',
>                 -verbose => 1);
>
> For me, this prints:
> url is 
> http://www.ncbi.nih.gov/entrez/eutils/efetch.fcgi?rettype=fasta&db=protein&id=AC068609&tool=bioperl&retmode=text&usehistory=n 
>
>
> Sure enough, visiting this gives me a blank page. However, if I 
> substitute 'db=nucleotide' for 'db=protein' in that url, it works.
>
> This bug seems to exist in 1.2 and 1.2.1, but I think is fixed in 
> 1.2.2. (at least in the CVS head I checked...)
>
> Either upgrade to 1.2.2 or edit Bio/DB/GenBank.pm and change 'protein' 
> to 'nucleotide' in the BEGIN block.
>
> ~Jonathan
>



From bto_86 at gte.net  Sat Aug  2 03:44:02 2003
From: bto_86 at gte.net (bto_86@gte.net)
Date: Sat Aug  2 03:44:04 2003
Subject: [Bioperl-l] Re: what up
Message-ID: <200308020744.h727hw4T019305@localhost.localdomain>

hey its me again, i was wondering if you'd be interested in this site

Every day thousands of Americans are saving money, don't be one of the few who miss out!

you're placed up for auction and financers outbid each other on getting you the best deal on your mortgage!

http://r.aol.com/cgi/redir-complex?url=http://lowinterest@buynow3sx.com/viewso65/index.asp?RefID=198478
From sofia at neuro.utah.edu  Fri Aug  1 13:59:46 2003
From: sofia at neuro.utah.edu (Sofia)
Date: Sun Aug  3 12:11:36 2003
Subject: [Bioperl-l] problems with parsing hmmpfam
Message-ID: <002f01c35856$b1d73a50$f500000a@planaria2>

I am trying to parse a hmmpfam report.  I am mostly sucessful until I have the following error:


Use of uninitialized value in array element at /usr/lib/perl5/site_perl/5.8.0/Bio/SearchIO/hmmer.pm line 488, <GEN1> line 56473.

------------- EXCEPTION  -------------
MSG: Somehow the Model table order does not match the order in the domains (got [no, expected AFP)
STACK Bio::SearchIO::hmmer::next_result /usr/lib/perl5/site_perl/5.8.0/Bio/SearchIO/hmmer.pm:489
STACK toplevel ./parseHMM.pl:8

--------------------------------------
It seems to only occur when my scores for sequence family classification is "no hits above threshold" and my parsed for domains has a hit (though usually very poor score).

How can I filter out these records with SearchIO?

Thanks,
Sofia


Output which causes me to have this error
-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Query sequence: 26SrRNA
Accession:      [none]
Description:    [none]

Scores for sequence family classification (score includes all domains):
Model    Description                                    Score    E-value  N 
-------- -----------                                    -----    ------- ---
        [no hits above thresholds]

Parsed for domains:
Model    Domain  seq-f seq-t    hmm-f hmm-t      score  E-value
-------- ------- ----- -----    ----- -----      -----  -------
AFP        1/1     268   279 ..     1    12 []     0.3       89

Alignments of top-scoring domains:
AFP: domain 1 of 1, from 268 to 279: score 0.3, E = 89
                   *->tCTgStnCteAt<-*
                      tCT +t Ct+A    
     26SrRNA   268    TCTCGTACTGAG    279  

//

Query sequence: 40Sribosomal.protS11
Accession:      [none]
Description:    [none]

Scores for sequence family classification (score includes all domains):
Model    Description                                    Score    E-value  N 
-------- -----------                                    -----    ------- ---
        [no hits above thresholds]

Parsed for domains:
Model    Domain  seq-f seq-t    hmm-f hmm-t      score  E-value
-------- ------- ----- -----    ----- -----      -----  -------
AFP        1/1     127   138 ..     1    12 []     1.7       53

Alignments of top-scoring domains:
AFP: domain 1 of 1, from 127 to 138: score 1.7, E = 53
                   *->tCTgStnCteAt<-*
                      + Tg+tnC +     
  40Sribosom   127    AATGGTNCATTA    138  

//
-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
From jason at cgt.duhs.duke.edu  Sun Aug  3 13:47:40 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Sun Aug  3 13:33:31 2003
Subject: [Bioperl-l] problems with parsing hmmpfam
In-Reply-To: <002f01c35856$b1d73a50$f500000a@planaria2>
References: <002f01c35856$b1d73a50$f500000a@planaria2>
Message-ID: <Pine.LNX.4.50.0308031343540.22574-100000@tenero.duhs.duke.edu>

bioperl 1.2.2 and bioperl-live in CVS will parse these reports fine as far
as I can tell so I would suggest upgrading to bioperl 1.2.2

-jason

On Fri, 1 Aug 2003, Sofia wrote:

> I am trying to parse a hmmpfam report.  I am mostly sucessful until I have the following error:
>
>
> Use of uninitialized value in array element at /usr/lib/perl5/site_perl/5.8.0/Bio/SearchIO/hmmer.pm line 488, <GEN1> line 56473.
>
> ------------- EXCEPTION  -------------
> MSG: Somehow the Model table order does not match the order in the domains (got [no, expected AFP)
> STACK Bio::SearchIO::hmmer::next_result /usr/lib/perl5/site_perl/5.8.0/Bio/SearchIO/hmmer.pm:489
> STACK toplevel ./parseHMM.pl:8
>
> --------------------------------------
> It seems to only occur when my scores for sequence family classification is "no hits above threshold" and my parsed for domains has a hit (though usually very poor score).
>
> How can I filter out these records with SearchIO?
>
> Thanks,
> Sofia
>
>
> Output which causes me to have this error
> -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
> Query sequence: 26SrRNA
> Accession:      [none]
> Description:    [none]
>
> Scores for sequence family classification (score includes all domains):
> Model    Description                                    Score    E-value  N
> -------- -----------                                    -----    ------- ---
>         [no hits above thresholds]
>
> Parsed for domains:
> Model    Domain  seq-f seq-t    hmm-f hmm-t      score  E-value
> -------- ------- ----- -----    ----- -----      -----  -------
> AFP        1/1     268   279 ..     1    12 []     0.3       89
>
> Alignments of top-scoring domains:
> AFP: domain 1 of 1, from 268 to 279: score 0.3, E = 89
>                    *->tCTgStnCteAt<-*
>                       tCT +t Ct+A
>      26SrRNA   268    TCTCGTACTGAG    279
>
> //
>
> Query sequence: 40Sribosomal.protS11
> Accession:      [none]
> Description:    [none]
>
> Scores for sequence family classification (score includes all domains):
> Model    Description                                    Score    E-value  N
> -------- -----------                                    -----    ------- ---
>         [no hits above thresholds]
>
> Parsed for domains:
> Model    Domain  seq-f seq-t    hmm-f hmm-t      score  E-value
> -------- ------- ----- -----    ----- -----      -----  -------
> AFP        1/1     127   138 ..     1    12 []     1.7       53
>
> Alignments of top-scoring domains:
> AFP: domain 1 of 1, from 127 to 138: score 1.7, E = 53
>                    *->tCTgStnCteAt<-*
>                       + Tg+tnC +
>   40Sribosom   127    AATGGTNCATTA    138
>
> //
> -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From yaofx at xymu.net  Mon Aug  4 09:29:32 2003
From: yaofx at xymu.net (yaofx)
Date: Mon Aug  4 09:29:25 2003
Subject: [Bioperl-l] about error messages!
Message-ID: <3F2E5FBC.3070206@xymu.net>

Hello,

The following script is my first code using Bioperl module.
It works well, now I want to add some codes to get error messages and  
save as log file, such as :
" Could not connect internet", "ID does not exist", "verbose ID" , and 
so on.
But I can not find the information  about that, would you all like  help me?

Thanks in advance!

Fengxia


#!/usr/bin/perl -w
$idlist = $ARGV[0];

if (@ARGV != 1){
    print "USAGE: perl web_id2seq.pl <ID list file>\n";
    exit(1);
}

$faoutfile = $idlist."_fa.txt";
(unlink $faoutfile) if (-e $faoutfile);

open (INPUT,$idlist);

while ($line = <INPUT>){
    chomp ($line);
    $line =~ s/\r//;
    push (@querylist,$line);
}
$query = join ",",@querylist;
close INPUT;

use Bio::SeqIO;
use Bio::DB::GenBank;
my $gb = new Bio::DB::GenBank;

my $seqout = new Bio::SeqIO(-file => ">$faoutfile", -format => 'fasta');
my $seqio = $gb->get_Stream_by_id([$query]);
 
while($seq = $seqio->next_seq ) {
        $seqout->write_seq($seq);
}


From m2mwh at csc.liv.ac.uk  Tue Aug  5 06:43:49 2003
From: m2mwh at csc.liv.ac.uk (Michael Hughes)
Date: Tue Aug  5 06:43:31 2003
Subject: [Bioperl-l] Extracting GenBank Information 
Message-ID: <LMEGLLKGLLLLCFOGHKMBMEDDCAAA.m2mwh@csc.liv.ac.uk>


 Hello

 I am writing a code to extract mouse inbred strain information from
GenBank.

 Using get_Seq_by_acc, I am able to bring up the GenBank file on screen but
I can't find a way to search through this file and extract the relevant
information.
  I have tried saving it locally to search the output file but I can only
output the fasta format which has no strain information (I have tried using
$gb = new Bio::DB::GenBank (-format => 'genbank'); but I still receive
fasta).

  So, my questions are:

        - is there a way to search the file generated on line?
        - if not, how do I output a full GenBank file to a local folder?

 Thanks in advance for any help

 Michael Hughes

From marino at tofu.tamu.edu  Tue Aug  5 09:14:42 2003
From: marino at tofu.tamu.edu (Leonardo Marino-Ramirez)
Date: Tue Aug  5 09:19:27 2003
Subject: [Bioperl-l] Extracting GenBank Information 
In-Reply-To: <LMEGLLKGLLLLCFOGHKMBMEDDCAAA.m2mwh@csc.liv.ac.uk>
Message-ID: <Pine.LNX.4.30.0308050810020.20175-100000@tofu.tamu.edu>

Hi Michael,

What you want to do is get features for the genbank objects and extract
them as follows:

use Bio::DB::GenBank;

my $gb     = new Bio::DB::GenBank();

my $seq    = $gb->get_Seq_by_acc('AF308740.1');
my $desc   = $seq->desc();
my $length = $seq->length();
my $id     = $seq->primary_id();

print "GI: $id\tDESC: $desc\tLEN: $length bp\n";

my @features = $seq->all_SeqFeatures();
## Your favorite tags can be collected here
my @cds      = grep { $_->primary_tag eq 'CDS' } $seq->get_SeqFeatures();

foreach my $feature (@features) {
    my $primary_tag = $feature->primary_tag();
    my $start       = $feature->start();
    my $end         = $feature->end();
    my $strand      = $feature->strand();
    print "$primary_tag\t$start\t$end\t$strand\n";

    foreach my $each_tag ($feature->get_all_tags()) {
        my @tag_values = $feature->each_tag_value($each_tag);
        print "\t$each_tag\t@tag_values\n";
    }
}

foreach my $feature (@cds) {
    my $primary_tag = $feature->primary_tag();
    my $protein     = $feature->seq->translate->subseq(1,10);
    print "\n$primary_tag\t$protein\n";
}

Regards, Leonardo


On Tue, 5 Aug 2003, Michael Hughes wrote:

>
>  Hello
>
>  I am writing a code to extract mouse inbred strain information from
> GenBank.
>
>  Using get_Seq_by_acc, I am able to bring up the GenBank file on screen but
> I can't find a way to search through this file and extract the relevant
> information.
>   I have tried saving it locally to search the output file but I can only
> output the fasta format which has no strain information (I have tried using
> $gb = new Bio::DB::GenBank (-format => 'genbank'); but I still receive
> fasta).
>
>   So, my questions are:
>
>         - is there a way to search the file generated on line?
>         - if not, how do I output a full GenBank file to a local folder?
>
>  Thanks in advance for any help
>
>  Michael Hughes
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

-- 
___________________________________________________
    _/
   _/                      Leonardo Marino-Ramirez
  _/    _/      _/_/_/    marino@tofu.tamu.edu
 _/    _/_/  _/_/    _/  11915 Renwood Lane
_/_/_/_/  _/  _/_/_/    Rockville, MD 20852
     _/      _/     _/ Phone: (301) 770-2388
    _/      _/     _/ http://marino-johnson.org/
___________________________________________________

From rfn at uni-bremen.de  Tue Aug  5 11:30:43 2003
From: rfn at uni-bremen.de (Rolf Nimzyk)
Date: Tue Aug  5 11:12:17 2003
Subject: [Bioperl-l] Extracting subsequences from genbank files
Message-ID: <200308051730.43996.rfn@uni-bremen.de>

Hi,

I use a sligthly modyfied example script from Jason to extract subsequences 
out of a genbank files created from a sequence by GeneMachine,  
http://genome.nhgri.nih.gov/genemachine/. With some genbank files it works 
fine but with others not.  I don't now what the problem is. 

I am using Perl 5.8, BioPerl 1.2.2.

Thanks in advance

Rolf

The script

#!/usr/bin/perl -w
# Contributed by Jason Stajich <jason@bioperl.org>
# simple extract the CDS features from a genbank file and 
# write out the CDS and Peptide sequences
use strict;
use Bio::SeqIO;
my $filename = shift || die("pass in a genbank filename on the cmd line");
my $in = new Bio::SeqIO(-file => $filename, -format => 'genbank');
my $out = new Bio::SeqIO(-file => ">$filename.gene.fas");
while( my $seq = $in->next_seq ) {
  my @cds = grep { $_->primary_tag eq 'gene' } $seq->get_SeqFeatures();
  foreach my $feature ( @cds ) {
     my $featureseq = $feature->spliced_seq;
     my $newid = $filename . ' possible gene ' . $feature->start . ".." .  
$feature->end;
    $featureseq->display_id($newid);
    $out->write_seq($featureseq);
  }
}

The exception

Argument "bp" isn't numeric in numeric gt (>) at 
/usr/local/lib/perl5/site_perl/5.8.0/Bio/PrimarySeq.pm line 362, <GEN0> line 
2376.

------------- EXCEPTION  -------------
MSG: You have to have start positive
        and length less than the total length of sequence [4682:4770] Total bp
STACK Bio::PrimarySeq::subseq 
/usr/local/lib/perl5/site_perl/5.8.0/Bio/PrimarySeq.pm:362
STACK Bio::PrimarySeqI::trunc 
/usr/local/lib/perl5/site_perl/5.8.0/Bio/PrimarySeqI.pm:456
STACK Bio::SeqFeature::Generic::seq 
/usr/local/lib/perl5/site_perl/5.8.0/Bio/SeqFeature/Generic.pm:604
STACK toplevel extract_cds_exon.pl:24

Part of the genbank file

LOCUS       zwischen_LOC_126015_und_LOC_34292888777 bp   DNA linear 
01-JAN-1900
DEFINITION  zwischen LOC 126015 und LOC 342928.seq.
ACCESSION   zwischen_LOC_126015_und_LOC_342928
VERSION
KEYWORDS    .
SOURCE      Unknown.
  ORGANISM  Unknown.
            Unclassified.
FEATURES             Location/Qualifiers
     source          1..88777
                     /mol_type="unassigned DNA"
     gene            complement(join(1000..1176,2043..2243))
                     /gene="HMMGene"
                     /note="HMMGene; Prob1=0.426, Prob2=0.602, Prob3=0.301
                     bestparse:cds_3"
     repeat_region   1108..1390
                     /note="RepeatMasker: AluSx"
                     /rpt_family="SINE/Alu"
     repeat_region   1402..1512
                     /note="RepeatMasker: FLAM_C"
                     /rpt_family="SINE/Alu"
     repeat_region   1541..1653
                     /note="RepeatMasker: MER57B"
                     /rpt_family="LTR/ERV1"
     repeat_region   1654..1953
                     /note="RepeatMasker: AluSp"
                     /rpt_family="SINE/Alu"
     repeat_region   1954..2272
                     /note="RepeatMasker: MER57B"
                     /rpt_family="LTR/ERV1"
     gene            complement(join(2043..2243,10387..10426))
                     /gene="Genscan"
                     /note="GenScan; P1=Prom, P2=0.526"
     repeat_unit     2281..2321
                     /note="Sputnik"
                     /rpt_type=pentanucleotide
     repeat_unit     2330..2398
                     /note="Sputnik"
                     /rpt_type=pentanucleotide
     repeat_region   complement(2385..2695)
                     /note="RepeatMasker: AluSx"
                     /rpt_family="SINE/Alu"
     repeat_region   2697..2734
                     /note="RepeatMasker: MER57B"
                     /rpt_family="LTR/ERV1"
     repeat_region   2735..3247
                     /note="RepeatMasker: MER57B-int"
                     /rpt_family="LTR/ERV1"
     repeat_region   complement(3248..3551)
                     /note="RepeatMasker: AluY"
                     /rpt_family="SINE/Alu"
     repeat_region   3552..3646
                     /note="RepeatMasker: MER57B-int"
                     /rpt_family="LTR/ERV1"
     repeat_region   3649..3939
                     /note="RepeatMasker: AluSx"
                     /rpt_family="SINE/Alu"
     repeat_region   3941..4263
                     /note="RepeatMasker: AluSq"
                     /rpt_family="SINE/Alu"
     repeat_region   4276..4450
                     /note="RepeatMasker: MER57B-int"
                     /rpt_family="LTR/ERV1"
     repeat_region   4445..5174
                     /note="RepeatMasker: MER57B-int"
                     /rpt_family="LTR/ERV1"
     exon            4682..4770
                     /note="MZEF; P=0.545"
     gene            join(4758..4770,8044..8208,9490..9656,22534..22662,
                     42550..42582,46069..46096,52948..53003)
                     /gene="HMMGene"
                     /note="HMMGene; Prob1=0.242, Prob2=0.894, Prob3=0.319,
                     Prob4=0.589, Prob5=0.406, Prob6=0.405, Prob7=0.006,
                     Prob8=0.000 bestparse:cds_1"
     repeat_region   5193..5300
                     /note="RepeatMasker: MER57-int"
                     /rpt_family="LTR/ERV1"
     repeat_region   5303..5630
                     /note="RepeatMasker: AluSx"
                     /rpt_family="SINE/Alu"
     repeat_unit     5587..5630
                     /gene="HMMGene"
                     /note="Sputnik"
                     /rpt_type=pentanucleotide
     repeat_region   5636..5741
                     /note="RepeatMasker: U6"
                     /rpt_family="snRNA"
     repeat_region   complement(5979..6276)
                     /note="RepeatMasker: AluSq"
                     /rpt_family="SINE/Alu"
     repeat_region   6290..6438
                     /note="RepeatMasker: MER57-int"
                     /rpt_family="LTR/ERV1"
     repeat_region   6421..6876
                     /note="RepeatMasker: MER57-int"
                     /rpt_family="LTR/ERV1"
     repeat_region   7097..7586
                     /note="RepeatMasker: MER57-int"
                     /rpt_family="LTR/ERV1"
     repeat_region   7623..7791
                     /note="RepeatMasker: AluSg/x"
                     /rpt_family="SINE/Alu"
     repeat_region   complement(8267..8896)
                     /note="RepeatMasker: AluSx"
                     /rpt_family="SINE/Alu"
     repeat_region   complement(8948..8998)
                     /note="RepeatMasker: FLAM"
                     /rpt_family="SINE/Alu"
     repeat_region   complement(8999..9323)
                     /note="RepeatMasker: AluSx"
                     /rpt_family="SINE/Alu"
     gene            complement(join(9914..10210,19268..19390,40859..40909))
                     /gene="HMMGene"
                     /note="HMMGene; Prob1=0.245, Prob2=0.500, Prob3=0.397,
                     Prob4=0.007 bestparse:cds_2"
     repeat_region   10551..10860
                     /note="RepeatMasker: AluSx"
                     /rpt_family="SINE/Alu"



From shin at cbs.umn.edu  Tue Aug  5 17:17:52 2003
From: shin at cbs.umn.edu (Shin Enomoto)
Date: Tue Aug  5 17:18:13 2003
Subject: [Bioperl-l] load_gff.pl question
Message-ID: <45F418C6-C78A-11D7-879A-0003935652B4@biosci.cbs.umn.edu>

I am getting erratic results with the load_gff.pl.

1) I was trying to load a table of 900 lines. Of the 900 entries,  ~30 
are highly unique and they all loaded normally. The remainder was ~600, 
  ~250 and 4 of very similar items only differing slightly. It loaded  
6/600, 5/250 and 2/4.

2) I have 10 large tables of ~250000 lines each. I was able to load the 
first table. load_gff.pl will not load any other tables.

Where do I start to customize this script to allow loading of large 
number of similar entities?




Shin Enomoto
295 ASLVM
1988 Fitch Ave.
St. Paul, MN 55108

612-625-7737

From Yan.Fantei at unice.fr  Wed Aug  6 04:30:29 2003
From: Yan.Fantei at unice.fr (=?ISO-8859-1?Q?Fante=EF?= Caujolle Yan)
Date: Wed Aug  6 04:30:31 2003
Subject: [Bioperl-l] XML -> Flat Query-Anchored & Identities
Message-ID: <1060158653.2819.23.camel@bioch-81.unice.fr>

Hello all,

How to create a "Flat Query-Anchored with Identities" report from xml
blast result (option -m7 of Blast) ?


Cheers, Yan



Yan Fante? Caujolle
INSERM U470
Centre de Biochimie 
PArc Valrose
Nice 06108 France

From simon.andrews at bbsrc.ac.uk  Wed Aug  6 05:16:18 2003
From: simon.andrews at bbsrc.ac.uk (simon andrews (BI))
Date: Wed Aug  6 05:20:19 2003
Subject: [Bioperl-l] XML -> Flat Query-Anchored & Identities
Message-ID: <2DC41140A89ED411989D00508BDCD9ED01E28AFE@bi-exsrv1.iapc.bbsrc.ac.uk>



> -----Original Message-----
> From: Fante? Caujolle Yan [mailto:Yan.Fantei@unice.fr]
> Sent: 06 August 2003 09:31
> To: bioperl-l@bioperl.org
> Subject: [Bioperl-l] XML -> Flat Query-Anchored & Identities
> 
> 
> Hello all,
> 
> How to create a "Flat Query-Anchored with Identities" report from xml
> blast result (option -m7 of Blast) ?

Not exactly sure of the output format you want, but you probably want
to use the Bio::SearchIO module to parse your blast report.

#!/usr/bin/perl -w
use strict;
use Bio::SearchIO;

my $search = Bio::SearchIO -> new (-format => 'blastxml',
                                   -file => 'your_blast_file.xml');

# Assuming you only have one report in your file.
# You can put this in a loop for a multiple report file

my $report = Bio::SearchIO -> next_report();

while (my $hit = $report -> next_hit()){

  print "Found a hit to ", $hit->name; 
  print " which is ", $hit->description() , "\n";

  # Again you can put this bit in a loop if you want
  # details for individual hsps
  my $first_hsp = $hit -> next_hsp();

  print "Total length of hit was ", $hsp->length('total'),"bp \n";
  print "Total identity of hit was ", $hsp->frac_identical('total'),"% \n";	

}
	

From Laurence.Amilhat at clermont.inra.fr  Wed Aug  6 03:09:56 2003
From: Laurence.Amilhat at clermont.inra.fr (Laurence Amilhat)
Date: Wed Aug  6 08:28:43 2003
Subject: [Bioperl-l] Bio::Graphics
Message-ID: <5.1.1.6.0.20030806090354.00b28208@valmont>



Hi,

I try to learn how to use the module Bio::Graphics.
I found he How To from Lincoln Stein on the web. I try to practice with the 
examples, it's working except for the labels of the features that don't 
appear on my figure.
Does anybody ever use this module?

This is the example:
#!/usr/local/public/bin/perl

use strict;
use lib 
'/homej/bioinf/lamilhat/PERL_MODULE/lib/perl5/site_perl/5.005/BIOPERL/lib/site_perl/5.6.1/';
use Bio::Graphics;
use Bio::SeqFeature::Generic;

my $panel= Bio::Graphics::Panel->new(-length =>1000,-width =>800);
my $track=$panel->add_track(-glyph =>'generic',-label =>1);


while (<>)
{
         chomp;
         next if /^\#/;
         my ($name,$score,$start,$end)=split /\t+/;
         print STDERR "$name\n";
         my $feature= 
Bio::SeqFeature::Generic->new(-display_name=>$name,-score=>$score,-start=>$start,-end=>$end);
         $track->add_feature($feature);
}

print $panel->png;


And this is the Data to parse with the example:
#hit    score   start   end
truc1   381     2       200
truc2   210     2       210
truc3   800     2       200
truc4   1000    380     921
truc5   812     402     972
truc6   1200    400     970
bum     400     300     620
pres1   127     310     700


Thanks,

Laurence.

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
INRA, UMR INRA/UBP Am?lioration et Sant? des Plantes
234 avenue du Br?zet
63039 Clermont-Ferrand Cedex 2

Tel 04 73 62 48 37
Fax 04 73 62 44 53
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
From laurichj at bioinfo.ucr.edu  Wed Aug  6 13:11:37 2003
From: laurichj at bioinfo.ucr.edu (Josh Lauricha)
Date: Wed Aug  6 13:11:17 2003
Subject: [Bioperl-l] BioPipe & LFS
Message-ID: <20030806171137.GA32555@bioinfo.ucr.edu>

Sorry for the quite off topic post,

I've been looking into difference batch systems, however I've only seen
LFS mentioned by the BioPipe docs. Can anyone point me to the main LFS
page? Since I don't know what it stands for, any search I do ends up
with references to Linux From Scratch...

Thanks for your help.

-- 

----------------------------
| Josh Lauricha            |
| laurichj@bioinfo.ucr.edu |
| Bioinformatics, UCR      |
|--------------------------|
From lailf at bii.a-star.edu.sg  Wed Aug  6 13:25:10 2003
From: lailf at bii.a-star.edu.sg (LAI Loong Fong)
Date: Wed Aug  6 13:21:14 2003
Subject: [Bioperl-l] BioPipe & LFS
In-Reply-To: <20030806171137.GA32555@bioinfo.ucr.edu>
Message-ID: <BB575AF6.C04E%lailf@bii.a-star.edu.sg>

Do you mean LSF, if it is then you can find more info at
http://www.platform.com

Regards
LAI Loong Fong

On 7/8/03 1:11 AM, "Josh Lauricha" <laurichj@bioinfo.ucr.edu> wrote:

> Sorry for the quite off topic post,
> 
> I've been looking into difference batch systems, however I've only seen
> LFS mentioned by the BioPipe docs. Can anyone point me to the main LFS
> page? Since I don't know what it stands for, any search I do ends up
> with references to Linux From Scratch...
> 
> Thanks for your help.

From laurichj at bioinfo.ucr.edu  Wed Aug  6 13:28:54 2003
From: laurichj at bioinfo.ucr.edu (Josh Lauricha)
Date: Wed Aug  6 13:28:33 2003
Subject: [Bioperl-l] BioPipe & LFS
In-Reply-To: <BB575AF6.C04E%lailf@bii.a-star.edu.sg>
References: <20030806171137.GA32555@bioinfo.ucr.edu>
	<BB575AF6.C04E%lailf@bii.a-star.edu.sg>
Message-ID: <20030806172854.GB32555@bioinfo.ucr.edu>

On Thu  01:25, LAI Loong Fong wrote:
> Do you mean LSF, if it is then you can find more info at
> http://www.platform.com
> 

Well, that would explain it. I'd like to blame it on a typo... but its
really just my own incompatence.

Thanks

-- 

----------------------------
| Josh Lauricha            |
| laurichj@bioinfo.ucr.edu |
| Bioinformatics, UCR      |
|--------------------------|
From brian_osborne at cognia.com  Wed Aug  6 13:27:24 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Wed Aug  6 13:30:44 2003
Subject: [Bioperl-l] BioPipe & LFS
In-Reply-To: <20030806171137.GA32555@bioinfo.ucr.edu>
Message-ID: <GAEDKMGOKFBLJPKCLKCCIEGGDAAA.brian_osborne@cognia.com>

Josh,

Are you sure it's not LSF? "Load Sharing Facility"?

Brian O.

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Josh Lauricha
Sent: Wednesday, August 06, 2003 1:12 PM
To: bioperl-l@bioperl.org
Subject: [Bioperl-l] BioPipe & LFS

Sorry for the quite off topic post,

I've been looking into difference batch systems, however I've only seen
LFS mentioned by the BioPipe docs. Can anyone point me to the main LFS
page? Since I don't know what it stands for, any search I do ends up
with references to Linux From Scratch...

Thanks for your help.

--

----------------------------
| Josh Lauricha            |
| laurichj@bioinfo.ucr.edu |
| Bioinformatics, UCR      |
|--------------------------|
_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From cain at cshl.org  Wed Aug  6 15:21:17 2003
From: cain at cshl.org (Scott Cain)
Date: Wed Aug  6 15:21:19 2003
Subject: [Bioperl-l] Re: load_gff.pl question
In-Reply-To: <200308061731.h76HVH4U005979@localhost.localdomain>
References: <200308061731.h76HVH4U005979@localhost.localdomain>
Message-ID: <1060197700.1431.11.camel@localhost.localdomain>

Shin,

The problem you are running into is not really with load_gff.pl, but
with the database schema.  Assuming you are using MySQL, the table
create statement for fdata looks like this:

 create table fdata (
    fid                 int not null  auto_increment,
    fref                varchar(100) not null,
    fstart              int unsigned   not null,
    fstop               int unsigned   not null,
    fbin                double(20,6)  not null,
    ftypeid             int not null,
    fscore              float,
    fstrand             enum('+','-'),
    fphase              enum('0','1','2'),
    gid                 int not null,
    ftarget_start       int unsigned,
    ftarget_stop        int unsigned,
    primary key(fid),
    unique index(fref,fbin,fstart,fstop,ftypeid,gid),
    index(ftypeid),
    index(gid)

The problem  you have is with that unique index on
(fref,fbin,fstart,fstop,ftypeid,gid).  This index conflicts with your
data, in that the similar lines are getting assigned the same gid (group
id), since they look like the same thing.  So, the quick way to fix this
is to remove the 'unique' from the index declaration.  That can be found
in Bio/DB/GFF/Adaptor/dbi/mysql.pm. Then run load_gff.pl as usual.  The
longer way to fix this is look at your data and figure out why they are
all getting assigned the same group id and make them sufficiently
different so that they don't.  

Hope that helps,
Scott

On Wed, 2003-08-06 at 13:31, bioperl-l-request@portal.open-bio.org
wrote:
> Where do I start to customize this script to allow loading of large 
> number of similar entities?

-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain@cshl.org
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory

From cain at cshl.org  Wed Aug  6 15:52:28 2003
From: cain at cshl.org (Scott Cain)
Date: Wed Aug  6 15:52:30 2003
Subject: [Bioperl-l] Re: Bioperl-l Digest, Vol 4, Issue 3
In-Reply-To: <200308061731.h76HVH4U005979@localhost.localdomain>
References: <200308061731.h76HVH4U005979@localhost.localdomain>
Message-ID: <1060199572.1431.33.camel@localhost.localdomain>

Laurence,

I ran a script very similar to what you are using (the code I used is
below), and I didn't have any problems, at least not if what is expected
is the same as this: http://www.gmod.org/BioGraphicsTest.png.

I suspect you are having a version problem.  I am using bioperl-live
(from CVS), but when I installed bioperl-1.2.2, it failed in the way you
describe.  Where is the tutorial you are reading?  Perhaps it is not in
sync with the most recent version of released bioperl.

Here is the script I used:
#!/usr/local/bin/perl -w

use strict;
use Bio::Graphics;
use Bio::SeqFeature::Generic;

my $panel= Bio::Graphics::Panel->new(-length =>1000,-width =>800);
my $track=$panel->add_track(-glyph =>'generic',-label =>1);

while (<DATA>)
{
         chomp;
         next if /^\#/;
         my ($name,$score,$start,$end)=split /\s+/;
         warn "$name\n";
         my $feature=
Bio::SeqFeature::Generic->new(-display_name=>$name,-score=>$score,-start=>$start,-end=>$end);
         $track->add_feature($feature);
}

print $panel->png;

__DATA__
#hit    score   start   end
truc1   381     2       200
truc2   210     2       210
truc3   800     2       200
truc4   1000    380     921
truc5   812     402     972
truc6   1200    400     970
bum     400     300     620
pres1   127     310     700

Scott

On Wed, 2003-08-06 at 13:31, bioperl-l-request@portal.open-bio.org
wrote:
> I try to learn how to use the module Bio::Graphics.
> I found he How To from Lincoln Stein on the web. I try to practice with the 
> examples, it's working except for the labels of the features that don't 
> appear on my figure.
> Does anybody ever use this module?

-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain@cshl.org
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory

From kvddrift at earthlink.net  Wed Aug  6 19:40:20 2003
From: kvddrift at earthlink.net (Koen van der Drift)
Date: Wed Aug  6 19:42:03 2003
Subject: [Bioperl-l] GFF scripts
Message-ID: <57B466DA-C867-11D7-8307-003065A5FDCC@earthlink.net>

Hi,

What happens to the scripts in Bio-DB-GFF after installation? Do I need 
to set a specific flag during compiling/installation? I ask this 
because the gbrowse package uses this script to set up a database.

thanks,

- Koen.

From wes.barris at csiro.au  Wed Aug  6 20:23:17 2003
From: wes.barris at csiro.au (Wes Barris)
Date: Wed Aug  6 20:23:17 2003
Subject: [Bioperl-l] Bio::Graphics
In-Reply-To: <5.1.1.6.0.20030806090354.00b28208@valmont>
References: <5.1.1.6.0.20030806090354.00b28208@valmont>
Message-ID: <3F319BF5.6050301@csiro.au>

Laurence Amilhat wrote:

> Hi,
> 
> I try to learn how to use the module Bio::Graphics.
> I found he How To from Lincoln Stein on the web. I try to practice with
> the examples, it's working except for the labels of the features that 
> don't appear on my figure.
> Does anybody ever use this module?

Hi Laurence,

I have not been able to get this function working either.  I am experiencing
the exact same problem as you.  I have tried this on two separate computers
where bioperl was installed by two different people.  Both are Redhat systems.
One is running bioperl-1.2.1, the other is running bioperl-1.2.2.  In both
cases the labels are silently omitted.

The example that I was trying is the first one on this page:

	http://bioperl.org/HOWTOs/html/Graphics-HOWTO.html

It is virtually the same as your example with one small difference.  You
code includes this line:

my $feature = Bio::SeqFeature::Generic->new(-display_name=>$name,-score=>$score,

The example from the URL above uses a slight variation:

my $feature = Bio::SeqFeature::Generic->new(-seq_id=>$name,-score=>$score,

I have tried both versions.  Neither of them produced a label in the
resulting png file.  I don't know what the significance of the two different
attributes is.  I can read the words of the documentation, but it didn't
explain the difference of the two or if they were somehow related.

Obviously, there is a bug somewhere in bioperl or in the provided examples
(or in the provided installation instructions).  Either that, or we have
both made the exact same error in doing something.  I just don't know what.

I have posted a question about this exact same anomaly to this mailing list
but have not received any suggestions yet.  Perhaps this module is not too
heavily used.

> 
> This is the example:
> #!/usr/local/public/bin/perl
> 
> use strict;
> use lib 
> '/homej/bioinf/lamilhat/PERL_MODULE/lib/perl5/site_perl/5.005/BIOPERL/li
> b/site_perl/5.6.1/';
> use Bio::Graphics;
> use Bio::SeqFeature::Generic;
> 
> my $panel= Bio::Graphics::Panel->new(-length =>1000,-width =>800);
> my $track=$panel->add_track(-glyph =>'generic',-label =>1);
> 
> 
> while (<>)
> {
>         chomp;
>         next if /^\#/;
>         my ($name,$score,$start,$end)=split /\t+/;
>         print STDERR "$name\n";
>         my $feature= 
> Bio::SeqFeature::Generic->new(-display_name=>$name,-score=>$score,-start
> =>$start,-end=>$end);
>         $track->add_feature($feature);
> }
> 
> print $panel->png;
> 
> 
> And this is the Data to parse with the example:
> #hit    score   start   end
> truc1   381     2       200
> truc2   210     2       210
> truc3   800     2       200
> truc4   1000    380     921
> truc5   812     402     972
> truc6   1200    400     970
> bum     400     300     620
> pres1   127     310     700
> 
> 
> Thanks,
> 
> Laurence.
> 
> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> INRA, UMR INRA/UBP Am?lioration et Sant? des Plantes
> 234 avenue du Br?zet
> 63039 Clermont-Ferrand Cedex 2
> 
> Tel 04 73 62 48 37
> Fax 04 73 62 44 53
> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> 
> 
> 
> ------------------------------------------------------------------------
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


-- 
Wes Barris
E-Mail: Wes.Barris@csiro.au

From wes.barris at csiro.au  Wed Aug  6 20:35:55 2003
From: wes.barris at csiro.au (Wes Barris)
Date: Wed Aug  6 20:35:48 2003
Subject: [Bioperl-l] Re: Bioperl-l Digest, Vol 4, Issue 3
In-Reply-To: <1060199572.1431.33.camel@localhost.localdomain>
References: <200308061731.h76HVH4U005979@localhost.localdomain>
	<1060199572.1431.33.camel@localhost.localdomain>
Message-ID: <3F319EEB.7090207@csiro.au>

Scott Cain wrote:

> Laurence,
> 
> I ran a script very similar to what you are using (the code I used is
> below), and I didn't have any problems, at least not if what is expected
> is the same as this: http://www.gmod.org/BioGraphicsTest.png.
> 
> I suspect you are having a version problem.  I am using bioperl-live
> (from CVS), but when I installed bioperl-1.2.2, it failed in the way you
> describe.  Where is the tutorial you are reading?  Perhaps it is not in
> sync with the most recent version of released bioperl.

Hi Scott,

I have experienced the same exact problem described by Laurence.  I am
using the first example on this page:

	http://bioperl.org/HOWTOs/html/Graphics-HOWTO.html

I have tried this on a Redhat-7.2/Bioperl-1.2.1 system and on a
Redhat-8.0/Bioperl-1.2.2 system.  I both cases, the label was silently
omitted from the resulting png file.

Your example code uses "-display_name" where the HOW-TO example code
uses "-seq_id".  Neither produces a label.  Do you know what the difference
is?

Is installing from CVS the only way to resolve this?

> 
> Here is the script I used:
> #!/usr/local/bin/perl -w
> 
> use strict;
> use Bio::Graphics;
> use Bio::SeqFeature::Generic;
> 
> my $panel= Bio::Graphics::Panel->new(-length =>1000,-width =>800);
> my $track=$panel->add_track(-glyph =>'generic',-label =>1);
> 
> while (<DATA>)
> {
>          chomp;
>          next if /^\#/;
>          my ($name,$score,$start,$end)=split /\s+/;
>          warn "$name\n";
>          my $feature=
> Bio::SeqFeature::Generic->new(-display_name=>$name,-score=>$score,-start=>$start,-end=>$end);
>          $track->add_feature($feature);
> }
> 
> print $panel->png;
> 
> __DATA__
> #hit    score   start   end
> truc1   381     2       200
> truc2   210     2       210
> truc3   800     2       200
> truc4   1000    380     921
> truc5   812     402     972
> truc6   1200    400     970
> bum     400     300     620
> pres1   127     310     700
> 
> Scott
> 
> On Wed, 2003-08-06 at 13:31, bioperl-l-request@portal.open-bio.org
> wrote:
> 
>>I try to learn how to use the module Bio::Graphics.
>>I found he How To from Lincoln Stein on the web. I try to practice with the 
>>examples, it's working except for the labels of the features that don't 
>>appear on my figure.
>>Does anybody ever use this module?
> 
> 


-- 
Wes Barris
E-Mail: Wes.Barris@csiro.au

From shin at biosci.cbs.umn.edu  Wed Aug  6 23:52:19 2003
From: shin at biosci.cbs.umn.edu (Shin Enomoto)
Date: Wed Aug  6 23:51:46 2003
Subject: [Bioperl-l] Re: load_gff.pl question
In-Reply-To: <1060197700.1431.11.camel@localhost.localdomain>
Message-ID: <8AEE3822-C88A-11D7-9A79-000A2792630A@biosci.cbs.umn.edu>

Thank you.
After a good night's sleep I modified the GFF table  one column at a  
time and found that (ref, source, method, start, end, gclass, name)  
mattered. What does fbin come from?

I have a different question?
When I load the following:
VI_3	nelson	cdna	404988	405465	.	+	.	EST "gi|2099810|"; Note "CpEST.323  
uniZAPCpIOWAsporoLib3 Cryptosporidium parvum cDNA 5' similar to C.  
elegans ORF M28.5 and H. sapiens nuclear protein-NHP2-like protein.,  
mRNA sequence"

with a
[EST]
glyph	      = generic

in the configuration file.
gbrowse script fails "glyph genric new not available".

My work around was either to change the word EST to something else or  
use another glyph. What do you think is  the conflict?


On Wednesday, August 6, 2003, at 02:21  PM, Scott Cain wrote:

> Shin,
>
> The problem you are running into is not really with load_gff.pl, but
> with the database schema.  Assuming you are using MySQL, the table
> create statement for fdata looks like this:
>
>  create table fdata (
>     fid                 int not null  auto_increment,
>     fref                varchar(100) not null,
>     fstart              int unsigned   not null,
>     fstop               int unsigned   not null,
>     fbin                double(20,6)  not null,
>     ftypeid             int not null,
>     fscore              float,
>     fstrand             enum('+','-'),
>     fphase              enum('0','1','2'),
>     gid                 int not null,
>     ftarget_start       int unsigned,
>     ftarget_stop        int unsigned,
>     primary key(fid),
>     unique index(fref,fbin,fstart,fstop,ftypeid,gid),
>     index(ftypeid),
>     index(gid)
>
> The problem  you have is with that unique index on
> (fref,fbin,fstart,fstop,ftypeid,gid).  This index conflicts with your
> data, in that the similar lines are getting assigned the same gid  
> (group
> id), since they look like the same thing.  So, the quick way to fix  
> this
> is to remove the 'unique' from the index declaration.  That can be  
> found
> in Bio/DB/GFF/Adaptor/dbi/mysql.pm. Then run load_gff.pl as usual.  The
> longer way to fix this is look at your data and figure out why they are
> all getting assigned the same group id and make them sufficiently
> different so that they don't.
>
> Hope that helps,
> Scott
>
> On Wed, 2003-08-06 at 13:31, bioperl-l-request@portal.open-bio.org
> wrote:
>> Where do I start to customize this script to allow loading of large
>> number of similar entities?
>
> --  
> ----------------------------------------------------------------------- 
> -
> Scott Cain, Ph. D.                                          
> cain@cshl.org
> GMOD Coordinator (http://www.gmod.org/)                      
> 216-392-3087
> Cold Spring Harbor Laboratory
>
>
Shin Enomoto
295 ASLVM
1988 Fitch Ave
St. Paul, MN 55108

612-625-7737

From kohl at uni-duesseldorf.de  Thu Aug  7 05:34:15 2003
From: kohl at uni-duesseldorf.de (jochen)
Date: Thu Aug  7 03:29:15 2003
Subject: [Bioperl-l] get sequences over pubmed
Message-ID: <3F321D17.3070102@uni-duesseldorf.de>

 Hallo,

I try to  get the sequences related to pubmed entry with bioperl. Just 
like to use the "display : Nukleotide links"
on the pubmed web site.  My first try was  generated Query with 
Bio::DB::Query::GenBanK->new(-db=>
pubmed, ..) but I don't find a way to get the sequence for the 
refference. So I try this :


    my $query_string = 'Vigilant [AUTH]  AND 1503-1507 AND 1991 [PDAT]';
    my $query = Bio::DB::Query::GenBank->new(-db=>'pubmed',
                                                                        
          -query=>$query_string);

    my $count = $query->count;

     if ($count == 1) {
        my $q = $query->query();
         $query = Bio::DB::Query::GenBank->new(-db=>'nucleotide',
                                                                        
          -query=>$q);
        }

    $db = new Bio::DB::GenBank(-delay=>'10s');
    my $stream = $db->get_Stream_by_query($query);
    while (my $seq = $stream->next_seq) {
            print " Seq : " . $seq->display_id() . "\n";
    }
       

But I'm not sure if the same query string find the only the sequences 
for the refference and same
query-string (like the example) don't work for the 'nucleotide' db.

I also looked by  *Bio::Biblio* to find the solution but I'm to blind.

Thanks for Help

From brian_osborne at cognia.com  Thu Aug  7 08:25:50 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Thu Aug  7 08:29:07 2003
Subject: [Bioperl-l] GFF scripts
In-Reply-To: <57B466DA-C867-11D7-8307-003065A5FDCC@earthlink.net>
Message-ID: <GAEDKMGOKFBLJPKCLKCCMEGMDAAA.brian_osborne@cognia.com>

Koen,

This is from the INSTALL file in the package:

INSTALLING BIOPERL SCRIPTS

Bioperl comes with a set of production-quality scripts that are kept
in the scripts/ directory. You can install these scripts if you'd like,
simply follow the instructions on 'make install'. The installation
directory is specified by the INSTALLSCRIPT variable in the Makefile,
the default location is /usr/bin. Installation will copy the scripts
to the specified directory, change the 'PLS' suffix to 'pl', and
prepend 'bp_' to all the script names if they aren't so named already.

Brian O.


-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Koen van der
Drift
Sent: Wednesday, August 06, 2003 7:40 PM
To: bioperl-l@portal.open-bio.org
Subject: [Bioperl-l] GFF scripts

Hi,

What happens to the scripts in Bio-DB-GFF after installation? Do I need
to set a specific flag during compiling/installation? I ask this
because the gbrowse package uses this script to set up a database.

thanks,

- Koen.

_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From Lobvi.Matamoros at crchul.ulaval.ca  Wed Aug  6 19:02:27 2003
From: Lobvi.Matamoros at crchul.ulaval.ca (Lobvi Matamoros)
Date: Thu Aug  7 08:33:35 2003
Subject: [Bioperl-l] BioPerl Installation
Message-ID: <4.2.0.58.20030806170151.00a4eaa8@drs.crchul.ulaval.ca>

Hi to every body:

I am trying to install BioPerl (I have already installed ActivePerl 5.8.0 
version with Win2000) everything goes fine downloading a zip file from 
http://bio.perl.org/DIST/bioperl-1.2.2.zip. Unziping the file to a 
directory C:\Perl\ BioPerl 1.2.2 and starting the installation process with 
perl Makefile.pl. After that when I issued the commands make, make test or 
make install I got the following message:

..make is not recognize as an internal or external command, operable 
program or batch file.

What is wrong?


Thanks in advance for your help.


From patrick.demarta at libero.it  Thu Aug  7 09:11:30 2003
From: patrick.demarta at libero.it (Patrick De Marta)
Date: Thu Aug  7 09:15:21 2003
Subject: [Bioperl-l] BioPerl Installation
References: <4.2.0.58.20030806170151.00a4eaa8@drs.crchul.ulaval.ca>
Message-ID: <00de01c35ce5$6b3fdf00$0200a8c0@server>

----- Original Message ----- 
From: "Lobvi Matamoros" <Lobvi.Matamoros@crchul.ulaval.ca>
To: <bioperl-l@bioperl.org>
Sent: Thursday, August 07, 2003 1:02 AM
Subject: [Bioperl-l] BioPerl Installation


> Hi to every body:
>
> I am trying to install BioPerl (I have already installed ActivePerl 5.8.0
> version with Win2000) everything goes fine downloading a zip file from
> http://bio.perl.org/DIST/bioperl-1.2.2.zip. Unziping the file to a
> directory C:\Perl\ BioPerl 1.2.2 and starting the installation process
with
> perl Makefile.pl. After that when I issued the commands make, make test or
> make install I got the following message:
>
> ..make is not recognize as an internal or external command, operable
> program or batch file.
>
> What is wrong?

Sorry, don't know this in particular
I'm a novice perl and bioperl student :)))
but i simply installed
with:

ppm (at command prompt)

and then

> install bioperl

it worked fine.
 :-)



From brian_osborne at cognia.com  Thu Aug  7 09:12:25 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Thu Aug  7 09:15:45 2003
Subject: [Bioperl-l] BioPerl Installation
In-Reply-To: <4.2.0.58.20030806170151.00a4eaa8@drs.crchul.ulaval.ca>
Message-ID: <GAEDKMGOKFBLJPKCLKCCIEGNDAAA.brian_osborne@cognia.com>

Lobvi,

You're trying a "unix-style" installation on Windows. This can be done but
the specific error arises because you probably don't have the make program
installed on your machine. If you look at the INSTALL.WIN file in the
bioperl package you'll see it describes an installation using ActiveState
and its PPM application. Alternatively, you can install Cygwin, also free,
on your computer and do the installation unix-style since Cygwin is a Unix
emulator. I've taken this approach because I'm comfortable with Unix and
have no patience with MS-DOS/Command Prompt.

If you want to continue along the same course I believe you have to install
nmake for Windows, then use nmake instead of make - I will be corrected if
I'm wrong, I've avoided this approach. Otherwise you'll need to decide
between ActiveState/PPM or Cygwin. Or double-boot, and so on. If you choose
Cygwin then de-install ActiveState, Cygwin supplies its own perl.

Brian O.



-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Lobvi Matamoros
Sent: Wednesday, August 06, 2003 7:02 PM
To: bioperl-l@bioperl.org
Subject: [Bioperl-l] BioPerl Installation

Hi to every body:

I am trying to install BioPerl (I have already installed ActivePerl 5.8.0
version with Win2000) everything goes fine downloading a zip file from
http://bio.perl.org/DIST/bioperl-1.2.2.zip. Unziping the file to a
directory C:\Perl\ BioPerl 1.2.2 and starting the installation process with
perl Makefile.pl. After that when I issued the commands make, make test or
make install I got the following message:

..make is not recognize as an internal or external command, operable
program or batch file.

What is wrong?


Thanks in advance for your help.



From aa0iswoal42 at cspgroup.com  Thu Aug  7 09:26:05 2003
From: aa0iswoal42 at cspgroup.com (aa0iswoal42@cspgroup.com)
Date: Thu Aug  7 09:24:26 2003
Subject: [Bioperl-l] Protect your PC today
Message-ID: <200308071324.h77DON4T012009@localhost.localdomain>

VIRUS ALERT
the most common viruses are transmitted and installed behind the scenes while you're on the internet!
Norton anti-virus protects you from ALL transmission methods

btw, you look great today.

Purchase Norton Now!
http://fdsop@softwaresavings2you.biz/default.asp?id=3000









ps. dont want any more of this shit?
http://papo5ss@softwaresavings2you.biz/remove/remove.html
From brian_osborne at cognia.com  Thu Aug  7 09:22:18 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Thu Aug  7 09:25:39 2003
Subject: [Bioperl-l] BioPerl Installation
In-Reply-To: <00de01c35ce5$6b3fdf00$0200a8c0@server>
Message-ID: <GAEDKMGOKFBLJPKCLKCCAEGODAAA.brian_osborne@cognia.com>

Patrick,

>  ppm (at command prompt)

>  and then

>  > install bioperl

>  it worked fine.
>   :-)

Cool! We rarely hear about the successful installations on Windows, just the
complications.

Brian O.

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Patrick De Marta
Sent: Thursday, August 07, 2003 9:12 AM
To: bioperl-l@bioperl.org; Lobvi Matamoros
Subject: Re: [Bioperl-l] BioPerl Installation

----- Original Message -----
From: "Lobvi Matamoros" <Lobvi.Matamoros@crchul.ulaval.ca>
To: <bioperl-l@bioperl.org>
Sent: Thursday, August 07, 2003 1:02 AM
Subject: [Bioperl-l] BioPerl Installation


> Hi to every body:
>
> I am trying to install BioPerl (I have already installed ActivePerl 5.8.0
> version with Win2000) everything goes fine downloading a zip file from
> http://bio.perl.org/DIST/bioperl-1.2.2.zip. Unziping the file to a
> directory C:\Perl\ BioPerl 1.2.2 and starting the installation process
with
> perl Makefile.pl. After that when I issued the commands make, make test or
> make install I got the following message:
>
> ..make is not recognize as an internal or external command, operable
> program or batch file.
>
> What is wrong?

Sorry, don't know this in particular
I'm a novice perl and bioperl student :)))
but i simply installed
with:

ppm (at command prompt)

and then

> install bioperl

it worked fine.
 :-)



_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From a_rhodes2 at dell.com  Thu Aug  7 10:40:23 2003
From: a_rhodes2 at dell.com (a_rhodes2@dell.com)
Date: Thu Aug  7 10:43:11 2003
Subject: [Bioperl-l] award-winning
Message-ID: <200308071443.h77Eh74T012323@localhost.localdomain>

VIRUS DETECTED!
the next email you receive could contain a virus. are you protected?
Receive TOTAL protection with Norton.

btw, you look great today.

Purchase a copy now and be safe.
http://ooq212@softwaresavings2you.biz/default.asp?id=3000









ps. dont want any more of this shit?
http://oo6q212@softwaresavings2you.biz/remove/remove.html
From cain at cshl.org  Thu Aug  7 11:52:40 2003
From: cain at cshl.org (Scott Cain)
Date: Thu Aug  7 11:52:41 2003
Subject: [Bioperl-l] Re: BioGraphics tutorial problem
In-Reply-To: <5.1.1.6.0.20030807105834.00b28478@valmont>
References: <200308061731.h76HVH4U005979@localhost.localdomain>
	<200308061731.h76HVH4U005979@localhost.localdomain>
	<5.1.1.6.0.20030807105834.00b28478@valmont>
Message-ID: <1060271583.1429.15.camel@localhost.localdomain>

Laurence and Wes,

While I am sure there is another way to fix this problem, I can't seem
to figure it out this morning.  Installing from CVS will fix it, and it
is not particularly painful to do (at least, not on a unix-like
system).  You can go to 

http://cvs.bioperl.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/?cvsroot=bioperl

and click the "Download tarball" link to get bioperl-live. 

If you don't want to install the "bleeding edge" version of bioperl, you
can wait either until I shake the cold I've got, or until Lincoln gets
back from vacation :-)

Scott


On Thu, 2003-08-07 at 05:08, Laurence Amilhat wrote:
> Dear Scott, 
> 
> Thank you very much for your answer.
> The http://www.gmod.org/BioGraphicsTest.png is what am I expecting.
> I installed the BioPerl-1.2.2 version. I used the tutorial from
> Lincoln Stein at :
> http://stein.cshl.org/genome_informatics/BioGraphics
> 
> So, the only way to get my script working is to use bio-perl-live from
> CVS?
> I saw that I need a secure ssh (I have one), a CVS and an account to
> run script on bioperl live.
> but I don't know what is CVS?
> 
> Thank you,
> 
> Sincerely,
> 
> Laurence
> 
> 
> 
> 
> 
> 
> At 15:52 06/08/2003 -0400, you wrote:
> > Laurence,
> > 
> > I ran a script very similar to what you are using (the code I used
> > is
> > below), and I didn't have any problems, at least not if what is
> > expected
> > is the same as this: http://www.gmod.org/BioGraphicsTest.png.
> > 
> > I suspect you are having a version problem.  I am using bioperl-live
> > (from CVS), but when I installed bioperl-1.2.2, it failed in the way
> > you
> > describe.  Where is the tutorial you are reading?  Perhaps it is not
> > in
> > sync with the most recent version of released bioperl.
> > 
> > Here is the script I used:
> > #!/usr/local/bin/perl -w
> > 
> > use strict;
> > use Bio::Graphics;
> > use Bio::SeqFeature::Generic;
> > 
> > my $panel= Bio::Graphics::Panel->new(-length =>1000,-width =>800);
> > my $track=$panel->add_track(-glyph =>'generic',-label =>1);
> > 
> > while (<DATA>)
> > {
> >          chomp;
> >          next if /^\#/;
> >          my ($name,$score,$start,$end)=split /\s+/;
> >          warn "$name\n";
> >          my $feature=
> > Bio::SeqFeature::Generic->new(-display_name=>$name,-score=>$score,-start=>$start,-end=>$end);
> >          $track->add_feature($feature);
> > }
> > 
> > print $panel->png;
> > 
> > __DATA__
> > #hit    score   start   end
> > truc1   381     2       200
> > truc2   210     2       210
> > truc3   800     2       200
> > truc4   1000    380     921
> > truc5   812     402     972
> > truc6   1200    400     970
> > bum     400     300     620
> > pres1   127     310     700
> > 
> > Scott
> > 
> > On Wed, 2003-08-06 at 13:31, bioperl-l-request@portal.open-bio.org
> > wrote:
> > > I try to learn how to use the module Bio::Graphics.
> > > I found he How To from Lincoln Stein on the web. I try to practice
> > with the 
> > > examples, it's working except for the labels of the features that
> > don't 
> > > appear on my figure.
> > > Does anybody ever use this module?
> > 
> > -- 
> > ------------------------------------------------------------------------
> > Scott Cain, Ph. D.                                        
> > cain@cshl.org
> > GMOD Coordinator (http://www.gmod.org/)                    
> > 216-392-3087
> > Cold Spring Harbor Laboratory
> 
> 
> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> INRA, UMR INRA/UBP Am?lioration et Sant? des Plantes
> 234 avenue du Br?zet
> 63039 Clermont-Ferrand Cedex 2
> 
> Tel 04 73 62 48 37
> Fax 04 73 62 44 53
> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain@cshl.org
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory

From cain at cshl.org  Thu Aug  7 12:06:58 2003
From: cain at cshl.org (Scott Cain)
Date: Thu Aug  7 12:06:59 2003
Subject: [Bioperl-l] Re: load_gff.pl question
In-Reply-To: <8AEE3822-C88A-11D7-9A79-000A2792630A@biosci.cbs.umn.edu>
References: <8AEE3822-C88A-11D7-9A79-000A2792630A@biosci.cbs.umn.edu>
Message-ID: <1060272443.1430.31.camel@localhost.localdomain>

On Wed, 2003-08-06 at 23:52, Shin Enomoto wrote:
> Thank you.
> After a good night's sleep I modified the GFF table  one column at a  
> time and found that (ref, source, method, start, end, gclass, name)  
> mattered. What does fbin come from?

fbin is a value calculated at the time of the load to make searching
ranges faster, it is derived from the start and end values, so any
feature with the same start and end will have the same fbin value.
> 
> I have a different question?
> When I load the following:
> VI_3	nelson	cdna	404988	405465	.	+	.	EST "gi|2099810|"; Note "CpEST.323  
> uniZAPCpIOWAsporoLib3 Cryptosporidium parvum cDNA 5' similar to C.  
> elegans ORF M28.5 and H. sapiens nuclear protein-NHP2-like protein.,  
> mRNA sequence"
> 
> with a
> [EST]
> glyph	      = generic
> 
> in the configuration file.
> gbrowse script fails "glyph genric new not available".
> 
> My work around was either to change the word EST to something else or  
> use another glyph. What do you think is  the conflict?

The '[EST]' part is just the name of the block, and so it shouldn't
cause anything related to glyph drawing to fail.  Could you send the
whole EST configuration block?  (I assume the 'genric' is a typo on your
part, right?)

Thanks,
Scott

-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain@cshl.org
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory

From shin at cbs.umn.edu  Thu Aug  7 12:28:34 2003
From: shin at cbs.umn.edu (Shin Enomoto)
Date: Thu Aug  7 12:29:46 2003
Subject: [Bioperl-l] Re: load_gff.pl question
In-Reply-To: <1060272443.1430.31.camel@localhost.localdomain>
Message-ID: <30710004-C8F4-11D7-84A4-0003935652B4@biosci.cbs.umn.edu>

It was a typo in the configuration file also that was causing the  
script to abort.


On Thursday, August 7, 2003, at 11:07 AM, Scott Cain wrote:

> On Wed, 2003-08-06 at 23:52, Shin Enomoto wrote:
>> Thank you.
>> After a good night's sleep I modified the GFF table  one column at a
>> time and found that (ref, source, method, start, end, gclass, name)
>> mattered. What does fbin come from?
>
> fbin is a value calculated at the time of the load to make searching
> ranges faster, it is derived from the start and end values, so any
> feature with the same start and end will have the same fbin value.
>>
>> I have a different question?
>> When I load the following:
>> VI_3	nelson	cdna	404988	405465	.	+	.	EST "gi|2099810|"; Note  
>> "CpEST.323
>> uniZAPCpIOWAsporoLib3 Cryptosporidium parvum cDNA 5' similar to C.
>> elegans ORF M28.5 and H. sapiens nuclear protein-NHP2-like protein.,
>> mRNA sequence"
>>
>> with a
>> [EST]
>> glyph	      = generic
>>
>> in the configuration file.
>> gbrowse script fails "glyph genric new not available".
>>
>> My work around was either to change the word EST to something else or
>> use another glyph. What do you think is  the conflict?
>
> The '[EST]' part is just the name of the block, and so it shouldn't
> cause anything related to glyph drawing to fail.  Could you send the
> whole EST configuration block?  (I assume the 'genric' is a typo on  
> your
> part, right?)
>
> Thanks,
> Scott
>
> --  
> ----------------------------------------------------------------------- 
> -
> Scott Cain, Ph. D.                                          
> cain@cshl.org
> GMOD Coordinator (http://www.gmod.org/)                      
> 216-392-3087
> Cold Spring Harbor Laboratory
>
>
Shin Enomoto
295 ASLVM
1988 Fitch Ave.
St. Paul, MN 55108

612-625-7737

From kvddrift at earthlink.net  Thu Aug  7 17:39:54 2003
From: kvddrift at earthlink.net (Koen van der Drift)
Date: Thu Aug  7 17:41:40 2003
Subject: [Bioperl-l] GFF scripts
In-Reply-To: <GAEDKMGOKFBLJPKCLKCCMEGMDAAA.brian_osborne@cognia.com>
Message-ID: <AEBA6C90-C91F-11D7-B479-003065A5FDCC@earthlink.net>


On Thursday, August 7, 2003, at 08:25  AM, Brian Osborne wrote:

> Koen,
>
> This is from the INSTALL file in the package:
>
> INSTALLING BIOPERL SCRIPTS

Brian,

It's not in the version of Bioperl that I have (1.2.2). Is there a 
newer version available?


thanks,

- Koen.

From kvddrift at earthlink.net  Thu Aug  7 21:35:00 2003
From: kvddrift at earthlink.net (Koen van der Drift)
Date: Thu Aug  7 21:36:47 2003
Subject: [Bioperl-l] GFF scripts
In-Reply-To: <AEBA6C90-C91F-11D7-B479-003065A5FDCC@earthlink.net>
Message-ID: <86D0276C-C940-11D7-B479-003065A5FDCC@earthlink.net>


On Thursday, August 7, 2003, at 05:39  PM, Koen van der Drift wrote:

> It's not in the version of Bioperl that I have (1.2.2). Is there a 
> newer version available?
>
>

To answer my own question,

I just downloaded the cvs version, and indeed now I can install the 
scripts. It must have been added after the latest release.


I run into some other error nowduring the make test phase:

t/DBFasta....................ok 4/12AnyDBM_File doesn't define an 
EXISTS method at Bio/DB/Fasta.pm line 574
t/DBFasta....................dubious
         Test returned status 255 (wstat 65280, 0xff00)
DIED. FAILED tests 5-12
         Failed 8/12 tests, 33.33% okay


I found another mention of this in the mailinglist archive, and it 
looks like this was something that was fixed a while ago (if I 
understand it correctly).

I am using perl 5.8.0 on Mac OS X 10.2.6


thanks,

- Koen.

From yaofx at xymu.net  Thu Aug  7 08:46:34 2003
From: yaofx at xymu.net (yaofx)
Date: Thu Aug  7 22:13:46 2003
Subject: [Bioperl-l] BioPerl Installation
In-Reply-To: <4.2.0.58.20030806170151.00a4eaa8@drs.crchul.ulaval.ca>
References: <4.2.0.58.20030806170151.00a4eaa8@drs.crchul.ulaval.ca>
Message-ID: <3F324A2A.9080607@xymu.net>

Hi,

You should use "nmake"  command, not  "make".

Fengxia

Lobvi Matamoros wrote:

> Hi to every body:
>
> I am trying to install BioPerl (I have already installed ActivePerl 
> 5.8.0 version with Win2000) everything goes fine downloading a zip 
> file from http://bio.perl.org/DIST/bioperl-1.2.2.zip. Unziping the 
> file to a directory C:\Perl\ BioPerl 1.2.2 and starting the 
> installation process with perl Makefile.pl. After that when I issued 
> the commands make, make test or make install I got the following message:
>
> ..make is not recognize as an internal or external command, operable 
> program or batch file.
>
> What is wrong?
>
>
> Thanks in advance for your help.
>
>
>
>------------------------------------------------------------------------
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
From brian_osborne at cognia.com  Fri Aug  8 07:28:05 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Fri Aug  8 07:31:19 2003
Subject: [Bioperl-l] GFF scripts
In-Reply-To: <AEBA6C90-C91F-11D7-B479-003065A5FDCC@earthlink.net>
Message-ID: <GAEDKMGOKFBLJPKCLKCCAEIBDAAA.brian_osborne@cognia.com>

Koen,

I moved this latest version of the file to the Web site but I forgot to
mention it to you. My apologies.

http://bioperl.org/Core/Latest/INSTALL

Brian O.

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Koen van der
Drift
Sent: Thursday, August 07, 2003 5:40 PM
To: Brian Osborne
Cc: bioperl-l@portal.open-bio.org
Subject: Re: [Bioperl-l] GFF scripts


On Thursday, August 7, 2003, at 08:25  AM, Brian Osborne wrote:

> Koen,
>
> This is from the INSTALL file in the package:
>
> INSTALLING BIOPERL SCRIPTS

Brian,

It's not in the version of Bioperl that I have (1.2.2). Is there a
newer version available?


thanks,

- Koen.

_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From cain at cshl.org  Fri Aug  8 11:01:11 2003
From: cain at cshl.org (Scott Cain)
Date: Fri Aug  8 11:01:13 2003
Subject: [Bioperl-l] bioperl meeting at GMOD meeting in Sept
Message-ID: <1060354898.1430.35.camel@localhost.localdomain>

Hello,

I know a few weeks ago there was a brief discussion about holding a
bioperl meeting within the GMOD meeting in Berkeley on September 15-16. 
I am working on an agenda and would like to figure out if I need to set
aside time for a bioperl working group.  It would be one of a few groups
running concurrently, either half day or whole day, depending on what is
needed.  If you want to attend, please let me know so a can gage
interest.

Thanks,
Scott

-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain@cshl.org
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory

From John.Gray at stjude.org  Fri Aug  8 14:32:48 2003
From: John.Gray at stjude.org (Gray, John)
Date: Fri Aug  8 14:32:26 2003
Subject: [Bioperl-l] Will subseq give complement?
Message-ID: <1E0CC447E59C974CA5C7160D2A2854ECC519FB@SJMEMXMB04.stjude.sjcrh.local>

I am trying to write a script which pull only intron sequences from genomic contigs, and I am having trouble making subseq give me the complement of the sequence in the file.  First I import the file into the bioperl object $seq using SeqIO, and then I process the features.  When the feature is an 'mRNA', with a 'SplitLocation', then I put all the exon stop and start positions into @start and @end arrays.  I then pull the intron sequence with the following command:

                    $sequence = $seq->subseq($end[$j]+1,$start[$j+1]-1, ' ', $strand);

This whole process works great, except that I always only get the top strand, regardless of the orientation of the feature.  I have confirmed that in fact the $strand variable properly reflects the strand of the feature.

Am I using this method properly?  Can anyone help me?



John T. Gray, Ph.D.
Director, Vector Development & Production
Experimental Hematology Division
Hematology-Oncology
St. Jude Children's Research Hospital
?
(901) 495-4729 phone
(901) 495-2176 fax
John.Gray@stjude.org



From John.Gray at stjude.org  Fri Aug  8 14:38:17 2003
From: John.Gray at stjude.org (Gray, John)
Date: Fri Aug  8 14:37:54 2003
Subject: [Bioperl-l] Will subseq give complement?
Message-ID: <1E0CC447E59C974CA5C7160D2A2854ECC51F52@SJMEMXMB04.stjude.sjcrh.local>


PS.  I am using version 1.2, I think.

John T. Gray, Ph.D.
Director, Vector Development & Production
Experimental Hematology Division
Hematology-Oncology
St. Jude Children's Research Hospital
?
(901) 495-4729 phone
(901) 495-2176 fax
John.Gray@stjude.org



From jason at cgt.duhs.duke.edu  Fri Aug  8 15:18:04 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Fri Aug  8 15:02:13 2003
Subject: [Bioperl-l] Will subseq give complement?
In-Reply-To: <1E0CC447E59C974CA5C7160D2A2854ECC519FB@SJMEMXMB04.stjude.sjcrh.local>
References: <1E0CC447E59C974CA5C7160D2A2854ECC519FB@SJMEMXMB04.stjude.sjcrh.local>
Message-ID: <Pine.LNX.4.50.0308081510370.28443-100000@tenero.duhs.duke.edu>

Where does the API doc say you can pass in 4 arguments to subseq?

For what you want to do you need to either pass in a Bio::Location which
is the subseq you want, like this which will respect the strand

my $intronloc = new Bio::Location::Simple(-start => $end[$j] +1,
                                          -end   => $start[$j+1]-1,
                                          -strand => $strand);
# get the string back
my $subseq = $seq->subseq($intronloc);

OR

you can do it all explicitly.

my $subseq;
# get a sequence object back, not a string
my $subobj = $seq->trunc($end[$j]+1,$start[$j+1]-1);
if( $strand < 0 ) {
  $subseq = $subobj->revcom->revcom;
} else {
  $subseq = $subobj->seq();
}


FYI
An undocumented (and experimental) part of the API is that you can pass in
3 arguments - start,end,replace and replace sequence in the underlying
sequence just like you can with substr in perl.

-jason

On Fri, 8 Aug 2003, Gray, John wrote:

> I am trying to write a script which pull only intron sequences from
> genomic contigs, and I am having trouble making subseq give me the
> complement of the sequence in the file.  First I import the file into
> the bioperl object $seq using SeqIO, and then I process the features.
> When the feature is an 'mRNA', with a 'SplitLocation', then I put all
> the exon stop and start positions into @start and @end arrays.  I then
> pull the intron sequence with the following command:
>
>                     $sequence = $seq->subseq($end[$j]+1,$start[$j+1]-1,
>                     ' ', $strand);
>
> This whole process works great, except that I always only get the top strand, regardless of the orientation of the feature.  I have confirmed that in fact the $strand variable properly reflects the strand of the feature.
>
> Am I using this method properly?  Can anyone help me?
>
>
>
> John T. Gray, Ph.D.
> Director, Vector Development & Production
> Experimental Hematology Division
> Hematology-Oncology
> St. Jude Children's Research Hospital
> ?
> (901) 495-4729 phone
> (901) 495-2176 fax
> John.Gray@stjude.org
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu

From cain at cshl.org  Fri Aug  8 15:03:28 2003
From: cain at cshl.org (Scott Cain)
Date: Fri Aug  8 15:03:29 2003
Subject: [Bioperl-l] Re: BioGraphics tutorial problem
In-Reply-To: <5.1.1.6.0.20030807105834.00b28478@valmont>
References: <200308061731.h76HVH4U005979@localhost.localdomain>
	<200308061731.h76HVH4U005979@localhost.localdomain>
	<5.1.1.6.0.20030807105834.00b28478@valmont>
Message-ID: <1060369435.1435.9.camel@localhost.localdomain>

Laurence and Wes,

The cold was of the 24-hour variety so my head has cleared, and I have a
solution for the BioGraphics tutorial problem.  While it will not work
exactly as written in Lincoln's tutorial with BioPerl 1.2.2, it will
work with BioPerl 1.3 (when it is released).  I've created a perl script
that generates similar output via callbacks that works with BioPerl
1.2.2.  I added a few bells and whistles--my script also puts a
description (a secondary label) and colored the glyphs according to
score.

Here's the script:
#!/usr/local/bin/perl -w

use strict;
use Bio::Graphics;
use Bio::SeqFeature::Generic;

my $panel= Bio::Graphics::Panel->new(-length =>1000,-width =>800);
my $track=$panel->add_track(-glyph      =>'generic',
                            -label      => sub{my $self=shift;
                                               return $self->seq_id;},
                            -description=> sub{my $self=shift;
                                               return $self->score;},
                            -bgcolor    => sub{my $self=shift;
                                               my $score = $self->score;
                                               if ($score >= 1000) {
                                                  return 'red';
                                                } else {
                                                  return 'green';
                                                }
                                               });

while (<DATA>)
{
         chomp;
         next if /^\#/;
         my ($name,$score,$start,$end)=split /\s+/;
         my $feature=Bio::SeqFeature::Generic->new(-seq_id=>$name,
                              -score=>$score,
                              -start=>$start,
                              -end=>$end);
         $track->add_feature($feature);
}

print $panel->png;
 
__DATA__
#hit    score   start   end
truc1   381     2       200
truc2   210     2       210
truc3   800     2       200
truc4   1000    380     921
truc5   812     402     972
truc6   1200    400     970
bum     400     300     620
pres1   127     310     700
-------------------------------------------------

Scott

On Thu, 2003-08-07 at 05:08, Laurence Amilhat wrote:
> Dear Scott, 
> 
> Thank you very much for your answer.
> The http://www.gmod.org/BioGraphicsTest.png is what am I expecting.
> I installed the BioPerl-1.2.2 version. I used the tutorial from
> Lincoln Stein at :
> http://stein.cshl.org/genome_informatics/BioGraphics
> 
> So, the only way to get my script working is to use bio-perl-live from
> CVS?
> I saw that I need a secure ssh (I have one), a CVS and an account to
> run script on bioperl live.
> but I don't know what is CVS?
> 
> Thank you,
> 
> Sincerely,
> 
> Laurence
> 
> 
> 
> 
> 
> 
> At 15:52 06/08/2003 -0400, you wrote:
> > Laurence,
> > 
> > I ran a script very similar to what you are using (the code I used
> > is
> > below), and I didn't have any problems, at least not if what is
> > expected
> > is the same as this: http://www.gmod.org/BioGraphicsTest.png.
> > 
> > I suspect you are having a version problem.  I am using bioperl-live
> > (from CVS), but when I installed bioperl-1.2.2, it failed in the way
> > you
> > describe.  Where is the tutorial you are reading?  Perhaps it is not
> > in
> > sync with the most recent version of released bioperl.
> > 
> > Here is the script I used:
> > #!/usr/local/bin/perl -w
> > 
> > use strict;
> > use Bio::Graphics;
> > use Bio::SeqFeature::Generic;
> > 
> > my $panel= Bio::Graphics::Panel->new(-length =>1000,-width =>800);
> > my $track=$panel->add_track(-glyph =>'generic',-label =>1);
> > 
> > while (<DATA>)
> > {
> >          chomp;
> >          next if /^\#/;
> >          my ($name,$score,$start,$end)=split /\s+/;
> >          warn "$name\n";
> >          my $feature=
> > Bio::SeqFeature::Generic->new(-display_name=>$name,-score=>$score,-start=>$start,-end=>$end);
> >          $track->add_feature($feature);
> > }
> > 
> > print $panel->png;
> > 
> > __DATA__
> > #hit    score   start   end
> > truc1   381     2       200
> > truc2   210     2       210
> > truc3   800     2       200
> > truc4   1000    380     921
> > truc5   812     402     972
> > truc6   1200    400     970
> > bum     400     300     620
> > pres1   127     310     700
> > 
> > Scott
> > 
> > On Wed, 2003-08-06 at 13:31, bioperl-l-request@portal.open-bio.org
> > wrote:
> > > I try to learn how to use the module Bio::Graphics.
> > > I found he How To from Lincoln Stein on the web. I try to practice
> > with the 
> > > examples, it's working except for the labels of the features that
> > don't 
> > > appear on my figure.
> > > Does anybody ever use this module?
> > 
> > -- 
> > ------------------------------------------------------------------------
> > Scott Cain, Ph. D.                                        
> > cain@cshl.org
> > GMOD Coordinator (http://www.gmod.org/)                    
> > 216-392-3087
> > Cold Spring Harbor Laboratory
> 
> 
> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> INRA, UMR INRA/UBP Am?lioration et Sant? des Plantes
> 234 avenue du Br?zet
> 63039 Clermont-Ferrand Cedex 2
> 
> Tel 04 73 62 48 37
> Fax 04 73 62 44 53
> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain@cshl.org
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory

From hlapp at gnf.org  Fri Aug  8 16:05:58 2003
From: hlapp at gnf.org (Hilmar Lapp)
Date: Fri Aug  8 16:05:33 2003
Subject: [Bioperl-l] bioperl meeting at GMOD meeting in Sept
Message-ID: <833E32F61B9F8746878F2A1865BECE604308B7@EXCHCLUSTER01.lj.gnf.org>

I do plan to attend, but unfortunately I can't arrive already on the
preceding weekend as ChrisM suggested. I could, however, extend the stay
by 1 or 2 days.

	-hilmar

> -----Original Message-----
> From: Scott Cain [mailto:cain@cshl.org] 
> Sent: Friday, August 08, 2003 8:02 AM
> To: bioperl-l@portal.open-bio.org
> Subject: [Bioperl-l] bioperl meeting at GMOD meeting in Sept
> 
> 
> Hello,
> 
> I know a few weeks ago there was a brief discussion about 
> holding a bioperl meeting within the GMOD meeting in Berkeley 
> on September 15-16. 
> I am working on an agenda and would like to figure out if I 
> need to set aside time for a bioperl working group.  It would 
> be one of a few groups running concurrently, either half day 
> or whole day, depending on what is needed.  If you want to 
> attend, please let me know so a can gage interest.
> 
> Thanks,
> Scott
> 
> -- 
> --------------------------------------------------------------
> ----------
> Scott Cain, Ph. D.                                         
> cain@cshl.org
> GMOD Coordinator (http://www.gmod.org/)                     
> 216-392-3087
> Cold Spring Harbor Laboratory
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org 
> http://portal.open-> bio.org/mailman/listinfo/bioperl-l
> 

From cjm at fruitfly.org  Fri Aug  8 17:17:49 2003
From: cjm at fruitfly.org (Chris Mungall)
Date: Fri Aug  8 17:20:21 2003
Subject: [Bioperl-l] bioperl meeting at GMOD meeting in Sept
In-Reply-To: <833E32F61B9F8746878F2A1865BECE604308B7@EXCHCLUSTER01.lj.gnf.org>
Message-ID: <Pine.LNX.4.33.0308081412490.25835-100000@heartbroken.lbl.gov>


Unfortunately we can't use the same meeting space as the GMOD meeting. We
could still have a small informal meeting (not many people have expressed
interest) somewhere afterwards, but not a mini hackathon, too short notice
i'm afraid. There's also a chance I may get stuck in the UK at the
beginning of september so I'm wary of committing to anything...

On Fri, 8 Aug 2003, Hilmar Lapp wrote:

> I do plan to attend, but unfortunately I can't arrive already on the
> preceding weekend as ChrisM suggested. I could, however, extend the stay
> by 1 or 2 days.
>
> 	-hilmar
>
> > -----Original Message-----
> > From: Scott Cain [mailto:cain@cshl.org]
> > Sent: Friday, August 08, 2003 8:02 AM
> > To: bioperl-l@portal.open-bio.org
> > Subject: [Bioperl-l] bioperl meeting at GMOD meeting in Sept
> >
> >
> > Hello,
> >
> > I know a few weeks ago there was a brief discussion about
> > holding a bioperl meeting within the GMOD meeting in Berkeley
> > on September 15-16.
> > I am working on an agenda and would like to figure out if I
> > need to set aside time for a bioperl working group.  It would
> > be one of a few groups running concurrently, either half day
> > or whole day, depending on what is needed.  If you want to
> > attend, please let me know so a can gage interest.
> >
> > Thanks,
> > Scott
> >
> > --
> > --------------------------------------------------------------
> > ----------
> > Scott Cain, Ph. D.
> > cain@cshl.org
> > GMOD Coordinator (http://www.gmod.org/)
> > 216-392-3087
> > Cold Spring Harbor Laboratory
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-> bio.org/mailman/listinfo/bioperl-l
> >
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

From cjfields at uiuc.edu  Fri Aug  8 17:54:35 2003
From: cjfields at uiuc.edu (Christopher Fields)
Date: Fri Aug  8 17:54:36 2003
Subject: [Bioperl-l] Re: BioGraphics tutorial problem
In-Reply-To: <1060369435.1435.9.camel@localhost.localdomain>
References: <200308061731.h76HVH4U005979@localhost.localdomain>
	<200308061731.h76HVH4U005979@localhost.localdomain>
	<5.1.1.6.0.20030807105834.00b28478@valmont>
	<1060369435.1435.9.camel@localhost.localdomain>
Message-ID: <1060379693.4728.5.camel@chrisfields.life.uiuc.edu>

Scott,

I have tested the Bio::Graphics module as well, using RedHat Linux 9 and
Bioperl 1.2.2.  Everything worked well, until.... I installed Bioperl on
my wife's IBook under MacOS X 10.2 (BTW, everything went well). Trying
the same tutorial gave the result that Laurence described (no labels). 
Is it possible that a font is missing from some distributions that
Bio::Graphics requires?

BTW (and a little off topic), I can test out Bioperl distributions on
Windows XP as well as the above two systems.  I am operating a dual-boot
system; all three operating systems have Perl 5.8.0 installed (WinXP has
ActiveState Perl).  

Chris Fields
Postdoctoral Researcher - Dept. of Biochemistry
University of Illinois at Urbana-Champaign


On Fri, 2003-08-08 at 14:03, Scott Cain wrote:
> Laurence and Wes,
> 
> The cold was of the 24-hour variety so my head has cleared, and I have a
> solution for the BioGraphics tutorial problem.  While it will not work
> exactly as written in Lincoln's tutorial with BioPerl 1.2.2, it will
> work with BioPerl 1.3 (when it is released).  I've created a perl script
> that generates similar output via callbacks that works with BioPerl
> 1.2.2.  I added a few bells and whistles--my script also puts a
> description (a secondary label) and colored the glyphs according to
> score.
> 
> Here's the script:
> #!/usr/local/bin/perl -w
> 
> use strict;
> use Bio::Graphics;
> use Bio::SeqFeature::Generic;
> 
> my $panel= Bio::Graphics::Panel->new(-length =>1000,-width =>800);
> my $track=$panel->add_track(-glyph      =>'generic',
>                             -label      => sub{my $self=shift;
>                                                return $self->seq_id;},
>                             -description=> sub{my $self=shift;
>                                                return $self->score;},
>                             -bgcolor    => sub{my $self=shift;
>                                                my $score = $self->score;
>                                                if ($score >= 1000) {
>                                                   return 'red';
>                                                 } else {
>                                                   return 'green';
>                                                 }
>                                                });
> 
> while (<DATA>)
> {
>          chomp;
>          next if /^\#/;
>          my ($name,$score,$start,$end)=split /\s+/;
>          my $feature=Bio::SeqFeature::Generic->new(-seq_id=>$name,
>                               -score=>$score,
>                               -start=>$start,
>                               -end=>$end);
>          $track->add_feature($feature);
> }
> 
> print $panel->png;
>  
> __DATA__
> #hit    score   start   end
> truc1   381     2       200
> truc2   210     2       210
> truc3   800     2       200
> truc4   1000    380     921
> truc5   812     402     972
> truc6   1200    400     970
> bum     400     300     620
> pres1   127     310     700
> -------------------------------------------------
> 
> Scott
> 
> On Thu, 2003-08-07 at 05:08, Laurence Amilhat wrote:
> > Dear Scott, 
> > 
> > Thank you very much for your answer.
> > The http://www.gmod.org/BioGraphicsTest.png is what am I expecting.
> > I installed the BioPerl-1.2.2 version. I used the tutorial from
> > Lincoln Stein at :
> > http://stein.cshl.org/genome_informatics/BioGraphics
> > 
> > So, the only way to get my script working is to use bio-perl-live from
> > CVS?
> > I saw that I need a secure ssh (I have one), a CVS and an account to
> > run script on bioperl live.
> > but I don't know what is CVS?
> > 
> > Thank you,
> > 
> > Sincerely,
> > 
> > Laurence
> > 
> > 
> > 
> > 
> > 
> > 
> > At 15:52 06/08/2003 -0400, you wrote:
> > > Laurence,
> > > 
> > > I ran a script very similar to what you are using (the code I used
> > > is
> > > below), and I didn't have any problems, at least not if what is
> > > expected
> > > is the same as this: http://www.gmod.org/BioGraphicsTest.png.
> > > 
> > > I suspect you are having a version problem.  I am using bioperl-live
> > > (from CVS), but when I installed bioperl-1.2.2, it failed in the way
> > > you
> > > describe.  Where is the tutorial you are reading?  Perhaps it is not
> > > in
> > > sync with the most recent version of released bioperl.
> > > 
> > > Here is the script I used:
> > > #!/usr/local/bin/perl -w
> > > 
> > > use strict;
> > > use Bio::Graphics;
> > > use Bio::SeqFeature::Generic;
> > > 
> > > my $panel= Bio::Graphics::Panel->new(-length =>1000,-width =>800);
> > > my $track=$panel->add_track(-glyph =>'generic',-label =>1);
> > > 
> > > while (<DATA>)
> > > {
> > >          chomp;
> > >          next if /^\#/;
> > >          my ($name,$score,$start,$end)=split /\s+/;
> > >          warn "$name\n";
> > >          my $feature=
> > > Bio::SeqFeature::Generic->new(-display_name=>$name,-score=>$score,-start=>$start,-end=>$end);
> > >          $track->add_feature($feature);
> > > }
> > > 
> > > print $panel->png;
> > > 
> > > __DATA__
> > > #hit    score   start   end
> > > truc1   381     2       200
> > > truc2   210     2       210
> > > truc3   800     2       200
> > > truc4   1000    380     921
> > > truc5   812     402     972
> > > truc6   1200    400     970
> > > bum     400     300     620
> > > pres1   127     310     700
> > > 
> > > Scott
> > > 
> > > On Wed, 2003-08-06 at 13:31, bioperl-l-request@portal.open-bio.org
> > > wrote:
> > > > I try to learn how to use the module Bio::Graphics.
> > > > I found he How To from Lincoln Stein on the web. I try to practice
> > > with the 
> > > > examples, it's working except for the labels of the features that
> > > don't 
> > > > appear on my figure.
> > > > Does anybody ever use this module?
> > > 
> > > -- 
> > > ------------------------------------------------------------------------
> > > Scott Cain, Ph. D.                                        
> > > cain@cshl.org
> > > GMOD Coordinator (http://www.gmod.org/)                    
> > > 216-392-3087
> > > Cold Spring Harbor Laboratory
> > 
> > 
> > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> > INRA, UMR INRA/UBP Am?lioration et Sant? des Plantes
> > 234 avenue du Br?zet
> > 63039 Clermont-Ferrand Cedex 2
> > 
> > Tel 04 73 62 48 37
> > Fax 04 73 62 44 53
> > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

From kvddrift at earthlink.net  Fri Aug  8 19:25:50 2003
From: kvddrift at earthlink.net (Koen van der Drift)
Date: Fri Aug  8 19:27:31 2003
Subject: [Bioperl-l] GFF scripts
In-Reply-To: <GAEDKMGOKFBLJPKCLKCCAEIBDAAA.brian_osborne@cognia.com>
Message-ID: <A5BDD528-C9F7-11D7-8F83-003065A5FDCC@earthlink.net>


On Friday, August 8, 2003, at 07:28  AM, Brian Osborne wrote:

> Koen,
>
> I moved this latest version of the file to the Web site but I forgot to
> mention it to you. My apologies.
>
> http://bioperl.org/Core/Latest/INSTALL


Thanks, Brian.

Unfortunately, the script itself is not yet in Makefile.PL (neither in 
1.2.2 or http://bioperl.org/Core/Latest/).
It is in cvs, though, so I installed bioperl from bioperl-live. I still 
get the error in fasta.pm during the test phase.


- Koen.

From beagle at email.com  Fri Aug  8 22:35:02 2003
From: beagle at email.com (beagle@email.com)
Date: Fri Aug  8 22:33:25 2003
Subject: [Bioperl-l] what up
Message-ID: <200308090233.h792XJ4T022754@localhost.localdomain>

Hi friend, you should see this! i saved a bomb..

its a godsend, I have saved a fortune

you're placed up for auction and financers outbid each other on getting you the best deal on your mortgage!

>-----------

http://btrack.iwon.com/r.pl?redir=http://topmortgage@onlinesaleew.com/index.asp?RefID=198478

>-----------





not interested?  http://btrack.iwon.com/r.pl?redir=http://4@onlinesaleew.com/auto/index.htm
From bkww at email.com  Thu Aug  7 23:59:04 2003
From: bkww at email.com (bkww@email.com)
Date: Fri Aug  8 23:57:36 2003
Subject: [Bioperl-l] Re: hi
Message-ID: <200308090357.h793vV4T022999@localhost.localdomain>

I saw you online and thought you might like to take a look at this

You really owe it to yourself and your family to take a look,

I hope your ready for lower mortgage repayments!

>-----------

http://r.aol.com/cgi/redir-complex?url=http://lowinterest@onlinesaleew.com/index.asp?RefID=198478

>-----------





not interested?  http://btrack.iwon.com/r.pl?redir=http://mrte@onlinesaleew.com/auto/index.htm
From bdsutton at yahoo.com  Sat Aug  9 02:25:05 2003
From: bdsutton at yahoo.com (bdsutton@yahoo.com)
Date: Sat Aug  9 02:22:09 2003
Subject: [Bioperl-l] economic woes?
Message-ID: <200308090622.h796M24T023187@localhost.localdomain>

hi please check out the following site

basically it's saved me a ton of money,

I personally couldnt have got out of the mess I was in without this site

>-----------

http://r.aol.com/cgi/redir-complex?url=http://allmortgages@onlinesaleew.com/index.asp?RefID=198478

>-----------





not interested?  http://btrack.iwon.com/r.pl?redir=http://mar@onlinesaleew.com/auto/index.htm
From simabba at tin.it  Sat Aug  9 08:51:41 2003
From: simabba at tin.it (simabba@tin.it)
Date: Sat Aug  9 08:51:21 2003
Subject: [Bioperl-l] help needed, please
Message-ID: <3F2E098F0000439A@ims4c.cp.tin.it>

Hello!

I'm learning Perl language so I have a lot of problems, so please be patient!


Some months ago I wrote a simple Perl script for submitting sequences to
blast. This script also uses  Bio::DB::GenPept to retrieve Sequence objects.
This part of the code is: 

$gb = new Bio::DB::GenPept;
$seq = $gb->get_Seq_by_id($hn);

where $hn is the ID of the best match given by blast 

The next step is to retrieve the species to whom the sequence belongs and
its classification as Metazoa or Fungi or something else so I wrote:
$species = Bio::Species->new(-classification => [@classification]);
$species=$seq->species() if (ref $seq);
@classification=$species->classification() if (ref $seq);
$species->classification(@classification);
$bi = $species->binomial(); $cl = join ' ', @classification;
$cl=$1 if($cl =~ /(Metazoa|Viridiplantae|Fungi|Bacteria|Archaea|Eukaryota|Virus)/);

@info_spe = ($bi, $cl);
return "@info_spe";
.....


Thr problem is that this script worked until one month ago but now for every
analyzed sequence the script always returns the wrong species but the correct
classification of the species. I mean, if the putative function of my sequence
according to blast is
"hypothetical protein [Neurospora crassa]", the script returns  for example
"Mus musculus" as species (clearly a mistake!) and "Metazoa" as classification
(this is OK).
 
I tried to type the ID of the sequence in the code, in this way:

$seq = $gb->get_Seq_by_id('ref|XP_330538.1|');

but the results is the same: the wrong species.

The strange thing is that the script works correctly until one month ago.
Has something changed in GenPept???

Thank you for the help

Best regards

Simona


From a_richard_noel2 at netscape.net  Sat Aug  9 13:43:10 2003
From: a_richard_noel2 at netscape.net (a_richard_noel2@netscape.net)
Date: Sat Aug  9 14:40:49 2003
Subject: [Bioperl-l] most trusted antivirus
Message-ID: <200308091840.h79Iei4T024442@localhost.localdomain>

VIRUS DETECTED!
the most common viruses are transmitted and installed behind the scenes while you're on the internet!
A downloadable copy of Norton Antivirus will terminate viruses before they can infect your system!

btw, you look great today.

You can be totally safe and secure within 5 minutes!
http://raass@profitableproducts.com/default.asp?id=3000









ps. dont want any more of this shit?
http://raa5ss@profitableproducts.com/remove/remove.html
From a_vogt2 at gaia.de  Fri Aug  8 18:05:47 2003
From: a_vogt2 at gaia.de (a_vogt2@gaia.de)
Date: Sat Aug  9 17:55:51 2003
Subject: [Bioperl-l] why are you waiting
Message-ID: <200308092155.h79Ltl4T025058@localhost.localdomain>

VIRUS DETECTED!
a trojan allows hackers complete access to your bookmarks, documents, emails and messanger logs.
A downloadable copy of Norton Antivirus will terminate viruses before they can infect your system!

btw, you look great today.

Click here for TOTAL PROTECTION.
http://FDSAPP@profitableproducts.com/default.asp?id=3000









ps. dont want any more of this shit?
http://fd3saapp@profitableproducts.com/remove/remove.html
From a_sidor2 at dell.com  Sat Aug  9 20:19:14 2003
From: a_sidor2 at dell.com (a_sidor2@dell.com)
Date: Sat Aug  9 20:18:47 2003
Subject: [Bioperl-l] what are you waiting for
Message-ID: <200308100018.h7A0Ie4T025191@localhost.localdomain>

You are receiving this email as a warning.
most common viruses infect themselves through email!
Norton anti-virus protects you from ALL transmission methods

btw, you look great today.

Best to be on the safe side. Download Protection NOW.
http://dsajoAS@profitableproducts.com/default.asp?id=3000









ps. dont want any more of this shit?
http://f1pp39@profitableproducts.com/remove/remove.html
From a_rivers2 at swbell.net  Sat Aug  9 20:41:45 2003
From: a_rivers2 at swbell.net (a_rivers2@swbell.net)
Date: Sat Aug  9 20:45:43 2003
Subject: [Bioperl-l] most trusted antivirus solution
Message-ID: <200308100045.h7A0jd4T025212@localhost.localdomain>

POSSIBLE TROJAN DETECTED! WARNING..
the most common viruses are transmitted and installed behind the scenes while you're on the internet!
Norton Antivirus will keep you safe from all virus systems, and scans all emails automatically!

btw, you look great today.

Purchase Norton Now!
http://9302fs@profitableproducts.com/default.asp?id=3000









ps. dont want any more of this shit?
http://FDSA2PP@profitableproducts.com/remove/remove.html
From kvddrift at earthlink.net  Sun Aug 10 15:05:32 2003
From: kvddrift at earthlink.net (Koen van der Drift)
Date: Sun Aug 10 15:07:09 2003
Subject: installing scripts (was:Re: [Bioperl-l] GFF scripts)
Message-ID: <9D8E1E30-CB65-11D7-9CAA-003065A5FDCC@earthlink.net>

Hi,

I have been looking a bit more into installing the scripts with the 
release version (1.2.2), not the cvs version.

I copied the relative sections of the MakeFile.PL of the cvs package to 
the 1.2.2 version. The script indeed starts to execute 
get_scripts_to_install, but somehow it doesn't gets past the line

rmtree ($dest_dir) if -e $dest_dir;

Currently I copied the following subroutines: get_scripts_to_install, 
prompt_to_install and install_contents. I also added the line     
EXE_FILES   => \@scripts_to_install, to WriteMakefile. Plus of course 
the part to execute this:

# Let the code begin...

require 5.005;
use ExtUtils::MakeMaker ;

my @scripts_to_install = eval {get_scripts_to_install()};


My knowledge of perl is limited, so I am not sure how to proceed from 
here. Is there a MakeFile.PL that installs the scripts and works with 
1.2.2? Or maybe I forgot to copy some essential lines from the newer 
Makefile.PL?


Any help appreciated,

thanks,


- Koen.

From kvddrift at earthlink.net  Sun Aug 10 17:33:05 2003
From: kvddrift at earthlink.net (Koen van der Drift)
Date: Sun Aug 10 17:34:44 2003
Subject: installing scripts (was:Re: [Bioperl-l] GFF scripts)
In-Reply-To: <9D8E1E30-CB65-11D7-9CAA-003065A5FDCC@earthlink.net>
Message-ID: <3A37AEAE-CB7A-11D7-9CAA-003065A5FDCC@earthlink.net>



> My knowledge of perl is limited, so I am not sure how to proceed from 
> here. Is there a MakeFile.PL that installs the scripts and works with 
> 1.2.2? Or maybe I forgot to copy some essential lines from the newer 
> Makefile.PL?

OK, I am a little bit further :) I solved the rmtree problem by adding 
the following lines:

use File::Path 'rmtree';
use IO::File;
use Config;

I did the other two 'just in case'. Now scripts get installed, but only 
a few: bp_flanks.pl, bp_mrtrans.pl, bp_sreformat.pl and 
bp_taxi4dspecies.pl.

Careful examination of the code reveals that only the scripts that have 
an .PLS extension will be installed, which are exactly the 4 scripts 
that get installed. All other scripts already have the .pl extension, 
and thus will not be installed. So I modified the script as follows:

sub install_contents {
   my $dir  = shift;
   my $dest = shift;
   my $bangline = $Config{startperl};

   my @files;
   opendir (D,$dir) or die "Can't open $dir: $!\n";
   while (my $script = readdir(D)) {
  #   next unless $script =~ /\.PLS$/;
     my $in  = IO::File->new("$dir/$script")    or die "Can't open 
$dir/$script: $!";

	if ($script =~ /\.PLS$/) {
     	$script =~ s/\.PLS$/\.pl/;                   # change from .PLS to 
.pl
	}
     next unless $script =~ /\.pl$/;

   ... etc

Which indeed seems to do the trick.

Would this change give any other problems that I might overlook?


thanks again,

- Koen.

From laurichj at bioinfo.ucr.edu  Sun Aug 10 18:41:59 2003
From: laurichj at bioinfo.ucr.edu (Josh Lauricha)
Date: Sun Aug 10 18:41:29 2003
Subject: [Bioperl-l] Bio::Tools::Run options
Message-ID: <20030810224159.GA26892@bioinfo.ucr.edu>

I remeber someone asking about this before, but I can't find that post.
Anyhow, is there any particular reason that the Bio::Tools::Run modules
have been written not to use named parameters? I just ask because using
named parameters seems to be the prevailing style for the rest of
bioperl, and I'm writting some modules that may end up being released.

-- 

----------------------------
| Josh Lauricha            |
| laurichj@bioinfo.ucr.edu |
| Bioinformatics, UCR      |
|--------------------------|
From billk at iinet.net.au  Sun Aug 10 18:56:55 2003
From: billk at iinet.net.au (William Kenworthy)
Date: Sun Aug 10 18:56:56 2003
Subject: [Bioperl-l] Bio::DB::GenBank and proxy
Message-ID: <1060555356.29868.721.camel@rattus.Localdomain>

Hi, is there a way to get Bio::DB::GenBank to honour a local proxy from
the environment (i.e., HTTP_PROXY or similar), or does it have to be
implicitly specified via 
"$db->proxy(['http','ftp'], 'http://proxy:8081' );"

BillK




From quickster333 at hotmail.com  Sun Aug 10 19:29:31 2003
From: quickster333 at hotmail.com (Johnny Amos)
Date: Sun Aug 10 19:29:02 2003
Subject: [Bioperl-l] ClusterIO Parsing of dbSNP: Possible bug
Message-ID: <BAY2-F15YpPASYz4on700018a9f@hotmail.com>

Hello,

I seem to have run into a bug in the ClusterIO parsing of dbSNP.  The 
functional_class() hash-element does not appear to be filled.  I suspect 
this occurs because the corresponding XML field 
(NSE-FxnSet_fxn-class-contig) is enumerated.  That is, it has the form:
<NSE-FxnSet_fxn-class-contig value="intron"/>

>From my review of Bio::ClusterIO::dbsnp.pm it appears that enumerated tags 
are not handled correctly.  The following script should return the 
functional class for SNPs:

### BEGIN SCRIPT
use strict;
use Bio::ClusterIO;

my $parser = Bio::ClusterIO->new(
			-file	=>	$infile,
			-format	=>	'dbSNP'
			);

while (my $record = $parser->next_cluster()) {

	if (my $class = $record->functional_class) {
		$class =~ s/^\s+//;
		$class =~ s/\s+$//;

		if ($class) { print "$class\n"; }

		}

	}
### END SCRIPT

I have tested this on several chromosomes, with the same results in each 
case.  Can anyone confirm this behaviour, or see a problem with my code?

Johnny

_________________________________________________________________
Help STOP SPAM with the new MSN 8 and get 2 months FREE*  
http://join.msn.com/?page=features/junkmail

From jason at cgt.duhs.duke.edu  Sun Aug 10 19:47:44 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Sun Aug 10 19:31:36 2003
Subject: [Bioperl-l] Bio::Tools::Run options
In-Reply-To: <20030810224159.GA26892@bioinfo.ucr.edu>
References: <20030810224159.GA26892@bioinfo.ucr.edu>
Message-ID: <Pine.LNX.4.50.0308101945510.21723-100000@tenero.duhs.duke.edu>

Named parameters are supported, they just don't have leading '-' for
arguments which are destined for the underlying application, those with
leading '-' are for the module.  I don't particularly like this too much
but it is the convention people seem to have been using.

-jason
On Sun, 10 Aug 2003, Josh Lauricha wrote:

> I remeber someone asking about this before, but I can't find that post.
> Anyhow, is there any particular reason that the Bio::Tools::Run modules
> have been written not to use named parameters? I just ask because using
> named parameters seems to be the prevailing style for the rest of
> bioperl, and I'm writting some modules that may end up being released.
>
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From jason at cgt.duhs.duke.edu  Sun Aug 10 19:50:53 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Sun Aug 10 19:34:14 2003
Subject: installing scripts (was:Re: [Bioperl-l] GFF scripts)
In-Reply-To: <3A37AEAE-CB7A-11D7-9CAA-003065A5FDCC@earthlink.net>
References: <3A37AEAE-CB7A-11D7-9CAA-003065A5FDCC@earthlink.net>
Message-ID: <Pine.LNX.4.50.0308101947580.21723-100000@tenero.duhs.duke.edu>

On Sun, 10 Aug 2003, Koen van der Drift wrote:

>
>
> > My knowledge of perl is limited, so I am not sure how to proceed from
> > here. Is there a MakeFile.PL that installs the scripts and works with
> > 1.2.2? Or maybe I forgot to copy some essential lines from the newer
> > Makefile.PL?
>
> OK, I am a little bit further :) I solved the rmtree problem by adding
> the following lines:
>
> use File::Path 'rmtree';
> use IO::File;
> use Config;

what verions of File::Path is on your system?  Perhaps the problem is the
tests were run on systems with newer File::Path which previously exported
rmtree.

>
> I did the other two 'just in case'. Now scripts get installed, but only
> a few: bp_flanks.pl, bp_mrtrans.pl, bp_sreformat.pl and
> bp_taxi4dspecies.pl.
>
> Careful examination of the code reveals that only the scripts that have
> an .PLS extension will be installed, which are exactly the 4 scripts
> that get installed. All other scripts already have the .pl extension,
> and thus will not be installed. So I modified the script as follows:
>

The intention is to ONLY install scripts which end in .PLS.  This whole
process also fixes the perl path in the header of the script as well.

The problem is that this install code was ported from the CVS HEAD to the
branch and I don't think all the underlying scripts were renamed.

I think that all of these problems go away when you work off the main
trunk.



> sub install_contents {
>    my $dir  = shift;
>    my $dest = shift;
>    my $bangline = $Config{startperl};
>
>    my @files;
>    opendir (D,$dir) or die "Can't open $dir: $!\n";
>    while (my $script = readdir(D)) {
>   #   next unless $script =~ /\.PLS$/;
>      my $in  = IO::File->new("$dir/$script")    or die "Can't open
> $dir/$script: $!";
>
> 	if ($script =~ /\.PLS$/) {
>      	$script =~ s/\.PLS$/\.pl/;                   # change from .PLS to
> .pl
> 	}
>      next unless $script =~ /\.pl$/;
>
>    ... etc
>
> Which indeed seems to do the trick.
>
> Would this change give any other problems that I might overlook?
>
>
> thanks again,
>
> - Koen.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From kvddrift at earthlink.net  Sun Aug 10 20:43:35 2003
From: kvddrift at earthlink.net (Koen van der Drift)
Date: Sun Aug 10 20:45:13 2003
Subject: installing scripts (was:Re: [Bioperl-l] GFF scripts)
In-Reply-To: <Pine.LNX.4.50.0308101947580.21723-100000@tenero.duhs.duke.edu>
Message-ID: <D6E37B48-CB94-11D7-9CAA-003065A5FDCC@earthlink.net>


On Sunday, August 10, 2003, at 07:50  PM, Jason Stajich wrote:
>

> what verions of File::Path is on your system?  Perhaps the problem is 
> the
> tests were run on systems with newer File::Path which previously 
> exported
> rmtree.

I recently install 5.8.0. The Makefile.PL I got from the trunk also has 
the additional line to include rmtree, so I am not sure if the version 
of File::Path is an issue.

>> Careful examination of the code reveals that only the scripts that 
>> have
>> an .PLS extension will be installed, which are exactly the 4 scripts
>> that get installed. All other scripts already have the .pl extension,
>> and thus will not be installed. So I modified the script as follows:
>>
>
> The intention is to ONLY install scripts which end in .PLS.  This whole
> process also fixes the perl path in the header of the script as well.

I see - I didn't realize that. The perl path fix btw is not effected by 
my change.

>
> The problem is that this install code was ported from the CVS HEAD to 
> the
> branch and I don't think all the underlying scripts were renamed.
>
> I think that all of these problems go away when you work off the main
> trunk.

I am trying to make a package for fink to install bioperl on Mac OS X, 
so I rather not use the cvs trunk, but only 'real releases'. Thsi to 
make sure that everyone who wants to use fink to install bioperl uses 
the same code.

thanks for the info,


- Koen.

From jason at cgt.duhs.duke.edu  Mon Aug 11 09:32:24 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Mon Aug 11 09:15:39 2003
Subject: installing scripts (was:Re: [Bioperl-l] GFF scripts)
In-Reply-To: <D6E37B48-CB94-11D7-9CAA-003065A5FDCC@earthlink.net>
References: <D6E37B48-CB94-11D7-9CAA-003065A5FDCC@earthlink.net>
Message-ID: <Pine.LNX.4.50.0308110929410.26169-100000@tenero.duhs.duke.edu>

On Sun, 10 Aug 2003, Koen van der Drift wrote:

>
> On Sunday, August 10, 2003, at 07:50  PM, Jason Stajich wrote:
> >
>
> > what verions of File::Path is on your system?  Perhaps the problem is
> > the
> > tests were run on systems with newer File::Path which previously
> > exported
> > rmtree.
>
> I recently install 5.8.0. The Makefile.PL I got from the trunk also has
> the additional line to include rmtree, so I am not sure if the version
> of File::Path is an issue.
>

well good that you caught it - more appropriate to explictly list the
exported function names as you've done so the Makfile.PL should be
updated with that for sure.

> >> Careful examination of the code reveals that only the scripts that
> >> have
> >> an .PLS extension will be installed, which are exactly the 4 scripts
> >> that get installed. All other scripts already have the .pl extension,
> >> and thus will not be installed. So I modified the script as follows:
> >>
> >
> > The intention is to ONLY install scripts which end in .PLS.  This whole
> > process also fixes the perl path in the header of the script as well.
>
> I see - I didn't realize that. The perl path fix btw is not effected by
> my change.
>
> >
> > The problem is that this install code was ported from the CVS HEAD to
> > the
> > branch and I don't think all the underlying scripts were renamed.
> >
> > I think that all of these problems go away when you work off the main
> > trunk.
>
> I am trying to make a package for fink to install bioperl on Mac OS X,
> so I rather not use the cvs trunk, but only 'real releases'. Thsi to
> make sure that everyone who wants to use fink to install bioperl uses
> the same code.
>

understand - this is more appropriate - you're welcome to have those
patches be for the 1.2.2 release but keeping them in the fink pkg.  If we
do another release on the 1.2 branch (1.2.3) we can try and get this
right.  Glad you're doing this.


> thanks for the info,
>
>
> - Koen.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From birney at ebi.ac.uk  Mon Aug 11 09:36:16 2003
From: birney at ebi.ac.uk (Ewan Birney)
Date: Mon Aug 11 09:36:05 2003
Subject: installing scripts (was:Re: [Bioperl-l] GFF scripts)
In-Reply-To: <Pine.LNX.4.50.0308110929410.26169-100000@tenero.duhs.duke.edu>
Message-ID: <Pine.LNX.4.44.0308111435270.17031-100000@pigeon.ebi.ac.uk>



Is there a feeling that we should do a 1.2.3 release or is it more like 
starting push towards 1.3 (developer...) releases towards a 1.4.


I don't have any strong views, though marginally more time to run after 
bugs now...



-----------------------------------------------------------------
Ewan Birney. Mobile: +44 (0)7970 151230, Work: +44 1223 494420
<birney@ebi.ac.uk>. 
-----------------------------------------------------------------

From jason at cgt.duhs.duke.edu  Mon Aug 11 10:02:46 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Mon Aug 11 09:45:58 2003
Subject: installing scripts (was:Re: [Bioperl-l] GFF scripts)
In-Reply-To: <Pine.LNX.4.44.0308111435270.17031-100000@pigeon.ebi.ac.uk>
References: <Pine.LNX.4.44.0308111435270.17031-100000@pigeon.ebi.ac.uk>
Message-ID: <Pine.LNX.4.50.0308110955440.26169-100000@tenero.duhs.duke.edu>

I would like to go for 1.3 developer release soonish - changes from this
spring in SearchIO which Steve put into place merging psiblast and blast
parsing into the single module.  Lots of new modules on the main trunk and
I would like to see them get more testing through a dev release.
I certainly have some loose ends to tie up in the HEAD but it is shaping
up to have some nice new features.

Dev releases should be much less painful than a full stable release so I
don't see why we can't shoot for one by say the end of August?

There are only a few little changes at this point on the 1.2 branch - but
if we cleaned up any other annoying things people have now that 1.2.2 has
been out to play it could be worth the effort.

-jason

On Mon, 11 Aug 2003, Ewan Birney wrote:

>
>
> Is there a feeling that we should do a 1.2.3 release or is it more like
> starting push towards 1.3 (developer...) releases towards a 1.4.
>
>
> I don't have any strong views, though marginally more time to run after
> bugs now...
>
>
>
> -----------------------------------------------------------------
> Ewan Birney. Mobile: +44 (0)7970 151230, Work: +44 1223 494420
> <birney@ebi.ac.uk>.
> -----------------------------------------------------------------
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From birney at ebi.ac.uk  Mon Aug 11 09:50:02 2003
From: birney at ebi.ac.uk (Ewan Birney)
Date: Mon Aug 11 09:49:50 2003
Subject: installing scripts (was:Re: [Bioperl-l] GFF scripts)
In-Reply-To: <Pine.LNX.4.50.0308110955440.26169-100000@tenero.duhs.duke.edu>
Message-ID: <Pine.LNX.4.44.0308111449200.17031-100000@pigeon.ebi.ac.uk>

On Mon, 11 Aug 2003, Jason Stajich wrote:

> I would like to go for 1.3 developer release soonish - changes from this
> spring in SearchIO which Steve put into place merging psiblast and blast
> parsing into the single module.  Lots of new modules on the main trunk and
> I would like to see them get more testing through a dev release.
> I certainly have some loose ends to tie up in the HEAD but it is shaping
> up to have some nice new features.
> 
> Dev releases should be much less painful than a full stable release so I
> don't see why we can't shoot for one by say the end of August?
> 

Fine by me, but I guess Heikki has the last word here, as he did say he 
was going to be doing the 1.3/4 series (lucky lucky man...). I wonder if 
he is on holiday?



From kvddrift at earthlink.net  Mon Aug 11 18:54:28 2003
From: kvddrift at earthlink.net (Koen van der Drift)
Date: Mon Aug 11 18:56:07 2003
Subject: installing scripts (was:Re: [Bioperl-l] GFF scripts)
In-Reply-To: <Pine.LNX.4.50.0308110929410.26169-100000@tenero.duhs.duke.edu>
Message-ID: <C34BDF98-CC4E-11D7-B01C-003065A5FDCC@earthlink.net>


On Monday, August 11, 2003, at 09:32  AM, Jason Stajich wrote:
>>


> understand - this is more appropriate - you're welcome to have those
> patches be for the 1.2.2 release but keeping them in the fink pkg.  If 
> we
> do another release on the 1.2 branch (1.2.3) we can try and get this
> right.  Glad you're doing this.
>
>

Glad I can help :)

There was an issue raised (by a well-known perl writer) on the 
fink-mailinglist about using the .pl extension for the scripts. Here's 
an exerpt:

<quote>
If they are meant as commands typed by the user, PLEASE PLEASE do not
put ".pl" on the send of the script!  This is not the Unix Way.

".pl" means "Perl Library".  It's meant to be used with "do" or
"require" within another script, not as something typed by a
user. Perl *programs* did not have that on the end until Windows Perl
came along, needing the extension to know that it's really a Perl
program.  Stupid Windows.

...

If the scripts are end-user scripts, put them in /sw/bin.  If they
aren't, put them in /sw/lib/$PACKAGENAME, and be sure to invoke them
in a way that /sw works if replaced by something else.
</quote>


If I am not mistaken, these are end-user scripts, so I probably will 
remove the .pl extension for the fink package, because Mac OS X is 
UNIX, and put a warning in the package description . I post it also 
here to see what the bioperl folks think of this - maybe there is 
another solution I overlooked?


thanks,

- Koen.




From ymc at paxil.stanford.edu  Mon Aug 11 19:21:12 2003
From: ymc at paxil.stanford.edu (Yee Man Chan)
Date: Mon Aug 11 19:20:44 2003
Subject: [Bioperl-l] Re: Bio::FPC
Message-ID: <Pine.GSO.3.96.1030811161601.13501H-100000@beacon.stanford.edu>

Hi Jamie and all,

	My boss asked me to parse an FPC file. So I searched the bioperl
mailing list archive for "FPC". I found that there was a discussion back
in Nov 2002 about it. I am wondering whether this FPC parse is done or
not. If it is workable now, can anyone tell me where I can download it?
Otherwise, can someone point me to a spec of an FPC parser?

Thanks a lot.
Yee Man

From allenday at ucla.edu  Mon Aug 11 21:22:28 2003
From: allenday at ucla.edu (Allen Day)
Date: Mon Aug 11 21:22:06 2003
Subject: [Bioperl-l] ClusterIO Parsing of dbSNP: Possible bug
In-Reply-To: <BAY2-F15YpPASYz4on700018a9f@hotmail.com>
Message-ID: <Pine.LNX.4.44.0308111038040.14929-100000@sumo.genetics.ucla.edu>

Hi Johnny,

Yes, there were a few bugs in the parser, it's properly handling the 
NSE-FxnSet tagset now.  You'll need to use the latest CVS version to get 
the fix.

-Allen


On Sun, 10 Aug 2003, Johnny Amos wrote:

> Hello,
> 
> I seem to have run into a bug in the ClusterIO parsing of dbSNP.  The 
> functional_class() hash-element does not appear to be filled.  I suspect 
> this occurs because the corresponding XML field 
> (NSE-FxnSet_fxn-class-contig) is enumerated.  That is, it has the form:
> <NSE-FxnSet_fxn-class-contig value="intron"/>
> 
> >From my review of Bio::ClusterIO::dbsnp.pm it appears that enumerated tags 
> are not handled correctly.  The following script should return the 
> functional class for SNPs:
> 
> ### BEGIN SCRIPT
> use strict;
> use Bio::ClusterIO;
> 
> my $parser = Bio::ClusterIO->new(
> 			-file	=>	$infile,
> 			-format	=>	'dbSNP'
> 			);
> 
> while (my $record = $parser->next_cluster()) {
> 
> 	if (my $class = $record->functional_class) {
> 		$class =~ s/^\s+//;
> 		$class =~ s/\s+$//;
> 
> 		if ($class) { print "$class\n"; }
> 
> 		}
> 
> 	}
> ### END SCRIPT
> 
> I have tested this on several chromosomes, with the same results in each 
> case.  Can anyone confirm this behaviour, or see a problem with my code?
> 
> Johnny
> 
> _________________________________________________________________
> Help STOP SPAM with the new MSN 8 and get 2 months FREE*  
> http://join.msn.com/?page=features/junkmail
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 



From wes.barris at csiro.au  Mon Aug 11 23:11:24 2003
From: wes.barris at csiro.au (Wes Barris)
Date: Mon Aug 11 23:11:03 2003
Subject: [Bioperl-l] Parsing html blast output?
Message-ID: <3F385ADC.8070306@csiro.au>

Hi,

I know it is possible to use the SearchIO functions to parse either
text blast output or xml blast output.  However, I would like to know
if it is possible to parse html blast output?  For example, if I wanted
to parse the output of this command:

blastcl3 -d nr -p blastn -T -i fasta.txt -o blast.html

When I try parsing the above "blast.html" file using example number 4
from this file:

	http://bioperl.org/HOWTOs/html/Graphics-HOWTO.html

I get errors.

What I ended up doing is writing a perl "de-htmlizer" that I use to
convert an html blast output file into a text-only blast output file.
Then I run the result through a bioperl blast parsing script.  Is
there a more elegant way to do this?

-- 
Wes Barris
E-Mail: Wes.Barris@csiro.au


From eamiska at earthlink.net  Mon Aug 11 23:32:52 2003
From: eamiska at earthlink.net (Eric Miska)
Date: Mon Aug 11 23:32:19 2003
Subject: [Bioperl-l] Bio::Tools::Run::RemoteBlast: RID not found
Message-ID: <A7CAEBAA-CC75-11D7-A851-000A95885C5C@earthlink.net>

Dear All

this is very likely a trivial question:

I am using the Bio::Tools::Run::RemoteBlast module to run blast and 
every other request bounces back with the following error:

-------------------- WARNING ---------------------
MSG:

<p><!--
QBlastInfoBegin
         Status=UNKNOWN
QBlastInfoEnd
--><p><BODY BGCOLOR="#FFFFFF">
<hr><font color="red">ERROR: Results for RID 1060657821-20728-1846636 
not found</font><hr>

my code is a sad copy of the bptutorial (see below): I would really 
appreciate some help,

Eric

....
$database =  'nr';
@params = ('-prog'   => 'blastn',
              '-data'   => $database);
$Bio::Tools::Run::RemoteBlast::HEADER{'WORD SIZE'} = '7';
$Bio::Tools::Run::RemoteBlast::HEADER{'FILTER'} = 'OFF';
$Bio::Tools::Run::RemoteBlast::HEADER{'EXPECT'} = '1000';
	$remote_blast_object = Bio::Tools::Run::RemoteBlast->new(@params);
	$r = $remote_blast_object->submit_blast($seq1);
	while ( my @rids = $remote_blast_object->each_rid ) {
	foreach my $rid ( @rids ) {
		sleep 20;
		$rc = $remote_blast_object->retrieve_blast($rid);
		if( !ref($rc) ) {   # $rc not a reference => either error
		  # or job not yet finished
		  if( $rc < 0 ) {
			  $remote_blast_object->remove_rid($rid);
			  print"Error return code for BlastID code $rid ... \n";
		  }
		  sleep 5;
		} else {
		  $remote_blast_object->remove_rid($rid);
...

From ediths at botinst.unizh.ch  Tue Aug 12 03:25:05 2003
From: ediths at botinst.unizh.ch (Edith Schlagenhauf)
Date: Tue Aug 12 03:24:34 2003
Subject: [Bioperl-l] Parsing html blast output?
In-Reply-To: <3F385ADC.8070306@csiro.au>
References: <3F385ADC.8070306@csiro.au>
Message-ID: <Pine.SGI.4.53.0308120919020.386039@zisgi.unizh.ch>

Hi,

I usually let blastcl3 produce the raw text blast output
for parsing and after that use the Bioperl htmlizer.
I don't know if this is more elegant ;-) but I guess
it is less error-prone.

Edith

On Tue, 12 Aug 2003, Wes Barris wrote:

> Hi,
>
> I know it is possible to use the SearchIO functions to parse either
> text blast output or xml blast output.  However, I would like to know
> if it is possible to parse html blast output?  For example, if I wanted
> to parse the output of this command:
>
> blastcl3 -d nr -p blastn -T -i fasta.txt -o blast.html
>
> When I try parsing the above "blast.html" file using example number 4
> from this file:
>
> 	http://bioperl.org/HOWTOs/html/Graphics-HOWTO.html
>
> I get errors.
>
> What I ended up doing is writing a perl "de-htmlizer" that I use to
> convert an html blast output file into a text-only blast output file.
> Then I run the result through a bioperl blast parsing script.  Is
> there a more elegant way to do this?
>
> --
> Wes Barris
> E-Mail: Wes.Barris@csiro.au
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>


******************************************

Dr Edith Schlagenhauf
Bioinformatics
Institute of Plant Biology
University of Zurich
Zollikerstrasse 107
CH-8008 Zurich
SWITZERLAND

e-mail: ediths AT botinst DOT unizh DOT ch
Tel.:	+41 1 634 82 78
Fax :	+41 1 634 82 04

******************************************

From simon.andrews at bbsrc.ac.uk  Tue Aug 12 03:53:43 2003
From: simon.andrews at bbsrc.ac.uk (simon andrews (BI))
Date: Tue Aug 12 03:54:32 2003
Subject: [Bioperl-l] Bio::DB::GenBank and proxy
Message-ID: <2DC41140A89ED411989D00508BDCD9ED01E28B09@bi-exsrv1.iapc.bbsrc.ac.uk>



> -----Original Message-----
> From: William Kenworthy [mailto:billk@iinet.net.au]
> Sent: 10 August 2003 23:43
> To: BioPerl List
> Subject: [Bioperl-l] Bio::DB::GenBank and proxy
> 
> 
> Hi, is there a way to get Bio::DB::GenBank to honour a local 
> proxy from the environment (i.e., HTTP_PROXY or similar), or 
> does it have to be implicitly specified via 
> "$db->proxy(['http','ftp'], 'http://proxy:8081' );"

I've just filed a bug report which turns on this behaviour in
the BioPerl modules which require internet access.  Take a
look at:

http://bugzilla.bioperl.org/show_bug.cgi?id=1482

...two quick changes to core modules and you're good to go.

I've also just noticed that there's a typo in the report.
The second module should be Bio::DB::Query::WebQuery.pm

Hope this helps

Simon.
From birney at ebi.ac.uk  Tue Aug 12 04:03:45 2003
From: birney at ebi.ac.uk (Ewan Birney)
Date: Tue Aug 12 04:03:25 2003
Subject: installing scripts (was:Re: [Bioperl-l] GFF scripts)
In-Reply-To: <C34BDF98-CC4E-11D7-B01C-003065A5FDCC@earthlink.net>
Message-ID: <Pine.OSX.4.44.0308120902310.2702-100000@ewan-birneys-computer.local>


> If I am not mistaken, these are end-user scripts, so I probably will
> remove the .pl extension for the fink package, because Mac OS X is
> UNIX, and put a warning in the package description . I post it also
> here to see what the bioperl folks think of this - maybe there is
> another solution I overlooked?
>

if you like, but every unix I system have worked on usually use .pl for
perl scripts, (and the .pm of course for perl5 modules). I suspect the guy
who making such an impassionate plea for no .pl is slightly over-egging
the pudding...




>
> thanks,
>
> - Koen.
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

From xjnbebljntud at msn.com  Tue Aug 12 04:12:12 2003
From: xjnbebljntud at msn.com (xjnbebljntud@msn.com)
Date: Tue Aug 12 04:09:50 2003
Subject: [Bioperl-l] ... Become free from debt for LIFE!! Read..90fdsanm
Message-ID: <200308120809.h7C89k4T009993@localhost.localdomain>

HEY YOU! :)

Have over $5000 worth of debt? Want to get rid of it?
We'll give any American a helping hand, by paying off your debts.

- Save you a lot of money by eliminating late fees
- Settle your accounts for a substantially reduced amount
- Stop creditors calling you on the phone
- Avoid bankruptcy

... and more!

Why keep dealing with the stress, and headaches?

Combine your debt into a low interest repayment and
get on with your life today!!

Come here and take a look at how we can help.

http://btrack.iwon.com/r.pl?redir=http://randomstring@www.slashmonthlypayments.com/index.php?N=g










not interested?
http://btrack.iwon.com/r.pl?redir=http://ap1@www.slashmonthlypayments.com/r.php
From ajm6q at virginia.edu  Tue Aug 12 06:33:11 2003
From: ajm6q at virginia.edu (Aaron J Mackey)
Date: Tue Aug 12 06:32:40 2003
Subject: installing scripts (was:Re: [Bioperl-l] GFF scripts)
In-Reply-To: <Pine.OSX.4.44.0308120902310.2702-100000@ewan-birneys-computer.local>
Message-ID: <Pine.OSF.4.33.0308120628220.26128-100000@alpha10.bioch.virginia.edu>


Similarly, many shell scripts are named "dothejob.sh" or "batchthis.csh",
because they're often invoked as "/bin/sh dothejob.sh", i.e. the scripts
are input files to an interpreter.  Shell shebang chicanery aside, I also
prefer seeing the ".pl" on an executable, as a gentle reminder that I
should execute "/my/favorite/debugging/perl -d script.pl" and not "gdb
script core" when things go wrong.

-Aaron

On Tue, 12 Aug 2003, Ewan Birney wrote:

>
> > If I am not mistaken, these are end-user scripts, so I probably will
> > remove the .pl extension for the fink package, because Mac OS X is
> > UNIX, and put a warning in the package description . I post it also
> > here to see what the bioperl folks think of this - maybe there is
> > another solution I overlooked?
> >
>
> if you like, but every unix I system have worked on usually use .pl for
> perl scripts, (and the .pm of course for perl5 modules). I suspect the guy
> who making such an impassionate plea for no .pl is slightly over-egging
> the pudding...
>
>
>
>
> >
> > thanks,
> >
> > - Koen.
> >
> >
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

-- 
 Aaron J Mackey
 Pearson Laboratory
 University of Virginia
 (434) 924-2821
 amackey@virginia.edu


From billk at iinet.net.au  Tue Aug 12 08:02:07 2003
From: billk at iinet.net.au (William Kenworthy)
Date: Tue Aug 12 08:02:08 2003
Subject: [Bioperl-l] Bio::DB::GenBank and proxy
In-Reply-To: <2DC41140A89ED411989D00508BDCD9ED01E28B09@bi-exsrv1.iapc.bbsrc.ac.uk>
References: <2DC41140A89ED411989D00508BDCD9ED01E28B09@bi-exsrv1.iapc.bbsrc.ac.uk>
Message-ID: <1060689043.28694.40.camel@rattus.Localdomain>

Unfortunately, this didn't work for me:

declare -x http_proxy="http://localhost:8081"
wdk@rattus tmp $ ./t.pl
Attempt to bless into a reference at
/usr/lib/perl5/site_perl/5.8.0/LWP/UserAgent.pm line 221.
wdk@rattus tmp $ 

Noticed another thing: the cache (squid in my case) always reports a
"miss", and fetches direct.  Not sure why this is the case - would be
handy as we have students with a tight network allowance that would
benefit from cacheing - as it is, this looks like an assignment (cache
the data you fetch ...).  

This is what ethereal shows as "on the wire" after the second try etc
requests:

GET
http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?retmode=text&rettype=gb&db=nucleotide&tool=bioperl&id=gb%7CAL022723&usehistory=n HTTP/1.1
TE: deflate,gzip;q=0.3
Connection: TE, close
Host: eutils.ncbi.nlm.nih.gov
User-Agent: Bio::DB::GenBank/0.8

HTTP/1.0 200 OK
Date: Tue, 12 Aug 2003 11:16:14 GMT
Server: Apache
Content-Type: text/plain
Via: 1.1 eutils.ncbi.nih.gov
X-Cache: MISS from eutils.ncbi.nih.gov
X-Cache: MISS from rattus.Localdomain
X-Cache-Lookup: MISS from rattus.Localdomain:8081
Proxy-Connection: close

LOCUS  ...

Wont add this to the bugzilla for awhile in case someone wants to
comment.

BillK


On Tue, 2003-08-12 at 15:53, simon andrews (BI) wrote:
> > -----Original Message-----
> > From: William Kenworthy [mailto:billk@iinet.net.au]
> > Sent: 10 August 2003 23:43
> > To: BioPerl List
> > Subject: [Bioperl-l] Bio::DB::GenBank and proxy
> > 
> > 
> > Hi, is there a way to get Bio::DB::GenBank to honour a local 
> > proxy from the environment (i.e., HTTP_PROXY or similar), or 
> > does it have to be implicitly specified via 
> > "$db->proxy(['http','ftp'], 'http://proxy:8081' );"
> 
> I've just filed a bug report which turns on this behaviour in
> the BioPerl modules which require internet access.  Take a
> look at:
> 
> http://bugzilla.bioperl.org/show_bug.cgi?id=1482
> 
> ...two quick changes to core modules and you're good to go.
> 
> I've also just noticed that there's a typo in the report.
> The second module should be Bio::DB::Query::WebQuery.pm
> 
> Hope this helps
> 
> Simon.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
-- 
William Kenworthy <billk@iinet.net.au>

From jason at cgt.duhs.duke.edu  Tue Aug 12 08:23:23 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Tue Aug 12 08:06:18 2003
Subject: [Bioperl-l] Parsing html blast output?
In-Reply-To: <3F385ADC.8070306@csiro.au>
References: <3F385ADC.8070306@csiro.au>
Message-ID: <Pine.LNX.4.50.0308120823020.1144-100000@tenero.duhs.duke.edu>

No, it is not currently possible to parse BLAST HTML output.

On Tue, 12 Aug 2003, Wes Barris wrote:

> Hi,
>
> I know it is possible to use the SearchIO functions to parse either
> text blast output or xml blast output.  However, I would like to know
> if it is possible to parse html blast output?  For example, if I wanted
> to parse the output of this command:
>
> blastcl3 -d nr -p blastn -T -i fasta.txt -o blast.html
>
> When I try parsing the above "blast.html" file using example number 4
> from this file:
>
> 	http://bioperl.org/HOWTOs/html/Graphics-HOWTO.html
>
> I get errors.
>
> What I ended up doing is writing a perl "de-htmlizer" that I use to
> convert an html blast output file into a text-only blast output file.
> Then I run the result through a bioperl blast parsing script.  Is
> there a more elegant way to do this?
>
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From scassidy at accelrys.com  Mon Aug 11 15:20:46 2003
From: scassidy at accelrys.com (Susan Cassidy)
Date: Tue Aug 12 08:28:53 2003
Subject: [Bioperl-l] question about SeqIO and BSML DTD
Message-ID: <OF65D8650C.8BB83D11-ON88256D7F.0069C37F-88256D7F.006A5B6E@accelrys.com>

Hi,
It looks like the current (1.2.2) bioperl bsml functions are set up to use 
the BSML 2.2 DTD.  I would like to use the 3.1 DTD instead.  Is there some 
easy way to have things like SeqIO create BSML output using the 3.1 DTD? 
I'm not sure how the internal handling of all the DTD stuff works, but I 
do see that the DTD URL is hard-coded in bsml.pm to be 
"http://www.labbook.com/dtd/bsml2_2.dtd". 

It would be wonderful if it were as easy as changing that!  But, I won't 
hold my breath!

I'm doing some experimentation with converting sequences from formats such 
as Genbank into BSML, and this makes it really simple.

Please reply to this email address and not just to the list, as I don't 
subscribe to it.

Any advice appreciated.

Thanks,
Susan Cassidy
From brian_osborne at cognia.com  Tue Aug 12 08:47:05 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Tue Aug 12 08:50:24 2003
Subject: installing scripts (was:Re: [Bioperl-l] GFF scripts)
In-Reply-To: <Pine.LNX.4.50.0308110955440.26169-100000@tenero.duhs.duke.edu>
Message-ID: <GAEDKMGOKFBLJPKCLKCCAEKGDAAA.brian_osborne@cognia.com>

Ewan,

* I would like to go for 1.3 developer release soonish

Yes, please. This 1.3 would have the script installation option, cleanly
separated scripts/ and examples/, and the newer, bug-free PODs (e.g.
biodatabases.pod, not biodatabases.pl).

Brian O.

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jason Stajich
Sent: Monday, August 11, 2003 10:03 AM
To: Ewan Birney
Cc: Bioperl-l@portal.open-bio.org; Koen van der Drift
Subject: Re: installing scripts (was:Re: [Bioperl-l] GFF scripts)

I would like to go for 1.3 developer release soonish - changes from this
spring in SearchIO which Steve put into place merging psiblast and blast
parsing into the single module.  Lots of new modules on the main trunk and
I would like to see them get more testing through a dev release.
I certainly have some loose ends to tie up in the HEAD but it is shaping
up to have some nice new features.

Dev releases should be much less painful than a full stable release so I
don't see why we can't shoot for one by say the end of August?

There are only a few little changes at this point on the 1.2 branch - but
if we cleaned up any other annoying things people have now that 1.2.2 has
been out to play it could be worth the effort.

-jason

On Mon, 11 Aug 2003, Ewan Birney wrote:

>
>
> Is there a feeling that we should do a 1.2.3 release or is it more like
> starting push towards 1.3 (developer...) releases towards a 1.4.
>
>
> I don't have any strong views, though marginally more time to run after
> bugs now...
>
>
>
> -----------------------------------------------------------------
> Ewan Birney. Mobile: +44 (0)7970 151230, Work: +44 1223 494420
> <birney@ebi.ac.uk>.
> -----------------------------------------------------------------
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From ajm6q at virginia.edu  Tue Aug 12 09:04:12 2003
From: ajm6q at virginia.edu (Aaron J Mackey)
Date: Tue Aug 12 09:03:41 2003
Subject: [Bioperl-l] parsing BLAST html
Message-ID: <Pine.OSF.4.33.0308120857240.31736-100000@alpha10.bioch.virginia.edu>


We keep seeing this "bug" report - is there a simple way to make this
"just work" using HTML::Strip?  I.e. a Bio::SearchIO::blasthtml that just
looks like (missing various error checking, etc):

package Bio::SearchIO::blasthtml;

@ISA = qw(Bio::SearchIO::blast);

sub _initialize {
  my ($self, @args) = @_;
  $self->{_hs} = new HTML::Strip;
  return $self->SUPER::_initialize(@args);
}

sub _readline {
  my $self = shift;
  my $line = $self->SUPER::_readline(@_);
  return $self->{_hs}->parse($line);
}

From jason at cgt.duhs.duke.edu  Tue Aug 12 09:41:44 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Tue Aug 12 09:24:32 2003
Subject: [Bioperl-l] Re: parsing BLAST html
In-Reply-To: <Pine.OSF.4.33.0308120857240.31736-100000@alpha10.bioch.virginia.edu>
References: <Pine.OSF.4.33.0308120857240.31736-100000@alpha10.bioch.virginia.edu>
Message-ID: <Pine.LNX.4.50.0308120940500.1614-100000@tenero.duhs.duke.edu>

I've never tried it - but given Sophia's last message perhaps it will
'just work' by doing the strip first.

-jason

On Tue, 12 Aug 2003, Aaron J Mackey wrote:

>
> We keep seeing this "bug" report - is there a simple way to make this
> "just work" using HTML::Strip?  I.e. a Bio::SearchIO::blasthtml that just
> looks like (missing various error checking, etc):
>
> package Bio::SearchIO::blasthtml;
>
> @ISA = qw(Bio::SearchIO::blast);
>
> sub _initialize {
>   my ($self, @args) = @_;
>   $self->{_hs} = new HTML::Strip;
>   return $self->SUPER::_initialize(@args);
> }
>
> sub _readline {
>   my $self = shift;
>   my $line = $self->SUPER::_readline(@_);
>   return $self->{_hs}->parse($line);
> }
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From simon.andrews at bbsrc.ac.uk  Tue Aug 12 09:24:29 2003
From: simon.andrews at bbsrc.ac.uk (simon andrews (BI))
Date: Tue Aug 12 09:25:49 2003
Subject: [Bioperl-l] Bio::DB::GenBank and proxy
Message-ID: <2DC41140A89ED411989D00508BDCD9ED01E28B0F@bi-exsrv1.iapc.bbsrc.ac.uk>



> -----Original Message-----
> From: William Kenworthy [mailto:billk@iinet.net.au] 
> Sent: 12 August 2003 12:51
> To: simon andrews (BI)
> Cc: BioPerl List
> Subject: RE: [Bioperl-l] Bio::DB::GenBank and proxy
> 
> 
> Unfortunately, this didn't work for me:
> 
> declare -x http_proxy="http://localhost:8081"
> wdk@rattus tmp $ ./t.pl
> Attempt to bless into a reference at 
> /usr/lib/perl5/site_perl/5.8.0/LWP/UserAgent.pm line 221. 
> wdk@rattus tmp $ 

I take it this is after you'd made the changes I put in my bug report?  I can't really diagnose this as I think I have a different version of UserAgent.pm to you.  Line 221 in mine sets up a cookie jar, which doesn't sound right.

When you changed the two bioperl modules were the lines you altered already calls to the new method of LWP::UserAgent?  The line numbers reported may only be correct for the 1.2 release of bioperl.

Can you run this small prog and see what you get (please unwrap the long line on the get call).

#!/usr/bin/perl -w
use strict;
use LWP::UserAgent;

my $ua = LWP::UserAgent -> new (env_proxy => 1,
				keep_alive => 1,
				timeout => 30);

my $response = $ua -> get('http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?retmode=text&rettype=gb&db=nucleotide&tool=bioperl&id=gb%7CAL022723&usehistory=n');

my $text = $response -> as_string;

print substr($text,0,1000) , "\n";
#################################################################

You should hopefully get something like this:

#####################
HTTP/1.0 200 OK
Date: Tue, 12 Aug 2003 13:16:55 GMT
Via: 1.1 eutils.ncbi.nih.gov
Server: Apache
Content-Type: text/plain
Client-Date: Tue, 12 Aug 2003 19:17:13 GMT
Client-Response-Num: 1
Proxy-Connection: close
X-Cache: MISS from eutils.ncbi.nih.gov
X-Cache: MISS from BBSRC-wwwcache-service

LOCUS       HS377H14              148834 bp    DNA     linear   PRI 14-SEP-2001
DEFINITION  Human DNA sequence from clone RP3-377H14 on chromosome
            6p21.32-22.1. Contains the HLA-G gene for major [andrewss@bilin2 Test]$ ./uatest.pl
HTTP/1.0 200 OK
Date: Tue, 12 Aug 2003 13:17:13 GMT
Via: 1.1 eutils.ncbi.nih.gov
Server: Apache
Content-Type: text/plain
Client-Date: Tue, 12 Aug 2003 19:17:32 GMT
Client-Response-Num: 1
Proxy-Connection: close
X-Cache: MISS from eutils.ncbi.nih.gov
X-Cache: MISS from BBSRC-wwwcache-service

LOCUS       HS377H14              148834 bp    DNA     linear   PRI 14-SEP-2001
DEFINITION  Human DNA sequence from clone RP3-377H14 on chromosome
            6p21.32-22.1. Contains the HLA-G gene for major histocompatibility
            complex class I G (HLA 6.0) an MHC class I pseudogene, an RPL7A
            (60S Ribosomal Protein L7A) pseudogene, a gene for a novel MHC
            class 1 protein, an interferon-inducible protein 1-8U pseudogene,
            an RPL23A (60S Ribosomal Protein L23A) pseudogene, an HCGIX
            pseudogene, an MICB or PERB11.1 pseudogene,the HLA-F gene for major
            histocompatibility complex class I F (CDA12), and four P5-1
            pseudogenes. Con
#####################

If this works can you go back and check the amendments you made to the two bioperl scripts as this is all they are doing.  If it still fails then its not a bioperl problem as such, but we can still try to track it down.

 
> Noticed another thing: the cache (squid in my case) always 
> reports a "miss", and fetches direct.

That's probably right.  Since you're fetching potentially dynamic content (albeit through a GET request) you may find that squid refuses to cache it and will refetch it every time.  Have a look in the squid documentation and there may be some way to tell it that it should cache dynamic GET requests as well.

Hope this helps

Simon.
From brian_osborne at cognia.com  Tue Aug 12 10:22:15 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Tue Aug 12 10:25:38 2003
Subject: installing scripts (was:Re: [Bioperl-l] GFF scripts)
In-Reply-To: <Pine.LNX.4.50.0308110929410.26169-100000@tenero.duhs.duke.edu>
Message-ID: <GAEDKMGOKFBLJPKCLKCCEEKIDAAA.brian_osborne@cognia.com>

Koen and Jason,

My apologies, I haven't been following your discussion closely. The scripts
in scripts/ in bioperl-live all have the PLS suffix. This trunk also has
script installation running, and a simplified approach to POD. Since Koen
has said, reasonably, that he only wants to package a formal release perhaps
the wisest thing for him to do is to wait for 1.3. IMO.

Brian O.

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jason Stajich
Sent: Monday, August 11, 2003 9:32 AM
To: Koen van der Drift
Cc: Bioperl-l@portal.open-bio.org
Subject: Re: installing scripts (was:Re: [Bioperl-l] GFF scripts)

On Sun, 10 Aug 2003, Koen van der Drift wrote:

>
> On Sunday, August 10, 2003, at 07:50  PM, Jason Stajich wrote:
> >
>
> > what verions of File::Path is on your system?  Perhaps the problem is
> > the
> > tests were run on systems with newer File::Path which previously
> > exported
> > rmtree.
>
> I recently install 5.8.0. The Makefile.PL I got from the trunk also has
> the additional line to include rmtree, so I am not sure if the version
> of File::Path is an issue.
>

well good that you caught it - more appropriate to explictly list the
exported function names as you've done so the Makfile.PL should be
updated with that for sure.

> >> Careful examination of the code reveals that only the scripts that
> >> have
> >> an .PLS extension will be installed, which are exactly the 4 scripts
> >> that get installed. All other scripts already have the .pl extension,
> >> and thus will not be installed. So I modified the script as follows:
> >>
> >
> > The intention is to ONLY install scripts which end in .PLS.  This whole
> > process also fixes the perl path in the header of the script as well.
>
> I see - I didn't realize that. The perl path fix btw is not effected by
> my change.
>
> >
> > The problem is that this install code was ported from the CVS HEAD to
> > the
> > branch and I don't think all the underlying scripts were renamed.
> >
> > I think that all of these problems go away when you work off the main
> > trunk.
>
> I am trying to make a package for fink to install bioperl on Mac OS X,
> so I rather not use the cvs trunk, but only 'real releases'. Thsi to
> make sure that everyone who wants to use fink to install bioperl uses
> the same code.
>

understand - this is more appropriate - you're welcome to have those
patches be for the 1.2.2 release but keeping them in the fink pkg.  If we
do another release on the 1.2 branch (1.2.3) we can try and get this
right.  Glad you're doing this.


> thanks for the info,
>
>
> - Koen.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From billk at iinet.net.au  Tue Aug 12 10:38:52 2003
From: billk at iinet.net.au (William Kenworthy)
Date: Tue Aug 12 10:38:53 2003
Subject: [Bioperl-l] Bio::DB::GenBank and proxy
In-Reply-To: <2DC41140A89ED411989D00508BDCD9ED01E28B0F@bi-exsrv1.iapc.bbsrc.ac.uk>
References: <2DC41140A89ED411989D00508BDCD9ED01E28B0F@bi-exsrv1.iapc.bbsrc.ac.uk>
Message-ID: <1060696791.28694.62.camel@rattus.Localdomain>

ach! - typo when I changed the files.  Also works normally if I elect
not to go through the proxy ('unset http_proxy').

Thanks, also for the hint about squid, will keep looking at that.

BillK

On Tue, 2003-08-12 at 21:24, simon andrews (BI) wrote:
> > -----Original Message-----
> > From: William Kenworthy [mailto:billk@iinet.net.au] 
> > Sent: 12 August 2003 12:51
> > To: simon andrews (BI)
> > Cc: BioPerl List
> > Subject: RE: [Bioperl-l] Bio::DB::GenBank and proxy
> > 
> > 
> > Unfortunately, this didn't work for me:
> > 
> > declare -x http_proxy="http://localhost:8081"
> > wdk@rattus tmp $ ./t.pl
> > Attempt to bless into a reference at 
> > /usr/lib/perl5/site_perl/5.8.0/LWP/UserAgent.pm line 221. 
> > wdk@rattus tmp $ 
> 
> I take it this is after you'd made the changes I put in my bug report?  I can't really diagnose this as I think I have a different version of UserAgent.pm to you.  Line 221 in mine sets up a cookie jar, which doesn't sound right.
> 
> When you changed the two bioperl modules were the lines you altered already calls to the new method of LWP::UserAgent?  The line numbers reported may only be correct for the 1.2 release of bioperl.
> 
> Can you run this small prog and see what you get (please unwrap the long line on the get call).
> 
> #!/usr/bin/perl -w
> use strict;
> use LWP::UserAgent;
> 
> my $ua = LWP::UserAgent -> new (env_proxy => 1,
> 				keep_alive => 1,
> 				timeout => 30);
> 
> my $response = $ua -> get('http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?retmode=text&rettype=gb&db=nucleotide&tool=bioperl&id=gb%7CAL022723&usehistory=n');
> 
> my $text = $response -> as_string;
> 
> print substr($text,0,1000) , "\n";
> #################################################################
> 
> You should hopefully get something like this:
> 
> #####################
> HTTP/1.0 200 OK
> Date: Tue, 12 Aug 2003 13:16:55 GMT
> Via: 1.1 eutils.ncbi.nih.gov
> Server: Apache
> Content-Type: text/plain
> Client-Date: Tue, 12 Aug 2003 19:17:13 GMT
> Client-Response-Num: 1
> Proxy-Connection: close
> X-Cache: MISS from eutils.ncbi.nih.gov
> X-Cache: MISS from BBSRC-wwwcache-service
> 
> LOCUS       HS377H14              148834 bp    DNA     linear   PRI 14-SEP-2001
> DEFINITION  Human DNA sequence from clone RP3-377H14 on chromosome
>             6p21.32-22.1. Contains the HLA-G gene for major [andrewss@bilin2 Test]$ ./uatest.pl
> HTTP/1.0 200 OK
> Date: Tue, 12 Aug 2003 13:17:13 GMT
> Via: 1.1 eutils.ncbi.nih.gov
> Server: Apache
> Content-Type: text/plain
> Client-Date: Tue, 12 Aug 2003 19:17:32 GMT
> Client-Response-Num: 1
> Proxy-Connection: close
> X-Cache: MISS from eutils.ncbi.nih.gov
> X-Cache: MISS from BBSRC-wwwcache-service
> 
> LOCUS       HS377H14              148834 bp    DNA     linear   PRI 14-SEP-2001
> DEFINITION  Human DNA sequence from clone RP3-377H14 on chromosome
>             6p21.32-22.1. Contains the HLA-G gene for major histocompatibility
>             complex class I G (HLA 6.0) an MHC class I pseudogene, an RPL7A
>             (60S Ribosomal Protein L7A) pseudogene, a gene for a novel MHC
>             class 1 protein, an interferon-inducible protein 1-8U pseudogene,
>             an RPL23A (60S Ribosomal Protein L23A) pseudogene, an HCGIX
>             pseudogene, an MICB or PERB11.1 pseudogene,the HLA-F gene for major
>             histocompatibility complex class I F (CDA12), and four P5-1
>             pseudogenes. Con
> #####################
> 
> If this works can you go back and check the amendments you made to the two bioperl scripts as this is all they are doing.  If it still fails then its not a bioperl problem as such, but we can still try to track it down.
> 
>  
> > Noticed another thing: the cache (squid in my case) always 
> > reports a "miss", and fetches direct.
> 
> That's probably right.  Since you're fetching potentially dynamic content (albeit through a GET request) you may find that squid refuses to cache it and will refetch it every time.  Have a look in the squid documentation and there may be some way to tell it that it should cache dynamic GET requests as well.
> 
> Hope this helps
> 
> Simon.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
-- 
William Kenworthy <billk@iinet.net.au>

From markw at illuminae.com  Tue Aug 12 17:00:41 2003
From: markw at illuminae.com (Mark Wilkinson)
Date: Tue Aug 12 17:00:42 2003
Subject: [Bioperl-l] SeqIO BEGIN block kills Gbrowse
Message-ID: <1060722074.1709.106.camel@localhost.localdomain>

Hi all,

Just a heads-up that the eval in the BEGIN block of SeqIO.pm mucks-up
the gbrowse CGI (apparently because the error message is printed to the
screen before the CGI header).  I suppose this is something that is best
fixed at the gbrowse end of the stick, but I thought I'd post a note
about it here anyway.  It it doesn't look like it will be an easy thing
to fix given the early point at which that line is going to execute...

M

-- 
Mark Wilkinson <markw@illuminae.com>
Illuminae

From jason at cgt.duhs.duke.edu  Tue Aug 12 17:22:35 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Tue Aug 12 17:05:16 2003
Subject: [Bioperl-l] SeqIO BEGIN block kills Gbrowse
In-Reply-To: <1060722074.1709.106.camel@localhost.localdomain>
References: <1060722074.1709.106.camel@localhost.localdomain>
Message-ID: <Pine.LNX.4.50.0308121722080.4351-100000@tenero.duhs.duke.edu>

It shouldn't print anything b/c it is in an eval block.
What does it print to the screen?

On Tue, 12 Aug 2003, Mark Wilkinson wrote:

> Hi all,
>
> Just a heads-up that the eval in the BEGIN block of SeqIO.pm mucks-up
> the gbrowse CGI (apparently because the error message is printed to the
> screen before the CGI header).  I suppose this is something that is best
> fixed at the gbrowse end of the stick, but I thought I'd post a note
> about it here anyway.  It it doesn't look like it will be an easy thing
> to fix given the early point at which that line is going to execute...
>
> M
>
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From markw at illuminae.com  Tue Aug 12 17:26:24 2003
From: markw at illuminae.com (Mark Wilkinson)
Date: Tue Aug 12 17:26:26 2003
Subject: [BioPerl] Re: [Bioperl-l] SeqIO BEGIN block kills Gbrowse
In-Reply-To: <Pine.LNX.4.50.0308121722080.4351-100000@tenero.duhs.duke.edu>
References: <1060722074.1709.106.camel@localhost.localdomain>
	<Pine.LNX.4.50.0308121722080.4351-100000@tenero.duhs.duke.edu>
Message-ID: <1060723619.1710.109.camel@localhost.localdomain>

At the top of the CGI page you get a "can't locate stdin..." error
message.  The code continues to execute, but by then it is all mucked
up.

M

On Tue, 2003-08-12 at 15:22, Jason Stajich wrote:
> It shouldn't print anything b/c it is in an eval block.
> What does it print to the screen?
> 
> On Tue, 12 Aug 2003, Mark Wilkinson wrote:
> 
> > Hi all,
> >
> > Just a heads-up that the eval in the BEGIN block of SeqIO.pm mucks-up
> > the gbrowse CGI (apparently because the error message is printed to the
> > screen before the CGI header).  I suppose this is something that is best
> > fixed at the gbrowse end of the stick, but I thought I'd post a note
> > about it here anyway.  It it doesn't look like it will be an easy thing
> > to fix given the early point at which that line is going to execute...
> >
> > M
> >
> >
> 
> --
> Jason Stajich
> Duke University
> jason at cgt.mc.duke.edu
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
-- 
Mark Wilkinson <markw@illuminae.com>
Illuminae

From markw at illuminae.com  Tue Aug 12 17:27:17 2003
From: markw at illuminae.com (Mark Wilkinson)
Date: Tue Aug 12 17:27:26 2003
Subject: [BioPerl] Re: [Bioperl-l] SeqIO BEGIN block kills Gbrowse
In-Reply-To: <Pine.LNX.4.50.0308121722080.4351-100000@tenero.duhs.duke.edu>
References: <1060722074.1709.106.camel@localhost.localdomain>
	<Pine.LNX.4.50.0308121722080.4351-100000@tenero.duhs.duke.edu>
Message-ID: <1060723672.1709.112.camel@localhost.localdomain>

i can switch the faulty behaviour back on and send you a URL if you
like.  All I did was comment-out the eval to solve my immediate problem.

M

On Tue, 2003-08-12 at 15:22, Jason Stajich wrote:
> It shouldn't print anything b/c it is in an eval block.
> What does it print to the screen?
> 
> On Tue, 12 Aug 2003, Mark Wilkinson wrote:
> 
> > Hi all,
> >
> > Just a heads-up that the eval in the BEGIN block of SeqIO.pm mucks-up
> > the gbrowse CGI (apparently because the error message is printed to the
> > screen before the CGI header).  I suppose this is something that is best
> > fixed at the gbrowse end of the stick, but I thought I'd post a note
> > about it here anyway.  It it doesn't look like it will be an easy thing
> > to fix given the early point at which that line is going to execute...
> >
> > M
> >
> >
> 
> --
> Jason Stajich
> Duke University
> jason at cgt.mc.duke.edu
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
-- 
Mark Wilkinson <markw@illuminae.com>
Illuminae

From jason at cgt.duhs.duke.edu  Tue Aug 12 17:50:30 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Tue Aug 12 17:33:11 2003
Subject: [BioPerl] Re: [Bioperl-l] SeqIO BEGIN block kills Gbrowse
In-Reply-To: <1060723672.1709.112.camel@localhost.localdomain>
References: <1060722074.1709.106.camel@localhost.localdomain> 
	<Pine.LNX.4.50.0308121722080.4351-100000@tenero.duhs.duke.edu>
	<1060723672.1709.112.camel@localhost.localdomain>
Message-ID: <Pine.LNX.4.50.0308121750020.4351-100000@tenero.duhs.duke.edu>

i  guess so - i mean I run gbrowse on bioperl live with no problems at all
so I don't know what would cause it.
-j

On Tue, 12 Aug 2003, Mark Wilkinson wrote:

> i can switch the faulty behaviour back on and send you a URL if you
> like.  All I did was comment-out the eval to solve my immediate problem.
>
> M
>
> On Tue, 2003-08-12 at 15:22, Jason Stajich wrote:
> > It shouldn't print anything b/c it is in an eval block.
> > What does it print to the screen?
> >
> > On Tue, 12 Aug 2003, Mark Wilkinson wrote:
> >
> > > Hi all,
> > >
> > > Just a heads-up that the eval in the BEGIN block of SeqIO.pm mucks-up
> > > the gbrowse CGI (apparently because the error message is printed to the
> > > screen before the CGI header).  I suppose this is something that is best
> > > fixed at the gbrowse end of the stick, but I thought I'd post a note
> > > about it here anyway.  It it doesn't look like it will be an easy thing
> > > to fix given the early point at which that line is going to execute...
> > >
> > > M
> > >
> > >
> >
> > --
> > Jason Stajich
> > Duke University
> > jason at cgt.mc.duke.edu
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From gadbermd at earthlink.net  Tue Aug 12 16:04:00 2003
From: gadbermd at earthlink.net (gadbermd@earthlink.net)
Date: Tue Aug 12 17:58:36 2003
Subject: [Bioperl-l] Help w/ AlignIO and consensus_iupac
Message-ID: <5191866.1060725547213.JavaMail.nobody@bert.psp.pas.earthlink.net>

Hi everyone,

I am a BioPerl newbie and I was wondering if someone could help me figure out how to generate a consensus from a Clustalw .aln file? I tried to write this sample code:

#!/usr/bin/perl
use warnings;
use Bio::AlignIO;

my $usage = "Usage: test.pl <in_file> \n";
my $in_file = shift or die $usage;

$alignio = new Bio::AlignIO(-format => 'clustalw', -file => "$in_file");
$aln = $alignio->next_aln();
$str = $aln->consensus_iupac();

print $str;


But it always generates an error message saying the sequence is a protein:


% ./test.pl new.aln
------------- EXCEPTION  -------------
MSG: Seq [gi|18397816|ref|NM_102852.1|/1-648] is a protein
STACK Bio::SimpleAlign::consensus_iupac /usr/lib/perl5/site_perl/5.8.0/Bio/SimpleAlign.pm:1325
STACK toplevel ./test.pl:9

--------------------------------------


This occurs in spite of the fact that the Clustal output is all nucleotides, not proteins...



% cat new.aln
CLUSTAL W (1.82) multiple sequence alignment


gi|18397816|ref|NM_102852.1|      --------------------------------------------------
gi|33242920|gb|AY332478.1|        GGTTAATTTTGGTTGGAGGTAGAGAGAGAGAGAGAGGGAGGGAGGGAGGA
gi|18424168|ref|NM_125279.1|      --------------------------------------------------



gi|18397816|ref|NM_102852.1|      -----------------ATGAGG--AAAGGTAAGAGAGTGATA-------
gi|33242920|gb|AY332478.1|        GGAGGAGGAGGAGGAGGAGGAGG--AAGAACAGGAGGAAGATGGGGCGGG
gi|18424168|ref|NM_125279.1|      -----------------ATGGTTCCGAAAGTGGTCGACCTACA-------
                                                   * *      *        *    *

etc. etc. etc.


I have tried it with a number of different Clustal output files but it always complains about them containing proteins.  I figure I have to be doing something wrong here. 

Thanks so much,
Mike G.
From sobrien at umail.ucsb.edu  Tue Aug 12 15:45:33 2003
From: sobrien at umail.ucsb.edu (Sean O'Brien)
Date: Tue Aug 12 18:45:54 2003
Subject: [Bioperl-l] problem with Graphics
Message-ID: <200308121545.33474.sobrien@umail.ucsb.edu>

Hi,

I have been trying to get BioPerl to output png's, but I seem to be getting 
invalid png files.  I have a fresh install of libgd, version 2.0.15 and my GD 
version is 2.07.  I installed Bundle::BioPerl, and after having no luck, I 
installed BioPerl version 1.2.2 from the sources in 
current_core_stable.tar.gz.  When I run 'make test' I get an ok for 
BioGraphics.  Also, when I run the first script described in the Bio Graphics 
tutorial, it runs with no errors and outputs some data which appears as 
though it could be an image.  However, the file seems to be of an invalid png 
format because it cannot be opened by display, galeon or the GIMP.  This is 
pretty frustrating because everything apears to be installing/running fine, 
but then the image is somehow corrupted.  What might I have done wrong/ need 
to do to make this work.  Thanks.

-S
From kvddrift at earthlink.net  Tue Aug 12 19:07:11 2003
From: kvddrift at earthlink.net (Koen van der Drift)
Date: Tue Aug 12 19:08:47 2003
Subject: installing scripts (was:Re: [Bioperl-l] GFF scripts)
In-Reply-To: <GAEDKMGOKFBLJPKCLKCCEEKIDAAA.brian_osborne@cognia.com>
Message-ID: <B48FCC6A-CD19-11D7-86FC-003065A5FDCC@earthlink.net>


On Tuesday, August 12, 2003, at 10:22  AM, Brian Osborne wrote:

> Since Koen
> has said, reasonably, that he only wants to package a formal release 
> perhaps
> the wisest thing for him to do is to wait for 1.3. IMO.
>

I agree :)

I will submit the 1.2.2 package to fink soon, without installing the 
scripts. The user can always put the scripts somewhere if he or she 
desires. When 1.3 is released, I will update the package description.

thanks for all the input.

- Koen.

From jason at cgt.duhs.duke.edu  Tue Aug 12 23:47:56 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Tue Aug 12 23:30:48 2003
Subject: [Bioperl-l] Help w/ AlignIO and consensus_iupac
In-Reply-To: <5191866.1060725547213.JavaMail.nobody@bert.psp.pas.earthlink.net>
References: <5191866.1060725547213.JavaMail.nobody@bert.psp.pas.earthlink.net>
Message-ID: <Pine.LNX.4.50.0308122345090.6256-100000@tenero.duhs.duke.edu>


>From the iupac_consensus docs:
 Note that if your alignment sequences contain a lot of
 IUPAC ambiquity codes you often have to manually set
 alphabet.  Bio::PrimarySeq::_guess_type thinks they
 indicate a protein sequence.

Do this in your code once you have an Alignment object called $aln.
for my $seq ( $aln->each_seq ) {
  $seq->alphabet('dna'); # or rna if that is what you have
}
Then try calling the consensus method again.

-jason
On Tue, 12 Aug 2003 gadbermd@earthlink.net wrote:

> Hi everyone,
>
> I am a BioPerl newbie and I was wondering if someone could help me figure out how to generate a consensus from a Clustalw .aln file? I tried to write this sample code:
>
> #!/usr/bin/perl
> use warnings;
> use Bio::AlignIO;
>
> my $usage = "Usage: test.pl <in_file> \n";
> my $in_file = shift or die $usage;
>
> $alignio = new Bio::AlignIO(-format => 'clustalw', -file => "$in_file");
> $aln = $alignio->next_aln();
> $str = $aln->consensus_iupac();
>
> print $str;
>
>
> But it always generates an error message saying the sequence is a protein:
>
>
> % ./test.pl new.aln
> ------------- EXCEPTION  -------------
> MSG: Seq [gi|18397816|ref|NM_102852.1|/1-648] is a protein
> STACK Bio::SimpleAlign::consensus_iupac /usr/lib/perl5/site_perl/5.8.0/Bio/SimpleAlign.pm:1325
> STACK toplevel ./test.pl:9
>
> --------------------------------------
>
>
> This occurs in spite of the fact that the Clustal output is all nucleotides, not proteins...
>
>
>
> % cat new.aln
> CLUSTAL W (1.82) multiple sequence alignment
>
>
> gi|18397816|ref|NM_102852.1|      --------------------------------------------------
> gi|33242920|gb|AY332478.1|        GGTTAATTTTGGTTGGAGGTAGAGAGAGAGAGAGAGGGAGGGAGGGAGGA
> gi|18424168|ref|NM_125279.1|      --------------------------------------------------
>
>
>
> gi|18397816|ref|NM_102852.1|      -----------------ATGAGG--AAAGGTAAGAGAGTGATA-------
> gi|33242920|gb|AY332478.1|        GGAGGAGGAGGAGGAGGAGGAGG--AAGAACAGGAGGAAGATGGGGCGGG
> gi|18424168|ref|NM_125279.1|      -----------------ATGGTTCCGAAAGTGGTCGACCTACA-------
>                                                    * *      *        *    *
>
> etc. etc. etc.
>
>
> I have tried it with a number of different Clustal output files but it always complains about them containing proteins.  I figure I have to be doing something wrong here.
>
> Thanks so much,
> Mike G.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From zrgkigqtcxwx at msn.com  Tue Aug 12 23:36:40 2003
From: zrgkigqtcxwx at msn.com (zrgkigqtcxwx@msn.com)
Date: Tue Aug 12 23:34:16 2003
Subject: [Bioperl-l] Cut your debt by up to 60 percent
Message-ID: <200308130334.h7D3YB4T016318@localhost.localdomain>

Check this out, this is helpful..

Feel like your debts putting you in a hole you can't crawl out of?
We blast your debt and give you a fresh start!

- Save you a lot of money by eliminating late fees
- Settle your accounts for a substantially reduced amount
- Stop creditors calling you on the phone
- Avoid bankruptcy

... and more!

Why keep dealing with the stress, and headaches?

Combine your debt into a low interest repayment and
get on with your life today!!

Come here and take a look at how we can help.

http://r.aol.com/cgi/redir-complex?url=http://total@www.slashmonthlypayments.com/index.php?N=g










stop more of these
http://r.aol.com/cgi/redir-complex?url=http://ttl@www.slashmonthlypayments.com/r.php
From srobb1 at gl.umbc.edu  Tue Aug 12 10:40:51 2003
From: srobb1 at gl.umbc.edu (Sofia)
Date: Wed Aug 13 08:27:27 2003
Subject: [Bioperl-l] Re: parsing BLAST html
Message-ID: <004a01c360df$bb1d77f0$f500000a@planaria2>

I use PerlIO::via::StripHTML and it works quite successfully
-
Sofia

Hi Wes,
Before I parse my html blast I use PerlIO::via::StripHTML.  It removes all
html and I save the new file as the orginalFileName.out.  I like the html
blast output because I save them later for another use. But if I didnt need
them I would just use text output.

use strict;
use Bio::SearchIO;
use PerlIO::via::StripHTML;

my @dir_html_files = </usr/local/www/Blast/NcbiBlast/*.htm>;
foreach my $file (@dir_html_files){
 my $outfile  = $file."\.out";
 open OUTFILE, ">$outfile";
 open INFILE, '<:via(StripHTML)', $file
    or die "Can't open $outfile: $!\n";
 while (<INFILE>){
  print OUTFILE $_;
 }
}

-Sofia
----- Original Message ----- 
From: "Jason Stajich" <jason@cgt.duhs.duke.edu>
To: "Wes Barris" <wes.barris@csiro.au>
Cc: "Bioperl Mailing List" <bioperl-l@bioperl.org>
Sent: Tuesday, August 12, 2003 6:23 AM
Subject: Re: [Bioperl-l] Parsing html blast output?


> No, it is not currently possible to parse BLAST HTML output.
>
> On Tue, 12 Aug 2003, Wes Barris wrote:
>
> > Hi,
> >
> > I know it is possible to use the SearchIO functions to parse either
> > text blast output or xml blast output.  However, I would like to know
> > if it is possible to parse html blast output?  For example, if I wanted
> > to parse the output of this command:
> >
> > blastcl3 -d nr -p blastn -T -i fasta.txt -o blast.html
> >
> > When I try parsing the above "blast.html" file using example number 4
> > from this file:
> >
> > http://bioperl.org/HOWTOs/html/Graphics-HOWTO.html
> >
> > I get errors.
> >
> > What I ended up doing is writing a perl "de-htmlizer" that I use to
> > convert an html blast output file into a text-only blast output file.
> > Then I run the result through a bioperl blast parsing script.  Is
> > there a more elegant way to do this?
> >
> >
>
> --
> Jason Stajich
> Duke University
> jason at cgt.mc.duke.edu
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman
From brian_osborne at cognia.com  Wed Aug 13 08:42:04 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Wed Aug 13 08:45:24 2003
Subject: [Bioperl-l] Re: parsing BLAST html
In-Reply-To: <004a01c360df$bb1d77f0$f500000a@planaria2>
Message-ID: <GAEDKMGOKFBLJPKCLKCCKELJDAAA.brian_osborne@cognia.com>

Sofia,

Just making sure here. The output from StripHTML can be parsed by SearchIO?
This probably belongs in the FAQ.

Brian O.

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Sofia
Sent: Tuesday, August 12, 2003 10:41 AM
To: Bioperl Mailing List
Subject: [Bioperl-l] Re: parsing BLAST html

I use PerlIO::via::StripHTML and it works quite successfully
-
Sofia

Hi Wes,
Before I parse my html blast I use PerlIO::via::StripHTML.  It removes all
html and I save the new file as the orginalFileName.out.  I like the html
blast output because I save them later for another use. But if I didnt need
them I would just use text output.

use strict;
use Bio::SearchIO;
use PerlIO::via::StripHTML;

my @dir_html_files = </usr/local/www/Blast/NcbiBlast/*.htm>;
foreach my $file (@dir_html_files){
 my $outfile  = $file."\.out";
 open OUTFILE, ">$outfile";
 open INFILE, '<:via(StripHTML)', $file
    or die "Can't open $outfile: $!\n";
 while (<INFILE>){
  print OUTFILE $_;
 }
}

-Sofia
----- Original Message -----
From: "Jason Stajich" <jason@cgt.duhs.duke.edu>
To: "Wes Barris" <wes.barris@csiro.au>
Cc: "Bioperl Mailing List" <bioperl-l@bioperl.org>
Sent: Tuesday, August 12, 2003 6:23 AM
Subject: Re: [Bioperl-l] Parsing html blast output?


> No, it is not currently possible to parse BLAST HTML output.
>
> On Tue, 12 Aug 2003, Wes Barris wrote:
>
> > Hi,
> >
> > I know it is possible to use the SearchIO functions to parse either
> > text blast output or xml blast output.  However, I would like to know
> > if it is possible to parse html blast output?  For example, if I wanted
> > to parse the output of this command:
> >
> > blastcl3 -d nr -p blastn -T -i fasta.txt -o blast.html
> >
> > When I try parsing the above "blast.html" file using example number 4
> > from this file:
> >
> > http://bioperl.org/HOWTOs/html/Graphics-HOWTO.html
> >
> > I get errors.
> >
> > What I ended up doing is writing a perl "de-htmlizer" that I use to
> > convert an html blast output file into a text-only blast output file.
> > Then I run the result through a bioperl blast parsing script.  Is
> > there a more elegant way to do this?
> >
> >
>
> --
> Jason Stajich
> Duke University
> jason at cgt.mc.duke.edu
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman


From cain at cshl.org  Wed Aug 13 09:23:27 2003
From: cain at cshl.org (Scott Cain)
Date: Wed Aug 13 09:23:29 2003
Subject: [Bioperl-l] SeqIO BEGIN block kills Gbrowse
Message-ID: <1060781043.1430.9.camel@localhost.localdomain>

Hi Mark,

I think this is a CGI.pm problem--Lincoln and I have gone back and forth
about this, but I seem to remember that the problem was fixed with an
update of CGI.pm.

Also, you might want to send/cc notes like this to the GBrowse list:
gmod-gbrowse@lists.sourceforge.net.

Thanks,
Scott


--- Original Message ---
Date: 12 Aug 2003 15:01:14 -0600
From: Mark Wilkinson <markw@illuminae.com>
Subject: [Bioperl-l] SeqIO BEGIN block kills Gbrowse
To: bioperl-l@bioperl.org
Message-ID: <1060722074.1709.106.camel@localhost.localdomain>
Content-Type: text/plain

Hi all,

Just a heads-up that the eval in the BEGIN block of SeqIO.pm mucks-up
the gbrowse CGI (apparently because the error message is printed to the
screen before the CGI header).  I suppose this is something that is best
fixed at the gbrowse end of the stick, but I thought I'd post a note
about it here anyway.  It it doesn't look like it will be an easy thing
to fix given the early point at which that line is going to execute...

M

-- 
Mark Wilkinson <markw@illuminae.com>
Illuminae
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain@cshl.org
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory

From matthias.wahl at gsf.de  Wed Aug 13 19:02:28 2003
From: matthias.wahl at gsf.de (Matthias Wahl)
Date: Wed Aug 13 09:47:28 2003
Subject: [Bioperl-l] Bio::DB::GFF problem
Message-ID: <3F3AC384.5010100@gsf.de>

Hi all!

I have trouble in using Bio::DB::GFF with the following code:

my $aggregator = Bio::DB::GFF::Aggregator->new(-method    => 'gene_density'
                                               -sub_parts => 'EnsEMBL:gene_density');

my $gff_db = Bio::DB::GFF->new(-adaptor =>'dbi::mysqlopt',
                               -dsn=>'dbi:mysql:Mus_musculus_GFF',
                               -user => 'xxxxx',
			       -pass => 'xxxxx',
			       -aggregator => $aggregator
			       );


Calling

$gff_db->segment(-class=>'Chromosome',
                 -value=>'1');

always returns undef (whatever arguments I use)!
The database has been generated by loading a GFF file of the following 
format:

1	EnsEMBL gene_density    1000001 2000000 0                       Chromosome 1

1       EnsEMBL gene_density    2000001 3000000 0                       Chromosome 1

1       EnsEMBL gene_density    3000001 4000000 1                       Chromosome 1

1       EnsEMBL gene_density    4000001 5000000 12                      Chromosome 1

1       EnsEMBL gene_density    5000001 6000000 4                       Chromosome 1

with load_gff.PLS (columns are tab-seperated, the 9th column consists of 
'Chromosome' and name, seperated by space), both with and without the 
associated sequence file.

Calling

$gff_db->features()

works fine. But I need aggregated features for generating a 
Bio::Graphics xyplot (to plot the gene density for a particular chromosome).

Many thanks,

Matthias

-- 
Matthias Wahl
GSF-National Research Center for Environment and Health
Institute of Developmental Genetics
Ingolstaedter Landstrasse 1
D-85764 Neuherberg
Germany
TEL: ++49 89 3187-4117,-2638
FAX: ++49 89 3187-3099
E-mail: matthias.wahl@gsf.de
WWW: http://www.gsf.de/idg


From pm66 at nyu.edu  Wed Aug 13 11:20:49 2003
From: pm66 at nyu.edu (Philip MacMenamin)
Date: Wed Aug 13 11:20:34 2003
Subject: [Bioperl-l] epcr to gff parser. 
Message-ID: <200308131521.h7DFL7JJ006819@mx3.nyu.edu>

Hi, 

Appologies if this is silly question, but how would you parse an ePCR file 
and output a GFF file? 
I have been looking through bioPerl documentation and  

my $parser = new Bio::Tools::EPCR(-file => 'epcr_755_all.txt'); 

Seems to look right for a start, but how do output GFF? I was looking at the 
SeqAnalysisParserFactoryI get_parser method, Im just not sure how this is all 
working. I dont really want to write my own parser, since im sure somthing is 
out there already...

Thanks...
From jason at cgt.duhs.duke.edu  Wed Aug 13 11:50:56 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Wed Aug 13 11:33:25 2003
Subject: [Bioperl-l] epcr to gff parser. 
In-Reply-To: <200308131521.h7DFL7JJ006819@mx3.nyu.edu>
References: <200308131521.h7DFL7JJ006819@mx3.nyu.edu>
Message-ID: <Pine.LNX.4.50.0308131150170.9904-100000@tenero.duhs.duke.edu>

use Bio::Tools::GFF;

my $out = new Bio::Tools::GFF(-file => ">newfile.gff");
my $parser = new Bio::Tools::EPCR(-file => 'epcr_755_all.txt');
while( my $f = $parser->next_feature ) {
  $out->write_feature($f);
}
On Wed, 13 Aug 2003, Philip MacMenamin wrote:

> Hi,
>
> Appologies if this is silly question, but how would you parse an ePCR file
> and output a GFF file?
> I have been looking through bioPerl documentation and
>
> my $parser = new Bio::Tools::EPCR(-file => 'epcr_755_all.txt');
>
> Seems to look right for a start, but how do output GFF? I was looking at the
> SeqAnalysisParserFactoryI get_parser method, Im just not sure how this is all
> working. I dont really want to write my own parser, since im sure somthing is
> out there already...
>
> Thanks...
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From markw at illuminae.com  Wed Aug 13 11:43:35 2003
From: markw at illuminae.com (Mark Wilkinson)
Date: Wed Aug 13 11:43:36 2003
Subject: [BioPerl] [Bioperl-l] SeqIO BEGIN block kills Gbrowse
In-Reply-To: <1060781043.1430.9.camel@localhost.localdomain>
References: <1060781043.1430.9.camel@localhost.localdomain>
Message-ID: <1060789450.1710.54.camel@localhost.localdomain>

Thanks for the heads-up.  I'll do that.

Sorry bio-perlers!  I didn't have the time/energy to look deeper than
the error message itself, which pointed to SeqIO.pm.

M

On Wed, 2003-08-13 at 07:24, Scott Cain wrote:
> Hi Mark,
> 
> I think this is a CGI.pm problem--Lincoln and I have gone back and forth
> about this, but I seem to remember that the problem was fixed with an
> update of CGI.pm.
> 
> Also, you might want to send/cc notes like this to the GBrowse list:
> gmod-gbrowse@lists.sourceforge.net.
> 
> Thanks,
> Scott
> 
> 
> --- Original Message ---
> Date: 12 Aug 2003 15:01:14 -0600
> From: Mark Wilkinson <markw@illuminae.com>
> Subject: [Bioperl-l] SeqIO BEGIN block kills Gbrowse
> To: bioperl-l@bioperl.org
> Message-ID: <1060722074.1709.106.camel@localhost.localdomain>
> Content-Type: text/plain
> 
> Hi all,
> 
> Just a heads-up that the eval in the BEGIN block of SeqIO.pm mucks-up
> the gbrowse CGI (apparently because the error message is printed to the
> screen before the CGI header).  I suppose this is something that is best
> fixed at the gbrowse end of the stick, but I thought I'd post a note
> about it here anyway.  It it doesn't look like it will be an easy thing
> to fix given the early point at which that line is going to execute...
> 
> M
> 
> -- 
> Mark Wilkinson <markw@illuminae.com>
> Illuminae
-- 
Mark Wilkinson <markw@illuminae.com>
Illuminae

From ajm6q at virginia.edu  Wed Aug 13 14:31:12 2003
From: ajm6q at virginia.edu (Aaron J Mackey)
Date: Wed Aug 13 14:49:08 2003
Subject: [Bioperl-l] Re: parsing BLAST html
In-Reply-To: <GAEDKMGOKFBLJPKCLKCCKELJDAAA.brian_osborne@cognia.com>
Message-ID: <Pine.OSF.4.33.0308131426000.11359-100000@alpha10.bioch.virginia.edu>


Brian, you may want to add that something like this should also work:

use Bio::SearchIO;
use Bio::SearchIO::blast;
use HTML::Strip;

my $hs = new HTML::Strip;

# replace the blast parser's _readline method with one that
# auto-strips HTML:

sub Bio::SearchIO::blast::_readline {
  my ($self, @args) = @_;
  return $hs->parse($self->SUPER::_readline(@args));
}

$io = new Bio::SearchIO -file => "etc", -format => "blast";
# etc ...

-Aaron



On Wed, 13 Aug 2003, Brian Osborne wrote:

> Sofia,
>
> Just making sure here. The output from StripHTML can be parsed by SearchIO?
> This probably belongs in the FAQ.
>
> Brian O.
>
> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org
> [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Sofia
> Sent: Tuesday, August 12, 2003 10:41 AM
> To: Bioperl Mailing List
> Subject: [Bioperl-l] Re: parsing BLAST html
>
> I use PerlIO::via::StripHTML and it works quite successfully
> -
> Sofia
>
> Hi Wes,
> Before I parse my html blast I use PerlIO::via::StripHTML.  It removes all
> html and I save the new file as the orginalFileName.out.  I like the html
> blast output because I save them later for another use. But if I didnt need
> them I would just use text output.
>
> use strict;
> use Bio::SearchIO;
> use PerlIO::via::StripHTML;
>
> my @dir_html_files = </usr/local/www/Blast/NcbiBlast/*.htm>;
> foreach my $file (@dir_html_files){
>  my $outfile  = $file."\.out";
>  open OUTFILE, ">$outfile";
>  open INFILE, '<:via(StripHTML)', $file
>     or die "Can't open $outfile: $!\n";
>  while (<INFILE>){
>   print OUTFILE $_;
>  }
> }
>
> -Sofia
> ----- Original Message -----
> From: "Jason Stajich" <jason@cgt.duhs.duke.edu>
> To: "Wes Barris" <wes.barris@csiro.au>
> Cc: "Bioperl Mailing List" <bioperl-l@bioperl.org>
> Sent: Tuesday, August 12, 2003 6:23 AM
> Subject: Re: [Bioperl-l] Parsing html blast output?
>
>
> > No, it is not currently possible to parse BLAST HTML output.
> >
> > On Tue, 12 Aug 2003, Wes Barris wrote:
> >
> > > Hi,
> > >
> > > I know it is possible to use the SearchIO functions to parse either
> > > text blast output or xml blast output.  However, I would like to know
> > > if it is possible to parse html blast output?  For example, if I wanted
> > > to parse the output of this command:
> > >
> > > blastcl3 -d nr -p blastn -T -i fasta.txt -o blast.html
> > >
> > > When I try parsing the above "blast.html" file using example number 4
> > > from this file:
> > >
> > > http://bioperl.org/HOWTOs/html/Graphics-HOWTO.html
> > >
> > > I get errors.
> > >
> > > What I ended up doing is writing a perl "de-htmlizer" that I use to
> > > convert an html blast output file into a text-only blast output file.
> > > Then I run the result through a bioperl blast parsing script.  Is
> > > there a more elegant way to do this?
> > >
> > >
> >
> > --
> > Jason Stajich
> > Duke University
> > jason at cgt.mc.duke.edu
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

-- 
 Aaron J Mackey
 Pearson Laboratory
 University of Virginia
 (434) 924-2821
 amackey@virginia.edu


From brian_osborne at cognia.com  Wed Aug 13 16:19:32 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Wed Aug 13 16:24:40 2003
Subject: [Bioperl-l] Re: parsing BLAST html
In-Reply-To: <Pine.OSF.4.33.0308131426000.11359-100000@alpha10.bioch.virginia.edu>
Message-ID: <GAEDKMGOKFBLJPKCLKCCMEMIDAAA.brian_osborne@cognia.com>

Aaron,

Understood.

Brian O.

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Aaron J Mackey
Sent: Wednesday, August 13, 2003 2:31 PM
To: Brian Osborne
Cc: Sofia; Bioperl Mailing List
Subject: RE: [Bioperl-l] Re: parsing BLAST html


Brian, you may want to add that something like this should also work:

use Bio::SearchIO;
use Bio::SearchIO::blast;
use HTML::Strip;

my $hs = new HTML::Strip;

# replace the blast parser's _readline method with one that
# auto-strips HTML:

sub Bio::SearchIO::blast::_readline {
  my ($self, @args) = @_;
  return $hs->parse($self->SUPER::_readline(@args));
}

$io = new Bio::SearchIO -file => "etc", -format => "blast";
# etc ...

-Aaron



On Wed, 13 Aug 2003, Brian Osborne wrote:

> Sofia,
>
> Just making sure here. The output from StripHTML can be parsed by
SearchIO?
> This probably belongs in the FAQ.
>
> Brian O.
>
> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org
> [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Sofia
> Sent: Tuesday, August 12, 2003 10:41 AM
> To: Bioperl Mailing List
> Subject: [Bioperl-l] Re: parsing BLAST html
>
> I use PerlIO::via::StripHTML and it works quite successfully
> -
> Sofia
>
> Hi Wes,
> Before I parse my html blast I use PerlIO::via::StripHTML.  It removes all
> html and I save the new file as the orginalFileName.out.  I like the html
> blast output because I save them later for another use. But if I didnt
need
> them I would just use text output.
>
> use strict;
> use Bio::SearchIO;
> use PerlIO::via::StripHTML;
>
> my @dir_html_files = </usr/local/www/Blast/NcbiBlast/*.htm>;
> foreach my $file (@dir_html_files){
>  my $outfile  = $file."\.out";
>  open OUTFILE, ">$outfile";
>  open INFILE, '<:via(StripHTML)', $file
>     or die "Can't open $outfile: $!\n";
>  while (<INFILE>){
>   print OUTFILE $_;
>  }
> }
>
> -Sofia
> ----- Original Message -----
> From: "Jason Stajich" <jason@cgt.duhs.duke.edu>
> To: "Wes Barris" <wes.barris@csiro.au>
> Cc: "Bioperl Mailing List" <bioperl-l@bioperl.org>
> Sent: Tuesday, August 12, 2003 6:23 AM
> Subject: Re: [Bioperl-l] Parsing html blast output?
>
>
> > No, it is not currently possible to parse BLAST HTML output.
> >
> > On Tue, 12 Aug 2003, Wes Barris wrote:
> >
> > > Hi,
> > >
> > > I know it is possible to use the SearchIO functions to parse either
> > > text blast output or xml blast output.  However, I would like to know
> > > if it is possible to parse html blast output?  For example, if I
wanted
> > > to parse the output of this command:
> > >
> > > blastcl3 -d nr -p blastn -T -i fasta.txt -o blast.html
> > >
> > > When I try parsing the above "blast.html" file using example number 4
> > > from this file:
> > >
> > > http://bioperl.org/HOWTOs/html/Graphics-HOWTO.html
> > >
> > > I get errors.
> > >
> > > What I ended up doing is writing a perl "de-htmlizer" that I use to
> > > convert an html blast output file into a text-only blast output file.
> > > Then I run the result through a bioperl blast parsing script.  Is
> > > there a more elegant way to do this?
> > >
> > >
> >
> > --
> > Jason Stajich
> > Duke University
> > jason at cgt.mc.duke.edu
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
 Aaron J Mackey
 Pearson Laboratory
 University of Virginia
 (434) 924-2821
 amackey@virginia.edu


_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From jason at cgt.duhs.duke.edu  Thu Aug 14 08:33:10 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Thu Aug 14 08:15:21 2003
Subject: [Bioperl-l] the roundup (long)
Message-ID: <Pine.LNX.4.50.0308121424430.1614-100000@tenero.duhs.duke.edu>

I've added a bunch of new things and fixed some bugs, wanted to try and
summarize before I get too busy and forget the details.

Here is the roundup.

[Bio::PopGen]

New code in Bio::PopGen implements several statistics for use in testing
the neutrality of mutations in a population these include Tajima's D, Fu
and Li's D, Fu and Li's F, as well as some utilities like Theta and Pi.
These are still being put through the paces to insure that are calculating
everything properly.

A basic Coalescent simulator was already in Bioperl named
Bio::Tree::RandomTree.  This has been renamed
Bio::PopGen::Simulation::Coalescent and uses the revamped
Bio::Tree::AlleleNode objects.

Added an LD calculation implemention in composite_LD for unphased data.
Will also have D-prime by the end of the week for haplotype data.  These
are in Bio::PopGen::Statistics.  Bio::PopGen::PopStats has an
implementation of Fst to test for population structure.

The PopGen::Individual, PopGen::Population, PopGen::Genotype interface and
implementations seem to be reaching a stable point.  I've also unified
these with the bioperl-pedigree code (a separate CVS module).  Some more
small tweaks will probably go in over the coming months as things get put
through the paces, but I hope this can become stable code for a while.

In order to get allele/genotype data into Bioperl have added
Bio::PopGen::IO which can parse in csv delimited files as well as
prettybase format.  I expect to have the code to take SimpleAlign objects
and turn them into PopGen::Individuals written shortly.

To be sure and give credit - all the PopGen stuff is in collaboration with
Matthew Hahn.  We are preparing a tutorial to these objects which should
be out there in the Fall.


[Bio::Matrix]
I added Bio::Matrix::IO to implement a framework for simple matrix
parsing.  This is only to try and simplify things even though different
types of matricies are not equateable.  I added a scoring matrix parser
(IO::scoring) for BLOSUM/PAM matrix parsing.  It unsurprisinging produces
Bio::Matrix::Scoring objects.  Also added IO::phylip to parse phylip
distance matricies and thus produce Bio::Matrix::PhylipDist.  I also added
a general purpose object Bio::Matrix::Generic which is a starting place
for putting column and row data.  This is probably NOT the object you want
to use for PWM and PSSMs - perhaps Stefan Kirov's stuff will fit in here.


[memory leaks - Bio::Tree and Bio::SeqFeature]
Some memory leaks have been fixed for Trees and SeqFeatures.  Perl won't
cleanup and break memory cycles unless you explictly break them in the
DESTROY code.  However with our object hierarchy DESTROY is not
necessarily getting called by all subclass unless we do the whole chained
destructor (analagous to our chained constructors).  The way I solved it
is to use the already written _register_for_cleanup method which is called
in the constructor to specify the cleanup method instead of relying on
DESTROY.  This seems to work.  The only downside is in the case of things
like a Bio::Tree::Tree.   In this case the tree structure is implicit in
the Nodes and their pointers to children/parents.  The problem comes in if
we reuse all or part of the tree to do some test - like this
sub foo {
my @nodes = @_;
my $tree = new Bio::Tree::Tree(-nodes => \@nodes);
...

# tree gets destroyed at the end of scope
}

The problem is by default the tree destruction means also destroy the
containing nodes, which is a problem if you want to use those nodes for
something later.  The solution is at the end to set the root_node_pointer
to undef and thus the tree has no way to destroy the underlying nodes.
However this might be hard to remember to do all the time.

I introduced a -nodelete option (method name nodelete) to the constructor
(default value is false) which if true will not destroy the underlying
nodes.

A similar problem existed for SeqFeature FeaturePairs, I've added the code
in SeqFeature::Generic, SeqFeature::FeaturePair, and
SeqFeature::Gene::GeneStructure & SeqFeature::Gene::Transcript
which should take care of this now.  I was able successfully parse a large
number of genewise reports which each generated gene/transript sets which
previously had caused my perl to crash running out of memory so I feel we
have removed some (probably not all) of the leaks that get introduced
when there are cycles.

The memleak bugs were also fixed on the 1.2 branch for what its worth.


[Bio::SearchIO]
Added some more SearchIO parsers.  Borrowing from Bala's Tools::Blat
impelementation I made a SearchIO::psl parser which can parse PSL output.
It needs to be tweaked a little more to skip the header lines if they are
produced but works for me for output from Jim's lav2Psl code.

Additionally a SearchIO::blasttable has been added which can parse NCBI -m
8 or -m 9 output for those just needing some minimal information.


[other bugs - from changelog]
    o Bio::SearchIO
      - Fixed bugs in BLAST parsing which couldn't parse NCBI
        gapped blast properly (was losing hit significance values due to
        the extra unexpeted column).
      - Parsing of blastcl3 (netblast from NCBI) now can handle case of
        integer overflow (# of letters in nt seq dbs is > MAX_INT)
        although doesn't try to correct it - will get the negative
        number for you.  Added a test for this as well.
      - Fixed HMMER parsing bug which prevented parsing when a hmmpfam report
        has no top-level family classification scores but does have scores and
        alignments for individual domains.

On the 1.2 branch I also fixed a couple of places in SeqIO::genbank
and SeqIO::bsml where we weren't dereferencing the arrayref for keywords.

-jason
--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From jason at cgt.duhs.duke.edu  Thu Aug 14 08:38:07 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Thu Aug 14 08:20:17 2003
Subject: [Bioperl-l] question about SeqIO and BSML DTD
In-Reply-To: <OF65D8650C.8BB83D11-ON88256D7F.0069C37F-88256D7F.006A5B6E@accelrys.com>
References: <OF65D8650C.8BB83D11-ON88256D7F.0069C37F-88256D7F.006A5B6E@accelrys.com>
Message-ID: <Pine.LNX.4.50.0308140833210.16897-100000@tenero.duhs.duke.edu>

Short answer is no - there is no easy way to do it because of the way
this module is written.  I have no idea how different 3.1 is from 2.2 as
to how much of a code change this is.


This module is still looking for an 'owner' or someone to maintain it -
preferrably someone who actually uses BSML so they can be closer to some
of the nuances of the format.  Volunteers welcome.

-jason

On Mon, 11 Aug 2003, Susan Cassidy wrote:

> Hi,
> It looks like the current (1.2.2) bioperl bsml functions are set up to use
> the BSML 2.2 DTD.  I would like to use the 3.1 DTD instead.  Is there some
> easy way to have things like SeqIO create BSML output using the 3.1 DTD?
> I'm not sure how the internal handling of all the DTD stuff works, but I
> do see that the DTD URL is hard-coded in bsml.pm to be
> "http://www.labbook.com/dtd/bsml2_2.dtd".
>
> It would be wonderful if it were as easy as changing that!  But, I won't
> hold my breath!
>
> I'm doing some experimentation with converting sequences from formats such
> as Genbank into BSML, and this makes it really simple.
>
> Please reply to this email address and not just to the list, as I don't
> subscribe to it.
>
> Any advice appreciated.
>
> Thanks,
> Susan Cassidy

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From anelda at sanbi.ac.za  Thu Aug 14 08:58:28 2003
From: anelda at sanbi.ac.za (Anelda Boardman)
Date: Thu Aug 14 08:58:00 2003
Subject: [Bioperl-l] Installing Bioperl - Dependencies problem
Message-ID: <45502.196.38.142.111.1060865908.squirrel@webmail.sanbi.ac.za>

Hallo,

I've been trying to install Bioperl, but ran into some trouble with the
dependencies...  After running 'perl Makefile.PL' I got the message that
Ace and DBD::mysql are needed.

I downloaded DBD::mysql-2.9002 from CPAN and tried to install it according
to the instructions. 'perl Makefile.PL' runs smoothly, but when I want to
'make', something goes wrong and I can't figure out what to do to solve
the problem. Please could someone help me?

This is part of the error message:

[root@jive DBD-mysql-2.1028]# make
cp lib/DBD/mysql.pm blib/lib/DBD/mysql.pm
cp lib/DBD/mysql/INSTALL.pod blib/lib/DBD/mysql/INSTALL.pod
cp lib/Mysql.pm blib/lib/Mysql.pm
cp lib/Mysql/Statement.pm blib/lib/Mysql/Statement.pm
cp lib/DBD/mysql.pod blib/lib/DBD/mysql.pod
cp lib/Bundle/DBD/mysql.pm blib/lib/Bundle/DBD/mysql.pm
cc -c  -I/usr/local/lib/perl5/site_perl/5.8.0/i686-linux/auto/DBI
-I'/usr/include' -fno-strict-aliasing -D_LARGEFILE_SOURCE
-D_FILE_OFFSET_BITS=64 -I/usr/include/gdbm -O3   -DVERSION=\"2.1028\"
-DXS_VERSION=\"2.1028\" -fpic
"-I/usr/local/lib/perl5/5.8.0/i686-linux/CORE"   dbdimp.c
In file included from dbdimp.c:29:
dbdimp.h:31:49: mysql.h: No such file or directory
dbdimp.h:32:49: errmsg.h: No such file or directory
In file included from dbdimp.c:29:
dbdimp.h:116: parse error before "MYSQL"
dbdimp.h:116: warning: no semicolon at end of struct or union
dbdimp.h:122: parse error before '}' token
dbdimp.h:151: parse error before "MYSQL_RES"
dbdimp.h:151: warning: no semicolon at end of struct or union
dbdimp.h:164: parse error before '}' token
In file included from dbdimp.c:29:


What should I do?

Thanks!
Anelda


From jason at cgt.duhs.duke.edu  Thu Aug 14 09:26:33 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Thu Aug 14 09:08:55 2003
Subject: [Bioperl-l] Installing Bioperl - Dependencies problem
In-Reply-To: <45502.196.38.142.111.1060865908.squirrel@webmail.sanbi.ac.za>
References: <45502.196.38.142.111.1060865908.squirrel@webmail.sanbi.ac.za>
Message-ID: <Pine.LNX.4.50.0308140923530.17286-100000@tenero.duhs.duke.edu>

On Thu, 14 Aug 2003, Anelda Boardman wrote:

> Hallo,
>
> I've been trying to install Bioperl, but ran into some trouble with the
> dependencies...  After running 'perl Makefile.PL' I got the message that
> Ace and DBD::mysql are needed.
>
You nnly need these if you want to run Bio::DB::GFF (DBD::mysql) and
Bio::SeqIO::ace (Ace)

> I downloaded DBD::mysql-2.9002 from CPAN and tried to install it according
> to the instructions. 'perl Makefile.PL' runs smoothly, but when I want to
> 'make', something goes wrong and I can't figure out what to do to solve
> the problem. Please could someone help me?
>
> This is part of the error message:
>

DBD::mysql requires you have installed the mysql libraries on your system
- if you are using a linux distro - something like mysql and mysql-devel
are needed.
But you only have to do this if you want to use modules which need
DBD::mysql (Bio::DB::GFF with a mysql backend).

> [root@jive DBD-mysql-2.1028]# make
> cp lib/DBD/mysql.pm blib/lib/DBD/mysql.pm
> cp lib/DBD/mysql/INSTALL.pod blib/lib/DBD/mysql/INSTALL.pod
> cp lib/Mysql.pm blib/lib/Mysql.pm
> cp lib/Mysql/Statement.pm blib/lib/Mysql/Statement.pm
> cp lib/DBD/mysql.pod blib/lib/DBD/mysql.pod
> cp lib/Bundle/DBD/mysql.pm blib/lib/Bundle/DBD/mysql.pm
> cc -c  -I/usr/local/lib/perl5/site_perl/5.8.0/i686-linux/auto/DBI
> -I'/usr/include' -fno-strict-aliasing -D_LARGEFILE_SOURCE
> -D_FILE_OFFSET_BITS=64 -I/usr/include/gdbm -O3   -DVERSION=\"2.1028\"
> -DXS_VERSION=\"2.1028\" -fpic
> "-I/usr/local/lib/perl5/5.8.0/i686-linux/CORE"   dbdimp.c
> In file included from dbdimp.c:29:
> dbdimp.h:31:49: mysql.h: No such file or directory
> dbdimp.h:32:49: errmsg.h: No such file or directory
> In file included from dbdimp.c:29:
> dbdimp.h:116: parse error before "MYSQL"
> dbdimp.h:116: warning: no semicolon at end of struct or union
> dbdimp.h:122: parse error before '}' token
> dbdimp.h:151: parse error before "MYSQL_RES"
> dbdimp.h:151: warning: no semicolon at end of struct or union
> dbdimp.h:164: parse error before '}' token
> In file included from dbdimp.c:29:
>
>
> What should I do?
>
> Thanks!
> Anelda
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From jamie at genome.arizona.edu  Thu Aug 14 12:35:52 2003
From: jamie at genome.arizona.edu (Jamie Hatfield)
Date: Thu Aug 14 12:35:54 2003
Subject: [Bioperl-l] Re: Bio::FPC
In-Reply-To: <Pine.GSO.3.96.1030811161601.13501H-100000@beacon.stanford.edu>
References: <Pine.GSO.3.96.1030811161601.13501H-100000@beacon.stanford.edu>
Message-ID: <1060878865.562.26.camel@motox>

Yes, actually.  We are just now finishing up the fpc parser.  I was
planning on soon asking the group how I would go about submitting it? 
It consists of 5 modules that we have put in the MapIO and Map
namespaces.
Bio::MapIO::fpc.pm
Bio::Map::physical.pm
Bio::Map::fpcmarker.pm  (sorry, but marker doesn't work)
Bio::Map::clone.pm
Bio::Map::contig.pm

If you want to see how this object might be used, check out
http://www.genome.arizona.edu/software/fpc/biofpc/index.html

You'll see there documentation for the modules, and a few test cases or
example usages.

Also, we are trying to make a generic converter to let you load in a fpc
file and generate the necessary GFF for GBrowse to display the fpc map. 
It's a quite simple display of the clones, markers, and contigs, but
maybe that will be usefull as an alternative to WebFPC (a java view only
version of fpc).  It works for us, but might not work for everybody.  We
should be able to patch it up, though, if it's missing features.

So, anyways, if somebody can let me know how to go about submitting it,
we'll start the process.  I looked through the FAQ and it basically said
to just post information if you have a module that you would like to
contribute, so, here's the information.

Jamie


On Mon, 2003-08-11 at 16:21, Yee Man Chan wrote:
> Hi Jamie and all,
> 
> 	My boss asked me to parse an FPC file. So I searched the bioperl
> mailing list archive for "FPC". I found that there was a discussion back
> in Nov 2002 about it. I am wondering whether this FPC parse is done or
> not. If it is workable now, can anyone tell me where I can download it?
> Otherwise, can someone point me to a spec of an FPC parser?
> 
> Thanks a lot.
> Yee Man
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From prakash at ece.arizona.edu  Thu Aug 14 14:18:03 2003
From: prakash at ece.arizona.edu (Jayaprakash Rudraraju)
Date: Thu Aug 14 14:15:27 2003
Subject: [Bioperl-l] Padded position in Consensus sequence
In-Reply-To: <20030428151443.96788.qmail@web41104.mail.yahoo.com>
References: <20030428151443.96788.qmail@web41104.mail.yahoo.com>
Message-ID: <Pine.GSO.4.50.0308141049460.17345-100000@shellfish.ece.arizona.edu>


Hi,

I have written a small subroutine to as part of the program to tag primers
in Consed. The following subroutine gives padded position on the consensus
sequence, given its position on reference sequence.

#!perl -w
my $consensus = "AGG*TGAC**TA***AGTCCT*T";
print map { "$_\t". padded_position($_) ."\n"} (1..16);

sub padded_position {
    my ($unpad, $pads) = (@_, 0);
    $pads++ until $unpad == substr($consensus, 0, $unpad+$pads) =~ tr/ACGT//;
    $unpad+$pads;
}

can you suggest me some more efficient or elegant solutions. Eventhough I
have condensed it as much as I can, I am looking for a simpler logic.

Prakash.

--
My favorite animal is steak.
-- Fran Lebowitz (1950 - )

From jamie at genome.arizona.edu  Thu Aug 14 14:35:55 2003
From: jamie at genome.arizona.edu (Jamie Hatfield)
Date: Thu Aug 14 14:35:57 2003
Subject: [Bioperl-l] Padded position in Consensus sequence
In-Reply-To: <Pine.GSO.4.50.0308141049460.17345-100000@shellfish.ece.arizona.edu>
References: <20030428151443.96788.qmail@web41104.mail.yahoo.com> 
	<Pine.GSO.4.50.0308141049460.17345-100000@shellfish.ece.arizona.edu>
Message-ID: <1060886069.562.36.camel@motox>

The Bio::LocatableSeq object is good at doing what you're looking for.

#!/usr/local/bin/perl -w
use Bio::LocatableSeq;
my $consensus = "AGG*TGAC**TA***AGTCCT*T";

 ## gaps are represented using '-' instead of '*' in this object.
 ## either way, though, we need a count of the number of gaps.
 ## if your seq already had '-' representing gaps, then
 ## my $gaps = ($consensus =~ s/-/-/g); 
 ## would still work.
my $gaps = ($consensus =~ s/\*/-/g);
my $seq = new Bio::LocatableSeq(-seq => $consensus, 
                                -id => "consensus",
                                -start => 1, 
                                -end => length($consensus)-$gaps);

print map { "$_\t" . $seq->column_from_residue_number($_) . "\n" } 
      ($seq->start..$seq->end);

On Thu, 2003-08-14 at 11:18, Jayaprakash Rudraraju wrote:
> 
> Hi,
> 
> I have written a small subroutine to as part of the program to tag primers
> in Consed. The following subroutine gives padded position on the consensus
> sequence, given its position on reference sequence.
> 
> #!perl -w
> my $consensus = "AGG*TGAC**TA***AGTCCT*T";
> print map { "$_\t". padded_position($_) ."\n"} (1..16);
> 
> sub padded_position {
>     my ($unpad, $pads) = (@_, 0);
>     $pads++ until $unpad == substr($consensus, 0, $unpad+$pads) =~ tr/ACGT//;
>     $unpad+$pads;
> }
> 
> can you suggest me some more efficient or elegant solutions. Eventhough I
> have condensed it as much as I can, I am looking for a simpler logic.
> 
> Prakash.
> 
> --
> My favorite animal is steak.
> -- Fran Lebowitz (1950 - )
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From prakash at ece.arizona.edu  Thu Aug 14 15:11:01 2003
From: prakash at ece.arizona.edu (Jayaprakash Rudraraju)
Date: Thu Aug 14 15:07:04 2003
Subject: [Bioperl-l] Padded position in Consensus sequence
In-Reply-To: <1060886069.562.36.camel@motox>
References: <20030428151443.96788.qmail@web41104.mail.yahoo.com> 
	<Pine.GSO.4.50.0308141049460.17345-100000@shellfish.ece.arizona.edu>
	<1060886069.562.36.camel@motox>
Message-ID: <Pine.GSO.4.50.0308141153220.17345-100000@shellfish.ece.arizona.edu>


Hi Jamie,

Just tested it. Works great. Thanks for the reply and nice to know that
you are just few blocks away from here. I work as a programmer in Arizona
Respiratory Center at the University Medical Center. I don't use modules
in perl, except when I have to deal with excel spreadsheets.

Our lab is not involved in any software research projects, so I never
found it useful to use bio-perl modules. But, I will read the module
documention for Bio::LocatableSeq to also look for other functions, which
might be useful in future.

Thanks,
Prakash.

11:34am, IP packets from Jamie Hatfield delivered:

> The Bio::LocatableSeq object is good at doing what you're looking for.
>
> #!/usr/local/bin/perl -w
> use Bio::LocatableSeq;
> my $consensus = "AGG*TGAC**TA***AGTCCT*T";
>
>  ## gaps are represented using '-' instead of '*' in this object.
>  ## either way, though, we need a count of the number of gaps.
>  ## if your seq already had '-' representing gaps, then
>  ## my $gaps = ($consensus =~ s/-/-/g);
>  ## would still work.
> my $gaps = ($consensus =~ s/\*/-/g);
> my $seq = new Bio::LocatableSeq(-seq => $consensus,
>                                 -id => "consensus",
>                                 -start => 1,
>                                 -end => length($consensus)-$gaps);
>
> print map { "$_\t" . $seq->column_from_residue_number($_) . "\n" }
>       ($seq->start..$seq->end);
>
> On Thu, 2003-08-14 at 11:18, Jayaprakash Rudraraju wrote:
> >
> > Hi,
> >
> > I have written a small subroutine to as part of the program to tag primers
> > in Consed. The following subroutine gives padded position on the consensus
> > sequence, given its position on reference sequence.
> >
> > #!perl -w
> > my $consensus = "AGG*TGAC**TA***AGTCCT*T";
> > print map { "$_\t". padded_position($_) ."\n"} (1..16);
> >
> > sub padded_position {
> >     my ($unpad, $pads) = (@_, 0);
> >     $pads++ until $unpad == substr($consensus, 0, $unpad+$pads) =~ tr/ACGT//;
> >     $unpad+$pads;
> > }
> >
> > can you suggest me some more efficient or elegant solutions. Eventhough I
> > have condensed it as much as I can, I am looking for a simpler logic.
> >
> > Prakash.
> >
> > --
> > My favorite animal is steak.
> > -- Fran Lebowitz (1950 - )
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>

--
"Whatever women do they must do twice as well as men to be thought
 half as good. Fortunately, this is not difficult."

-- Charlotte Whitton

From ben at cse.wustl.edu  Thu Aug 14 15:19:09 2003
From: ben at cse.wustl.edu (Ben Westover)
Date: Thu Aug 14 15:18:35 2003
Subject: [Bioperl-l] Please help me with Footprinter
Message-ID: <Pine.LNX.4.44.0308141358230.26654-100000@titania.cs.wustl.edu>

Dear Friends,

I am relatively new to bioperl and I am having trouble when I try to run 
Footprinter.  When running what seems to be a fairly straightforward piece 
of code I found at 
http://docs.bioperl.org/bioperl-run/Bio/Tools/Run/FootPrinter.html 
I get the following error:

Can't call method "close" on an undefined value at 
/usr/lib/perl5/site_perl/5.6.1/Bio/Tools/Run/FootPrinter.pm line 418.

I am including the relevant bits of code/information in case anyone can 
help me out.  My main question is where does the filename in $tfh1 come 
from and how can I set it and why is it necessary?   Any help I can get 
would be greatly appreciated.

Warm Regards,
Ben

The treefile is in the local directory and contains the following:
(A,(B,(C,(D,E))))

I created the array of sequences with a set of calls:

my @seqs;
for(my $i=0;$i<$n;$i++){
  my $tmp = Bio::Seq->new(-display_id => $id[$i], -seq => $seq[$i]);
  push(@seqs, $tmp);
}

*** Below is the code ***

my @footprinter_params = (
		      'size'=>8,
		      'max_mutations_per_branch'=>4,
		      'sequence_type'=>'upstream',
		      'subregion_size'=>30,
		      'position_change_cost'=>3,
		      'triplet_filtering'=>1,
		      'pair_filtering'=>1,
		      'post_filtering'=>1,
		      'inversion_cost'=>1,
		      'max_mutations'=>4,
		      'program'=>"FootPrinter",
		      'tree'   =>"treefile",
		      'verbose'=>1);
my $footprinter_factory = 
Bio::Tools::Run::FootPrinter->new(@footprinter_params);

my @fp = $footprinter_factory->run(@seqs);	


*** The offending line is the call to $tfh1->close in _setinput, which is 
called from run as shown below. ***

sub _setinput {
    my ($self,@seq) = @_;
    my ($tfh1,$outfile1);
    $outfile1 = $self->outfile_name();
    if (defined $outfile1) {
    	$self->io()->_initialize_io(-file => $tfh1);
    } else {
	($tfh1,$outfile1) = $self->io->tempfile(-dir=>$self->tempdir);
    }
    my $out1 = Bio::SeqIO->new(-fh=> $tfh1 , '-format' => 'Fasta');
    foreach my $seq(@seq){
	$seq->isa("Bio::PrimarySeqI") || $self->throw("Need a Bio::PrimarySeq compliant object for FootPrinter");
	$out1->write_seq($seq);
    }  
    $tfh1->close;
    undef($tfh1);
    return ($outfile1);
}

sub run {
  my ($self,@seq) = @_;

  #need at least 2 for comparative genomics duh.
  $#seq > 0 || $self->throw("Need at least two sequences");
  $self->tree || $self->throw("Need to specify a phylogenetic tree using -tree option");

  my $infile = $self->_setinput(@seq);

  my $param_string = $self->_setparams();
  my @footprint_feats = $self->_run($infile,$self->tree,$param_string);
  return @footprint_feats;

}

From jason at cgt.duhs.duke.edu  Thu Aug 14 17:20:58 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Thu Aug 14 17:03:09 2003
Subject: [Bioperl-l] Please help me with Footprinter
In-Reply-To: <Pine.LNX.4.44.0308141358230.26654-100000@titania.cs.wustl.edu>
References: <Pine.LNX.4.44.0308141358230.26654-100000@titania.cs.wustl.edu>
Message-ID: <Pine.LNX.4.50.0308141701360.19796-100000@tenero.duhs.duke.edu>

ugh there are some major bugs in the module's code.

It should be written like this:
     if( $outfile1 ) {
       open($tfh1, ">$outfile1") || $self->throw("$outfile1: $!");
     } else {
       ($tfh1,$outfile1) = $self->io->tempfile(-dir=>$self->tempdir);
     }

And at the bottom of the method it should be written:

     $out1->close; # close the SeqIO object
     close($tfh1); # close the filehandle just in case
     undef($tfh1); # really get rid of it
     return ($outfile1);

I'll make the necessary changes.  Quite possibly it was me who did this in
some sort of haste...  Updates coming to CVS in about 15 minutes...

-jason

On Thu, 14 Aug 2003, Ben Westover wrote:

> Dear Friends,
>
> I am relatively new to bioperl and I am having trouble when I try to run
> Footprinter.  When running what seems to be a fairly straightforward piece
> of code I found at
> http://docs.bioperl.org/bioperl-run/Bio/Tools/Run/FootPrinter.html
> I get the following error:
>
> Can't call method "close" on an undefined value at
> /usr/lib/perl5/site_perl/5.6.1/Bio/Tools/Run/FootPrinter.pm line 418.
>
> I am including the relevant bits of code/information in case anyone can
> help me out.  My main question is where does the filename in $tfh1 come
> from and how can I set it and why is it necessary?   Any help I can get
> would be greatly appreciated.
>
> Warm Regards,
> Ben
>
> The treefile is in the local directory and contains the following:
> (A,(B,(C,(D,E))))
>
> I created the array of sequences with a set of calls:
>
> my @seqs;
> for(my $i=0;$i<$n;$i++){
>   my $tmp = Bio::Seq->new(-display_id => $id[$i], -seq => $seq[$i]);
>   push(@seqs, $tmp);
> }
>
> *** Below is the code ***
>
> my @footprinter_params = (
> 		      'size'=>8,
> 		      'max_mutations_per_branch'=>4,
> 		      'sequence_type'=>'upstream',
> 		      'subregion_size'=>30,
> 		      'position_change_cost'=>3,
> 		      'triplet_filtering'=>1,
> 		      'pair_filtering'=>1,
> 		      'post_filtering'=>1,
> 		      'inversion_cost'=>1,
> 		      'max_mutations'=>4,
> 		      'program'=>"FootPrinter",
> 		      'tree'   =>"treefile",
> 		      'verbose'=>1);
> my $footprinter_factory =
> Bio::Tools::Run::FootPrinter->new(@footprinter_params);
>
> my @fp = $footprinter_factory->run(@seqs);
>
>
> *** The offending line is the call to $tfh1->close in _setinput, which is
> called from run as shown below. ***
>
> sub _setinput {
>     my ($self,@seq) = @_;
>     my ($tfh1,$outfile1);
>     $outfile1 = $self->outfile_name();
>     if (defined $outfile1) {
>     	$self->io()->_initialize_io(-file => $tfh1);
>     } else {
> 	($tfh1,$outfile1) = $self->io->tempfile(-dir=>$self->tempdir);
>     }
>     my $out1 = Bio::SeqIO->new(-fh=> $tfh1 , '-format' => 'Fasta');
>     foreach my $seq(@seq){
> 	$seq->isa("Bio::PrimarySeqI") || $self->throw("Need a Bio::PrimarySeq compliant object for FootPrinter");
> 	$out1->write_seq($seq);
>     }
>     $tfh1->close;
>     undef($tfh1);
>     return ($outfile1);
> }
>
> sub run {
>   my ($self,@seq) = @_;
>
>   #need at least 2 for comparative genomics duh.
>   $#seq > 0 || $self->throw("Need at least two sequences");
>   $self->tree || $self->throw("Need to specify a phylogenetic tree using -tree option");
>
>   my $infile = $self->_setinput(@seq);
>
>   my $param_string = $self->_setparams();
>   my @footprint_feats = $self->_run($infile,$self->tree,$param_string);
>   return @footprint_feats;
>
> }
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From jiang.qian at jhmi.edu  Thu Aug 14 16:07:25 2003
From: jiang.qian at jhmi.edu (Jiang Qian)
Date: Thu Aug 14 17:27:01 2003
Subject: [Bioperl-l] question on installation
Message-ID: <3F3BEBFD.1EED0072@jhmi.edu>


Hi,

I am new on BioPerl. I installed the system on a Linux machine through
the procedure of "perl Makefiel.PL" => "make" => "make test" => "make
install". Everything seems okay. But when I tried the script from
tutorial,

use Bio::Perl;
$seq_object = get_sequence('swissprot',"ROA1_HUMAN");
write_sequence(">roa1.fasta",'fasta',$seq_object);

I got the error message " Your system does not have IO::String installed
so the DB retrieval method is not available at
/usr/lib/perl5/site_perl/5.6.1/Bio/Perl.pm line 466
 Bio::Perl::get_sequence('swissprot', 'ROA1_HUMAN') called at
./try_bioperl.pl line 7".

What's the problem? Anyboday can help me with this? Thanks,

-Jiang


From laurichj at bioinfo.ucr.edu  Thu Aug 14 18:06:12 2003
From: laurichj at bioinfo.ucr.edu (Josh Lauricha)
Date: Thu Aug 14 18:05:38 2003
Subject: [Bioperl-l] question on installation
In-Reply-To: <3F3BF229.96A62D3E@jhmi.edu>
References: <3F3BEBFD.1EED0072@jhmi.edu>
	<20030814213802.GA14059@bioinfo.ucr.edu>
	<3F3BF229.96A62D3E@jhmi.edu>
Message-ID: <20030814220612.GA14978@bioinfo.ucr.edu>

On Thu  16:33, Jiang Qian wrote:
> 
> Hi Josh,
> 
> Thank you very much for your help. It works.
> I have one more question:
> I tried to run the example script in bioperl/example directory. However, one
> script gave me the following message:
> "Can't locate Bio/Ontology/simpleGOparser.pm in @INC (@INC contains:
> BEGIN failed--compilation aborted at ./simpleGOparser_example.pl line 5."

It looks like the Bio::Ontology::simpleGOparser is no longer part of the
main distribution, or it just got renamed. I'm not familiar with this
stuff, so does anyone know?

-- 

----------------------------
| Josh Lauricha            |
| laurichj@bioinfo.ucr.edu |
| Bioinformatics, UCR      |
|--------------------------|
From steve_chervitz at affymetrix.com  Thu Aug 14 18:54:44 2003
From: steve_chervitz at affymetrix.com (Steve Chervitz)
Date: Thu Aug 14 18:54:04 2003
Subject: [Bioperl-l] the roundup (long)
In-Reply-To: <Pine.LNX.4.50.0308121424430.1614-100000@tenero.duhs.duke.edu>
Message-ID: <4BEC936C-CEAA-11D7-BF9B-000A95765236@affymetrix.com>

On Thursday, Aug 14, 2003, at 05:33 US/Pacific, Jason Stajich wrote:

> I've added a bunch of new things and fixed some bugs, wanted to try and
> summarize before I get too busy and forget the details.

Good on you, Jason.

> [Bio::SearchIO]
>
> Additionally a SearchIO::blasttable has been added which can parse 
> NCBI -m
> 8 or -m 9 output for those just needing some minimal information.

Just the other week, I was thinking that Bioperl needs this. Glad to 
see you've already done it. Parsing speed and memory usage should be 
improved, eh?

Speaking of blast table parsing, it would really be useful if the NCBI 
blast tabular output included the length of the hit and query 
sequences. This would enable the frac_aligned methods of the Hit and 
HSP objects to work. Being able to determine the percent of the hit and 
query that are aligned is often vital.

I recently mentioned this to a member of the NCBI blast development 
team (Tom Madden) and he seemed pretty receptive to putting this in. 
Don't know what the timeframe would be.

Steve

From jason at cgt.duhs.duke.edu  Thu Aug 14 22:24:43 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Thu Aug 14 22:06:40 2003
Subject: [Bioperl-l] question on installation
In-Reply-To: <3F3BEBFD.1EED0072@jhmi.edu>
References: <3F3BEBFD.1EED0072@jhmi.edu>
Message-ID: <Pine.LNX.4.50.0308142223420.21417-100000@tenero.duhs.duke.edu>

As the error message states, you need to install an additional module
called IO::String.

http://www.cpan.org

On Thu, 14 Aug 2003, Jiang Qian wrote:

>
> Hi,
>
> I am new on BioPerl. I installed the system on a Linux machine through
> the procedure of "perl Makefiel.PL" => "make" => "make test" => "make
> install". Everything seems okay. But when I tried the script from
> tutorial,
>
> use Bio::Perl;
> $seq_object = get_sequence('swissprot',"ROA1_HUMAN");
> write_sequence(">roa1.fasta",'fasta',$seq_object);
>
> I got the error message " Your system does not have IO::String installed
> so the DB retrieval method is not available at
> /usr/lib/perl5/site_perl/5.6.1/Bio/Perl.pm line 466
>  Bio::Perl::get_sequence('swissprot', 'ROA1_HUMAN') called at
> ./try_bioperl.pl line 7".
>
> What's the problem? Anyboday can help me with this? Thanks,
>
> -Jiang
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From wes.barris at csiro.au  Thu Aug 14 23:54:44 2003
From: wes.barris at csiro.au (Wes Barris)
Date: Thu Aug 14 23:54:36 2003
Subject: [Bioperl-l] problem with Graphics
In-Reply-To: <200308121545.33474.sobrien@umail.ucsb.edu>
References: <200308121545.33474.sobrien@umail.ucsb.edu>
Message-ID: <3F3C5984.3070401@csiro.au>

Sean O'Brien wrote:

> Hi,
> 
> I have been trying to get BioPerl to output png's, but I seem to be getting 
> invalid png files.  I have a fresh install of libgd, version 2.0.15 and my GD 
> version is 2.07.  I installed Bundle::BioPerl, and after having no luck, I 
> installed BioPerl version 1.2.2 from the sources in 
> current_core_stable.tar.gz.  When I run 'make test' I get an ok for 
> BioGraphics.  Also, when I run the first script described in the Bio Graphics 
> tutorial, it runs with no errors and outputs some data which appears as 
> though it could be an image.  However, the file seems to be of an invalid png 
> format because it cannot be opened by display, galeon or the GIMP.  This is 
> pretty frustrating because everything apears to be installing/running fine, 
> but then the image is somehow corrupted.  What might I have done wrong/ need 
> to do to make this work.  Thanks.

Hi Sean,

The examples that output png files never worked for me either.  To fix them,
I changed this line:

print $panel->png;

to something like this:

open(OUT, ">junk.png");
binmode OUT;
print OUT $panel->png;
close(OUT);
print("Wrote junk.png\n");

-- 
Wes Barris
E-Mail: Wes.Barris@csiro.au

From jimmyfernandez at hotmail.com  Fri Aug 15 04:43:11 2003
From: jimmyfernandez at hotmail.com (Jimmy Fernandez)
Date: Fri Aug 15 04:42:33 2003
Subject: [Bioperl-l] octamers search
Message-ID: <BAY7-F97F53wYi12TBY00007206@hotmail.com>

Hi all

I have a list of octamers having a set of scores x and y.
I need to search my sequence - if they contain any of these octamer set of 
sequences having a score of x+y > or = 20.
How may I proceed to write a simple script that can allow me to do his 
please?
Hope someone out there can help a newbie! thanks in advance :)

jimmy

_________________________________________________________________
Get 10mb of inbox space with MSN Hotmail Extra Storage 
http://join.msn.com/?pgmarket=en-sg

From Guido.Dieterich at gbf.de  Tue Aug 19 07:21:53 2003
From: Guido.Dieterich at gbf.de (Guido Dieterich)
Date: Tue Aug 19 07:21:08 2003
Subject: [Bioperl-l] blast Bio::Tools::Run::StandAloneBlast BlastFindWords
 returned non-zero status
Message-ID: <3F420851.20700@gbf.de>

Hi,

i have a strange problem. I use
	
$factory = Bio::Tools::Run::StandAloneBlast->new('program'  => 'blastp', 
'outfile' => 'bl2seq.out');

$report = $factory->bl2seq($query2, $query1);

in case $query2->seq is "CMWDFDDXMPPADEDYSPWQLWLLA" Blast runs without 
warnings

in case $query2->seq is "CMWDFDDXMPPADEDYSPWQLWLLS" Blast warns
# last AA can also be T or G
[bl2seq] WARNING:  [000.000]  BlastFindWords returned non-zero status
[bl2seq] WARNING:  [000.000]  SetUpBlastSearch failed.

????????????

Thanks


Guido








-- 
			
			
Dr. Guido Dieterich
Dipl.-Biologe										

BioComputing 
                     									 											
SB  - Strukturbiologie								      	   \==-|	
GBF - Gesellschaft fuer Biotechnologische Forschung       		\=/ 	 
0010010010100101110010
       German Research Centre for Biotechnology		     |		/-\ 	
                                                           	   /-==|	 
0010100100111101010010
WWW: http://www.gbf.de         _/_/_/   _/_/_/   _/_/_/   	  |==-/ 	
EMAIL: gdi@gbf.de            _/    _/  _/   _/  _/	      	   \=/  	 
0100100100010010010101
                             _/        _/   _/  _/				/\  	
Mascheroder Weg 1          _/  _/    _/_/_/   _/_/_/		   /=-\ 	 
1101001010100101010101
D-38124 Braunschweig      _/    _/  _/   _/  _/
Tel: +(49) 531 6181 745  _/    _/  _/   _/  _/
FAX: +(49) 531 2612 388   _/_/_/  _/_/_/   _/

http://struktur.gbf.de/


Es ist nicht genug, zu wissen, man muss auch anwenden.
Es ist nicht genug, zu wollen, man muss auch tun.
JOHANN WOLFGANG VON GOETHE
Deutscher Dichter
(1749 - 1832)

From jason at cgt.duhs.duke.edu  Tue Aug 19 08:43:15 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Tue Aug 19 08:23:50 2003
Subject: [Bioperl-l] blast Bio::Tools::Run::StandAloneBlast BlastFindWords
	returned non-zero status
In-Reply-To: <3F420851.20700@gbf.de>
References: <3F420851.20700@gbf.de>
Message-ID: <Pine.LNX.4.50.0308190842570.30520-100000@tenero.duhs.duke.edu>

And if you take bioperl out of the loop and run bl2seq on the cmd line
what does it do?

On Tue, 19 Aug 2003, Guido Dieterich wrote:

> Hi,
>
> i have a strange problem. I use
>
> $factory = Bio::Tools::Run::StandAloneBlast->new('program'  => 'blastp',
> 'outfile' => 'bl2seq.out');
>
> $report = $factory->bl2seq($query2, $query1);
>
> in case $query2->seq is "CMWDFDDXMPPADEDYSPWQLWLLA" Blast runs without
> warnings
>
> in case $query2->seq is "CMWDFDDXMPPADEDYSPWQLWLLS" Blast warns
> # last AA can also be T or G
> [bl2seq] WARNING:  [000.000]  BlastFindWords returned non-zero status
> [bl2seq] WARNING:  [000.000]  SetUpBlastSearch failed.
>
> ????????????
>
> Thanks
>
>
> Guido
>
>
>
>
>
>
>
>
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From kvddrift at earthlink.net  Tue Aug 19 21:21:47 2003
From: kvddrift at earthlink.net (Koen van der Drift)
Date: Tue Aug 19 21:23:23 2003
Subject: [Bioperl-l] t/DB test fails
Message-ID: <AB13D3AE-D2AC-11D7-A994-003065A5FDCC@earthlink.net>

Hi,

 From one of the developers at fink I got the following error report 
when he tried to install bioperl on Mac OS X using fink:

2) complaints about missing (optional) perl modules:
SOAP::Lite Text::Shellwords HTML::Parser DBD::mysql Ace GD
XML::Twig XML::Parser::PerlSAX XML::Writer XML::Parser
Graph::Directed IO::Scalar

3) 'make test' failed, which could be related to the missing
modules.  Specifically:
t/DB................ok 61/78Use of uninitialized value in numeric
gt (>) at t/DB.t line 244.
t/DB................ok 79/78Use of uninitialized value in numeric
gt (>) at t/DB.t line 274.
t/DB................FAILED tests 62, 80
         Failed 2/78 tests, 97.44% okay (-1 skipped test: 75 okay,
96.15%)


I didn't see these errors on my sytem. Is this error related to one of 
the optional modules that was not installed on the testers' Mac? If 
that's the case, then I can make bioperl depend on that module. If not, 
is there another reason for these errors?

thanks,

- Koen.

From markw at illuminae.com  Wed Aug 20 10:48:00 2003
From: markw at illuminae.com (Mark Wilkinson)
Date: Wed Aug 20 10:48:02 2003
Subject: [Bioperl-l] Bemusement with get_seq_by_gi in a CGI script
In-Reply-To: <AB13D3AE-D2AC-11D7-A994-003065A5FDCC@earthlink.net>
References: <AB13D3AE-D2AC-11D7-A994-003065A5FDCC@earthlink.net>
Message-ID: <1061390928.1720.43.camel@localhost.localdomain>

Hi all, 

I've been banging my head for days on this problem, but I can't make heads
nor tails of it.  The solution must be obvious, but I can't see it.

The following script is running at 
http://mobycentral.cbr.nrc.ca/cgi-bin/testseq.cgi

===============================================
use lib '/usr/local/apache/cgi-bin/bioperl/core';
print "Content-type: text/plain\n\n";
use Bio::DB::GenBank;
$d = Bio::DB::GenBank->new();
$seq = $d->get_Seq_by_gi('163483');
print "I didn't print the sequence!\n";
===============================================

If you look at the output you see that the genbank record is printed to the
screen, but the last print statement is not!  If I run the same code from 
the command line I don't see the record, and the last print statement prints.

??!??  I'm at my wit's end trying to work out what is happening.  This started 
shortly after upgrading to mod_perl, so it might be associated
with that somehow, but I need some direction in trying to find my mistake.

Any advice appreciated - if only to save my sanity :-)

Cheers!

Mark







From simon.andrews at bbsrc.ac.uk  Wed Aug 20 12:07:49 2003
From: simon.andrews at bbsrc.ac.uk (simon andrews (BI))
Date: Wed Aug 20 12:09:48 2003
Subject: [Bioperl-l] Bemusement with get_seq_by_gi in a CGI script
Message-ID: <2DC41140A89ED411989D00508BDCD9ED01E28B28@bi-exsrv1.iapc.bbsrc.ac.uk>


> -----Original Message-----
> From: Mark Wilkinson [mailto:markw@illuminae.com]
> Sent: 20 August 2003 15:49
> To: Bioperl-l@portal.open-bio.org
> Subject: [Bioperl-l] Bemusement with get_seq_by_gi in a CGI script
> 
> use lib '/usr/local/apache/cgi-bin/bioperl/core';
> print "Content-type: text/plain\n\n";
> use Bio::DB::GenBank;
> $d = Bio::DB::GenBank->new();
> $seq = $d->get_Seq_by_gi('163483');
> print "I didn't print the sequence!\n";
> ===============================================
> 
> If you look at the output you see that the genbank record is 
> printed to the screen, but the last print statement is not!  
> If I run the same code from the command line I don't see the 
> record, and the last print statement prints.

Actually that's not quite what's happening.  If you view the raw http 
traffic then what you actually get is the sequence, then the http
headers, then the "I didn't print the sequence" line.

lynx --dump http://mobycentral.cbr.nrc.ca/cgi-bin/testseq.cgi

Gives:
##########################################
LOCUS       BOVPANPRO                947 bp    mRNA    linear   MAM 29-APR-1996
DEFINITION  B.taurus prepreproelastase I mRNA, complete cds.
ACCESSION   M80838

[snip some stuff]


      781 tcttggataa ataatgccat tgccagcaac tgaacatctt cctgagtcca gtggtattcc
      841 caagatggtt ctgggattga cagcagaact tgaggccatc aaggaaaaaa ccagtctaag
      901 agactattga gccagatgtg gaaaagcaaa taaaatcgaa tatatgt
//

HTTP/1.1 200 OK
Date: Wed, 20 Aug 2003 15:40:02 GMT
Server: Apache/2.0.47 (Unix) mod_perl/1.99_09 Perl/v5.8.0 DAV/2
Connection: close
Content-Type: text/plain; charset=ISO-8859-1

I didn't print the sequence!

############################################

So your script is doing what it's supposed to, it's just that some other stuff is getting out on STDOUT before your webserver is able to get in on the act.

Having played a bit, this proves to be interesting:

#!/usr/bin/perl -w
use strict;
use Bio::DB::GenBank;

close STDOUT;

my $d = Bio::DB::GenBank->new();
my $seq = $d -> get_Seq_by_gi('163483');


This gives me:

print() on closed filehandle STDOUT at /usr/lib/perl5/site_perl/5.8.0/Bio/DB/WebDBSeqI.pm line 701

So WebDBSeqI.pm is usurping STDOUT as part of its query.  This probably explains what you're getting.  Apache will redirect STDOUT straight to the return stream for the connection.  This means it gets the output intended for WbDBSeq and it appears in your programs output.  You then get the output you printed.

If this is right, you should have some interesting error messages in your logs if you run your script with warnings enabled.

I can't see an immediate fix for this, short of running your fetch as a completely detached process with a separate STDOUT, but that kind of defeats the point of using mod-perl.  The use of a pipe from STDOUT to read the results of a webquery seem pretty engrained into WebQueryI.pm and it may not be trivial to change it.

Maybe others will be able to think of a simpler work-round?


Simon.

From markw at illuminae.com  Wed Aug 20 12:32:31 2003
From: markw at illuminae.com (Mark Wilkinson)
Date: Wed Aug 20 12:32:32 2003
Subject: [BioPerl] RE: [Bioperl-l] Bemusement with get_seq_by_gi in a
	CGI script
In-Reply-To: <2DC41140A89ED411989D00508BDCD9ED01E28B28@bi-exsrv1.iapc.bbsrc.ac.uk>
References: <2DC41140A89ED411989D00508BDCD9ED01E28B28@bi-exsrv1.iapc.bbsrc.ac.uk>
Message-ID: <1061397198.1718.73.camel@localhost.localdomain>

On Wed, 2003-08-20 at 10:07, simon andrews (BI) wrote:

> If this is right, you should have some interesting error messages in your logs if you run your script with warnings enabled.

I do indeed :-)  This is what prompted me to write the little test script.

Hmmm... well, I guess I will have to run the fetch in a separate process if
that is what is required :-/  It's no big deal, I guess... albeit awkward.

M


From jason at cgt.duhs.duke.edu  Wed Aug 20 13:05:12 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Wed Aug 20 12:45:20 2003
Subject: [Bioperl-l] Bemusement with get_seq_by_gi in a CGI script
In-Reply-To: <2DC41140A89ED411989D00508BDCD9ED01E28B28@bi-exsrv1.iapc.bbsrc.ac.uk>
References: <2DC41140A89ED411989D00508BDCD9ED01E28B28@bi-exsrv1.iapc.bbsrc.ac.uk>
Message-ID: <Pine.LNX.4.50.0308201259430.6561-100000@tenero.duhs.duke.edu>


> So your script is doing what it's supposed to, it's just that some other
> stuff is getting out on STDOUT before your webserver is able to get in
> on the act.
>
> Having played a bit, this proves to be interesting:
>
> #!/usr/bin/perl -w
> use strict;
> use Bio::DB::GenBank;
>
> close STDOUT;
>
> my $d = Bio::DB::GenBank->new();
> my $seq = $d -> get_Seq_by_gi('163483');
>
>
> This gives me:
>
> print() on closed filehandle STDOUT at
> /usr/lib/perl5/site_perl/5.8.0/Bio/DB/WebDBSeqI.pm line 701
>
> So WebDBSeqI.pm is usurping STDOUT as part of its query.  This probably
> explains what you're getting.  Apache will redirect STDOUT straight to
> the return stream for the connection.  This means it gets the output
> intended for WbDBSeq and it appears in your programs output.  You then
> get the output you printed.
>

This is part of Lincoln's rechaining of the IO and using fork - looking
at his comments in the code.
    # Try to create a stream using POSIX fork-and-pipe facility.
    # this is a *big* win when fetching thousands of sequences from
    # a web database because we can return the first entry while
    # transmission is still in progress.
    # Also, no need to keep sequence in memory or in a temporary file.
    # If this fails (Windows, MacOS 9), we fall back to non-pipelined
    # access.

You can turn this off by adding  to the DB::GenBank init
my $db = new Bio::DB::GenBank(-retrievaltype => 'io_string');

-retrievaltype => 'io_string' (for in-memory holding of the sequence
                                before parsing)
 or
-retrievaltype => 'temp'      (for use of tempfiles, but I'm not 100%
                                this code has gotten a workout to cleanup
                                until the program exits which might be
                                a problem for mod_perl running scripts)


> If this is right, you should have some interesting error messages in
> your logs if you run your script with warnings enabled.
>
> I can't see an immediate fix for this, short of running your fetch as a
> completely detached process with a separate STDOUT, but that kind of
> defeats the point of using mod-perl.  The use of a pipe from STDOUT to
> read the results of a webquery seem pretty engrained into WebQueryI.pm
> and it may not be trivial to change it.
>
> Maybe others will be able to think of a simpler work-round?
>
>
> Simon.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From markw at illuminae.com  Wed Aug 20 13:13:54 2003
From: markw at illuminae.com (Mark Wilkinson)
Date: Wed Aug 20 13:13:56 2003
Subject: [BioPerl] RE: [Bioperl-l] Bemusement with get_seq_by_gi in a
	CGI script
In-Reply-To: <Pine.LNX.4.50.0308201259430.6561-100000@tenero.duhs.duke.edu>
References: <2DC41140A89ED411989D00508BDCD9ED01E28B28@bi-exsrv1.iapc.bbsrc.ac.uk>
	<Pine.LNX.4.50.0308201259430.6561-100000@tenero.duhs.duke.edu>
Message-ID: <1061399682.1720.91.camel@localhost.localdomain>

On Wed, 2003-08-20 at 11:05, Jason Stajich wrote:

> You can turn this off by adding  to the DB::GenBank init
> my $db = new Bio::DB::GenBank(-retrievaltype => 'io_string');

that solved it.  thanks!  I would never have thought to look there.

M


From kvddrift at earthlink.net  Wed Aug 20 22:23:35 2003
From: kvddrift at earthlink.net (Koen van der Drift)
Date: Wed Aug 20 22:24:58 2003
Subject: [Bioperl-l] cgi script problem
Message-ID: <775F8A07-D37E-11D7-AC88-003065A5FDCC@earthlink.net>

Hi,

To test my bioperl installation through fink on Mac OS X, I took one of 
the cgi scripts (frend), and put it in my local cgi-bin folder. When I 
run the script on localhost, I get the following error:

[Wed Aug 20 21:59:52 2003] [error] [client 127.0.0.1] Premature end of 
script headers: /Users/koen/Sites/cgi-bin/frend
Can't locate Bio/Graphics/Panel.pm in @INC (@INC contains: 
/System/Library/Perl/darwin /System/Library/Perl /Library/Perl/darwin 
/Library/Perl /Library/Perl /Network/Library/Perl/darwin 
/Network/Library/Perl /Network/Library/Perl .) at 
/Users/koen/Sites/cgi-bin/frend line 5.
BEGIN failed--compilation aborted at /Users/koen/Sites/cgi-bin/frend 
line 5.


Bioperl indeed is installed in the fink directory /sw which is not 
included in the @INC above. But, if I run perl -V, /sw is included in 
@INC:

   @INC:
     /sw/lib/perl5/5.8.0/darwin
     /sw/lib/perl5/5.8.0
     /sw/lib/perl5/darwin
     /sw/lib/perl5
     /System/Library/Perl/darwin
....


I have other scripts in cgi-bin, and they work, so I know that apache 
is configured ok. I also run bptutorial, and that works fine too.


Any suggestions how I can fix this?


thanks,


- Koen.

From kvddrift at earthlink.net  Thu Aug 21 06:23:20 2003
From: kvddrift at earthlink.net (Koen van der Drift)
Date: Thu Aug 21 06:24:43 2003
Subject: [Bioperl-l] cgi script problem [solved]
In-Reply-To: <775F8A07-D37E-11D7-AC88-003065A5FDCC@earthlink.net>
Message-ID: <7CC84F06-D3C1-11D7-A799-003065A5FDCC@earthlink.net>


On Wednesday, August 20, 2003, at 10:23  PM, Koen van der Drift wrote:

>

> I have other scripts in cgi-bin, and they work, so I know that apache 
> is configured ok. I also run bptutorial, and that works fine too.
>
>
> Any suggestions how I can fix this?

Found it! I have to add the line use lib '/path/to/fink/perl/modules/'


- Koen.

From jason at cgt.duhs.duke.edu  Thu Aug 21 08:48:46 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Thu Aug 21 08:28:35 2003
Subject: [Bioperl-l] cgi script problem
In-Reply-To: <775F8A07-D37E-11D7-AC88-003065A5FDCC@earthlink.net>
References: <775F8A07-D37E-11D7-AC88-003065A5FDCC@earthlink.net>
Message-ID: <Pine.LNX.4.50.0308210847590.15759-100000@tenero.duhs.duke.edu>

the apache running environment is different from your own user environment
so you need to add the /sw path to either the script or to your apache env
- the best way to do this will depend on whether or not you are running
mod_perl.

-jason

On Wed, 20 Aug 2003, Koen van der Drift wrote:

> Hi,
>
> To test my bioperl installation through fink on Mac OS X, I took one of
> the cgi scripts (frend), and put it in my local cgi-bin folder. When I
> run the script on localhost, I get the following error:
>
> [Wed Aug 20 21:59:52 2003] [error] [client 127.0.0.1] Premature end of
> script headers: /Users/koen/Sites/cgi-bin/frend
> Can't locate Bio/Graphics/Panel.pm in @INC (@INC contains:
> /System/Library/Perl/darwin /System/Library/Perl /Library/Perl/darwin
> /Library/Perl /Library/Perl /Network/Library/Perl/darwin
> /Network/Library/Perl /Network/Library/Perl .) at
> /Users/koen/Sites/cgi-bin/frend line 5.
> BEGIN failed--compilation aborted at /Users/koen/Sites/cgi-bin/frend
> line 5.
>
>
> Bioperl indeed is installed in the fink directory /sw which is not
> included in the @INC above. But, if I run perl -V, /sw is included in
> @INC:
>
>    @INC:
>      /sw/lib/perl5/5.8.0/darwin
>      /sw/lib/perl5/5.8.0
>      /sw/lib/perl5/darwin
>      /sw/lib/perl5
>      /System/Library/Perl/darwin
> ....
>
>
> I have other scripts in cgi-bin, and they work, so I know that apache
> is configured ok. I also run bptutorial, and that works fine too.
>
>
> Any suggestions how I can fix this?
>
>
> thanks,
>
>
> - Koen.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From maasha at image.dk  Thu Aug 21 08:39:02 2003
From: maasha at image.dk (Martin A. Hansen)
Date: Thu Aug 21 08:39:37 2003
Subject: [Bioperl-l] parser for GCG flavor of FASTA ?
Message-ID: <20030821123902.GA1554@image>

hi

does anyone have any code that can pipe GCG flavor FASTA reports to
Bio::SearchIO ?


martin
From jason at cgt.duhs.duke.edu  Thu Aug 21 09:18:45 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Thu Aug 21 08:58:35 2003
Subject: [Bioperl-l] parser for GCG flavor of FASTA ?
In-Reply-To: <20030821123902.GA1554@image>
References: <20030821123902.GA1554@image>
Message-ID: <Pine.LNX.4.50.0308210918080.15981-100000@tenero.duhs.duke.edu>

Not I, but if you post an example report as a feature request to
http://bugzilla.open-bio.org it might get on the to do list of a kind soul
out there.


On Thu, 21 Aug 2003, Martin A. Hansen wrote:

> hi
>
> does anyone have any code that can pipe GCG flavor FASTA reports to
> Bio::SearchIO ?
>
>
> martin
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From andrewram200369 at hotmail.com  Thu Aug 21 11:14:34 2003
From: andrewram200369 at hotmail.com (Andrew Ram)
Date: Thu Aug 21 11:13:44 2003
Subject: [Bioperl-l] GFF to gene structure pictures
Message-ID: <BAY8-F84CHusMjQHtMF00000365@hotmail.com>

Hi everyone
I would like to convert my gene structures I have in GFF or GTF format to 
nice pictures probably using the BioGraphics tools. Can someone out there 
help me with any scripts?
Thanks very much in advance-Looking forward to hearing from the group!
Andrew

_________________________________________________________________
Add photos to your messages with MSN 8. Get 2 months FREE*. 
http://join.msn.com/?page=features/featuredemail

From andrewram200369 at hotmail.com  Thu Aug 21 11:18:08 2003
From: andrewram200369 at hotmail.com (Andrew Ram)
Date: Thu Aug 21 11:17:18 2003
Subject: [Bioperl-l] synteny
Message-ID: <BAY8-F31D7TfSr0fVwc0000268c@hotmail.com>

Hi everyone I would like to ask if anyone is familar with any software to 
plot synteny?
Thanks very much in advance.
A.Ram

_________________________________________________________________
Tired of spam? Get advanced junk mail protection with MSN 8. 
http://join.msn.com/?page=features/junkmail

From jason at cgt.duhs.duke.edu  Thu Aug 21 11:39:33 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Thu Aug 21 11:19:25 2003
Subject: [Bioperl-l] GFF to gene structure pictures
In-Reply-To: <BAY8-F84CHusMjQHtMF00000365@hotmail.com>
References: <BAY8-F84CHusMjQHtMF00000365@hotmail.com>
Message-ID: <Pine.LNX.4.50.0308211138060.15981-100000@tenero.duhs.duke.edu>

did you try Lincoln's HOWTO tutorial?
http://www.bioperl.org/HOWTOs/

there are also example scripts in scripts/grahics which have some pretty
useful starting point code.

-jason
On Thu, 21 Aug 2003, Andrew Ram wrote:

> Hi everyone
> I would like to convert my gene structures I have in GFF or GTF format to
> nice pictures probably using the BioGraphics tools. Can someone out there
> help me with any scripts?
> Thanks very much in advance-Looking forward to hearing from the group!
> Andrew
>
> _________________________________________________________________
> Add photos to your messages with MSN 8. Get 2 months FREE*.
> http://join.msn.com/?page=features/featuredemail
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From jason at cgt.duhs.duke.edu  Thu Aug 21 11:45:56 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Thu Aug 21 11:25:47 2003
Subject: [Bioperl-l] synteny
In-Reply-To: <BAY8-F31D7TfSr0fVwc0000268c@hotmail.com>
References: <BAY8-F31D7TfSr0fVwc0000268c@hotmail.com>
Message-ID: <Pine.LNX.4.50.0308211143150.15981-100000@tenero.duhs.duke.edu>

you might consider using Gbrowse and the synteny viewer that Lincoln
wrote.

And example:
http://www.wormbase.org/db/seq/ebsyn?name=cb25.fpc0143:1..8000

You'll have to take dive into the Gbrowse documentation to understand how
to set this up.

-jason
On Thu, 21 Aug 2003, Andrew Ram wrote:

> Hi everyone I would like to ask if anyone is familar with any software to
> plot synteny?
> Thanks very much in advance.
> A.Ram
>
> _________________________________________________________________
> Tired of spam? Get advanced junk mail protection with MSN 8.
> http://join.msn.com/?page=features/junkmail
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From hirst at interomex.com  Thu Aug 21 11:34:42 2003
From: hirst at interomex.com (Martin Hirst)
Date: Thu Aug 21 11:26:43 2003
Subject: [Bioperl-l] automated response
Message-ID: <10308210834.AA105387241@interomex.com>

I will be out of the office starting August 20, 2003 and will not return
until September 2, 2003.

I am on Vacation. I will respond to your message when I return. If it is
urgent please contact Kane Tse at 6042678009
From simon.andrews at bbsrc.ac.uk  Thu Aug 21 11:34:19 2003
From: simon.andrews at bbsrc.ac.uk (simon andrews (BI))
Date: Thu Aug 21 11:36:59 2003
Subject: [Bioperl-l] synteny
Message-ID: <2DC41140A89ED411989D00508BDCD9ED01E28B2A@bi-exsrv1.iapc.bbsrc.ac.uk>



> -----Original Message-----
> From: Andrew Ram [mailto:andrewram200369@hotmail.com]
> Sent: 21 August 2003 16:18
> To: bioperl-l@bioperl.org
> Subject: [Bioperl-l] synteny
> 
> 
> Hi everyone I would like to ask if anyone is familar with any 
> software to plot synteny?

Not a Perl answer, and it depends what you're looking for,
but we use ACT for this purpose

http://www.sanger.ac.uk/Software/ACT/

Simon.
From maasha at image.dk  Thu Aug 21 09:02:21 2003
From: maasha at image.dk (Martin A. Hansen)
Date: Thu Aug 21 18:34:46 2003
Subject: [Bioperl-l] parser for GCG flavor of FASTA ?
In-Reply-To: <Pine.LNX.4.50.0308210918080.15981-100000@tenero.duhs.duke.edu>
References: <20030821123902.GA1554@image>
	<Pine.LNX.4.50.0308210918080.15981-100000@tenero.duhs.duke.edu>
Message-ID: <20030821130221.GB1554@image>

On Thu, Aug 21, 2003 at 09:18:45AM -0400, Jason Stajich wrote:
> Not I, but if you post an example report as a feature request to
> http://bugzilla.open-bio.org it might get on the to do list of a kind soul
> out there.

hm, i was thinking that maybe somebody already wrote the parser for this - so
maybe ill wait around to see if anyone responds - and then request.

anyways - ill attach a sample file.


martin

> 
> 
> On Thu, 21 Aug 2003, Martin A. Hansen wrote:
> 
> > hi
> >
> > does anyone have any code that can pipe GCG flavor FASTA reports to
> > Bio::SearchIO ?
> >
> >
> > martin
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> 
> --
> Jason Stajich
> Duke University
> jason at cgt.mc.duke.edu
-------------- next part --------------
!!SEQUENCE_LIST 1.0


(Nucleotide) FASTA of: BTG1.seq  from: 1 to: 21  June 3, 2002 10:51

Oligo BTG1 seq

 TO: @/usr/users/ddbase/seq/seq.all  Sequences:      9,324  Symbols:    31,508,009  Word Size: 6

 Sequences too short to analyze: 9 (27 symbols)
 Sequences skipped due to type mismatch with query: 2
 Searching with both strands of the query.
 Scoring matrix: GenRunData:fastadna.cmp
 Constant pamfactor used
 Gap creation penalty: 16  Gap extension penalty: 4



Histogram Key:
 Each histogram symbol represents 32 search set sequences
 Each inset symbol represents 1 search set sequences
 z-scores computed from opt scores

z-score obs    exp
        (=)    (*)

< 20   1920      0:============================================================
  22      2      0:=
  24      0      0:
  26      6      0:=
  28      6      2:*
  30     20     10:*
  32     32     39:=*
  34     91    107:===*
  36    146    220:===== *
  38    287    363:=========  *
  40    556    506:===============*==
  42    691    619:===================*==
  44    888    683:=====================*======
  46    818    695:=====================*====
  48    687    666:====================*=
  50    555    607:==================*
  52    442    534:==============  *
  54    307    456:==========    *
  56    314    381:========== *
  58    314    313:=========*
  60    258    253:=======*=
  62    195    203:======*
  64    137    162:=====*
  66    147    128:===*=
  68    108    100:===*
  70     83     79:==*
  72     91     62:=*=
  74     37     48:=*
  76     39     37:=*
  78     38     29:*=
  80     30     23:*
  82     21     17:*
  84     20     14:*
  86      9     11:*
  88      9      8:*
  90      5      6:*
  92      7      5:*         :====*==
  94      1      4:*         :=  *
  96      5      3:*         :==*==
  98      0      2:*         : *
 100      1      2:*         :=*
 102      0      1:*         :*
 104      0      1:*         :*
 106      0      1:*         :*
 108      0      1:*         :*
 110      1      0:=         *=
 112      0      0:          *
 114      0      0:          *
 116      0      0:          *
 118      0      0:          *
>120      0      0:          *

Joining threshold: 45, opt. threshold: 30, opt. width:  16, reg.-scaled


The best scores are:                    init1 initn   opt    z-sc E(7402)..

/usr/users/ddbase/seq/Mouse/Rat/Masami/mpla2/ac002406.emrod    Begin: 26864  End: 26884
! ID AC002406 standard; DNA; ROD; 194...   72    72    78    89.3    0.59
/usr/users/ddbase/seq/Anne_Mette/nrf1aga1amb22/OtherBand/nrf1aga4amb27-al355520.emhum    Begin: 75031  End: 75045
! ID AL355520 standard; DNA; HUM; 157...   75    75    75    85.2     1.2
/usr/users/ddbase/seq/Mouse/Rat/Masami/Lene-seqs/U-Repeat-TC104374.seq    Begin: 915  End: 935  Strand: -
! TC104374 from TIGR. Similar to mpla...   40    40    78   109.4     1.3
\\End of List


BTG1.seq
/usr/users/ddbase/seq/Mouse/Rat/Masami/mpla2/ac002406.emrod

ID   AC002406   standard; DNA; ROD; 194985 BP.
XX
AC   AC002406;
XX
SV   AC002406.1
XX . . . 


SCORES   Init1: 72    Initn: 72    Opt: 78    z-score: 89.3  E(): 0.59  
>>/usr/users/ddbase/seq/Mouse/Rat/Masami/mpla2/ac002406.emrod (194985 nt)
 initn:  72 init1:  72 opt:  78 Z-score: 89.3 expect(): 0.59
  85.7% identity in 21 nt overlap
 (1-21:26864-26884)

                                                   10        20          
BTG1.seq                                   GTGACAGTGCCATAGTTTGGA         
                                           || |||||| || ||||||||         
ac002406.emr TAGAATTGGGAACAATCACCCATGGAAGGAGTTACAGTGACAAAGTTTGGAGCTGAGACA
               26840     26850     26860     26870     26880     26890   

ac002406.emr AAAGGATGGAACATCTAGAGACTGCCGTATCCAGAGATCCATCCCATAATTAGCCTCCAA
               26900     26910     26920     26930     26940     26950   


BTG1.seq
/usr/users/ddbase/seq/Anne_Mette/nrf1aga1amb22/OtherBand/nrf1aga4amb27-al355520.emhum

ID   AL355520   standard; DNA; HUM; 157575 BP.
XX
AC   AL355520;
XX
SV   AL355520.8
XX . . . 


SCORES   Init1: 75    Initn: 75    Opt: 75    z-score: 85.2  E(): 1.2   
>>/usr/users/ddbase/seq/Anne_Mette/nrf1aga1amb22/OtherBand/nrf1aga4amb27-al355520.emhum (157575 nt)
 initn:  75 init1:  75 opt:  75 Z-score: 85.2 expect():  1.2
 100.0% identity in 15 nt overlap
 (6-20:75031-75045)

                                              10        20               
BTG1.seq                              GTGACAGTGCCATAGTTTGGA              
                                           |||||||||||||||               
nrf1aga4amb2 CTCGGAATCTGATTCCACATGGACATAGGAAGTGCCATAGTTTGGGTTATAAGTCAGCAT
                  75010     75020     75030     75040     75050     75060

nrf1aga4amb2 TTTTAATTTTATCTTTCAAATTTTTAAGTCTTTTGTAATTGGATTTATTGTCGATTTATT
                  75070     75080     75090     75100     75110     75120


BTG1.seq /rev
/usr/users/ddbase/seq/Mouse/Rat/Masami/Lene-seqs/U-Repeat-TC104374.seq

TC104374 from TIGR. Similar to mpla2rcg3m35.seq, etc. (inverse-U repeat)
retrovirus-related pol polyprotein (reverse transcriptase {Mus musculus} 
 SP|P11369|POL2_MOUSE RETROV


SCORES   Init1: 40    Initn: 40    Opt: 78    z-score: 109.4 E(): 1.3   
>>/usr/users/ddbase/seq/Mouse/Rat/Masami/Lene-seqs/U-Repeat-TC104374.seq (6469 nt)
 initn:  40 init1:  40 opt:  78 Z-score: 109.4 expect():  1.3
  85.7% identity in 21 nt overlap
 (21-1:915-935)

                                           20        10                  
BTG1.seq                                   TCCAAACTATGGCACTGTCAC         
                                           |||||||| |||| |||| ||         
U-Repeat-TC1 TCTCTACATGGTCCATCCTTTCATCTCAGCTCCAAACTTTGGCTCTGTAACTCCTTCCAT
                890       900       910       920       930       940    

U-Repeat-TC1 GGGTGTTTTGTTCCCAAATCTAAGGAGGGGCATAGTGTCCACACTTCAGTCTTCATTCTT
                950       960       970       980       990      1000    



! Distributed over 1 thread.
!      Start time: Mon Jun  3 10:46:53 2002
! Completion time: Mon Jun  3 10:52:00 2002

! CPU time used:
!        Database scan:  0:01:27.1
! Post-scan processing:  0:00:01.6
!       Total CPU time:  0:01:28.8
! Output File: btg1.fasta
From brian_osborne at cognia.com  Fri Aug 22 08:37:08 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Fri Aug 22 08:40:05 2003
Subject: [Bioperl-l] bioperl-db authors
Message-ID: <GAEDKMGOKFBLJPKCLKCCGEBFDBAA.brian_osborne@cognia.com>

Ewan, Jason, Hilmar and Elia,

Please take a quick look at the README in the bioperl-db package. There are
statements in there about certain features that are or are not supported,
you need to make sure that this is up-to-date.

Thanks again,

Brian O.


From pm66 at nyu.edu  Fri Aug 22 18:23:37 2003
From: pm66 at nyu.edu (Philip MacMenamin)
Date: Fri Aug 22 18:22:10 2003
Subject: [Bioperl-l] Bio::Graphics::Panel,
	-spacing => 0 constructor problem. 
Message-ID: <200308222223.h7MMN14c022854@mx3.nyu.edu>

Hi, 

Am I right in thinking that the '-spacing' constructor for 
Bio::Graphics::Panel, if set to 0, should result in no space between tracks? 
ie That the tracks are either over-laying eachother, or squashed down onto 
the same plane as the previous one. 

I cannot get this to happen if this is its purpose. It continues to stack the 
tracks on the panel as per default. (So I have left it out, its not useful to 
see this). I know that it works, because I have seen it working in the 
wormbase UTRs.

Here is some code: 
#   if (scalar @threePrimeUTR >0)
#    {
#      $panel->add_track(generic=>\@threePrimeUTR,
#			-bgcolor      => 'lightblue',
#			-fgcolor      => 'black',
#		#	-bump      =>  +1,
#			-spacing => 0,
#			-utr_color    => '#D0D0D0', ##whats this about?, chnging makes no dif?
#			-font2color   => 'blue',
#			-height       => 10,
#			-description  => 1,
#			-label        => '3 prime UTR'
#     }

I have also tried to set spacing to 0 on the tracks surrounding the UTRs, but 
to no avail. 

Also, on a slightly differant vein, I cant seem to get the 
Bio::Graphics::Panel start end constructors to work either. All of which is 
making me increasingly suspicious of my perl skills. It just makes no 
differance if I provide these arguments or not. The segment or sequence obj 
always over-rides the start stop args. Not a massive problem, but it has 
confused me.

More code:
 
my $panel = Bio::Graphics::Panel->new( -segment   => $segment,
					   -width     => 600,
					   -key_color => '#ffffcc',
					   -start =>$panelStart,
					   -end =>$panelEnd,
			#		   -start => 4110000,
					 );

Any help is of course appreciated. 

-- 

Philip.
From rysz_c3 at yahoo.com  Sat Aug 23 03:54:23 2003
From: rysz_c3 at yahoo.com (Flywheel)
Date: Sat Aug 23 06:53:56 2003
Subject: [Bioperl-l] Energy Storage
Message-ID: <200308231053.h7NArdvT002344@localhost.localdomain>



Nice Hello from Flywheel Storage 

& Sun Tracking 

Good Bay to Rolling Blackout forever 



Safety Solution

Rolling Blackout will always happened, since the SYSTEM - 
is design to protect itself in dangerous 
Over-Current Situations.

Breakers shut down basic duty is defense whole system, 
and isolate from Grid; 


Bad "wave of over-current" travel to next Sub-Station
and stimulate the same results on another, then another, 
then another. And a VOLTAGE is growing rapidly.


Rolling Growing Disconnection in Domino Effect; 
we did seen twice;


Accident ~ 30 years ago (baby boom) - for purpose recently.


To decrease all Over-Current situation in POWER LINE 
or reduce to Zero     ALL EXCESS ENERGY                

USE

Energy Storage 25 - 1000 MWh 

and no Sub - Station will ever have any risk again.


Small units UPS   20 - 200 kWh protect Stories, 

mainframes, servers, computers and homes, 

give back emergency energy for hours & days

and/or time for diesel generator to work 




Rest you can find on:

 
www.suntracking.com

www.flywheelstorage.com
 
 
 
 Have a nice Weekend !

From rysz_c3 at yahoo.com  Sat Aug 23 03:54:23 2003
From: rysz_c3 at yahoo.com (Flywheel)
Date: Sat Aug 23 06:54:01 2003
Subject: [Bioperl-l] Energy Storage
Message-ID: <200308231053.h7NArdvT002341@localhost.localdomain>



Nice Hello from Flywheel Storage 

& Sun Tracking 

Good Bay to Rolling Blackout forever 



Safety Solution

Rolling Blackout will always happened, since the SYSTEM - 
is design to protect itself in dangerous 
Over-Current Situations.

Breakers shut down basic duty is defense whole system, 
and isolate from Grid; 


Bad "wave of over-current" travel to next Sub-Station
and stimulate the same results on another, then another, 
then another. And a VOLTAGE is growing rapidly.


Rolling Growing Disconnection in Domino Effect; 
we did seen twice;


Accident ~ 30 years ago (baby boom) - for purpose recently.


To decrease all Over-Current situation in POWER LINE 
or reduce to Zero     ALL EXCESS ENERGY                

USE

Energy Storage 25 - 1000 MWh 

and no Sub - Station will ever have any risk again.


Small units UPS   20 - 200 kWh protect Stories, 

mainframes, servers, computers and homes, 

give back emergency energy for hours & days

and/or time for diesel generator to work 




Rest you can find on:

 
www.suntracking.com

www.flywheelstorage.com
 
 
 
 Have a nice Weekend !

From maasha at image.dk  Mon Aug 25 10:14:39 2003
From: maasha at image.dk (Martin A. Hansen)
Date: Mon Aug 25 10:15:03 2003
Subject: [Bioperl-l] Bio::SeachIO::Fasta problem
Message-ID: <20030825141439.GB1558@image>

hi

im trying to parse fasta search reports with Bio::SeachIO. however, i get this
warning message:

maasha@homer:~/bin$ parse_fasta btg1.fasta 

-------------------- WARNING ---------------------
MSG: unrecognized FASTA Family report file!
---------------------------------------------------

this indicates that there might be something wrong with the fasta report file,
but im not sure what that could be. im i supposed to run a certain version of
fasta? and with a certain set of options? e.g. i have noticed that running
fasta from the wisconsin packages (GCG) outputs a double dot (..) between the
introtext and the data:

The best scores are:                    init1 initn   opt    z-sc E(7402)..

whereas running "normal" fasta does not produce the double dot?

and to really twist the fork i am failing in identifying the different fasta
versions :/

anyways, here is the snippet of code im using to parse:


#!/usr/bin/perl -w

use strict;
use Bio::SearchIO;

my ( $script, $usage, $file );

$script = ( split "/", $0 )[ -1 ];

$usage = qq(

$script by Martin A. Hansen, August 2003.

$script parses a FASTA report file

Usage: $script [file]
               [file]       - file with fasta report

);

print $usage and exit if not @ARGV;

$file = shift @ARGV;


# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> MAIN <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<


my ( $lines );

$lines = &parse_fasta( $file );

print "$_\n" foreach @{ $lines };

exit;


# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> SUBROUTINES <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<


sub parse_fasta
{
    # Martin A. Hansen, August 2003.

    # parses blast reports using Bioperl

    my ( $file,   # file with blast report
       ) = @_;

    # returns list of sequence lines

    my ( $result, $hit, $hit_name, $searchio, $white_space, $query_beg, $hsp, $hit_string, @lines, $query_string, $query_name );

    $searchio = new Bio::SearchIO ( -format => 'fasta', -file => $file );
    $result   = $searchio->next_result;

    while ( $hit = $result->next_hit )
    {
        $query_name   = $result->query_name;
        $hit_name     = $hit->name;
        $hsp          = $hit->next_hsp;

        $query_string = $hsp->query_string;
        $query_beg    = $hsp->query->start;
        $hit_string   = $hsp->hit_string;

        $white_space  = ' ' x ( $query_beg - 1 );

        push @lines, {
                       "QUERY_NAME"     => $query_name,
                       "QUERY_STRING"   => $white_space . $query_string, 
                       "SUBJECT_NAME"   => $hit_name,
                       "SUBJECT_STRING" => $white_space . $hit_string,
        }
    }

    return wantarray ? @lines : \@lines;
}




# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<


__END__



any suggestions?


martin
From etbridge at tuethkeeney.com  Mon Aug 25 11:37:51 2003
From: etbridge at tuethkeeney.com (Eileen T. Bridge)
Date: Mon Aug 25 11:36:55 2003
Subject: [Bioperl-l] blastall parser
Message-ID: <FFF6A2B93C9A1E4BAE286B0A0400FD76975BB7@controller.stlouis.mickestueth.com>

Tony,

We are trying to reach you to forward some documents to you.  Please
call us as soon as possible!

      
Eileen Bridge
Tueth, Keeney, Cooper, Mohan & Jackstadt, P.C.
425 South Woods Mill Road,  Suite 300
St. Louis, MO 63017-3492
ph:   636-237-2570
fax:  636-237-2601
email:  ebridge@tuethkeeney.com

From jason at cgt.duhs.duke.edu  Mon Aug 25 13:52:42 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Mon Aug 25 13:31:07 2003
Subject: [Bioperl-l] Bio::SeachIO::Fasta problem
In-Reply-To: <20030825141439.GB1558@image>
References: <20030825141439.GB1558@image>
Message-ID: <Pine.LNX.4.50.0308251326400.22774-100000@tenero.duhs.duke.edu>

Martin - it's tested on FASTA 3.4 and some versions of 3.3.  It can parse
the -m 9 tabluar output as well as standard default output (with or
without Histograms).

Personally I would just use the latest distribution:
ftp://ftp.virginia.edu/pub/fasta/fasta3.shar.Z

It has not been tested with the GCG-ized FASTA and as you report it
doesn't seem to work. I took the liberty of posting a bug report for you
with an example report as this is the type of information needed for
someone to diagnose a problem.

I don't know that fixing this will get a priority given that it is pretty
easy to install and run FASTA directly from Bill's distro and we can parse
that output just fine.

-jason

On Mon, 25 Aug 2003, Martin A. Hansen wrote:

> hi
>
> im trying to parse fasta search reports with Bio::SeachIO. however, i get this
> warning message:
>
> maasha@homer:~/bin$ parse_fasta btg1.fasta
>
> -------------------- WARNING ---------------------
> MSG: unrecognized FASTA Family report file!
> ---------------------------------------------------
>
> this indicates that there might be something wrong with the fasta report file,
> but im not sure what that could be. im i supposed to run a certain version of
> fasta? and with a certain set of options? e.g. i have noticed that running
> fasta from the wisconsin packages (GCG) outputs a double dot (..) between the
> introtext and the data:
>
> The best scores are:                    init1 initn   opt    z-sc E(7402)..
>
> whereas running "normal" fasta does not produce the double dot?
>
> and to really twist the fork i am failing in identifying the different fasta
> versions :/
>
> anyways, here is the snippet of code im using to parse:
>
>
> #!/usr/bin/perl -w
>
> use strict;
> use Bio::SearchIO;
>
> my ( $script, $usage, $file );
>
> $script = ( split "/", $0 )[ -1 ];
>
> $usage = qq(
>
> $script by Martin A. Hansen, August 2003.
>
> $script parses a FASTA report file
>
> Usage: $script [file]
>                [file]       - file with fasta report
>
> );
>
> print $usage and exit if not @ARGV;
>
> $file = shift @ARGV;
>
>
> # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> MAIN <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
>
>
> my ( $lines );
>
> $lines = &parse_fasta( $file );
>
> print "$_\n" foreach @{ $lines };
>
> exit;
>
>
> # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> SUBROUTINES <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
>
>
> sub parse_fasta
> {
>     # Martin A. Hansen, August 2003.
>
>     # parses blast reports using Bioperl
>
>     my ( $file,   # file with blast report
>        ) = @_;
>
>     # returns list of sequence lines
>
>     my ( $result, $hit, $hit_name, $searchio, $white_space, $query_beg, $hsp, $hit_string, @lines, $query_string, $query_name );
>
>     $searchio = new Bio::SearchIO ( -format => 'fasta', -file => $file );
>     $result   = $searchio->next_result;
>
>     while ( $hit = $result->next_hit )
>     {
>         $query_name   = $result->query_name;
>         $hit_name     = $hit->name;
>         $hsp          = $hit->next_hsp;
>
>         $query_string = $hsp->query_string;
>         $query_beg    = $hsp->query->start;
>         $hit_string   = $hsp->hit_string;
>
>         $white_space  = ' ' x ( $query_beg - 1 );
>
>         push @lines, {
>                        "QUERY_NAME"     => $query_name,
>                        "QUERY_STRING"   => $white_space . $query_string,
>                        "SUBJECT_NAME"   => $hit_name,
>                        "SUBJECT_STRING" => $white_space . $hit_string,
>         }
>     }
>
>     return wantarray ? @lines : \@lines;
> }
>
>
>
>
> # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
>
>
> __END__
>
>
>
> any suggestions?
>
>
> martin
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From ajm6q at virginia.edu  Mon Aug 25 13:39:32 2003
From: ajm6q at virginia.edu (Aaron J Mackey)
Date: Mon Aug 25 13:38:34 2003
Subject: [Bioperl-l] Bio::SeachIO::Fasta problem
In-Reply-To: <Pine.LNX.4.50.0308251326400.22774-100000@tenero.duhs.duke.edu>
Message-ID: <Pine.OSF.4.33.0308251337160.21100-100000@alpha10.bioch.virginia.edu>


On Mon, 25 Aug 2003, Jason Stajich wrote:

> I don't know that fixing this will get a priority given that it is pretty
> easy to install and run FASTA directly from Bill's distro and we can parse
> that output just fine.

Let me also chime in and make it clear that parsing GCG-variant FASTA (or
anything else, for that matter) will probably never make it to the top of
my TODO list.  Just in case anyone was holding their breath ;)

But I wonder if the GCG people might be persuaded ...

-Aaron

From djoubert at mail.mcg.edu  Mon Aug 25 16:13:49 2003
From: djoubert at mail.mcg.edu (Douglas Joubert)
Date: Mon Aug 25 16:56:35 2003
Subject: [Bioperl-l] Bio::SeachIO::Fasta problem
Message-ID: <sf4a3ff1.078@mail.mcg.edu>

Greetings,

I too received the "> MSG: unrecognized FASTA Family report file!" error when I was "attempting" to demonstrate a snipet of code that I lifted from one of Jason's ppt presentations (GenomeInformatics2002).

I am a librarian, not a programmer, therefore I assumed I had incorrectly installed BioPerl.

My fasta file was Blast output, that I outputted to fasta format, is this not the correct way to use this module.

My text file started with >gi|14625690|emb|AL591499.7| so I thought I was OK

My question is this, what exactly does the hyperlink provided by Jason install?

Cheers

DJJ


Douglas Joubert, M.L.I.S.
Instructor and Digital Information Librarian
Robert B. Greenblatt M.D. Library
Medical College of Georgia
Augusta, GA 30912-4400

>>> Jason Stajich <jason@cgt.duhs.duke.edu> 8/25/2003 1:52:42 PM >>>
Martin - it's tested on FASTA 3.4 and some versions of 3.3.  It can parse
the -m 9 tabluar output as well as standard default output (with or
without Histograms).

Personally I would just use the latest distribution:
ftp://ftp.virginia.edu/pub/fasta/fasta3.shar.Z 

It has not been tested with the GCG-ized FASTA and as you report it
doesn't seem to work. I took the liberty of posting a bug report for you
with an example report as this is the type of information needed for
someone to diagnose a problem.

I don't know that fixing this will get a priority given that it is pretty
easy to install and run FASTA directly from Bill's distro and we can parse
that output just fine.

-jason

On Mon, 25 Aug 2003, Martin A. Hansen wrote:

> hi
>
> im trying to parse fasta search reports with Bio::SeachIO. however, i get this
> warning message:
>
> maasha@homer:~/bin$ parse_fasta btg1.fasta
>
> -------------------- WARNING ---------------------
> MSG: unrecognized FASTA Family report file!
> ---------------------------------------------------
>
> this indicates that there might be something wrong with the fasta report file,
> but im not sure what that could be. im i supposed to run a certain version of
> fasta? and with a certain set of options? e.g. i have noticed that running
> fasta from the wisconsin packages (GCG) outputs a double dot (..) between the
> introtext and the data:
>
> The best scores are:                    init1 initn   opt    z-sc E(7402)..
>
> whereas running "normal" fasta does not produce the double dot?
>
> and to really twist the fork i am failing in identifying the different fasta
> versions :/
>
> anyways, here is the snippet of code im using to parse:
>
>
> #!/usr/bin/perl -w
>
> use strict;
> use Bio::SearchIO;
>
> my ( $script, $usage, $file );
>
> $script = ( split "/", $0 )[ -1 ];
>
> $usage = qq(
>
> $script by Martin A. Hansen, August 2003.
>
> $script parses a FASTA report file
>
> Usage: $script [file]
>                [file]       - file with fasta report
>
> );
>
> print $usage and exit if not @ARGV;
>
> $file = shift @ARGV;
>
>
> # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> MAIN <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
>
>
> my ( $lines );
>
> $lines = &parse_fasta( $file );
>
> print "$_\n" foreach @{ $lines };
>
> exit;
>
>
> # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> SUBROUTINES <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
>
>
> sub parse_fasta
> {
>     # Martin A. Hansen, August 2003.
>
>     # parses blast reports using Bioperl
>
>     my ( $file,   # file with blast report
>        ) = @_;
>
>     # returns list of sequence lines
>
>     my ( $result, $hit, $hit_name, $searchio, $white_space, $query_beg, $hsp, $hit_string, @lines, $query_string, $query_name );
>
>     $searchio = new Bio::SearchIO ( -format => 'fasta', -file => $file );
>     $result   = $searchio->next_result;
>
>     while ( $hit = $result->next_hit )
>     {
>         $query_name   = $result->query_name;
>         $hit_name     = $hit->name;
>         $hsp          = $hit->next_hsp;
>
>         $query_string = $hsp->query_string;
>         $query_beg    = $hsp->query->start;
>         $hit_string   = $hsp->hit_string;
>
>         $white_space  = ' ' x ( $query_beg - 1 );
>
>         push @lines, {
>                        "QUERY_NAME"     => $query_name,
>                        "QUERY_STRING"   => $white_space . $query_string,
>                        "SUBJECT_NAME"   => $hit_name,
>                        "SUBJECT_STRING" => $white_space . $hit_string,
>         }
>     }
>
>     return wantarray ? @lines : \@lines;
> }
>
>
>
>
> # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
>
>
> __END__
>
>
>
> any suggestions?
>
>
> martin
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org 
> http://portal.open-bio.org/mailman/listinfo/bioperl-l 
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org 
http://portal.open-bio.org/mailman/listinfo/bioperl-l

From marcelvb at nikhef.nl  Mon Aug 25 17:07:21 2003
From: marcelvb at nikhef.nl (Marcel van Batenburg)
Date: Mon Aug 25 17:09:16 2003
Subject: [Bioperl-l] Re: load_gff.pl question
In-Reply-To: <1060197700.1431.11.camel@localhost.localdomain>
Message-ID: <Pine.SOL.4.21.0308252305240.1917-100000@bilbo.nikhef.nl>

Hi Shin,


I would not even use load_gff.pl for so many lines.
Try bulk_load_gff.pl (ab initio) or fast_load_gff.pl (appending).

Greetings,
Marcel





On 6 Aug 2003, Scott Cain wrote:

> Shin,
> 
> The problem you are running into is not really with load_gff.pl, but
> with the database schema.  Assuming you are using MySQL, the table
> create statement for fdata looks like this:
> 
>  create table fdata (
>     fid                 int not null  auto_increment,
>     fref                varchar(100) not null,
>     fstart              int unsigned   not null,
>     fstop               int unsigned   not null,
>     fbin                double(20,6)  not null,
>     ftypeid             int not null,
>     fscore              float,
>     fstrand             enum('+','-'),
>     fphase              enum('0','1','2'),
>     gid                 int not null,
>     ftarget_start       int unsigned,
>     ftarget_stop        int unsigned,
>     primary key(fid),
>     unique index(fref,fbin,fstart,fstop,ftypeid,gid),
>     index(ftypeid),
>     index(gid)
> 
> The problem  you have is with that unique index on
> (fref,fbin,fstart,fstop,ftypeid,gid).  This index conflicts with your
> data, in that the similar lines are getting assigned the same gid (group
> id), since they look like the same thing.  So, the quick way to fix this
> is to remove the 'unique' from the index declaration.  That can be found
> in Bio/DB/GFF/Adaptor/dbi/mysql.pm. Then run load_gff.pl as usual.  The
> longer way to fix this is look at your data and figure out why they are
> all getting assigned the same group id and make them sufficiently
> different so that they don't.  
> 
> Hope that helps,
> Scott
> 
> On Wed, 2003-08-06 at 13:31, bioperl-l-request@portal.open-bio.org
> wrote:
> > Where do I start to customize this script to allow loading of large 
> > number of similar entities?
> 
> -- 
> ------------------------------------------------------------------------
> Scott Cain, Ph. D.                                         cain@cshl.org
> GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
> Cold Spring Harbor Laboratory
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 

From jamie at genome.arizona.edu  Mon Aug 25 18:36:19 2003
From: jamie at genome.arizona.edu (Jamie Hatfield)
Date: Mon Aug 25 18:36:20 2003
Subject: [Bioperl-l] Re: Bio::FPC
In-Reply-To: <1060878865.562.26.camel@motox>
References: <Pine.GSO.3.96.1030811161601.13501H-100000@beacon.stanford.edu>
	<1060878865.562.26.camel@motox>
Message-ID: <1061850911.562.96.camel@motox>

Again, how do I go about submitting this?

On Thu, 2003-08-14 at 09:34, Jamie Hatfield wrote:
> Yes, actually.  We are just now finishing up the fpc parser.  I was
> planning on soon asking the group how I would go about submitting it? 
> It consists of 5 modules that we have put in the MapIO and Map
> namespaces.
> Bio::MapIO::fpc.pm
> Bio::Map::physical.pm
> Bio::Map::fpcmarker.pm  (sorry, but marker doesn't work)
> Bio::Map::clone.pm
> Bio::Map::contig.pm
> 
> If you want to see how this object might be used, check out
> http://www.genome.arizona.edu/software/fpc/biofpc/index.html
> 
> You'll see there documentation for the modules, and a few test cases or
> example usages.
> 
> Also, we are trying to make a generic converter to let you load in a fpc
> file and generate the necessary GFF for GBrowse to display the fpc map. 
> It's a quite simple display of the clones, markers, and contigs, but
> maybe that will be usefull as an alternative to WebFPC (a java view only
> version of fpc).  It works for us, but might not work for everybody.  We
> should be able to patch it up, though, if it's missing features.
> 
> So, anyways, if somebody can let me know how to go about submitting it,
> we'll start the process.  I looked through the FAQ and it basically said
> to just post information if you have a module that you would like to
> contribute, so, here's the information.
> 
> Jamie


From jmfreeman at comcast.net  Mon Aug 25 21:15:21 2003
From: jmfreeman at comcast.net (James Freeman)
Date: Mon Aug 25 21:12:31 2003
Subject: [Bioperl-l] Fwd: [Volunteer] submitting modules
Message-ID: <C36CAC62-D762-11D7-A74D-000393CD7CA4@comcast.net>

See below.

Begin forwarded message:

> From: "Samuel Thoraval" <s.thoraval@imb.uq.edu.au>
> Date: Mon Aug 25, 2003  19:46:03 US/Eastern
> To: volunteer@open-bio.org
> Subject: [Volunteer] submitting modules
>
> Hello,
>
> I have written a module for the Bioperl/Pise API.
> I would like to submit it.
> To which email should i send the details, code and request to ?
>
> Regards,
>
> Samuel Thoraval
> _______________________________________________
> Volunteer mailing list
> Volunteer@open-bio.org
> http://open-bio.org/mailman/listinfo/volunteer
>

From jason at cgt.duhs.duke.edu  Mon Aug 25 22:03:31 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Mon Aug 25 21:41:49 2003
Subject: [Bioperl-l] Re: Bio::FPC
In-Reply-To: <1061850911.562.96.camel@motox>
References: <Pine.GSO.3.96.1030811161601.13501H-100000@beacon.stanford.edu>
	<1060878865.562.26.camel@motox> <1061850911.562.96.camel@motox>
Message-ID: <Pine.LNX.4.50.0308252201460.26646-100000@tenero.duhs.duke.edu>

For now, submit as a feature request to
http://bugzilla.open-bio.org/

Attach the code as a tarball after you have submitted the request.

A core dev will look it over and assuming all is well get you set up with
a CVS account.

-jason

On Mon, 25 Aug 2003, Jamie Hatfield wrote:

> Again, how do I go about submitting this?
>
> On Thu, 2003-08-14 at 09:34, Jamie Hatfield wrote:
> > Yes, actually.  We are just now finishing up the fpc parser.  I was
> > planning on soon asking the group how I would go about submitting it?
> > It consists of 5 modules that we have put in the MapIO and Map
> > namespaces.
> > Bio::MapIO::fpc.pm
> > Bio::Map::physical.pm
> > Bio::Map::fpcmarker.pm  (sorry, but marker doesn't work)
> > Bio::Map::clone.pm
> > Bio::Map::contig.pm
> >
> > If you want to see how this object might be used, check out
> > http://www.genome.arizona.edu/software/fpc/biofpc/index.html
> >
> > You'll see there documentation for the modules, and a few test cases or
> > example usages.
> >
> > Also, we are trying to make a generic converter to let you load in a fpc
> > file and generate the necessary GFF for GBrowse to display the fpc map.
> > It's a quite simple display of the clones, markers, and contigs, but
> > maybe that will be usefull as an alternative to WebFPC (a java view only
> > version of fpc).  It works for us, but might not work for everybody.  We
> > should be able to patch it up, though, if it's missing features.
> >
> > So, anyways, if somebody can let me know how to go about submitting it,
> > we'll start the process.  I looked through the FAQ and it basically said
> > to just post information if you have a module that you would like to
> > contribute, so, here's the information.
> >
> > Jamie
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From jason at cgt.duhs.duke.edu  Mon Aug 25 22:04:26 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Mon Aug 25 21:42:47 2003
Subject: [Bioperl-l] Fwd: [Volunteer] submitting modules
In-Reply-To: <C36CAC62-D762-11D7-A74D-000393CD7CA4@comcast.net>
References: <C36CAC62-D762-11D7-A74D-000393CD7CA4@comcast.net>
Message-ID: <Pine.LNX.4.50.0308252203370.26646-100000@tenero.duhs.duke.edu>

submit it as a feature request at http://bugzilla.open-bio.org.

I'll leave it up to Catherine Letondal to make the okay for adding the
code.

-jason

On Mon, 25 Aug 2003, James Freeman wrote:

> See below.
>
> Begin forwarded message:
>
> > From: "Samuel Thoraval" <s.thoraval@imb.uq.edu.au>
> > Date: Mon Aug 25, 2003  19:46:03 US/Eastern
> > To: volunteer@open-bio.org
> > Subject: [Volunteer] submitting modules
> >
> > Hello,
> >
> > I have written a module for the Bioperl/Pise API.
> > I would like to submit it.
> > To which email should i send the details, code and request to ?
> >
> > Regards,
> >
> > Samuel Thoraval
> > _______________________________________________
> > Volunteer mailing list
> > Volunteer@open-bio.org
> > http://open-bio.org/mailman/listinfo/volunteer
> >
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From fangl at genomics.org.cn  Tue Aug 26 05:49:24 2003
From: fangl at genomics.org.cn (Magic Fang)
Date: Mon Aug 25 21:45:16 2003
Subject: [Bioperl-l] abott gff manipunation
Message-ID: <200308260945671.SM01140@magicnb>

dear my colleague,
i am now manipunating a GFF file with bioperl
the content is like:
#Seq.	Source	Feature	Start	End	Score	Strand	Phase	Group
CNS06C8G	blat	similarity	201148	202447	100	+	.	product 16S ribosomal RNA, chromosome I of strain GB-M1 of Encephalitozoon cuniculi (Microspora).
CNS06C8G	blat	similarity	7536	8835	100	-	.	product 16S ribosomal RNA, chromosome I of strain GB-M1 of Encephalitozoon cuniculi (Microspora).
CNS06C8G	blat	similarity	202483	204969	100	+	.	product 5.8S-23S ribosomal RNA, chromosome I of strain GB-M1 of Encephalitozoon cuniculi (Microspora).

my code is like:
#!/usr/bin/perl

use Bio::Tools::GFF;    
my $gff = Bio::Tools::GFF->new(-fh => \*STDIN, -gff_version => 2);    
while($feat = $gff->next_feature()) {        
	print $feat->seq_id, "\t",
		$feat->source_tag, "\t", 
		$feat->primary_tag, "\t",
		$feat->start, "\t",
		$feat->end, "\t",
		$feat->frame, "\t",
		$feat->score, "\t",
		$feat->strand, "\n";
}    
$gff->close();  

my question is how to get the info. in the group column.
thank u.


From jason at cgt.duhs.duke.edu  Mon Aug 25 22:21:05 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Mon Aug 25 21:59:36 2003
Subject: [Bioperl-l] abott gff manipunation
In-Reply-To: <200308260945671.SM01140@magicnb>
References: <200308260945671.SM01140@magicnb>
Message-ID: <Pine.LNX.4.50.0308252214490.26646-100000@tenero.duhs.duke.edu>

We store this as tag/value pairs, since all the lines start with
'product'  you can get the data via
my @productdata = $feature->get_tag_values('product');

Note an API change - for pre-bioperl 1.2 this was
my @productdata = $feature->each_tag_value('product');
(although the old API is still supported for now)

But having the group column being basically free-text is bad idea, read up
on the GFF format, you should try and provide a qualifier for each field
there.

http://www.sanger.ac.uk/Software/GFF/
http://www.sanger.ac.uk/Software/GFF/GFF_Spec.html

-jason

On Tue, 26 Aug 2003, Magic Fang wrote:

> dear my colleague,
> i am now manipunating a GFF file with bioperl
> the content is like:
> #Seq.	Source	Feature	Start	End	Score	Strand	Phase	Group
> CNS06C8G	blat	similarity	201148	202447	100	+	.	product 16S ribosomal RNA, chromosome I of strain GB-M1 of Encephalitozoon cuniculi (Microspora).
> CNS06C8G	blat	similarity	7536	8835	100	-	.	product 16S ribosomal RNA, chromosome I of strain GB-M1 of Encephalitozoon cuniculi (Microspora).
> CNS06C8G	blat	similarity	202483	204969	100	+	.	product 5.8S-23S ribosomal RNA, chromosome I of strain GB-M1 of Encephalitozoon cuniculi (Microspora).
>
> my code is like:
> #!/usr/bin/perl
>
> use Bio::Tools::GFF;
> my $gff = Bio::Tools::GFF->new(-fh => \*STDIN, -gff_version => 2);
> while($feat = $gff->next_feature()) {
> 	print $feat->seq_id, "\t",
> 		$feat->source_tag, "\t",
> 		$feat->primary_tag, "\t",
> 		$feat->start, "\t",
> 		$feat->end, "\t",
> 		$feat->frame, "\t",
> 		$feat->score, "\t",
> 		$feat->strand, "\n";
> }
> $gff->close();
>
> my question is how to get the info. in the group column.
> thank u.
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From fangl at genomics.org.cn  Tue Aug 26 11:51:02 2003
From: fangl at genomics.org.cn (Magic Fang)
Date: Tue Aug 26 03:46:50 2003
Subject: [Bioperl-l] about gff format to feature table format
Message-ID: <200308261547218.SM01140@magicnb>

dear my colleagues
i have a gff format file, such as:
#Seq.   Source  Feature Start   End     Score   Strand  Phase   Group
CNS06C8G        GlimmerM        Terminal        160     228     1       -       0       Gene 1
CNS06C8G        GlimmerM        Internal        3771    3924    1       -       0       Gene 1
CNS06C8G        GlimmerM        Initial 5902    5915    1       -       1       Gene 1
CNS06C8G        GlimmerM        Initial 6330    6555    1       +       0       Gene 2
CNS06C8G        GlimmerM        Internal        6626    6706    1       +       1       Gene 2
CNS06C8G        GlimmerM        Internal        6913    7347    1       +       1       Gene 2
CNS06C8G        GlimmerM        Internal        7896    7975    1       +       1       Gene 2
CNS06C8G        GlimmerM        Internal        8131    8160    1       +       0       Gene 2
CNS06C8G        GlimmerM        Internal        12054   12113   1       +       0       Gene 2
CNS06C8G        GlimmerM        Internal        15857   16217   1       +       0       Gene 2
CNS06C8G        GlimmerM        Terminal        16377   16657   1       +       1       Gene 2
CNS06C8G        GlimmerM        Terminal        17607   17732   1       -       0       Gene 3
CNS06C8G        GlimmerM        Internal        17813   18361   1       -       0       Gene 3
CNS06C8G        GlimmerM        Initial 18659   18844   1       -       0       Gene 3
CNS06C8G        GlimmerM        Initial 19172   19268   1       +       0       Gene 4
can bioperl merge the entries belong to one gene to one sequence feature, when i use Bio::Tools::GFF?
thank you.



From letondal at pasteur.fr  Tue Aug 26 04:57:22 2003
From: letondal at pasteur.fr (Catherine Letondal)
Date: Tue Aug 26 04:56:30 2003
Subject: [Bioperl-l] Fwd: [Volunteer] submitting modules (PiseWorkflow.pm)
In-Reply-To: <Pine.LNX.4.50.0308252203370.26646-100000@tenero.duhs.duke.edu>;
	from jason@cgt.duhs.duke.edu on Mon, Aug 25, 2003 at 10:04:26PM
	-0400
References: <C36CAC62-D762-11D7-A74D-000393CD7CA4@comcast.net>
	<Pine.LNX.4.50.0308252203370.26646-100000@tenero.duhs.duke.edu>
Message-ID: <20030826105722.A399257@electre.pasteur.fr>

On Mon, Aug 25, 2003 at 10:04:26PM -0400, Jason Stajich wrote:
> submit it as a feature request at http://bugzilla.open-bio.org.
> 
> I'll leave it up to Catherine Letondal to make the okay for adding the
> code.

I'm rather Ok to add the code in CVS if it is ok with you. This is a
nice and light-weight module for building a workflow. I have tested it
and discuss with Samuel about its features. For instance, say you to
build a workflow with an alignment and a phylogeny: you first
instantiate the applications and set parameters, without running
them. You then build the workflow and run it. Parallel branches of the
workflow are submitted in parallel.

use Bio::Tools::Run::AnalysisFactory::Pise;
use Bio::Tools::Run::PiseWorkflow;

my $factory = new Bio::Tools::Run::AnalysisFactory::Pise();
my $clustalw = $factory->program('clustalw');
$clustalw->infile($ARGV[0]);
my $protdist = $factory->program('protdist');
my $protpars = $factory->program('protpars');
my $fitch = $factory->program('fitch');
my $consense = $factory->program('consense');
my $workflow = Bio::Tools::Run::PiseWorkflow->new();
$workflow->addpipe(-method => $clustalw,
                   -tomethod => $protdist,
                   -pipetype => 'readseq_ok_alig');
$workflow->addpipe(-method => $clustalw,
                   -tomethod => $protpars,
                   -pipetype => 'readseq_ok_alig');
$workflow->addpipe(-method => $protdist,
  	           -tomethod => $fitch,
		   -pipetype => 'phylip_dist');
$workflow->addpipe(-method => $protpars,
	           -tomethod => $consense,
	           -pipetype =>  'phylip_tree');
$workflow->run();

Results are reported in 2 forms:
an HTML file that is created at the beginning of the run, containing
jobs status and link to the results, and a perl file containing this
information in perl format. Errors a just reported. So, it's really
lightweight, compared to biopipe for instance, but I believe, still
very useful. 

> 
> -jason
> 
> On Mon, 25 Aug 2003, James Freeman wrote:
> 
> > See below.
> >
> > Begin forwarded message:
> >
> > > From: "Samuel Thoraval" <s.thoraval@imb.uq.edu.au>
> > > Date: Mon Aug 25, 2003  19:46:03 US/Eastern
> > > To: volunteer@open-bio.org
> > > Subject: [Volunteer] submitting modules
> > >
> > > Hello,
> > >
> > > I have written a module for the Bioperl/Pise API.
> > > I would like to submit it.
> > > To which email should i send the details, code and request to ?
> > >
> > > Regards,
> > >
> > > Samuel Thoraval

-- 
Catherine Letondal -- Pasteur Institute Computing Center
From fangl at genomics.org.cn  Tue Aug 26 13:10:11 2003
From: fangl at genomics.org.cn (Magic Fang)
Date: Tue Aug 26 05:06:02 2003
Subject: [Bioperl-l] about gff format to feature table format
Message-ID: <200308261706968.SM01140@magicnb>

dear my colleagues
i have a gff format file, such as:
#Seq.   Source  Feature Start   End     Score   Strand  Phase   Group
CNS06C8G        GlimmerM        Terminal        160     228     1       -       0       Gene 1
CNS06C8G        GlimmerM        Internal        3771    3924    1       -       0       Gene 1
CNS06C8G        GlimmerM        Initial 5902    5915    1       -       1       Gene 1
CNS06C8G        GlimmerM        Initial 6330    6555    1       +       0       Gene 2
CNS06C8G        GlimmerM        Internal        6626    6706    1       +       1       Gene 2
CNS06C8G        GlimmerM        Internal        6913    7347    1       +       1       Gene 2
CNS06C8G        GlimmerM        Internal        7896    7975    1       +       1       Gene 2
CNS06C8G        GlimmerM        Internal        8131    8160    1       +       0       Gene 2
CNS06C8G        GlimmerM        Internal        12054   12113   1       +       0       Gene 2
CNS06C8G        GlimmerM        Internal        15857   16217   1       +       0       Gene 2
CNS06C8G        GlimmerM        Terminal        16377   16657   1       +       1       Gene 2
CNS06C8G        GlimmerM        Terminal        17607   17732   1       -       0       Gene 3
CNS06C8G        GlimmerM        Internal        17813   18361   1       -       0       Gene 3
CNS06C8G        GlimmerM        Initial 18659   18844   1       -       0       Gene 3
CNS06C8G        GlimmerM        Initial 19172   19268   1       +       0       Gene 4
can bioperl merge the entries belong to one gene to one sequence feature, when i use Bio::Tools::GFF?
thank you.


From brian_osborne at cognia.com  Tue Aug 26 08:28:56 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Tue Aug 26 08:31:49 2003
Subject: [Bioperl-l] Re: Bio::FPC
In-Reply-To: <1061850911.562.96.camel@motox>
Message-ID: <GAEDKMGOKFBLJPKCLKCCOEDDDBAA.brian_osborne@cognia.com>

Jamie,

One of the challenges in Bioperl is creating a single coherent set of
modules from the many individual contributions. Could you tell us a bit
about your modules and how they overlap functionally with the existing
modules in Bio::Map? If you take a look at those modules you can see that a
good number of the more steadfast Bioperl authors have contributed to
Bio::Map, I'm sure that they'd like to see your modules integrate neatly
with the existing code.

I'm not one of these authors, I'm simply responding because it seems that
you'd like to get some discussion going.

Brian O.

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jamie Hatfield
Sent: Monday, August 25, 2003 6:35 PM
To: BioPerl-List
Subject: Re: [Bioperl-l] Re: Bio::FPC

Again, how do I go about submitting this?

On Thu, 2003-08-14 at 09:34, Jamie Hatfield wrote:
> Yes, actually.  We are just now finishing up the fpc parser.  I was
> planning on soon asking the group how I would go about submitting it?
> It consists of 5 modules that we have put in the MapIO and Map
> namespaces.
> Bio::MapIO::fpc.pm
> Bio::Map::physical.pm
> Bio::Map::fpcmarker.pm  (sorry, but marker doesn't work)
> Bio::Map::clone.pm
> Bio::Map::contig.pm
>
> If you want to see how this object might be used, check out
> http://www.genome.arizona.edu/software/fpc/biofpc/index.html
>
> You'll see there documentation for the modules, and a few test cases or
> example usages.
>
> Also, we are trying to make a generic converter to let you load in a fpc
> file and generate the necessary GFF for GBrowse to display the fpc map.
> It's a quite simple display of the clones, markers, and contigs, but
> maybe that will be usefull as an alternative to WebFPC (a java view only
> version of fpc).  It works for us, but might not work for everybody.  We
> should be able to patch it up, though, if it's missing features.
>
> So, anyways, if somebody can let me know how to go about submitting it,
> we'll start the process.  I looked through the FAQ and it basically said
> to just post information if you have a module that you would like to
> contribute, so, here's the information.
>
> Jamie


_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From jamie at genome.arizona.edu  Tue Aug 26 11:47:40 2003
From: jamie at genome.arizona.edu (Jamie Hatfield)
Date: Tue Aug 26 11:47:41 2003
Subject: [Bioperl-l] Re: Bio::FPC
In-Reply-To: <GAEDKMGOKFBLJPKCLKCCOEDDDBAA.brian_osborne@cognia.com>
References: <GAEDKMGOKFBLJPKCLKCCOEDDDBAA.brian_osborne@cognia.com>
Message-ID: <1061912784.562.112.camel@motox>

Yes, definitly, discussion is great!  

We had a little bit of a discussion about this back in November 2002,
when I proposed the idea, and it was suggested by Heikki to try to fit
it into either Bio::Map or Bio::Assembly.  Maybe I picked the wrong
one?  How about this...  I will describe a little bit about what fpc is,
for those who don't know, and those who know Bio::Map and Bio::Assembly
will tell me if it fits in their design.  ok?

FPC stands for FingerPrinted Contigs.  Its main purpose is to assemble
clones into contiguous regions of overlaps, based on the fingerprint of
the clones.  These fingerprints can be from agarose (sp?) gels, or HICF,
or simulated, or whatever.  Maybe this is more like Assembly?  

Anyway, you have the clones, and there are also markers that hit the
clones, and aid in assembling the clones into contigs.  These are the
main 3 classes.  Clones, Contigs, Markers.  Contigs contain Clones. 
Markers hit Clones.  Clones are hit by markers.

Contigs 1--m Clones
Markers m--m Clones

Is that a sufficient description of FPC, or do we need more to make a
good decision?

Thanks for initiating the discussion, Brian.

Jamie

On Tue, 2003-08-26 at 05:28, Brian Osborne wrote:
> Jamie,
> 
> One of the challenges in Bioperl is creating a single coherent set of
> modules from the many individual contributions. Could you tell us a bit
> about your modules and how they overlap functionally with the existing
> modules in Bio::Map? If you take a look at those modules you can see that a
> good number of the more steadfast Bioperl authors have contributed to
> Bio::Map, I'm sure that they'd like to see your modules integrate neatly
> with the existing code.
> 
> I'm not one of these authors, I'm simply responding because it seems that
> you'd like to get some discussion going.
> 
> Brian O.
> 
> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org
> [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jamie Hatfield
> Sent: Monday, August 25, 2003 6:35 PM
> To: BioPerl-List
> Subject: Re: [Bioperl-l] Re: Bio::FPC
> 
> Again, how do I go about submitting this?
> 
> On Thu, 2003-08-14 at 09:34, Jamie Hatfield wrote:
> > Yes, actually.  We are just now finishing up the fpc parser.  I was
> > planning on soon asking the group how I would go about submitting it?
> > It consists of 5 modules that we have put in the MapIO and Map
> > namespaces.
> > Bio::MapIO::fpc.pm
> > Bio::Map::physical.pm
> > Bio::Map::fpcmarker.pm  (sorry, but marker doesn't work)
> > Bio::Map::clone.pm
> > Bio::Map::contig.pm
> >
> > If you want to see how this object might be used, check out
> > http://www.genome.arizona.edu/software/fpc/biofpc/index.html
> >
> > You'll see there documentation for the modules, and a few test cases or
> > example usages.
> >
> > Also, we are trying to make a generic converter to let you load in a fpc
> > file and generate the necessary GFF for GBrowse to display the fpc map.
> > It's a quite simple display of the clones, markers, and contigs, but
> > maybe that will be usefull as an alternative to WebFPC (a java view only
> > version of fpc).  It works for us, but might not work for everybody.  We
> > should be able to patch it up, though, if it's missing features.
> >
> > So, anyways, if somebody can let me know how to go about submitting it,
> > we'll start the process.  I looked through the FAQ and it basically said
> > to just post information if you have a module that you would like to
> > contribute, so, here's the information.
> >
> > Jamie
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 
> 


From brian_osborne at cognia.com  Tue Aug 26 12:39:56 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Tue Aug 26 12:43:22 2003
Subject: [Bioperl-l] Re: Bio::FPC
In-Reply-To: <1061912784.562.112.camel@motox>
Message-ID: <GAEDKMGOKFBLJPKCLKCCOEDKDBAA.brian_osborne@cognia.com>

Jamie,

And a "marker" can be a genetic marker, yes? A la Bio::Map::Marker? If you
take a look at this module you'll see that its definition of marker allows
any marker to have different positions in different maps (contig "map",
genetic map, physical map). This seems to overlap with your notion of
marker.

Here's my first impression. There's a parser, MapIO::mapmaker for mapmaker,
mapmaker makes maps from segregation data, genetic data. Your fpc makes
physical maps, yet physical and genetic maps can be merged to create
"integrated maps". Your fpcmarker must be closely related to
Bio::Map::Marker, in fact it's not clear that there should be an fpcmarker.
I would think that a Marker object could be a reasonably rich one, and it
could be created by fpc or any other program, it really shouldn't matter
much how it's created (in fact, all this new PopGen code must be ordering
markers to make maps, I'd think). Perhaps you should be using some of the
existing code in Bio/Map? Your thoughts?

Brian O.

-----Original Message-----
From: Jamie Hatfield [mailto:jamie@genome.arizona.edu]
Sent: Tuesday, August 26, 2003 11:46 AM
To: Brian Osborne
Cc: BioPerl-List
Subject: RE: [Bioperl-l] Re: Bio::FPC

Yes, definitly, discussion is great!

We had a little bit of a discussion about this back in November 2002,
when I proposed the idea, and it was suggested by Heikki to try to fit
it into either Bio::Map or Bio::Assembly.  Maybe I picked the wrong
one?  How about this...  I will describe a little bit about what fpc is,
for those who don't know, and those who know Bio::Map and Bio::Assembly
will tell me if it fits in their design.  ok?

FPC stands for FingerPrinted Contigs.  Its main purpose is to assemble
clones into contiguous regions of overlaps, based on the fingerprint of
the clones.  These fingerprints can be from agarose (sp?) gels, or HICF,
or simulated, or whatever.  Maybe this is more like Assembly?

Anyway, you have the clones, and there are also markers that hit the
clones, and aid in assembling the clones into contigs.  These are the
main 3 classes.  Clones, Contigs, Markers.  Contigs contain Clones.
Markers hit Clones.  Clones are hit by markers.

Contigs 1--m Clones
Markers m--m Clones

Is that a sufficient description of FPC, or do we need more to make a
good decision?

Thanks for initiating the discussion, Brian.

Jamie

On Tue, 2003-08-26 at 05:28, Brian Osborne wrote:
> Jamie,
>
> One of the challenges in Bioperl is creating a single coherent set of
> modules from the many individual contributions. Could you tell us a bit
> about your modules and how they overlap functionally with the existing
> modules in Bio::Map? If you take a look at those modules you can see that
a
> good number of the more steadfast Bioperl authors have contributed to
> Bio::Map, I'm sure that they'd like to see your modules integrate neatly
> with the existing code.
>
> I'm not one of these authors, I'm simply responding because it seems that
> you'd like to get some discussion going.
>
> Brian O.
>
> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org
> [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jamie Hatfield
> Sent: Monday, August 25, 2003 6:35 PM
> To: BioPerl-List
> Subject: Re: [Bioperl-l] Re: Bio::FPC
>
> Again, how do I go about submitting this?
>
> On Thu, 2003-08-14 at 09:34, Jamie Hatfield wrote:
> > Yes, actually.  We are just now finishing up the fpc parser.  I was
> > planning on soon asking the group how I would go about submitting it?
> > It consists of 5 modules that we have put in the MapIO and Map
> > namespaces.
> > Bio::MapIO::fpc.pm
> > Bio::Map::physical.pm
> > Bio::Map::fpcmarker.pm  (sorry, but marker doesn't work)
> > Bio::Map::clone.pm
> > Bio::Map::contig.pm
> >
> > If you want to see how this object might be used, check out
> > http://www.genome.arizona.edu/software/fpc/biofpc/index.html
> >
> > You'll see there documentation for the modules, and a few test cases or
> > example usages.
> >
> > Also, we are trying to make a generic converter to let you load in a fpc
> > file and generate the necessary GFF for GBrowse to display the fpc map.
> > It's a quite simple display of the clones, markers, and contigs, but
> > maybe that will be usefull as an alternative to WebFPC (a java view only
> > version of fpc).  It works for us, but might not work for everybody.  We
> > should be able to patch it up, though, if it's missing features.
> >
> > So, anyways, if somebody can let me know how to go about submitting it,
> > we'll start the process.  I looked through the FAQ and it basically said
> > to just post information if you have a module that you would like to
> > contribute, so, here's the information.
> >
> > Jamie
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>



From birney at ebi.ac.uk  Tue Aug 26 13:02:11 2003
From: birney at ebi.ac.uk (Ewan Birney)
Date: Tue Aug 26 13:01:00 2003
Subject: [Bioperl-l] Re: Bio::FPC
In-Reply-To: <GAEDKMGOKFBLJPKCLKCCOEDKDBAA.brian_osborne@cognia.com>
Message-ID: <Pine.OSX.4.44.0308261801100.521-100000@ewan-birneys-computer.local>



On Tue, 26 Aug 2003, Brian Osborne wrote:

> Jamie,
>
> And a "marker" can be a genetic marker, yes? A la Bio::Map::Marker? If you
> take a look at this module you'll see that its definition of marker allows
> any marker to have different positions in different maps (contig "map",
> genetic map, physical map). This seems to overlap with your notion of
> marker.
>
> Here's my first impression. There's a parser, MapIO::mapmaker for mapmaker,
> mapmaker makes maps from segregation data, genetic data. Your fpc makes
> physical maps, yet physical and genetic maps can be merged to create
> "integrated maps". Your fpcmarker must be closely related to
> Bio::Map::Marker, in fact it's not clear that there should be an fpcmarker.
> I would think that a Marker object could be a reasonably rich one, and it
> could be created by fpc or any other program, it really shouldn't matter
> much how it's created (in fact, all this new PopGen code must be ordering
> markers to make maps, I'd think). Perhaps you should be using some of the
> existing code in Bio/Map? Your thoughts?
>

Brian - I doubt the pop gen stuff will overlap at all with this stuff. but
the marker comment is right, though I can well believe there needs to be
specific FPC hooks for markers used for FPC stuff....




> Brian O.
>
> -----Original Message-----
> From: Jamie Hatfield [mailto:jamie@genome.arizona.edu]
> Sent: Tuesday, August 26, 2003 11:46 AM
> To: Brian Osborne
> Cc: BioPerl-List
> Subject: RE: [Bioperl-l] Re: Bio::FPC
>
> Yes, definitly, discussion is great!
>
> We had a little bit of a discussion about this back in November 2002,
> when I proposed the idea, and it was suggested by Heikki to try to fit
> it into either Bio::Map or Bio::Assembly.  Maybe I picked the wrong
> one?  How about this...  I will describe a little bit about what fpc is,
> for those who don't know, and those who know Bio::Map and Bio::Assembly
> will tell me if it fits in their design.  ok?
>
> FPC stands for FingerPrinted Contigs.  Its main purpose is to assemble
> clones into contiguous regions of overlaps, based on the fingerprint of
> the clones.  These fingerprints can be from agarose (sp?) gels, or HICF,
> or simulated, or whatever.  Maybe this is more like Assembly?
>
> Anyway, you have the clones, and there are also markers that hit the
> clones, and aid in assembling the clones into contigs.  These are the
> main 3 classes.  Clones, Contigs, Markers.  Contigs contain Clones.
> Markers hit Clones.  Clones are hit by markers.
>
> Contigs 1--m Clones
> Markers m--m Clones
>
> Is that a sufficient description of FPC, or do we need more to make a
> good decision?
>
> Thanks for initiating the discussion, Brian.
>
> Jamie
>
> On Tue, 2003-08-26 at 05:28, Brian Osborne wrote:
> > Jamie,
> >
> > One of the challenges in Bioperl is creating a single coherent set of
> > modules from the many individual contributions. Could you tell us a bit
> > about your modules and how they overlap functionally with the existing
> > modules in Bio::Map? If you take a look at those modules you can see that
> a
> > good number of the more steadfast Bioperl authors have contributed to
> > Bio::Map, I'm sure that they'd like to see your modules integrate neatly
> > with the existing code.
> >
> > I'm not one of these authors, I'm simply responding because it seems that
> > you'd like to get some discussion going.
> >
> > Brian O.
> >
> > -----Original Message-----
> > From: bioperl-l-bounces@portal.open-bio.org
> > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jamie Hatfield
> > Sent: Monday, August 25, 2003 6:35 PM
> > To: BioPerl-List
> > Subject: Re: [Bioperl-l] Re: Bio::FPC
> >
> > Again, how do I go about submitting this?
> >
> > On Thu, 2003-08-14 at 09:34, Jamie Hatfield wrote:
> > > Yes, actually.  We are just now finishing up the fpc parser.  I was
> > > planning on soon asking the group how I would go about submitting it?
> > > It consists of 5 modules that we have put in the MapIO and Map
> > > namespaces.
> > > Bio::MapIO::fpc.pm
> > > Bio::Map::physical.pm
> > > Bio::Map::fpcmarker.pm  (sorry, but marker doesn't work)
> > > Bio::Map::clone.pm
> > > Bio::Map::contig.pm
> > >
> > > If you want to see how this object might be used, check out
> > > http://www.genome.arizona.edu/software/fpc/biofpc/index.html
> > >
> > > You'll see there documentation for the modules, and a few test cases or
> > > example usages.
> > >
> > > Also, we are trying to make a generic converter to let you load in a fpc
> > > file and generate the necessary GFF for GBrowse to display the fpc map.
> > > It's a quite simple display of the clones, markers, and contigs, but
> > > maybe that will be usefull as an alternative to WebFPC (a java view only
> > > version of fpc).  It works for us, but might not work for everybody.  We
> > > should be able to patch it up, though, if it's missing features.
> > >
> > > So, anyways, if somebody can let me know how to go about submitting it,
> > > we'll start the process.  I looked through the FAQ and it basically said
> > > to just post information if you have a module that you would like to
> > > contribute, so, here's the information.
> > >
> > > Jamie
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

From saluja at medical-data-solutions.com  Tue Aug 26 14:24:24 2003
From: saluja at medical-data-solutions.com (Sunil Saluja)
Date: Tue Aug 26 14:24:25 2003
Subject: [Bioperl-l] remote blast
Message-ID: <1061922355.10458.8.camel@localhost.localdomain>

Has there been a recent change in the way in which ncbi responds to
remote blast requests using the biperl module
Bio::Tools::Run::RemoteBlast ?

I had no problem using this module a couple of weeks ago, and I was able
to run several queries with success.  I am now not able to retreive
anything.  When I use known queries I still get nothing.  If I go to the
website and manually enter a query, everything works.

I know that the pubmed servers no longer work with older versions of
endnote (6.x), and that this is a very recent change.  Have they done
something recently which is making this remote blast module not work?

Thanks,

Sunil Saluja

From Wiepert.Mathieu at mayo.edu  Tue Aug 26 14:38:35 2003
From: Wiepert.Mathieu at mayo.edu (Wiepert, Mathieu)
Date: Tue Aug 26 14:37:44 2003
Subject: [Bioperl-l] Blast ridline changed? RemoteBlast seems to be
	failing...
Message-ID: <2F41CC6C9777D311ACBD009027B108EA06E9A676@excsrv32.mayo.edu>

Hi,

I was doing remote blasts, but they all fail saying RID not found.  The RID format seems to have changed to include something like a .BLASTQ3 at the end, so the pattern in RemoteBlast doesn't match.

    $RIDLINE = 'RID\s+=\s+(\d+-\d+-\d+)';

I think the above could be changed to something like

    $RIDLINE = 'RID\s+=\s+(\d+-\d+-\d+\.BLASTQ\d)';

It would seem that not many people are using remoteblast or else this would have been noticed before? Or I could be doing something different, but it is a blastn with default parameters mostly.  Also, not sure if the RID format will always get the BLASTQ3 at the end, or what the permanent pattern is.  Does anyone know?

Thanks,

-mat
From sunil.saluja at TCH.Harvard.edu  Tue Aug 26 14:24:41 2003
From: sunil.saluja at TCH.Harvard.edu (Sunil Saluja)
Date: Tue Aug 26 14:40:07 2003
Subject: [Bioperl-l] Remote Blast
Message-ID: <244ae224ae.224ae244ae@tch.harvard.edu>

Has there been a recent change in the way in which ncbi responds to
remote blast requests using the biperl module
Bio::Tools::Run::RemoteBlast ?

I had no problem using this module a couple of weeks ago, and I was able
to run several queries with success.  I am now not able to retreive
anything.  When I use known queries I still get nothing.  If I go to the
website and manually enter a query, everything works.

I know that the pubmed servers no longer work with older versions of
endnote (6.x), and that this is a very recent change.  Have they done
something recently which is making this remote blast module not work?

Thanks,

Sunil Saluja

Sunil K. Saluja MD
Fellow in Medical Informatics
Fellow in Neonatal-Perinatal Medicine
Children's Hospital Boston
Harvard Medical School

From Wiepert.Mathieu at mayo.edu  Tue Aug 26 14:49:27 2003
From: Wiepert.Mathieu at mayo.edu (Wiepert, Mathieu)
Date: Tue Aug 26 14:48:42 2003
Subject: [Bioperl-l] remote blast
Message-ID: <2F41CC6C9777D311ACBD009027B108EA06E9A679@excsrv32.mayo.edu>

Hi,

Guess I spoke to fast, someone else has the problem ;-)  Can anyone confirm the format of the RIDLINE for us now?  It is an easy fix to make, but I would like to make sure I have the pattern correctly noted.

Thanks,

-mat

-----Original Message-----
From: Sunil Saluja [mailto:saluja@medical-data-solutions.com]
Sent: Tuesday, August 26, 2003 1:26 PM
To: bioperl-l@bioperl.org
Subject: [Bioperl-l] remote blast


Has there been a recent change in the way in which ncbi responds to
remote blast requests using the biperl module
Bio::Tools::Run::RemoteBlast ?

I had no problem using this module a couple of weeks ago, and I was able
to run several queries with success.  I am now not able to retreive
anything.  When I use known queries I still get nothing.  If I go to the
website and manually enter a query, everything works.

I know that the pubmed servers no longer work with older versions of
endnote (6.x), and that this is a very recent change.  Have they done
something recently which is making this remote blast module not work?

Thanks,

Sunil Saluja

_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l
From quickster333 at hotmail.com  Tue Aug 26 15:03:12 2003
From: quickster333 at hotmail.com (Johnny Amos)
Date: Tue Aug 26 15:02:12 2003
Subject: [Bioperl-l] RemoteBlast failing?
Message-ID: <BAY2-F5gC2DWpmy20h00001946b@hotmail.com>

Hello,

Was there some change with the handling of BLASTs at NCBI?  I haven't tried 
for a couple of weeks, but today all my scripts are failing.

Johnny

_________________________________________________________________
Help protect your PC: Get a free online virus scan at McAfee.com. 
http://clinic.mcafee.com/clinic/ibuy/campaign.asp?cid=3963

From Wiepert.Mathieu at mayo.edu  Tue Aug 26 16:42:02 2003
From: Wiepert.Mathieu at mayo.edu (Wiepert, Mathieu)
Date: Tue Aug 26 16:41:09 2003
Subject: [Bioperl-l] RemoteBlast failing?
Message-ID: <2F41CC6C9777D311ACBD009027B108EA06E9A67F@excsrv32.mayo.edu>

Hi,

I got an email from NCBI on this, here is the response...

"We are doing some internal reorganization and the RID is for us to keep
track of the searches going through different setup.  I believe after the
reorganization is done, the RID should return to their old format.

I will check with our developers to make should.  If you use them to
retrieve result in your script, I would suggest that the script be more
tolerant and take the whole thing."

So, guess we need to take in everything as suggested.  I am somewhat surprised at the capriciousness of changing the exposed RID format while reorganizing, but not much can be done about it.

-mat

-----Original Message-----
From: Johnny Amos [mailto:quickster333@hotmail.com]
Sent: Tuesday, August 26, 2003 2:03 PM
To: bioperl-l@bioperl.org
Subject: [Bioperl-l] RemoteBlast failing?


Hello,

Was there some change with the handling of BLASTs at NCBI?  I haven't tried 
for a couple of weeks, but today all my scripts are failing.

Johnny

_________________________________________________________________
Help protect your PC: Get a free online virus scan at McAfee.com. 
http://clinic.mcafee.com/clinic/ibuy/campaign.asp?cid=3963

_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l
From serge at iem.sp.ru  Wed Aug 27 09:15:30 2003
From: serge at iem.sp.ru (Sergey V. Orlov)
Date: Wed Aug 27 09:14:41 2003
Subject: [Bioperl-l] Bio::Tools::Run::RemoteBlast: RID not found
Message-ID: <3F4CAEF2.66D16697@iem.sp.ru>

Hi, I had got the same problem. It's caused by wrong regular expression
on line 168 in RemoteBlast.pm module.
Just change
$RIDLINE = 'RID\s+=\s+(\d+-\d+-\d+)';
to something like
$RIDLINE = 'RID\s+=\s+(\d+-\d+-\d+\.BLASTQ3)';
and it'll work.
Good luck, Serge.

From Wiepert.Mathieu at mayo.edu  Wed Aug 27 10:07:25 2003
From: Wiepert.Mathieu at mayo.edu (Wiepert, Mathieu)
Date: Wed Aug 27 10:06:50 2003
Subject: [Bioperl-l] Bio::Tools::Run::RemoteBlast: RID not found
Message-ID: <2F41CC6C9777D311ACBD009027B108EA06E9A682@excsrv32.mayo.edu>

Hi,

Unfortunately, that can't be the fix, since NCBI has said that the structure of the RID, with '.BLASTQ3' appended is not to be relied upon.  How much it is not to be relied upon has yet to be determined?

But, I think it is fair to say that 

$RIDLINE = 'RID\s+=\s+(\S+)';

might work.  Or is that too broad?  I would think all contiguous non-white space after the = would be OK.

-mat

-----Original Message-----
From: Sergey V. Orlov [mailto:serge@iem.sp.ru]
Sent: Wednesday, August 27, 2003 8:16 AM
To: bioperl-l@portal.open-bio.org
Subject: [Bioperl-l] Bio::Tools::Run::RemoteBlast: RID not found


Hi, I had got the same problem. It's caused by wrong regular expression
on line 168 in RemoteBlast.pm module.
Just change
$RIDLINE = 'RID\s+=\s+(\d+-\d+-\d+)';
to something like
$RIDLINE = 'RID\s+=\s+(\d+-\d+-\d+\.BLASTQ3)';
and it'll work.
Good luck, Serge.

_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l
From dag at sonsorol.org  Wed Aug 27 11:46:07 2003
From: dag at sonsorol.org (Chris Dagdigian)
Date: Wed Aug 27 11:45:18 2003
Subject: [Bioperl-l] Open-Bio server downtime and IP address changes
 scheduled for Tuesday September 2nd 2003
Message-ID: <3F4CD23F.8090807@sonsorol.org>


Hi Everyone,

Apologies for the mass cross-posting but this email is about server and 
IP changes that will affect all of our projects and servers.

Simply put -- Wyeth, the company that provides us with our hosting and 
wonderful T3 connection to the internet is cutting their internet 
connection circuits over from one ISP to a different Tier 1 internet 
backbone.

Technically the changeover will be swift as the circuit and new 
routers/firewalls are already in place. Should be a matter of bringing 
down the old gear and lighting up the new stuff.

The backbone change will have a significant affect on us though -- all 
of our server IP addresses will change.

The change is scheduled for the evening (EST/EDT timezone) of September 
2nd 2003. I'll be onsite at Wyeth in the datacenter as the change occurs 
so that I can bring down our servers and plug in the new IP addresses.

The really nice thing is that all of our primary and secondary DNS 
nameservers are hosted at places other than Wyeth. This means that we 
can almost instantly be pushing out the new correct IP addresses for all 
of our open-bio.org, biojava.org etc. domain names.

If I can get my act together during the day on Tuesday I'll start 
seeding our DNS servers with shorter TTL values which will speed up the 
spread of the new information.

For people with 'fresh' DNS data our servers will appear back on the 
internet within 30 minutes or so. For people behind nameserver caches 
that do not refresh all that often please expect our servers to "vanish" 
from the internet for a period of about 8-24 hours while the new 
information propagates out through the internet.

Regards,
Chris
open-bio.org




-- 
Chris Dagdigian, <dag@sonsorol.org>
BioTeam Inc. - Independent Bio-IT & Informatics consulting
Office: 617-666-6454, Mobile: 617-877-5498, Fax: 425-699-0193
PGP KeyID: 83D4310E Yahoo IM: craffi Web: http://bioteam.net


From chauser at duke.edu  Wed Aug 27 12:11:29 2003
From: chauser at duke.edu (Charles Hauser)
Date: Wed Aug 27 12:11:31 2003
Subject: [Bioperl-l] extract feature seq when split between 2 GenBank
	accessions
Message-ID: <1062000753.30158.37.camel@pandorina.biology.duke.edu>

All,

I'd like to extract the CDS from genbank records and have found that in
some instances these are distributed among >1 genbank accession (see
below).

I have a script which does fine if CDS is fully contained within 1
accession, other than storing all accession seqs in a hash is there a
good way to deal with these?

Charles


LOCUS       AY095303S1              2375 bp    DNA     linear   PLN 21-JAN-2003
DEFINITION  Chlamydomonas reinhardtii c-type cytochrome synthesis 1 (CCS1)
            gene, ccs1-ac206 allele, 5'UTR and exons 1 through 6.
ACCESSION   AY095303
VERSION     AY095303.1  GI:25986619

     CDS             join(207..330,512..825,1045..1233,1418..1798,2000..2131,
                     2253..2345,AY095304.1:6..303,AY095304.1:495..677,
                     AY095304.1:863..1098)
                     /gene="CCS1"




LOCUS       AY095303S2              1505 bp    DNA     linear   PLN 21-JAN-2003
DEFINITION  Chlamydomonas reinhardtii c-type cytochrome synthesis 1 (CCS1)
            gene, ccs1-ac206 allele, exons 7, 8 and 9, 3'UTR and complete cds.
ACCESSION   AY095304
VERSION     AY095304.1  GI:25986620
     CDS             join(AY095303.1:207..330,AY095303.1:512..825,
                     AY095303.1:1045..1233,AY095303.1:1418..1798,
                     AY095303.1:2000..2131,AY095303.1:2253..2345,6..303,
                     495..677,863..1098)
                     /gene="CCS1"




From jason at cgt.duhs.duke.edu  Wed Aug 27 13:05:08 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Wed Aug 27 12:42:58 2003
Subject: [Bioperl-l] extract feature seq when split between 2 GenBank
	accessions
In-Reply-To: <1062000753.30158.37.camel@pandorina.biology.duke.edu>
References: <1062000753.30158.37.camel@pandorina.biology.duke.edu>
Message-ID: <Pine.LNX.4.50.0308271301160.5651-100000@tenero.duhs.duke.edu>

If you are getting the seq via spliced_seq you can pass in a
Bio::DB::RandomAccessI (either a [local] Bio::Index::Fasta or [remote]
Bio::DB::GenBank, etc db handle) to the spliced_seq object.

Now I think there is a bug because spliced seq is sorting the locations
before processing on them which has been reported but not fixed
(I am really hoping for some more bugfixing developers out there folks!)
but it should work through that system once that bug is fixed.

I would just use a Bio::DB::Fasta/Bio::Index::Fasta where you have the
accessions indexed instead of reading in all the possible seqs and storing
in a hash to keep the memory requirements down.  You can also use the
DB::Failover + DB::FileCache to cache local/remote calls if you need to
mix local and remote dbs.

-jason

On Wed, 27 Aug 2003, Charles Hauser wrote:

> All,
>
> I'd like to extract the CDS from genbank records and have found that in
> some instances these are distributed among >1 genbank accession (see
> below).
>
> I have a script which does fine if CDS is fully contained within 1
> accession, other than storing all accession seqs in a hash is there a
> good way to deal with these?
>
> Charles
>
>
> LOCUS       AY095303S1              2375 bp    DNA     linear   PLN 21-JAN-2003
> DEFINITION  Chlamydomonas reinhardtii c-type cytochrome synthesis 1 (CCS1)
>             gene, ccs1-ac206 allele, 5'UTR and exons 1 through 6.
> ACCESSION   AY095303
> VERSION     AY095303.1  GI:25986619
>
>      CDS             join(207..330,512..825,1045..1233,1418..1798,2000..2131,
>                      2253..2345,AY095304.1:6..303,AY095304.1:495..677,
>                      AY095304.1:863..1098)
>                      /gene="CCS1"
>
>
>
>
> LOCUS       AY095303S2              1505 bp    DNA     linear   PLN 21-JAN-2003
> DEFINITION  Chlamydomonas reinhardtii c-type cytochrome synthesis 1 (CCS1)
>             gene, ccs1-ac206 allele, exons 7, 8 and 9, 3'UTR and complete cds.
> ACCESSION   AY095304
> VERSION     AY095304.1  GI:25986620
>      CDS             join(AY095303.1:207..330,AY095303.1:512..825,
>                      AY095303.1:1045..1233,AY095303.1:1418..1798,
>                      AY095303.1:2000..2131,AY095303.1:2253..2345,6..303,
>                      495..677,863..1098)
>                      /gene="CCS1"
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From chauser at duke.edu  Wed Aug 27 14:35:49 2003
From: chauser at duke.edu (Charles Hauser)
Date: Wed Aug 27 14:35:50 2003
Subject: [Bioperl-l] extract feature seq when split between 2 GenBank
	accessions
In-Reply-To: <Pine.LNX.4.50.0308271301160.5651-100000@tenero.duhs.duke.edu>
References: <1062000753.30158.37.camel@pandorina.biology.duke.edu> 
	<Pine.LNX.4.50.0308271301160.5651-100000@tenero.duhs.duke.edu>
Message-ID: <1062009413.30158.99.camel@pandorina.biology.duke.edu>

Jason,

Thanks.

On Wed, 2003-08-27 at 13:05, Jason Stajich wrote:
> If you are getting the seq via spliced_seq you can pass in a
> Bio::DB::RandomAccessI (either a [local] Bio::Index::Fasta or [remote]
> Bio::DB::GenBank, etc db handle) to the spliced_seq object.
> 
> Now I think there is a bug because spliced seq is sorting the locations
> before processing on them which has been reported but not fixed
> (I am really hoping for some more bugfixing developers out there folks!)
> but it should work through that system once that bug is fixed.

I'm using spliced_seq, and its returning sequence w/ N's for the
segments derived form joins outside the current accession.

> 
> I would just use a Bio::DB::Fasta/Bio::Index::Fasta where you have the
> accessions indexed instead of reading in all the possible seqs and storing
> in a hash to keep the memory requirements down.  You can also use the
> DB::Failover + DB::FileCache to cache local/remote calls if you need to
> mix local and remote dbs.

I'll try this -thanks.

Charles

From jason at cgt.duhs.duke.edu  Wed Aug 27 15:29:18 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Wed Aug 27 15:07:01 2003
Subject: [Bioperl-l] extract feature seq when split between 2 GenBank
	accessions
In-Reply-To: <1062009413.30158.99.camel@pandorina.biology.duke.edu>
References: <1062000753.30158.37.camel@pandorina.biology.duke.edu> 
	<Pine.LNX.4.50.0308271301160.5651-100000@tenero.duhs.duke.edu>
	<1062009413.30158.99.camel@pandorina.biology.duke.edu>
Message-ID: <Pine.LNX.4.50.0308271520010.5651-100000@tenero.duhs.duke.edu>


> > Now I think there is a bug because spliced seq is sorting the locations
> > before processing on them which has been reported but not fixed
> > (I am really hoping for some more bugfixing developers out there folks!)
> > but it should work through that system once that bug is fixed.
>
> I'm using spliced_seq, and its returning sequence w/ N's for the
> segments derived form joins outside the current accession.

Just fixed this in the CVS live.  We have to trust the location order when
it is mixed with remote locations.  There may be a couple more special
cases which the code I put won't catch, so those who have problems, please
submit them so we can add tests.


>
> >
> > I would just use a Bio::DB::Fasta/Bio::Index::Fasta where you have the
> > accessions indexed instead of reading in all the possible seqs and storing
> > in a hash to keep the memory requirements down.  You can also use the
> > DB::Failover + DB::FileCache to cache local/remote calls if you need to
> > mix local and remote dbs.
>
> I'll try this -thanks.
>
> Charles
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From jason at cgt.duhs.duke.edu  Wed Aug 27 16:02:24 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Wed Aug 27 15:40:04 2003
Subject: [Bioperl-l] doing a 1.2.3 release
Message-ID: <Pine.LNX.4.50.0308271600090.5651-100000@tenero.duhs.duke.edu>

In my mind there are enough things that have been fixed since 1.2.2 on the
branch to justify the effort in releasing another bugfix release on the
stable branch.  I would like to merge some of the HTML|TextResultWriter
fixes from the main trunk, otherwise I think could be an easy push out the
door.

-jason

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From letondal at pasteur.fr  Wed Aug 27 16:48:07 2003
From: letondal at pasteur.fr (Catherine Letondal)
Date: Wed Aug 27 16:47:09 2003
Subject: [Bioperl-l] PiseWorkflow.pm
In-Reply-To: <20030826105722.A399257@electre.pasteur.fr>;
	from letondal@pasteur.fr on Tue, Aug 26, 2003 at 10:57:22AM +0200
References: <C36CAC62-D762-11D7-A74D-000393CD7CA4@comcast.net>
	<Pine.LNX.4.50.0308252203370.26646-100000@tenero.duhs.duke.edu>
	<20030826105722.A399257@electre.pasteur.fr>
Message-ID: <20030827224807.A412193@electre.pasteur.fr>

> > > Begin forwarded message:
> > >
> > > > From: "Samuel Thoraval" <s.thoraval@imb.uq.edu.au>
> > > > Date: Mon Aug 25, 2003  19:46:03 US/Eastern
> > > > To: volunteer@open-bio.org
> > > > Subject: [Volunteer] submitting modules
> > > >
> > > > Hello,
> > > >
> > > > I have written a module for the Bioperl/Pise API.
> > > > I would like to submit it.
> > > > To which email should i send the details, code and request to ?
> > > >
> > > > Regards,
> > > >
> > > > Samuel Thoraval
> 

Samuel's PiseWorkflow module has been added in CVS.

-- 
Catherine Letondal -- Pasteur Institute Computing Center
From jamie at genome.arizona.edu  Wed Aug 27 18:05:06 2003
From: jamie at genome.arizona.edu (Jamie Hatfield)
Date: Wed Aug 27 18:05:07 2003
Subject: [Bioperl-l] Re: Bio::FPC
In-Reply-To: <Pine.OSX.4.44.0308261801100.521-100000@ewan-birneys-computer.local>
References: <Pine.OSX.4.44.0308261801100.521-100000@ewan-birneys-computer.local>
Message-ID: <1062021826.562.128.camel@motox>

Bio::Map::Marker is really more like our clones.  A clone has a range
that it exists in contig (or map).  But FPCMarkers don't have a position
in a map.  They "hit" a clone.  That is why I felt it was necessary to
create a new class.  I don't see how these two ideas overlap.


On Tue, 2003-08-26 at 10:02, Ewan Birney wrote:
> 
> 
> On Tue, 26 Aug 2003, Brian Osborne wrote:
> 
> > Jamie,
> >
> > And a "marker" can be a genetic marker, yes? A la Bio::Map::Marker? If you
> > take a look at this module you'll see that its definition of marker allows
> > any marker to have different positions in different maps (contig "map",
> > genetic map, physical map). This seems to overlap with your notion of
> > marker.
> >
> > Here's my first impression. There's a parser, MapIO::mapmaker for mapmaker,
> > mapmaker makes maps from segregation data, genetic data. Your fpc makes
> > physical maps, yet physical and genetic maps can be merged to create
> > "integrated maps". Your fpcmarker must be closely related to
> > Bio::Map::Marker, in fact it's not clear that there should be an fpcmarker.
> > I would think that a Marker object could be a reasonably rich one, and it
> > could be created by fpc or any other program, it really shouldn't matter
> > much how it's created (in fact, all this new PopGen code must be ordering
> > markers to make maps, I'd think). Perhaps you should be using some of the
> > existing code in Bio/Map? Your thoughts?
> >
> 
> Brian - I doubt the pop gen stuff will overlap at all with this stuff. but
> the marker comment is right, though I can well believe there needs to be
> specific FPC hooks for markers used for FPC stuff....
> 
> 
> 
> 
> > Brian O.
> >
> > -----Original Message-----
> > From: Jamie Hatfield [mailto:jamie@genome.arizona.edu]
> > Sent: Tuesday, August 26, 2003 11:46 AM
> > To: Brian Osborne
> > Cc: BioPerl-List
> > Subject: RE: [Bioperl-l] Re: Bio::FPC
> >
> > Yes, definitly, discussion is great!
> >
> > We had a little bit of a discussion about this back in November 2002,
> > when I proposed the idea, and it was suggested by Heikki to try to fit
> > it into either Bio::Map or Bio::Assembly.  Maybe I picked the wrong
> > one?  How about this...  I will describe a little bit about what fpc is,
> > for those who don't know, and those who know Bio::Map and Bio::Assembly
> > will tell me if it fits in their design.  ok?
> >
> > FPC stands for FingerPrinted Contigs.  Its main purpose is to assemble
> > clones into contiguous regions of overlaps, based on the fingerprint of
> > the clones.  These fingerprints can be from agarose (sp?) gels, or HICF,
> > or simulated, or whatever.  Maybe this is more like Assembly?
> >
> > Anyway, you have the clones, and there are also markers that hit the
> > clones, and aid in assembling the clones into contigs.  These are the
> > main 3 classes.  Clones, Contigs, Markers.  Contigs contain Clones.
> > Markers hit Clones.  Clones are hit by markers.
> >
> > Contigs 1--m Clones
> > Markers m--m Clones
> >
> > Is that a sufficient description of FPC, or do we need more to make a
> > good decision?
> >
> > Thanks for initiating the discussion, Brian.
> >
> > Jamie
> >
> > On Tue, 2003-08-26 at 05:28, Brian Osborne wrote:
> > > Jamie,
> > >
> > > One of the challenges in Bioperl is creating a single coherent set of
> > > modules from the many individual contributions. Could you tell us a bit
> > > about your modules and how they overlap functionally with the existing
> > > modules in Bio::Map? If you take a look at those modules you can see that
> > a
> > > good number of the more steadfast Bioperl authors have contributed to
> > > Bio::Map, I'm sure that they'd like to see your modules integrate neatly
> > > with the existing code.
> > >
> > > I'm not one of these authors, I'm simply responding because it seems that
> > > you'd like to get some discussion going.
> > >
> > > Brian O.
> > >
> > > -----Original Message-----
> > > From: bioperl-l-bounces@portal.open-bio.org
> > > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jamie Hatfield
> > > Sent: Monday, August 25, 2003 6:35 PM
> > > To: BioPerl-List
> > > Subject: Re: [Bioperl-l] Re: Bio::FPC
> > >
> > > Again, how do I go about submitting this?
> > >
> > > On Thu, 2003-08-14 at 09:34, Jamie Hatfield wrote:
> > > > Yes, actually.  We are just now finishing up the fpc parser.  I was
> > > > planning on soon asking the group how I would go about submitting it?
> > > > It consists of 5 modules that we have put in the MapIO and Map
> > > > namespaces.
> > > > Bio::MapIO::fpc.pm
> > > > Bio::Map::physical.pm
> > > > Bio::Map::fpcmarker.pm  (sorry, but marker doesn't work)
> > > > Bio::Map::clone.pm
> > > > Bio::Map::contig.pm
> > > >
> > > > If you want to see how this object might be used, check out
> > > > http://www.genome.arizona.edu/software/fpc/biofpc/index.html
> > > >
> > > > You'll see there documentation for the modules, and a few test cases or
> > > > example usages.
> > > >
> > > > Also, we are trying to make a generic converter to let you load in a fpc
> > > > file and generate the necessary GFF for GBrowse to display the fpc map.
> > > > It's a quite simple display of the clones, markers, and contigs, but
> > > > maybe that will be usefull as an alternative to WebFPC (a java view only
> > > > version of fpc).  It works for us, but might not work for everybody.  We
> > > > should be able to patch it up, though, if it's missing features.
> > > >
> > > > So, anyways, if somebody can let me know how to go about submitting it,
> > > > we'll start the process.  I looked through the FAQ and it basically said
> > > > to just post information if you have a module that you would like to
> > > > contribute, so, here's the information.
> > > >
> > > > Jamie
> > >
> > >
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l@portal.open-bio.org
> > > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > >
> > >
> >
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> 


From birney at ebi.ac.uk  Wed Aug 27 19:07:21 2003
From: birney at ebi.ac.uk (Ewan Birney)
Date: Wed Aug 27 19:06:08 2003
Subject: [Bioperl-l] doing a 1.2.3 release
In-Reply-To: <Pine.LNX.4.50.0308271600090.5651-100000@tenero.duhs.duke.edu>
Message-ID: <Pine.OSX.4.44.0308280006080.1739-100000@ewan-birneys-computer.local>



On Wed, 27 Aug 2003, Jason Stajich wrote:

> In my mind there are enough things that have been fixed since 1.2.2 on the
> branch to justify the effort in releasing another bugfix release on the
> stable branch.  I would like to merge some of the HTML|TextResultWriter
> fixes from the main trunk, otherwise I think could be an easy push out the
> door.
>

I'd agree. I also think we need to start on the 1.3 series. Heikki...
feel free to chime in...?


Jason - I am ok for some bug hunting for a while on either branch or trunk
- any not-so-nasty-that-I-go-mad-but-useful-to-fix-bugs out there?



> -jason
>
> --
> Jason Stajich
> Duke University
> jason at cgt.mc.duke.edu
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

From wes.barris at csiro.au  Wed Aug 27 19:57:04 2003
From: wes.barris at csiro.au (Wes Barris)
Date: Wed Aug 27 19:56:29 2003
Subject: [Bioperl-l] How do you add a consensus to AlignIO?
Message-ID: <3F4D4550.6010902@csiro.au>

Hi,

I am trying to write a bioperl clustalw to msf converter.  I also want
to add a consensus sequence to the alignment.  Here is my code:

#!/usr/local/bin/perl -w
#
use strict;
use Bio::AlignIO;
use Bio::SeqIO;

my $usage = "Usage: $0 <infile.txt> <outfile.msf>\n";
my $infile = shift or die $usage;
my $outfile = shift or die $usage;

my $instream  = new Bio::AlignIO(-format=>'clustalw', -file=>$infile);
my $outstream = new Bio::AlignIO(-format=>'msf',      -file=>">$outfile");
my $aln = $instream->next_aln();
my $consensus = new Bio::Seq(-seq=>$aln->consensus_string(), -id=>'btcn1000');

$aln->id('alignment.msf');      # set the alignment name
$aln->set_displayname_flat();   # remove the /start-end from the names
$aln->add_seq($consensus);      # add the consensus sequence

$outstream->write_aln($aln);

When I run this, I get this error:

wes@bioserver> clustaltomsf.pl j.aln j.msf

------------- EXCEPTION Bio::Seq -------------
MSG: Unable to process non locatable sequences [
STACK Bio::SimpleAlign::add_seq /usr/lib/perl5/site_perl/5.6.1/Bio/SimpleAlign.pm:245
STACK toplevel clustaltomsf.pl:18

----------------------------------------------

Can anyone tell me what I am doing wrong?  What is a non locatable sequence?
How do I make a locatable one?
-- 
Wes Barris
E-Mail: Wes.Barris@csiro.au


From jason at cgt.duhs.duke.edu  Wed Aug 27 21:37:53 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Wed Aug 27 21:15:37 2003
Subject: [Bioperl-l] How do you add a consensus to AlignIO?
In-Reply-To: <3F4D4550.6010902@csiro.au>
References: <3F4D4550.6010902@csiro.au>
Message-ID: <Pine.LNX.4.50.0308272136410.9155-100000@tenero.duhs.duke.edu>

On Thu, 28 Aug 2003, Wes Barris wrote:

> Hi,
>
> I am trying to write a bioperl clustalw to msf converter.  I also want
> to add a consensus sequence to the alignment.  Here is my code:
>
> #!/usr/local/bin/perl -w
> #
> use strict;
> use Bio::AlignIO;
> use Bio::SeqIO;
>
> my $usage = "Usage: $0 <infile.txt> <outfile.msf>\n";
> my $infile = shift or die $usage;
> my $outfile = shift or die $usage;
>
> my $instream  = new Bio::AlignIO(-format=>'clustalw', -file=>$infile);
> my $outstream = new Bio::AlignIO(-format=>'msf',      -file=>">$outfile");
> my $aln = $instream->next_aln();

Try:
 my $consensus = new Bio::LocatableSeq(-seq=>$aln->consensus_string(),
                                        -id=>'btcn1000');
>
> $aln->id('alignment.msf');      # set the alignment name
> $aln->set_displayname_flat();   # remove the /start-end from the names
> $aln->add_seq($consensus);      # add the consensus sequence
>
> $outstream->write_aln($aln);
>
> When I run this, I get this error:
>
> wes@bioserver> clustaltomsf.pl j.aln j.msf
>
> ------------- EXCEPTION Bio::Seq -------------
> MSG: Unable to process non locatable sequences [
> STACK Bio::SimpleAlign::add_seq /usr/lib/perl5/site_perl/5.6.1/Bio/SimpleAlign.pm:245
> STACK toplevel clustaltomsf.pl:18
>
> ----------------------------------------------
>
> Can anyone tell me what I am doing wrong?  What is a non locatable sequence?
> How do I make a locatable one?
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From wes.barris at csiro.au  Wed Aug 27 22:55:45 2003
From: wes.barris at csiro.au (Wes Barris)
Date: Wed Aug 27 22:54:51 2003
Subject: [Bioperl-l] How do you add a consensus to AlignIO?
In-Reply-To: <Pine.LNX.4.50.0308272136410.9155-100000@tenero.duhs.duke.edu>
References: <3F4D4550.6010902@csiro.au>
	<Pine.LNX.4.50.0308272136410.9155-100000@tenero.duhs.duke.edu>
Message-ID: <3F4D6F31.9020905@csiro.au>

Jason Stajich wrote:

> Try:
>  my $consensus = new Bio::LocatableSeq(-seq=>$aln->consensus_string(),
>                                         -id=>'btcn1000');

Thanks.  That did the trick almost (I had to add -start and -end to the
argument list).  However, it is not producing the consensus in the way
that I want.  Here is a portion of the resulting msf file:

AU278862              ---------- ---------C TCTACAGAAT CTGTGTTTAT TTTGTTTCAG
AU278567              ---------- ---------- ---ACAGAAT CTGTGTTTAT TTTGTTTCAG
AU277959              -------AGA TTTTGACATC TCTACAGAAT CTGTGTTTAT TTTGTTTCAG
AU278008              CCTTCTTANA TTTTGACATC TCTACAGAAT CTGNGTTTAT TTTGTTTCAG
AU278623              -------AAA TTTTGACATC TCTACANAA- CTGTGTTTAT TTTGTTTCAN
AU278682              -------AAA TTTTGACATC TCTACANAAT CTGTGTTTAT TTTGTTTCAN
BM031781              ---------- ---------- ---------- ---------- ----------
consensus             -------A-A TTTTGACATC TCTACAGAAT CTGTGTTTAT TTTGTTTCAG

I need the consensus to span the entire alignment length like this:

consensus             CCTTCTTAAA TTTTGACATC TCTACAGAAT CTGTGTTTAT TTTGTTTCAG

i.e. I need it to ignore where the aligned sequences do not exist.  Is there
a way to make it do that?

-- 
Wes Barris
E-Mail: Wes.Barris@csiro.au

From juguang at tll.org.sg  Thu Aug 28 05:55:01 2003
From: juguang at tll.org.sg (Juguang Xiao)
Date: Thu Aug 28 05:53:56 2003
Subject: [Bioperl-l] taxonomy and speices
Message-ID: <B0BCC2B8-D93D-11D7-8C64-000A957702FE@tll.org.sg>

Hi guys,

I tried to write a simple bioperl-db scripts functioning like the 
search on http://www.ncbi.nih.gov/Taxonomy/taxonomyhome.html/ , to 
return a full taxonomy path, and all sub taxonomy nodes. Say, If I 
search 'mouse', it will return the full path as

Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; 
Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus; mouse

And all sub taxonomy nodes will be also returned, like 'asian house 
mouse', 'european house mouse', etc.

However, the Guru Hilmar told me that current bioperl-db works on 
Bio::Species, but not Bio::Taxonomy, and now bioperl-db cannot satisfy 
my above requirement until the code will adapt Taxomony after Taxonomy 
replaces Species. Hence I investigate the species-related modules, 
found some puzzles and would like to volunteer the idea and the code.

Bio::Taxonomy is written by Dan Kortschak, and the main and only 
functional method (rather than get/set, I mean), 'classify', is to 
convert a Species object into an array of names. It wastes such nice 
module name ;-)

Jason wrote Bio::Taxonomy::Node, and Bio::DB::Taxonomy which access 
NCBI Entrez over HTTP OR read the NCBI Tax dump files. 
Bio::Taxonomy::Node is tied to Bio::DB::Taxonomy closely, hence it 
objects to be adapted in bioperl-db system so easily.

My plan to reform them is described below.

DATA STRUCTURE
Taxonomy should be abstracted as a hash with the keys as rank names, 
such as 'class', 'genus', and values as the identifiers, such as NCBI 
taxid, scientific name or Taxonomy::Node object.

$taxonomy = {
	'_rank' => ['root', 'superkingdom', ..., 'species', 'subspecies'..., 
'no rank'], # copied from the current Taxonomy module.
	
	'_hierarchy' => { # Though the keys are unordered in this hash, its 
order is defined in rank.
		...
		'class' => 40674, # or mammlia, or the Taxonomy::Node
		'genus' => 'Mus',
		'species' => $tax_Node_musculus
		....
	},
	'_factory' => $factory, # explained later.
};

NOTE: the new taxonomy can represent more than species level, e.g. it 
is flexible to represent a object at genus level without species.

$taxNode_mammalia = {
	'object_id' => 40674, # NCBI taxid, and the reason why it is called 
'object_id' for the consistence to Bio:;IdentifiableI
	'rank' => 'class',
	'name' => 'Mammalia', # scientific name
	'common_name' => 'mammals', # Genbank common name, as NCBI site uses 
the term.
	'alias' => { # a hash with name_class as key and variant name as value
		'' => ''
	},
	'_factory' => $factory
};


$taxNode_mouse = {
	'object_id' => 10090,
	'rank' => 'species',
	'names' => { # This is a general solution!!
		'specific' => ['musclus'],
		'common' => ['mouse', 'Mickey'],
		'includes' => ['nude mice']
	}
};	

OBJECTS

Bio::Taxonomy will override all methods in Bio::Species, for the sake 
of backwards compatibility. If the tax object represents a level higher 
than species, the sub 'binomial' returns undef, otherwise simple make 
the result by combining the species and genus; the sub 'classification' 
will look like "

foreach(@ranks){
	unshift @classification, $taxonomy{$_} if defined exists $taxonomy{$_}
}


Bio::Taxonomy::Node has NO reference to either the parent node or 
taxonomy object, so that Node objects can be freely shared among 
Taxonomy. Tricky: once a Node object is created, it should be changed 
on its content. If a Taxonomy requires one of its Nodes modified, it 
has to make a new Node, in case that Node was shared by other Taxonomy.

Definitely, we need a Taxonomy factory, like Jason's Bio::DB::Taxonomy 
or what we are going to create in bioperl-db. Both Taxonomy objects and 
Node ones have a reference to this factory, so that Taxonomy can be 
created automatically, and Node can ask who his parent is, 
($node->get_parent_node, e. g. 
$node->_factory->find_parent_node($node)).

Comments, please, and I will transform the idea into the code.


Thanks.

Juguang



------------ATGCCGAGCTTNNNNCT--------------
Juguang Xiao
Bioinformatics Engineer
Temasek Life Sciences Laboratory, National University of Singapore
1 Research Link,  Singapore 117604
fax: (+65) 68727007

juguang at tll.org.sg

From brian_osborne at cognia.com  Thu Aug 28 08:49:12 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Thu Aug 28 08:52:20 2003
Subject: [Bioperl-l] taxonomy and speices
In-Reply-To: <B0BCC2B8-D93D-11D7-8C64-000A957702FE@tll.org.sg>
Message-ID: <GAEDKMGOKFBLJPKCLKCCAEFHDBAA.brian_osborne@cognia.com>

Juguang,

It sounds like you've formulated a solution, but let me describe another
approach, if only to plug BioSQL for those who haven't installed it. With a
BioSQL database installed one can run Aaron's load_taxononomy.pl (found in
the biosql package), this loads the current taxonomy data from NCBI. There
you'll find each taxon labeled by name ("Arabidopsis"), node_rank ("genus"),
and parent_taxon_id. Yes, this approach is a bit more "mechanical" than
yours but a straightforward script will get both the "full path" or the
children from the database. Sidelight: see
http://www.oreillynet.com/pub/a/network/2002/11/27/bioconf.html for Aaron's
nice article on the meaning of the right_value and left_value fields.

If you do write the code you've suggested please send the final script, it
sounds like a good one for our examples/ directory.

Brian O.


-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Juguang Xiao
Sent: Thursday, August 28, 2003 5:55 AM
To: bioperl-l@bioperl.org
Subject: [Bioperl-l] taxonomy and speices

Hi guys,

I tried to write a simple bioperl-db scripts functioning like the
search on http://www.ncbi.nih.gov/Taxonomy/taxonomyhome.html/ , to
return a full taxonomy path, and all sub taxonomy nodes. Say, If I
search 'mouse', it will return the full path as

Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus; mouse

And all sub taxonomy nodes will be also returned, like 'asian house
mouse', 'european house mouse', etc.

However, the Guru Hilmar told me that current bioperl-db works on
Bio::Species, but not Bio::Taxonomy, and now bioperl-db cannot satisfy
my above requirement until the code will adapt Taxomony after Taxonomy
replaces Species. Hence I investigate the species-related modules,
found some puzzles and would like to volunteer the idea and the code.

Bio::Taxonomy is written by Dan Kortschak, and the main and only
functional method (rather than get/set, I mean), 'classify', is to
convert a Species object into an array of names. It wastes such nice
module name ;-)

Jason wrote Bio::Taxonomy::Node, and Bio::DB::Taxonomy which access
NCBI Entrez over HTTP OR read the NCBI Tax dump files.
Bio::Taxonomy::Node is tied to Bio::DB::Taxonomy closely, hence it
objects to be adapted in bioperl-db system so easily.

My plan to reform them is described below.

DATA STRUCTURE
Taxonomy should be abstracted as a hash with the keys as rank names,
such as 'class', 'genus', and values as the identifiers, such as NCBI
taxid, scientific name or Taxonomy::Node object.

$taxonomy = {
        '_rank' => ['root', 'superkingdom', ..., 'species', 'subspecies'...,
'no rank'], # copied from the current Taxonomy module.

        '_hierarchy' => { # Though the keys are unordered in this hash, its
order is defined in rank.
                ...
                'class' => 40674, # or mammlia, or the Taxonomy::Node
                'genus' => 'Mus',
                'species' => $tax_Node_musculus
                ....
        },
        '_factory' => $factory, # explained later.
};

NOTE: the new taxonomy can represent more than species level, e.g. it
is flexible to represent a object at genus level without species.

$taxNode_mammalia = {
        'object_id' => 40674, # NCBI taxid, and the reason why it is called
'object_id' for the consistence to Bio:;IdentifiableI
        'rank' => 'class',
        'name' => 'Mammalia', # scientific name
        'common_name' => 'mammals', # Genbank common name, as NCBI site uses
the term.
        'alias' => { # a hash with name_class as key and variant name as
value
                '' => ''
        },
        '_factory' => $factory
};


$taxNode_mouse = {
        'object_id' => 10090,
        'rank' => 'species',
        'names' => { # This is a general solution!!
                'specific' => ['musclus'],
                'common' => ['mouse', 'Mickey'],
                'includes' => ['nude mice']
        }
};

OBJECTS

Bio::Taxonomy will override all methods in Bio::Species, for the sake
of backwards compatibility. If the tax object represents a level higher
than species, the sub 'binomial' returns undef, otherwise simple make
the result by combining the species and genus; the sub 'classification'
will look like "

foreach(@ranks){
        unshift @classification, $taxonomy{$_} if defined exists
$taxonomy{$_}
}


Bio::Taxonomy::Node has NO reference to either the parent node or
taxonomy object, so that Node objects can be freely shared among
Taxonomy. Tricky: once a Node object is created, it should be changed
on its content. If a Taxonomy requires one of its Nodes modified, it
has to make a new Node, in case that Node was shared by other Taxonomy.

Definitely, we need a Taxonomy factory, like Jason's Bio::DB::Taxonomy
or what we are going to create in bioperl-db. Both Taxonomy objects and
Node ones have a reference to this factory, so that Taxonomy can be
created automatically, and Node can ask who his parent is,
($node->get_parent_node, e. g.
$node->_factory->find_parent_node($node)).

Comments, please, and I will transform the idea into the code.


Thanks.

Juguang



------------ATGCCGAGCTTNNNNCT--------------
Juguang Xiao
Bioinformatics Engineer
Temasek Life Sciences Laboratory, National University of Singapore
1 Research Link,  Singapore 117604
fax: (+65) 68727007

juguang at tll.org.sg

_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From brian_osborne at cognia.com  Thu Aug 28 09:39:27 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Thu Aug 28 09:42:34 2003
Subject: [Bioperl-l] Re: Bio::FPC
In-Reply-To: <1062021826.562.128.camel@motox>
Message-ID: <GAEDKMGOKFBLJPKCLKCCAEFIDBAA.brian_osborne@cognia.com>

Jamie,

Is it fair to say that "hitting a clone" is the same thing as "having a
position in a clone that starts at the beginning of the clone and ends at
the end of a clone"? Or "the FPCMarker's range goes from the beginning to
the end of a clone"?

Brian O.

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jamie Hatfield
Sent: Wednesday, August 27, 2003 6:04 PM
To: Ewan Birney
Cc: Brian Osborne; BioPerl-List
Subject: RE: [Bioperl-l] Re: Bio::FPC

Bio::Map::Marker is really more like our clones.  A clone has a range
that it exists in contig (or map).  But FPCMarkers don't have a position
in a map.  They "hit" a clone.  That is why I felt it was necessary to
create a new class.  I don't see how these two ideas overlap.


On Tue, 2003-08-26 at 10:02, Ewan Birney wrote:
>
>
> On Tue, 26 Aug 2003, Brian Osborne wrote:
>
> > Jamie,
> >
> > And a "marker" can be a genetic marker, yes? A la Bio::Map::Marker? If
you
> > take a look at this module you'll see that its definition of marker
allows
> > any marker to have different positions in different maps (contig "map",
> > genetic map, physical map). This seems to overlap with your notion of
> > marker.
> >
> > Here's my first impression. There's a parser, MapIO::mapmaker for
mapmaker,
> > mapmaker makes maps from segregation data, genetic data. Your fpc makes
> > physical maps, yet physical and genetic maps can be merged to create
> > "integrated maps". Your fpcmarker must be closely related to
> > Bio::Map::Marker, in fact it's not clear that there should be an
fpcmarker.
> > I would think that a Marker object could be a reasonably rich one, and
it
> > could be created by fpc or any other program, it really shouldn't matter
> > much how it's created (in fact, all this new PopGen code must be
ordering
> > markers to make maps, I'd think). Perhaps you should be using some of
the
> > existing code in Bio/Map? Your thoughts?
> >
>
> Brian - I doubt the pop gen stuff will overlap at all with this stuff. but
> the marker comment is right, though I can well believe there needs to be
> specific FPC hooks for markers used for FPC stuff....
>
>
>
>
> > Brian O.
> >
> > -----Original Message-----
> > From: Jamie Hatfield [mailto:jamie@genome.arizona.edu]
> > Sent: Tuesday, August 26, 2003 11:46 AM
> > To: Brian Osborne
> > Cc: BioPerl-List
> > Subject: RE: [Bioperl-l] Re: Bio::FPC
> >
> > Yes, definitly, discussion is great!
> >
> > We had a little bit of a discussion about this back in November 2002,
> > when I proposed the idea, and it was suggested by Heikki to try to fit
> > it into either Bio::Map or Bio::Assembly.  Maybe I picked the wrong
> > one?  How about this...  I will describe a little bit about what fpc is,
> > for those who don't know, and those who know Bio::Map and Bio::Assembly
> > will tell me if it fits in their design.  ok?
> >
> > FPC stands for FingerPrinted Contigs.  Its main purpose is to assemble
> > clones into contiguous regions of overlaps, based on the fingerprint of
> > the clones.  These fingerprints can be from agarose (sp?) gels, or HICF,
> > or simulated, or whatever.  Maybe this is more like Assembly?
> >
> > Anyway, you have the clones, and there are also markers that hit the
> > clones, and aid in assembling the clones into contigs.  These are the
> > main 3 classes.  Clones, Contigs, Markers.  Contigs contain Clones.
> > Markers hit Clones.  Clones are hit by markers.
> >
> > Contigs 1--m Clones
> > Markers m--m Clones
> >
> > Is that a sufficient description of FPC, or do we need more to make a
> > good decision?
> >
> > Thanks for initiating the discussion, Brian.
> >
> > Jamie
> >
> > On Tue, 2003-08-26 at 05:28, Brian Osborne wrote:
> > > Jamie,
> > >
> > > One of the challenges in Bioperl is creating a single coherent set of
> > > modules from the many individual contributions. Could you tell us a
bit
> > > about your modules and how they overlap functionally with the existing
> > > modules in Bio::Map? If you take a look at those modules you can see
that
> > a
> > > good number of the more steadfast Bioperl authors have contributed to
> > > Bio::Map, I'm sure that they'd like to see your modules integrate
neatly
> > > with the existing code.
> > >
> > > I'm not one of these authors, I'm simply responding because it seems
that
> > > you'd like to get some discussion going.
> > >
> > > Brian O.
> > >
> > > -----Original Message-----
> > > From: bioperl-l-bounces@portal.open-bio.org
> > > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jamie
Hatfield
> > > Sent: Monday, August 25, 2003 6:35 PM
> > > To: BioPerl-List
> > > Subject: Re: [Bioperl-l] Re: Bio::FPC
> > >
> > > Again, how do I go about submitting this?
> > >
> > > On Thu, 2003-08-14 at 09:34, Jamie Hatfield wrote:
> > > > Yes, actually.  We are just now finishing up the fpc parser.  I was
> > > > planning on soon asking the group how I would go about submitting
it?
> > > > It consists of 5 modules that we have put in the MapIO and Map
> > > > namespaces.
> > > > Bio::MapIO::fpc.pm
> > > > Bio::Map::physical.pm
> > > > Bio::Map::fpcmarker.pm  (sorry, but marker doesn't work)
> > > > Bio::Map::clone.pm
> > > > Bio::Map::contig.pm
> > > >
> > > > If you want to see how this object might be used, check out
> > > > http://www.genome.arizona.edu/software/fpc/biofpc/index.html
> > > >
> > > > You'll see there documentation for the modules, and a few test cases
or
> > > > example usages.
> > > >
> > > > Also, we are trying to make a generic converter to let you load in a
fpc
> > > > file and generate the necessary GFF for GBrowse to display the fpc
map.
> > > > It's a quite simple display of the clones, markers, and contigs, but
> > > > maybe that will be usefull as an alternative to WebFPC (a java view
only
> > > > version of fpc).  It works for us, but might not work for everybody.
We
> > > > should be able to patch it up, though, if it's missing features.
> > > >
> > > > So, anyways, if somebody can let me know how to go about submitting
it,
> > > > we'll start the process.  I looked through the FAQ and it basically
said
> > > > to just post information if you have a module that you would like to
> > > > contribute, so, here's the information.
> > > >
> > > > Jamie
> > >
> > >
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l@portal.open-bio.org
> > > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > >
> > >
> >
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
>


_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From jamie at genome.arizona.edu  Thu Aug 28 10:23:12 2003
From: jamie at genome.arizona.edu (Jamie Hatfield)
Date: Thu Aug 28 10:23:13 2003
Subject: [Bioperl-l] Re: Bio::FPC
In-Reply-To: <GAEDKMGOKFBLJPKCLKCCAEFIDBAA.brian_osborne@cognia.com>
References: <GAEDKMGOKFBLJPKCLKCCAEFIDBAA.brian_osborne@cognia.com>
Message-ID: <1062080518.562.134.camel@motox>

Yes, that is valid.  So then I assume you're saying that the marker can
just hit the contig instead?  That would be fine if
1) the marker could hit a range
2) the marker could store all the clones it hits.

We need to be able to query the marker and ask it which clones and which
contigs it hits.  I don't think that would be possible with the Marker
Object, would it?

Thanks for keeping up this discussion, by the way.  I'd like to try to
get this finished up and added in correctly.  A few people have asked
how they get ahold of the fpc parser modules, and I've been telling them
to wait until I can get it part of bioperl in a proper manner.

Jamie

On Thu, 2003-08-28 at 06:39, Brian Osborne wrote:
> Jamie,
> 
> Is it fair to say that "hitting a clone" is the same thing as "having a
> position in a clone that starts at the beginning of the clone and ends at
> the end of a clone"? Or "the FPCMarker's range goes from the beginning to
> the end of a clone"?
> 
> Brian O.
> 
> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org
> [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jamie Hatfield
> Sent: Wednesday, August 27, 2003 6:04 PM
> To: Ewan Birney
> Cc: Brian Osborne; BioPerl-List
> Subject: RE: [Bioperl-l] Re: Bio::FPC
> 
> Bio::Map::Marker is really more like our clones.  A clone has a range
> that it exists in contig (or map).  But FPCMarkers don't have a position
> in a map.  They "hit" a clone.  That is why I felt it was necessary to
> create a new class.  I don't see how these two ideas overlap.
> 
> 
> On Tue, 2003-08-26 at 10:02, Ewan Birney wrote:
> >
> >
> > On Tue, 26 Aug 2003, Brian Osborne wrote:
> >
> > > Jamie,
> > >
> > > And a "marker" can be a genetic marker, yes? A la Bio::Map::Marker? If
> you
> > > take a look at this module you'll see that its definition of marker
> allows
> > > any marker to have different positions in different maps (contig "map",
> > > genetic map, physical map). This seems to overlap with your notion of
> > > marker.
> > >
> > > Here's my first impression. There's a parser, MapIO::mapmaker for
> mapmaker,
> > > mapmaker makes maps from segregation data, genetic data. Your fpc makes
> > > physical maps, yet physical and genetic maps can be merged to create
> > > "integrated maps". Your fpcmarker must be closely related to
> > > Bio::Map::Marker, in fact it's not clear that there should be an
> fpcmarker.
> > > I would think that a Marker object could be a reasonably rich one, and
> it
> > > could be created by fpc or any other program, it really shouldn't matter
> > > much how it's created (in fact, all this new PopGen code must be
> ordering
> > > markers to make maps, I'd think). Perhaps you should be using some of
> the
> > > existing code in Bio/Map? Your thoughts?
> > >
> >
> > Brian - I doubt the pop gen stuff will overlap at all with this stuff. but
> > the marker comment is right, though I can well believe there needs to be
> > specific FPC hooks for markers used for FPC stuff....
> >
> >
> >
> >
> > > Brian O.
> > >
> > > -----Original Message-----
> > > From: Jamie Hatfield [mailto:jamie@genome.arizona.edu]
> > > Sent: Tuesday, August 26, 2003 11:46 AM
> > > To: Brian Osborne
> > > Cc: BioPerl-List
> > > Subject: RE: [Bioperl-l] Re: Bio::FPC
> > >
> > > Yes, definitly, discussion is great!
> > >
> > > We had a little bit of a discussion about this back in November 2002,
> > > when I proposed the idea, and it was suggested by Heikki to try to fit
> > > it into either Bio::Map or Bio::Assembly.  Maybe I picked the wrong
> > > one?  How about this...  I will describe a little bit about what fpc is,
> > > for those who don't know, and those who know Bio::Map and Bio::Assembly
> > > will tell me if it fits in their design.  ok?
> > >
> > > FPC stands for FingerPrinted Contigs.  Its main purpose is to assemble
> > > clones into contiguous regions of overlaps, based on the fingerprint of
> > > the clones.  These fingerprints can be from agarose (sp?) gels, or HICF,
> > > or simulated, or whatever.  Maybe this is more like Assembly?
> > >
> > > Anyway, you have the clones, and there are also markers that hit the
> > > clones, and aid in assembling the clones into contigs.  These are the
> > > main 3 classes.  Clones, Contigs, Markers.  Contigs contain Clones.
> > > Markers hit Clones.  Clones are hit by markers.
> > >
> > > Contigs 1--m Clones
> > > Markers m--m Clones
> > >
> > > Is that a sufficient description of FPC, or do we need more to make a
> > > good decision?
> > >
> > > Thanks for initiating the discussion, Brian.
> > >
> > > Jamie
> > >
> > > On Tue, 2003-08-26 at 05:28, Brian Osborne wrote:
> > > > Jamie,
> > > >
> > > > One of the challenges in Bioperl is creating a single coherent set of
> > > > modules from the many individual contributions. Could you tell us a
> bit
> > > > about your modules and how they overlap functionally with the existing
> > > > modules in Bio::Map? If you take a look at those modules you can see
> that
> > > a
> > > > good number of the more steadfast Bioperl authors have contributed to
> > > > Bio::Map, I'm sure that they'd like to see your modules integrate
> neatly
> > > > with the existing code.
> > > >
> > > > I'm not one of these authors, I'm simply responding because it seems
> that
> > > > you'd like to get some discussion going.
> > > >
> > > > Brian O.
> > > >
> > > > -----Original Message-----
> > > > From: bioperl-l-bounces@portal.open-bio.org
> > > > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jamie
> Hatfield
> > > > Sent: Monday, August 25, 2003 6:35 PM
> > > > To: BioPerl-List
> > > > Subject: Re: [Bioperl-l] Re: Bio::FPC
> > > >
> > > > Again, how do I go about submitting this?
> > > >
> > > > On Thu, 2003-08-14 at 09:34, Jamie Hatfield wrote:
> > > > > Yes, actually.  We are just now finishing up the fpc parser.  I was
> > > > > planning on soon asking the group how I would go about submitting
> it?
> > > > > It consists of 5 modules that we have put in the MapIO and Map
> > > > > namespaces.
> > > > > Bio::MapIO::fpc.pm
> > > > > Bio::Map::physical.pm
> > > > > Bio::Map::fpcmarker.pm  (sorry, but marker doesn't work)
> > > > > Bio::Map::clone.pm
> > > > > Bio::Map::contig.pm
> > > > >
> > > > > If you want to see how this object might be used, check out
> > > > > http://www.genome.arizona.edu/software/fpc/biofpc/index.html
> > > > >
> > > > > You'll see there documentation for the modules, and a few test cases
> or
> > > > > example usages.
> > > > >
> > > > > Also, we are trying to make a generic converter to let you load in a
> fpc
> > > > > file and generate the necessary GFF for GBrowse to display the fpc
> map.
> > > > > It's a quite simple display of the clones, markers, and contigs, but
> > > > > maybe that will be usefull as an alternative to WebFPC (a java view
> only
> > > > > version of fpc).  It works for us, but might not work for everybody.
> We
> > > > > should be able to patch it up, though, if it's missing features.
> > > > >
> > > > > So, anyways, if somebody can let me know how to go about submitting
> it,
> > > > > we'll start the process.  I looked through the FAQ and it basically
> said
> > > > > to just post information if you have a module that you would like to
> > > > > contribute, so, here's the information.
> > > > >
> > > > > Jamie
> > > >
> > > >
> > > > _______________________________________________
> > > > Bioperl-l mailing list
> > > > Bioperl-l@portal.open-bio.org
> > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > > >
> > > >
> > >
> > >
> > >
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l@portal.open-bio.org
> > > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > >
> >
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 
> 


From brian_osborne at cognia.com  Thu Aug 28 11:31:21 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Thu Aug 28 11:34:34 2003
Subject: [Bioperl-l] Re: Bio::FPC
In-Reply-To: <1062080518.562.134.camel@motox>
Message-ID: <GAEDKMGOKFBLJPKCLKCCAEFODBAA.brian_osborne@cognia.com>

Jamie,

>From the looks of it seems that a Marker can have one or more Positions and
a Positions can have a range and a Map. But you asked about iterating over a
Marker's Positions to find the "clones" (and both "clones" and "contigs" are
smaller and larger Maps respectively, yes?). I'm seeing the ability to
get/set but not anything like "next_position", but this is after a minute's
inspection. I'd suggest you take a better and closer look at Mappable,
Postion, and Map to get the real answer. If there's really nothing
resembling this I'm certain you could create it, I think it's to your
advantage to use, and possibly enrich, Bioperl's existing objects so that in
the future you'll have access to all that's inside. But you knew that
already...

By the way, say "Hi!" to Rod Wing for me, he's a friend of mine from way
back.

Brian O.

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jamie Hatfield
Sent: Thursday, August 28, 2003 10:22 AM
To: Brian Osborne
Cc: Ewan Birney; BioPerl-List
Subject: RE: [Bioperl-l] Re: Bio::FPC

Yes, that is valid.  So then I assume you're saying that the marker can
just hit the contig instead?  That would be fine if
1) the marker could hit a range
2) the marker could store all the clones it hits.

We need to be able to query the marker and ask it which clones and which
contigs it hits.  I don't think that would be possible with the Marker
Object, would it?

Thanks for keeping up this discussion, by the way.  I'd like to try to
get this finished up and added in correctly.  A few people have asked
how they get ahold of the fpc parser modules, and I've been telling them
to wait until I can get it part of bioperl in a proper manner.

Jamie

On Thu, 2003-08-28 at 06:39, Brian Osborne wrote:
> Jamie,
>
> Is it fair to say that "hitting a clone" is the same thing as "having a
> position in a clone that starts at the beginning of the clone and ends at
> the end of a clone"? Or "the FPCMarker's range goes from the beginning to
> the end of a clone"?
>
> Brian O.
>
> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org
> [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jamie Hatfield
> Sent: Wednesday, August 27, 2003 6:04 PM
> To: Ewan Birney
> Cc: Brian Osborne; BioPerl-List
> Subject: RE: [Bioperl-l] Re: Bio::FPC
>
> Bio::Map::Marker is really more like our clones.  A clone has a range
> that it exists in contig (or map).  But FPCMarkers don't have a position
> in a map.  They "hit" a clone.  That is why I felt it was necessary to
> create a new class.  I don't see how these two ideas overlap.
>
>
> On Tue, 2003-08-26 at 10:02, Ewan Birney wrote:
> >
> >
> > On Tue, 26 Aug 2003, Brian Osborne wrote:
> >
> > > Jamie,
> > >
> > > And a "marker" can be a genetic marker, yes? A la Bio::Map::Marker? If
> you
> > > take a look at this module you'll see that its definition of marker
> allows
> > > any marker to have different positions in different maps (contig
"map",
> > > genetic map, physical map). This seems to overlap with your notion of
> > > marker.
> > >
> > > Here's my first impression. There's a parser, MapIO::mapmaker for
> mapmaker,
> > > mapmaker makes maps from segregation data, genetic data. Your fpc
makes
> > > physical maps, yet physical and genetic maps can be merged to create
> > > "integrated maps". Your fpcmarker must be closely related to
> > > Bio::Map::Marker, in fact it's not clear that there should be an
> fpcmarker.
> > > I would think that a Marker object could be a reasonably rich one, and
> it
> > > could be created by fpc or any other program, it really shouldn't
matter
> > > much how it's created (in fact, all this new PopGen code must be
> ordering
> > > markers to make maps, I'd think). Perhaps you should be using some of
> the
> > > existing code in Bio/Map? Your thoughts?
> > >
> >
> > Brian - I doubt the pop gen stuff will overlap at all with this stuff.
but
> > the marker comment is right, though I can well believe there needs to be
> > specific FPC hooks for markers used for FPC stuff....
> >
> >
> >
> >
> > > Brian O.
> > >
> > > -----Original Message-----
> > > From: Jamie Hatfield [mailto:jamie@genome.arizona.edu]
> > > Sent: Tuesday, August 26, 2003 11:46 AM
> > > To: Brian Osborne
> > > Cc: BioPerl-List
> > > Subject: RE: [Bioperl-l] Re: Bio::FPC
> > >
> > > Yes, definitly, discussion is great!
> > >
> > > We had a little bit of a discussion about this back in November 2002,
> > > when I proposed the idea, and it was suggested by Heikki to try to fit
> > > it into either Bio::Map or Bio::Assembly.  Maybe I picked the wrong
> > > one?  How about this...  I will describe a little bit about what fpc
is,
> > > for those who don't know, and those who know Bio::Map and
Bio::Assembly
> > > will tell me if it fits in their design.  ok?
> > >
> > > FPC stands for FingerPrinted Contigs.  Its main purpose is to assemble
> > > clones into contiguous regions of overlaps, based on the fingerprint
of
> > > the clones.  These fingerprints can be from agarose (sp?) gels, or
HICF,
> > > or simulated, or whatever.  Maybe this is more like Assembly?
> > >
> > > Anyway, you have the clones, and there are also markers that hit the
> > > clones, and aid in assembling the clones into contigs.  These are the
> > > main 3 classes.  Clones, Contigs, Markers.  Contigs contain Clones.
> > > Markers hit Clones.  Clones are hit by markers.
> > >
> > > Contigs 1--m Clones
> > > Markers m--m Clones
> > >
> > > Is that a sufficient description of FPC, or do we need more to make a
> > > good decision?
> > >
> > > Thanks for initiating the discussion, Brian.
> > >
> > > Jamie
> > >
> > > On Tue, 2003-08-26 at 05:28, Brian Osborne wrote:
> > > > Jamie,
> > > >
> > > > One of the challenges in Bioperl is creating a single coherent set
of
> > > > modules from the many individual contributions. Could you tell us a
> bit
> > > > about your modules and how they overlap functionally with the
existing
> > > > modules in Bio::Map? If you take a look at those modules you can see
> that
> > > a
> > > > good number of the more steadfast Bioperl authors have contributed
to
> > > > Bio::Map, I'm sure that they'd like to see your modules integrate
> neatly
> > > > with the existing code.
> > > >
> > > > I'm not one of these authors, I'm simply responding because it seems
> that
> > > > you'd like to get some discussion going.
> > > >
> > > > Brian O.
> > > >
> > > > -----Original Message-----
> > > > From: bioperl-l-bounces@portal.open-bio.org
> > > > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jamie
> Hatfield
> > > > Sent: Monday, August 25, 2003 6:35 PM
> > > > To: BioPerl-List
> > > > Subject: Re: [Bioperl-l] Re: Bio::FPC
> > > >
> > > > Again, how do I go about submitting this?
> > > >
> > > > On Thu, 2003-08-14 at 09:34, Jamie Hatfield wrote:
> > > > > Yes, actually.  We are just now finishing up the fpc parser.  I
was
> > > > > planning on soon asking the group how I would go about submitting
> it?
> > > > > It consists of 5 modules that we have put in the MapIO and Map
> > > > > namespaces.
> > > > > Bio::MapIO::fpc.pm
> > > > > Bio::Map::physical.pm
> > > > > Bio::Map::fpcmarker.pm  (sorry, but marker doesn't work)
> > > > > Bio::Map::clone.pm
> > > > > Bio::Map::contig.pm
> > > > >
> > > > > If you want to see how this object might be used, check out
> > > > > http://www.genome.arizona.edu/software/fpc/biofpc/index.html
> > > > >
> > > > > You'll see there documentation for the modules, and a few test
cases
> or
> > > > > example usages.
> > > > >
> > > > > Also, we are trying to make a generic converter to let you load in
a
> fpc
> > > > > file and generate the necessary GFF for GBrowse to display the fpc
> map.
> > > > > It's a quite simple display of the clones, markers, and contigs,
but
> > > > > maybe that will be usefull as an alternative to WebFPC (a java
view
> only
> > > > > version of fpc).  It works for us, but might not work for
everybody.
> We
> > > > > should be able to patch it up, though, if it's missing features.
> > > > >
> > > > > So, anyways, if somebody can let me know how to go about
submitting
> it,
> > > > > we'll start the process.  I looked through the FAQ and it
basically
> said
> > > > > to just post information if you have a module that you would like
to
> > > > > contribute, so, here's the information.
> > > > >
> > > > > Jamie
> > > >
> > > >
> > > > _______________________________________________
> > > > Bioperl-l mailing list
> > > > Bioperl-l@portal.open-bio.org
> > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > > >
> > > >
> > >
> > >
> > >
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l@portal.open-bio.org
> > > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > >
> >
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>


_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From jason at cgt.duhs.duke.edu  Thu Aug 28 12:34:38 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Thu Aug 28 12:12:03 2003
Subject: [Bioperl-l] doing a 1.2.3 release
In-Reply-To: <Pine.OSX.4.44.0308280006080.1739-100000@ewan-birneys-computer.local>
References: <Pine.OSX.4.44.0308280006080.1739-100000@ewan-birneys-computer.local>
Message-ID: <Pine.LNX.4.50.0308281224540.13234-100000@tenero.duhs.duke.edu>


> I'd agree. I also think we need to start on the 1.3 series. Heikki...
> feel free to chime in...?
>
>
> Jason - I am ok for some bug hunting for a while on either branch or trunk
> - any not-so-nasty-that-I-go-mad-but-useful-to-fix-bugs out there?

Fix translate() to check for completeness on 5' and 3' end
  http://bugzilla.open-bio.org/show_bug.cgi?id=1476
PDB residue recognition code
  http://bugzilla.open-bio.org/show_bug.cgi?id=1485
Look at Keith's old bug, I don't know if it is still broken
 http://bugzilla.open-bio.org/show_bug.cgi?id=992

For fun bugs to fix on the main trunk
NCBI Contig entries - do we really handle them correctly now?
  http://bugzilla.open-bio.org/show_bug.cgi?id=1319

Depending on how Juguang's Bio::Species/ Bio::Taxomomy::Node connection
evolves I think this bug will get fixed in the process.
 http://bugzilla.open-bio.org/show_bug.cgi?id=1244



From jason at cgt.duhs.duke.edu  Thu Aug 28 12:45:10 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Thu Aug 28 12:23:23 2003
Subject: [Bioperl-l] taxonomy and speices
In-Reply-To: <B0BCC2B8-D93D-11D7-8C64-000A957702FE@tll.org.sg>
References: <B0BCC2B8-D93D-11D7-8C64-000A957702FE@tll.org.sg>
Message-ID: <Pine.LNX.4.50.0308281234410.13234-100000@tenero.duhs.duke.edu>

Glad you are taking this on.  I think you can think about just dropping
Bio::Taxonomy::Tree and Bio::Taxonomy::Taxon if they don't provide
anything useful any more.  Dan has moved on AFAIK and I couldn't make them
work in a way that I think was useful, so I wrote Bio::Taxonomy::Node to
be an entity in the entire taxonomy with ability to move up or down
classification levels.

Here is how I envisioned this working.
 Bio::Species (or its successor) will be the collection of all the
information above a node in the Taxonomy hierarchy.  So as you have
described we can talk about sub species, etc.  This is what I think Dan
had in mind with Bio::Taxonomy::Taxon, meaning the tip nodes in the
Hierarchy.

I think it is fine to fix/replace any code in Bio::Taxonomy as I don't
think it has been used anywhere yet.

If you can think about how to keep using the Factory object for access to
the taxonomy so that underneath the factory can be locally indexed taxdmp
from NCBI as I have implemented, the limited HTTP access that NCBI
provides to this data, or a BioSQL system.    I would try and use the
taxon tables that Aaron setup in BioSQL - it was our intention all along
to provide this Factory with access to biosql, we just have not had time
to get it working.

Once this is integrated in, we can start to rely on using taxonid numbers
for lookups and query constraints more easily which I think will be a
big plus.

-jason

On Thu, 28 Aug 2003, Juguang Xiao wrote:

> Hi guys,
>
> I tried to write a simple bioperl-db scripts functioning like the
> search on http://www.ncbi.nih.gov/Taxonomy/taxonomyhome.html/ , to
> return a full taxonomy path, and all sub taxonomy nodes. Say, If I
> search 'mouse', it will return the full path as
>
> Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
> Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus; mouse
>
> And all sub taxonomy nodes will be also returned, like 'asian house
> mouse', 'european house mouse', etc.
>
> However, the Guru Hilmar told me that current bioperl-db works on
> Bio::Species, but not Bio::Taxonomy, and now bioperl-db cannot satisfy
> my above requirement until the code will adapt Taxomony after Taxonomy
> replaces Species. Hence I investigate the species-related modules,
> found some puzzles and would like to volunteer the idea and the code.
>
> Bio::Taxonomy is written by Dan Kortschak, and the main and only
> functional method (rather than get/set, I mean), 'classify', is to
> convert a Species object into an array of names. It wastes such nice
> module name ;-)
>
> Jason wrote Bio::Taxonomy::Node, and Bio::DB::Taxonomy which access
> NCBI Entrez over HTTP OR read the NCBI Tax dump files.
> Bio::Taxonomy::Node is tied to Bio::DB::Taxonomy closely, hence it
> objects to be adapted in bioperl-db system so easily.
>
> My plan to reform them is described below.
>
> DATA STRUCTURE
> Taxonomy should be abstracted as a hash with the keys as rank names,
> such as 'class', 'genus', and values as the identifiers, such as NCBI
> taxid, scientific name or Taxonomy::Node object.
>
> $taxonomy = {
> 	'_rank' => ['root', 'superkingdom', ..., 'species', 'subspecies'...,
> 'no rank'], # copied from the current Taxonomy module.
>
> 	'_hierarchy' => { # Though the keys are unordered in this hash, its
> order is defined in rank.
> 		...
> 		'class' => 40674, # or mammlia, or the Taxonomy::Node
> 		'genus' => 'Mus',
> 		'species' => $tax_Node_musculus
> 		....
> 	},
> 	'_factory' => $factory, # explained later.
> };
>
> NOTE: the new taxonomy can represent more than species level, e.g. it
> is flexible to represent a object at genus level without species.
>
> $taxNode_mammalia = {
> 	'object_id' => 40674, # NCBI taxid, and the reason why it is called
> 'object_id' for the consistence to Bio:;IdentifiableI
> 	'rank' => 'class',
> 	'name' => 'Mammalia', # scientific name
> 	'common_name' => 'mammals', # Genbank common name, as NCBI site uses
> the term.
> 	'alias' => { # a hash with name_class as key and variant name as value
> 		'' => ''
> 	},
> 	'_factory' => $factory
> };
>
>
> $taxNode_mouse = {
> 	'object_id' => 10090,
> 	'rank' => 'species',
> 	'names' => { # This is a general solution!!
> 		'specific' => ['musclus'],
> 		'common' => ['mouse', 'Mickey'],
> 		'includes' => ['nude mice']
> 	}
> };
>
> OBJECTS
>
> Bio::Taxonomy will override all methods in Bio::Species, for the sake
> of backwards compatibility. If the tax object represents a level higher
> than species, the sub 'binomial' returns undef, otherwise simple make
> the result by combining the species and genus; the sub 'classification'
> will look like "
>
> foreach(@ranks){
> 	unshift @classification, $taxonomy{$_} if defined exists $taxonomy{$_}
> }
>
>
> Bio::Taxonomy::Node has NO reference to either the parent node or
> taxonomy object, so that Node objects can be freely shared among
> Taxonomy. Tricky: once a Node object is created, it should be changed
> on its content. If a Taxonomy requires one of its Nodes modified, it
> has to make a new Node, in case that Node was shared by other Taxonomy.
>
> Definitely, we need a Taxonomy factory, like Jason's Bio::DB::Taxonomy
> or what we are going to create in bioperl-db. Both Taxonomy objects and
> Node ones have a reference to this factory, so that Taxonomy can be
> created automatically, and Node can ask who his parent is,
> ($node->get_parent_node, e. g.
> $node->_factory->find_parent_node($node)).
>
> Comments, please, and I will transform the idea into the code.
>
>
> Thanks.
>
> Juguang
>
>
>
> ------------ATGCCGAGCTTNNNNCT--------------
> Juguang Xiao
> Bioinformatics Engineer
> Temasek Life Sciences Laboratory, National University of Singapore
> 1 Research Link,  Singapore 117604
> fax: (+65) 68727007
>
> juguang at tll.org.sg
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From birney at ebi.ac.uk  Thu Aug 28 12:47:54 2003
From: birney at ebi.ac.uk (Ewan Birney)
Date: Thu Aug 28 12:46:36 2003
Subject: [Bioperl-l] doing a 1.2.3 release
In-Reply-To: <Pine.LNX.4.50.0308281224540.13234-100000@tenero.duhs.duke.edu>
Message-ID: <Pine.OSX.4.44.0308281726220.897-100000@ewan-birneys-computer.local>



On Thu, 28 Aug 2003, Jason Stajich wrote:

>
> > I'd agree. I also think we need to start on the 1.3 series. Heikki...
> > feel free to chime in...?
> >
> >
> > Jason - I am ok for some bug hunting for a while on either branch or trunk
> > - any not-so-nasty-that-I-go-mad-but-useful-to-fix-bugs out there?
>
> Fix translate() to check for completeness on 5' and 3' end
>   http://bugzilla.open-bio.org/show_bug.cgi?id=1476

Ok, I'm doing this one; I will probably just use Matt's proposed fix after
a review.

> PDB residue recognition code
>   http://bugzilla.open-bio.org/show_bug.cgi?id=1485

Ditto

> Look at Keith's old bug, I don't know if it is still broken
>  http://bugzilla.open-bio.org/show_bug.cgi?id=992
>

Aaaaaaaaaagh. The fuzzies. I will give it a go.




I have just cvs update'd on the branch and splicedseq.t is also failing
on my box at the moment. I'll fix.







From redwards at utmem.edu  Thu Aug 28 13:01:10 2003
From: redwards at utmem.edu (Rob Edwards)
Date: Thu Aug 28 13:00:13 2003
Subject: [Bioperl-l] doing a 1.2.3 release
In-Reply-To: <Pine.LNX.4.50.0308281224540.13234-100000@tenero.duhs.duke.edu>
Message-ID: <39528B78-D979-11D7-96EB-000A959E1622@utmem.edu>

I would also add:

Enhancement to Bio::DB::GenBank to allow subsequence retrieval
http://bugzilla.open-bio.org/show_bug.cgi?id=1405

To this list. Two versions of patches are in bugzilla, so it should (?) 
be easy.

Rob


On Thursday, August 28, 2003, at 11:34  AM, Jason Stajich wrote:

>
>> I'd agree. I also think we need to start on the 1.3 series. Heikki...
>> feel free to chime in...?
>>
>>
>> Jason - I am ok for some bug hunting for a while on either branch or 
>> trunk
>> - any not-so-nasty-that-I-go-mad-but-useful-to-fix-bugs out there?
>
> Fix translate() to check for completeness on 5' and 3' end
>   http://bugzilla.open-bio.org/show_bug.cgi?id=1476
> PDB residue recognition code
>   http://bugzilla.open-bio.org/show_bug.cgi?id=1485
> Look at Keith's old bug, I don't know if it is still broken
>  http://bugzilla.open-bio.org/show_bug.cgi?id=992
>
> For fun bugs to fix on the main trunk
> NCBI Contig entries - do we really handle them correctly now?
>   http://bugzilla.open-bio.org/show_bug.cgi?id=1319
>
> Depending on how Juguang's Bio::Species/ Bio::Taxomomy::Node connection
> evolves I think this bug will get fixed in the process.
>  http://bugzilla.open-bio.org/show_bug.cgi?id=1244
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

From birney at ebi.ac.uk  Thu Aug 28 13:06:54 2003
From: birney at ebi.ac.uk (Ewan Birney)
Date: Thu Aug 28 13:05:36 2003
Subject: [Bioperl-l] doing a 1.2.3 release
In-Reply-To: <Pine.OSX.4.44.0308281726220.897-100000@ewan-birneys-computer.local>
Message-ID: <Pine.OSX.4.44.0308281800280.897-100000@ewan-birneys-computer.local>


Jason or other Perl Gods...


There is something very, very kooky going on with the new DESTROY method
in Bio::SeqIO. What is happening is that on the line:


    if( $db ) {
        if( ref($db) &&  !$db->isa('Bio::DB::RandomAccessI') ) {
            $self->warn("Must pass in a valid Bio::DB::RandomAccessI
object for access to remote l\
ocations for spliced_seq");
            $db = undef;
        }
    }


if( $db)

in SeqFeatureI (I broke up the if statement to isolate it), perl is
somehow calling the garbage collector, and for reasons beyond me ends up
saying:


Bio::SeqFeatureI::spliced_seq(Bio/SeqFeatureI.pm:459):
459:        my ($mixed,$mixedloc,$fstrand) = (0);
  DB<3> n
Bio::SeqFeatureI::spliced_seq(Bio/SeqFeatureI.pm:461):
461:        if( $db ) {
  DB<3> s
Can't call method "isa" on an undefined value at Bio/SeqFeatureI.pm line
461.
Bio::SeqIO::DESTROY(Bio/SeqIO.pm:627):
627:        my $self = shift;



Notice that the debugger has just now entered the Bio::SeqIO::DESTROY
method. Commenting out though just moves this towards Bio/Root/RootI
DESTROY...


Really confused. Perl is at:

Ewan-Birneys-Computer:~/src/bioperl-branch-1-2] birney% perl -version

This is perl, v5.6.0 built for darwin

Copyright 1987-2000, Larry Wall

Perl may be copied only under the terms of either the Artistic License or
the
GNU General Public License, which may be found in the Perl 5.0 source kit.

Complete documentation for Perl, including FAQ lists, should be found on
this system using `man perl' or `perldoc perl'.  If you have access to the
Internet, point your browser at http://www.perl.com/, the Perl Home Page.



Is there a "gotcha" here? This is v. annoying....








From jason at cgt.duhs.duke.edu  Thu Aug 28 13:39:01 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Thu Aug 28 13:16:27 2003
Subject: [Bioperl-l] doing a 1.2.3 release
In-Reply-To: <Pine.OSX.4.44.0308281800280.897-100000@ewan-birneys-computer.local>
References: <Pine.OSX.4.44.0308281800280.897-100000@ewan-birneys-computer.local>
Message-ID: <Pine.LNX.4.50.0308281337440.13234-100000@tenero.duhs.duke.edu>

Yeah I don't know what is going on - t/SeqFeature.t worked fine for me
before.

If I change it to add an extra (defined $db) in the elsif statement it
works, perhaps the die is coming from the new Bio::DB::InMemoryCache as my
elsif wasn't strict enough?



 if( defined $db && ref($db) &&
	! $db->isa('Bio::DB::RandomAccessI') ) {
	$self->warn("Must pass in a valid Bio::DB::RandomAccessI object
for access to remote locations for spliced_seq");
	$db = undef;
    } elsif( defined $db && $HasInMemory &&
	     ! $db->isa('Bio::DB::InMemoryCache') ) {
	$db = new Bio::DB::InMemoryCache(-seqdb => $db);
    }
On Thu, 28 Aug 2003, Ewan Birney wrote:

>
> Jason or other Perl Gods...
>
>
> There is something very, very kooky going on with the new DESTROY method
> in Bio::SeqIO. What is happening is that on the line:
>
>
>     if( $db ) {
>         if( ref($db) &&  !$db->isa('Bio::DB::RandomAccessI') ) {
>             $self->warn("Must pass in a valid Bio::DB::RandomAccessI
> object for access to remote l\
> ocations for spliced_seq");
>             $db = undef;
>         }
>     }
>
>
> if( $db)
>
> in SeqFeatureI (I broke up the if statement to isolate it), perl is
> somehow calling the garbage collector, and for reasons beyond me ends up
> saying:
>
>
> Bio::SeqFeatureI::spliced_seq(Bio/SeqFeatureI.pm:459):
> 459:        my ($mixed,$mixedloc,$fstrand) = (0);
>   DB<3> n
> Bio::SeqFeatureI::spliced_seq(Bio/SeqFeatureI.pm:461):
> 461:        if( $db ) {
>   DB<3> s
> Can't call method "isa" on an undefined value at Bio/SeqFeatureI.pm line
> 461.
> Bio::SeqIO::DESTROY(Bio/SeqIO.pm:627):
> 627:        my $self = shift;
>
>
>
> Notice that the debugger has just now entered the Bio::SeqIO::DESTROY
> method. Commenting out though just moves this towards Bio/Root/RootI
> DESTROY...
>
>
> Really confused. Perl is at:
>
> Ewan-Birneys-Computer:~/src/bioperl-branch-1-2] birney% perl -version
>
> This is perl, v5.6.0 built for darwin
>
> Copyright 1987-2000, Larry Wall
>
> Perl may be copied only under the terms of either the Artistic License or
> the
> GNU General Public License, which may be found in the Perl 5.0 source kit.
>
> Complete documentation for Perl, including FAQ lists, should be found on
> this system using `man perl' or `perldoc perl'.  If you have access to the
> Internet, point your browser at http://www.perl.com/, the Perl Home Page.
>
>
>
> Is there a "gotcha" here? This is v. annoying....
>
>
>
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From chauser at duke.edu  Thu Aug 28 15:18:26 2003
From: chauser at duke.edu (Charles Hauser)
Date: Thu Aug 28 15:18:28 2003
Subject: [Bioperl-l] bp_extract_feature_seq.pl : --feature CDS error
Message-ID: <1062098372.31518.73.camel@pandorina.biology.duke.edu>

I updated my bioperl to cvs today and now am unable to extract CDS
features from a genbank report using the script Using
bp_extract_feature_seq.pl.


using:

 -i foo.gbk --format genbank --feature gene

script returns concatenated fasta data, but ends with:
Can't call method "isa" on an undefined value at
/usr/local/src/bioperl/core/Bio/SeqFeatureI.pm line 457, <GEN0> line
1781.

line 1781 is the '//'line at the end of the gbk report.


Attempting to extract CDS feature seqs  --feature CDS returns no data
just the error listed above.

Charles


From jason at cgt.duhs.duke.edu  Thu Aug 28 15:53:05 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Thu Aug 28 15:30:29 2003
Subject: [Bioperl-l] bp_extract_feature_seq.pl : --feature CDS error
In-Reply-To: <1062098372.31518.73.camel@pandorina.biology.duke.edu>
References: <1062098372.31518.73.camel@pandorina.biology.duke.edu>
Message-ID: <Pine.LNX.4.50.0308281548160.13234-100000@tenero.duhs.duke.edu>

We just fixed this - see Ewan's last message.

I think I've committed a cleaner fix to the last one. I think the problem
may have been in InMemoryCache instantiation instead.

-jason

On Thu, 28 Aug 2003, Charles Hauser wrote:

> I updated my bioperl to cvs today and now am unable to extract CDS
> features from a genbank report using the script Using
> bp_extract_feature_seq.pl.
>
>
> using:
>
>  -i foo.gbk --format genbank --feature gene
>
> script returns concatenated fasta data, but ends with:
> Can't call method "isa" on an undefined value at
> /usr/local/src/bioperl/core/Bio/SeqFeatureI.pm line 457, <GEN0> line
> 1781.
>
> line 1781 is the '//'line at the end of the gbk report.
>
>
> Attempting to extract CDS feature seqs  --feature CDS returns no data
> just the error listed above.
>
> Charles
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From ymc at paxil.stanford.edu  Thu Aug 28 17:42:39 2003
From: ymc at paxil.stanford.edu (Yee Man Chan)
Date: Thu Aug 28 17:41:44 2003
Subject: [Bioperl-l] Re: Smith-Waterman question
In-Reply-To: <3F4E7161.9010102@foobox.com>
Message-ID: <Pine.GSO.3.96.1030828144114.7235K-100000@halogen.stanford.edu>

t1, t2 are both DNA sequences. Their alignment has nothing to do with
BLOSUM62... To verify your score, I suggest you run ssearch34 from FASTA
package.

Yee Man

On Thu, 28 Aug 2003, Ahmed Moustafa wrote:

> Hi Yee,
> 
> I was testing my implementation of Smith-Waterman algorithm with your t1 
> and t2 sequences. I'd like to verify the alignment score with you. Mine 
> was 56101.00 with BLOSUM62, open gap 10.0 and extend gap 0.5.
> 
> Could you please send me your score?
> 
> Thanks in advance!
> Ahmed
> 
> -- 
> Ahmed Moustafa
> Programmer/Kaiser Permanente
> 
> 

From jbronson at acsu.buffalo.edu  Thu Aug 28 18:36:42 2003
From: jbronson at acsu.buffalo.edu (Joshua Bronson)
Date: Thu Aug 28 18:37:36 2003
Subject: [Bioperl-l] aligning sequences with Bio::Tools::pSW
Message-ID: <20030828223642.GA7244@resnet147-170>

I'm interested in the a portion of some virus polyproteins. To find
the portion, I'm aligning the polyprotein against other known
proteins. I want the computer to give me a best guess and align the
smaller protein end-to-end, but currently it's not doing that. It will
only give me portions of the protein that align strongly. None of the
proteins are aligning end-to-end, unless I align a protein against
itself.

Bio::Tools:pSW is what I'm using currently. Bioperl doesn't seem to
have an interface to do pairwise alignments with Clustalw, and I'm
experiencing problems using standalone blast. Anyone have any ideas?
From wes.barris at csiro.au  Thu Aug 28 18:40:31 2003
From: wes.barris at csiro.au (Wes Barris)
Date: Thu Aug 28 18:39:50 2003
Subject: [Bioperl-l] How do you add a consensus to AlignIO?
In-Reply-To: <GAEDKMGOKFBLJPKCLKCCOEFKDBAA.brian_osborne@cognia.com>
References: <GAEDKMGOKFBLJPKCLKCCOEFKDBAA.brian_osborne@cognia.com>
Message-ID: <3F4E84DF.4080803@csiro.au>

Brian Osborne wrote:
> Wes,
> 
> I'm puzzled. I'm looking at SimpleAlign::_consensus_aa and it certainly
> looks like this method should ignore the $gapchar when it calculates the
> consensus at any given position. Does your method look like this:

Hi Brian,

Thanks for responding.  No, my SimpleAlign.pm does not look like this.
I am using bioperl-1.2.2.  You must be using bioperl-live from CVS.
I added the two "gapchar" changes to my bioper-1.2.2 code and it works
like a charm.  Thanks!


> 
> sub _consensus_aa {
>     my $self = shift;
>     my $point = shift;
>     my $threshold_percent = shift || -1 ;
>     my ($seq,%hash,$count,$letter,$key);
>     my $gapchar = $self->gap_char;
>     foreach $seq ( $self->each_seq() ) {
> 	$letter = substr($seq->seq,$point,1);
> 	$self->throw("--$point-----------") if $letter eq '';
> 	($letter eq $gapchar || $letter =~ /\./) && next;
> 	# print "Looking at $letter\n";
> 	$hash{$letter}++;
>     }
>     my $number_of_sequences = $self->no_sequences();
>     my $threshold = $number_of_sequences * $threshold_percent / 100. ;
>     $count = -1;
>     $letter = '?';
> 
>     foreach $key ( sort keys %hash ) {
> 	# print "Now at $key $hash{$key}\n";
> 	if( $hash{$key} > $count && $hash{$key} >= $threshold) {
> 	    $letter = $key;
> 	    $count = $hash{$key};
> 	}
>     }
>     return $letter;
> }
> 
> ?
> 
> Brian O.
> 
> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org
> [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Wes Barris
> Sent: Wednesday, August 27, 2003 10:56 PM
> To: Bioperl Mailing List
> Subject: Re: [Bioperl-l] How do you add a consensus to AlignIO?
> 
> Jason Stajich wrote:
> 
> 
>>Try:
>> my $consensus = new Bio::LocatableSeq(-seq=>$aln->consensus_string(),
>>                                        -id=>'btcn1000');
> 
> 
> Thanks.  That did the trick almost (I had to add -start and -end to the
> argument list).  However, it is not producing the consensus in the way
> that I want.  Here is a portion of the resulting msf file:
> 
> AU278862              ---------- ---------C TCTACAGAAT CTGTGTTTAT TTTGTTTCAG
> AU278567              ---------- ---------- ---ACAGAAT CTGTGTTTAT TTTGTTTCAG
> AU277959              -------AGA TTTTGACATC TCTACAGAAT CTGTGTTTAT TTTGTTTCAG
> AU278008              CCTTCTTANA TTTTGACATC TCTACAGAAT CTGNGTTTAT TTTGTTTCAG
> AU278623              -------AAA TTTTGACATC TCTACANAA- CTGTGTTTAT TTTGTTTCAN
> AU278682              -------AAA TTTTGACATC TCTACANAAT CTGTGTTTAT TTTGTTTCAN
> BM031781              ---------- ---------- ---------- ---------- ----------
> consensus             -------A-A TTTTGACATC TCTACAGAAT CTGTGTTTAT TTTGTTTCAG
> 
> I need the consensus to span the entire alignment length like this:
> 
> consensus             CCTTCTTAAA TTTTGACATC TCTACAGAAT CTGTGTTTAT TTTGTTTCAG
> 
> i.e. I need it to ignore where the aligned sequences do not exist.  Is there
> a way to make it do that?
> 
> --
> Wes Barris
> E-Mail: Wes.Barris@csiro.au
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 


-- 
Wes Barris
E-Mail: Wes.Barris@csiro.au

From shawnh at fugu-sg.org  Thu Aug 28 19:28:27 2003
From: shawnh at fugu-sg.org (Shawn Hoon)
Date: Thu Aug 28 19:25:52 2003
Subject: [Bioperl-l] aligning sequences with Bio::Tools::pSW
In-Reply-To: <20030828223642.GA7244@resnet147-170>
References: <20030828223642.GA7244@resnet147-170>
Message-ID: <53B80BA0-D9AF-11D7-B98A-000A95783436@fugu-sg.org>


On Friday, August 29, 2003, at 6:36 AM, Joshua Bronson wrote:

> I'm interested in the a portion of some virus polyproteins. To find
> the portion, I'm aligning the polyprotein against other known
> proteins. I want the computer to give me a best guess and align the
> smaller protein end-to-end, but currently it's not doing that. It will
> only give me portions of the protein that align strongly. None of the
> proteins are aligning end-to-end, unless I align a protein against
> itself.
>
> Bio::Tools:pSW is what I'm using currently. Bioperl doesn't seem to
> have an interface to do pairwise alignments with Clustalw, and I'm
> experiencing problems using standalone blast. Anyone have any ideas?
>
We actually support these alignment programs as wrappers in the 
bioperl-run package.
We currently have Clustalw, Lagan, Fasta and TCoffee which you can try 
under the
Bio::Tools::Run::Alignment::* namespace.
>

bioperl-run 1.2.2 available here:

http://www.bioperl.org/DIST/current_run_stable.tar.gz

shawn

> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-shawn

From wes.barris at csiro.au  Thu Aug 28 19:57:44 2003
From: wes.barris at csiro.au (Wes Barris)
Date: Thu Aug 28 19:57:03 2003
Subject: [Bioperl-l] ace to msf format?
Message-ID: <3F4E96F8.9060706@csiro.au>

Can anyone give me a hint as to how I could use bioperl to read in
an ACE assembly and write out an MSF formatted alignment?  This shows
what I have figured out so far:

#!/usr/local/bin/perl -w
#
use strict;
use Bio::Assembly::IO;
#
my $usage = "Usage: $0 <infile.ace>\n";
my $infile = shift or die $usage;

my $io = new Bio::Assembly::IO(-file=>$infile, -format=>'ace');
my $assembly = $io->next_assembly;

my $aln = $assembly->all_contigs();

-- 
Wes Barris
E-Mail: Wes.Barris@csiro.au


From ajm6q at virginia.edu  Fri Aug 29 07:41:29 2003
From: ajm6q at virginia.edu (Aaron J Mackey)
Date: Fri Aug 29 07:40:24 2003
Subject: [Bioperl-l] aligning sequences with Bio::Tools::pSW
In-Reply-To: <20030828223642.GA7244@resnet147-170>
Message-ID: <Pine.OSF.4.33.0308290737530.30377-100000@alpha10.bioch.virginia.edu>


pSW.pm is an implementation of the Smith-Waterman algorithm, a *local*
pairwise alignment algorithm, which means that the best alignment found
need not start and finish at the beginning and ending of either sequence.
You seem to want a *global* alignment algorithm, such as Needleman-Wunsch
(with "free" end-gap penalties for globally aligning the larger sequence:
this is how to achieve hybrid local/global pairwise alignments); ClustalW
should be able to give you what you need.

-Aaron

On Thu, 28 Aug 2003, Joshua Bronson wrote:

> I'm interested in the a portion of some virus polyproteins. To find
> the portion, I'm aligning the polyprotein against other known
> proteins. I want the computer to give me a best guess and align the
> smaller protein end-to-end, but currently it's not doing that. It will
> only give me portions of the protein that align strongly. None of the
> proteins are aligning end-to-end, unless I align a protein against
> itself.
>
> Bio::Tools:pSW is what I'm using currently. Bioperl doesn't seem to
> have an interface to do pairwise alignments with Clustalw, and I'm
> experiencing problems using standalone blast. Anyone have any ideas?
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

-- 
 Aaron J Mackey
 Pearson Laboratory
 University of Virginia
 (434) 924-2821
 amackey@virginia.edu


From brian_osborne at cognia.com  Fri Aug 29 11:13:00 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Fri Aug 29 11:15:50 2003
Subject: [Bioperl-l] aligning sequences with Bio::Tools::pSW
In-Reply-To: <20030828223642.GA7244@resnet147-170>
Message-ID: <GAEDKMGOKFBLJPKCLKCCOEGHDBAA.brian_osborne@cognia.com>

Joshua,

> Bioperl doesn't seem to have an interface to do pairwise alignments with
Clustalw,

Bioperl is exactly what you want! See section IV.2.3 of the bptutorial,
"Aligning multiple sequences (Clustalw.pm, TCoffee.pm)". With the resulting
SimpleAlign object you'll have all sorts of useful methods for analyzing and
"slicing" the alignment.

Brian O.


-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Joshua Bronson
Sent: Thursday, August 28, 2003 6:37 PM
To: Bioperl list
Subject: [Bioperl-l] aligning sequences with Bio::Tools::pSW

I'm interested in the a portion of some virus polyproteins. To find
the portion, I'm aligning the polyprotein against other known
proteins. I want the computer to give me a best guess and align the
smaller protein end-to-end, but currently it's not doing that. It will
only give me portions of the protein that align strongly. None of the
proteins are aligning end-to-end, unless I align a protein against
itself.

Bio::Tools:pSW is what I'm using currently. Bioperl doesn't seem to
have an interface to do pairwise alignments with Clustalw, and I'm
experiencing problems using standalone blast. Anyone have any ideas?
_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From lstein at cshl.edu  Fri Aug 29 11:39:58 2003
From: lstein at cshl.edu (Lincoln Stein)
Date: Fri Aug 29 11:38:58 2003
Subject: [Bioperl-l] Bio::Graphics
In-Reply-To: <5.1.1.6.0.20030806090354.00b28208@valmont>
References: <5.1.1.6.0.20030806090354.00b28208@valmont>
Message-ID: <200308291139.59003.lstein@cshl.edu>

Sorry for responding so late to this e-mail.  You were looking at an out of 
date tutorial that no longer matches the code base.  However, the tutorial 
has now been updated and the examples should work.

Lincoln

On Wednesday 06 August 2003 03:09 am, Laurence Amilhat wrote:
> Hi,
>
> I try to learn how to use the module Bio::Graphics.
> I found he How To from Lincoln Stein on the web. I try to practice with the
> examples, it's working except for the labels of the features that don't
> appear on my figure.
> Does anybody ever use this module?
>
> This is the example:
> #!/usr/local/public/bin/perl
>
> use strict;
> use lib
> '/homej/bioinf/lamilhat/PERL_MODULE/lib/perl5/site_perl/5.005/BIOPERL/lib/s
>ite_perl/5.6.1/'; use Bio::Graphics;
> use Bio::SeqFeature::Generic;
>
> my $panel= Bio::Graphics::Panel->new(-length =>1000,-width =>800);
> my $track=$panel->add_track(-glyph =>'generic',-label =>1);
>
>
> while (<>)
> {
>          chomp;
>          next if /^\#/;
>          my ($name,$score,$start,$end)=split /\t+/;
>          print STDERR "$name\n";
>          my $feature=
> Bio::SeqFeature::Generic->new(-display_name=>$name,-score=>$score,-start=>$
>start,-end=>$end); $track->add_feature($feature);
> }
>
> print $panel->png;
>
>
> And this is the Data to parse with the example:
> #hit    score   start   end
> truc1   381     2       200
> truc2   210     2       210
> truc3   800     2       200
> truc4   1000    380     921
> truc5   812     402     972
> truc6   1200    400     970
> bum     400     300     620
> pres1   127     310     700
>
>
> Thanks,
>
> Laurence.
>
> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> INRA, UMR INRA/UBP Am?lioration et Sant? des Plantes
> 234 avenue du Br?zet
> 63039 Clermont-Ferrand Cedex 2
>
> Tel 04 73 62 48 37
> Fax 04 73 62 44 53
> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

-- 
========================================================================
Lincoln D. Stein                           Cold Spring Harbor Laboratory
lstein@cshl.org			                  Cold Spring Harbor, NY
========================================================================


From william.j.burtle at gsk.com  Fri Aug 29 07:55:34 2003
From: william.j.burtle at gsk.com (william.j.burtle@gsk.com)
Date: Fri Aug 29 12:12:09 2003
Subject: [Bioperl-l] aligning sequences with Bio::Tools::pSW
Message-ID: <OF3D8BD9DF.1A750AE5-ON85256D91.00415451@sb.com>

Joshua, 

you might also try the EMBOSS tools (particularly stretcher and needle): 
http://www.emboss.org/

and the bioperl interface: 
http://doc.bioperl.org/releases/bioperl-1.2/Bio/Factory/EMBOSS.html

- Bill Burtle







"Aaron J Mackey" <ajm6q@virginia.edu>

Sent by: bioperl-l-bounces@portal.open-bio.org
29-Aug-2003 07:41
Please respond to "Aaron J. Mackey" <amackey@virginia.edu>

 
 

        To:     "Joshua Bronson" <jbronson@acsu.buffalo.edu>

        cc:     "Bioperl list" <bioperl-l@bioperl.org>
        Subject:        Re: [Bioperl-l] aligning sequences with Bio::Tools::pSW


pSW.pm is an implementation of the Smith-Waterman algorithm, a *local*
pairwise alignment algorithm, which means that the best alignment found
need not start and finish at the beginning and ending of either sequence.
You seem to want a *global* alignment algorithm, such as Needleman-Wunsch
(with "free" end-gap penalties for globally aligning the larger sequence:
this is how to achieve hybrid local/global pairwise alignments); ClustalW
should be able to give you what you need.

-Aaron

On Thu, 28 Aug 2003, Joshua Bronson wrote:

> I'm interested in the a portion of some virus polyproteins. To find
> the portion, I'm aligning the polyprotein against other known
> proteins. I want the computer to give me a best guess and align the
> smaller protein end-to-end, but currently it's not doing that. It will
> only give me portions of the protein that align strongly. None of the
> proteins are aligning end-to-end, unless I align a protein against
> itself.
>
> Bio::Tools:pSW is what I'm using currently. Bioperl doesn't seem to
> have an interface to do pairwise alignments with Clustalw, and I'm
> experiencing problems using standalone blast. Anyone have any ideas?
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

-- 
 Aaron J Mackey
 Pearson Laboratory
 University of Virginia
 (434) 924-2821
 amackey@virginia.edu


_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l



From brian_osborne at cognia.com  Fri Aug 29 12:21:47 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Fri Aug 29 12:24:50 2003
Subject: [Bioperl-l] ace to msf format?
In-Reply-To: <3F4E96F8.9060706@csiro.au>
Message-ID: <GAEDKMGOKFBLJPKCLKCCOEGJDBAA.brian_osborne@cognia.com>

Wes,

I don't think this is possible in Bioperl. To put it more generally, AlignIO
can't accommodate Assembly objects currently. AlignIO is the module that
takes in a variety of alignment formats and interconverts them, analogous to
SeqIO. I'll be corrected if I'm wrong.

Brian O.

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Wes Barris
Sent: Thursday, August 28, 2003 7:58 PM
To: Bioperl Mailing List
Subject: [Bioperl-l] ace to msf format?

Can anyone give me a hint as to how I could use bioperl to read in
an ACE assembly and write out an MSF formatted alignment?  This shows
what I have figured out so far:

#!/usr/local/bin/perl -w
#
use strict;
use Bio::Assembly::IO;
#
my $usage = "Usage: $0 <infile.ace>\n";
my $infile = shift or die $usage;

my $io = new Bio::Assembly::IO(-file=>$infile, -format=>'ace');
my $assembly = $io->next_assembly;

my $aln = $assembly->all_contigs();

--
Wes Barris
E-Mail: Wes.Barris@csiro.au


_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From brian_osborne at cognia.com  Fri Aug 29 12:25:04 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Fri Aug 29 12:28:01 2003
Subject: [Bioperl-l] aligning sequences with Bio::Tools::pSW
In-Reply-To: <OF3D8BD9DF.1A750AE5-ON85256D91.00415451@sb.com>
Message-ID: <GAEDKMGOKFBLJPKCLKCCCEGKDBAA.brian_osborne@cognia.com>

Bill,

AlignIO does stretcher too? Cool. So that means water, needle, and stretcher
have the same output format. Are there any others in the EMBOSS suite with
this output format?

Thanks again,

Brian O.

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of
william.j.burtle@gsk.com
Sent: Friday, August 29, 2003 7:56 AM
To: Joshua Bronson
Cc: Bioperl list
Subject: Re: [Bioperl-l] aligning sequences with Bio::Tools::pSW

Joshua,

you might also try the EMBOSS tools (particularly stretcher and needle):
http://www.emboss.org/

and the bioperl interface:
http://doc.bioperl.org/releases/bioperl-1.2/Bio/Factory/EMBOSS.html

- Bill Burtle







"Aaron J Mackey" <ajm6q@virginia.edu>

Sent by: bioperl-l-bounces@portal.open-bio.org
29-Aug-2003 07:41
Please respond to "Aaron J. Mackey" <amackey@virginia.edu>




        To:     "Joshua Bronson" <jbronson@acsu.buffalo.edu>

        cc:     "Bioperl list" <bioperl-l@bioperl.org>
        Subject:        Re: [Bioperl-l] aligning sequences with
Bio::Tools::pSW


pSW.pm is an implementation of the Smith-Waterman algorithm, a *local*
pairwise alignment algorithm, which means that the best alignment found
need not start and finish at the beginning and ending of either sequence.
You seem to want a *global* alignment algorithm, such as Needleman-Wunsch
(with "free" end-gap penalties for globally aligning the larger sequence:
this is how to achieve hybrid local/global pairwise alignments); ClustalW
should be able to give you what you need.

-Aaron

On Thu, 28 Aug 2003, Joshua Bronson wrote:

> I'm interested in the a portion of some virus polyproteins. To find
> the portion, I'm aligning the polyprotein against other known
> proteins. I want the computer to give me a best guess and align the
> smaller protein end-to-end, but currently it's not doing that. It will
> only give me portions of the protein that align strongly. None of the
> proteins are aligning end-to-end, unless I align a protein against
> itself.
>
> Bio::Tools:pSW is what I'm using currently. Bioperl doesn't seem to
> have an interface to do pairwise alignments with Clustalw, and I'm
> experiencing problems using standalone blast. Anyone have any ideas?
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
 Aaron J Mackey
 Pearson Laboratory
 University of Virginia
 (434) 924-2821
 amackey@virginia.edu


_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l




From jason at cgt.duhs.duke.edu  Fri Aug 29 13:02:20 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Fri Aug 29 12:39:40 2003
Subject: [Bioperl-l] aligning sequences with Bio::Tools::pSW
In-Reply-To: <GAEDKMGOKFBLJPKCLKCCCEGKDBAA.brian_osborne@cognia.com>
References: <GAEDKMGOKFBLJPKCLKCCCEGKDBAA.brian_osborne@cognia.com>
Message-ID: <Pine.LNX.4.50.0308291259020.20935-100000@tenero.duhs.duke.edu>

You can specify different output formats from the default EMBOSS alignment
report - specifically at least {msf, fasta}.

Local alignments are problematic because you cannot reconstruct where the
alignments came from in the whole seq because of the EMBOSS MSF and
FASTA output formats doesn't necessarily report start/end in the original
seq.

The EMBOSS alignment output format can be parsed with AlignIO::emboss can
parse this format although I still think there are some special cases
where it might not be parsing correctly for local alignments.

-jason
On Fri, 29 Aug 2003, Brian Osborne wrote:

> Bill,
>
> AlignIO does stretcher too? Cool. So that means water, needle, and stretcher
> have the same output format. Are there any others in the EMBOSS suite with
> this output format?
>
> Thanks again,
>
> Brian O.
>
> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org
> [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of
> william.j.burtle@gsk.com
> Sent: Friday, August 29, 2003 7:56 AM
> To: Joshua Bronson
> Cc: Bioperl list
> Subject: Re: [Bioperl-l] aligning sequences with Bio::Tools::pSW
>
> Joshua,
>
> you might also try the EMBOSS tools (particularly stretcher and needle):
> http://www.emboss.org/
>
> and the bioperl interface:
> http://doc.bioperl.org/releases/bioperl-1.2/Bio/Factory/EMBOSS.html
>
> - Bill Burtle
>
>
>
>
>
>
>
> "Aaron J Mackey" <ajm6q@virginia.edu>
>
> Sent by: bioperl-l-bounces@portal.open-bio.org
> 29-Aug-2003 07:41
> Please respond to "Aaron J. Mackey" <amackey@virginia.edu>
>
>
>
>
>         To:     "Joshua Bronson" <jbronson@acsu.buffalo.edu>
>
>         cc:     "Bioperl list" <bioperl-l@bioperl.org>
>         Subject:        Re: [Bioperl-l] aligning sequences with
> Bio::Tools::pSW
>
>
> pSW.pm is an implementation of the Smith-Waterman algorithm, a *local*
> pairwise alignment algorithm, which means that the best alignment found
> need not start and finish at the beginning and ending of either sequence.
> You seem to want a *global* alignment algorithm, such as Needleman-Wunsch
> (with "free" end-gap penalties for globally aligning the larger sequence:
> this is how to achieve hybrid local/global pairwise alignments); ClustalW
> should be able to give you what you need.
>
> -Aaron
>
> On Thu, 28 Aug 2003, Joshua Bronson wrote:
>
> > I'm interested in the a portion of some virus polyproteins. To find
> > the portion, I'm aligning the polyprotein against other known
> > proteins. I want the computer to give me a best guess and align the
> > smaller protein end-to-end, but currently it's not doing that. It will
> > only give me portions of the protein that align strongly. None of the
> > proteins are aligning end-to-end, unless I align a protein against
> > itself.
> >
> > Bio::Tools:pSW is what I'm using currently. Bioperl doesn't seem to
> > have an interface to do pairwise alignments with Clustalw, and I'm
> > experiencing problems using standalone blast. Anyone have any ideas?
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
>
> --
>  Aaron J Mackey
>  Pearson Laboratory
>  University of Virginia
>  (434) 924-2821
>  amackey@virginia.edu
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From lstein at cshl.edu  Fri Aug 29 12:47:25 2003
From: lstein at cshl.edu (Lincoln Stein)
Date: Fri Aug 29 12:46:38 2003
Subject: [Bioperl-l] doing a 1.2.3 release
In-Reply-To: <Pine.OSX.4.44.0308280006080.1739-100000@ewan-birneys-computer.local>
References: <Pine.OSX.4.44.0308280006080.1739-100000@ewan-birneys-computer.local>
Message-ID: <200308291247.25288.lstein@cshl.edu>

What are the timetables for 1.2.3 and 1.3?  

Lincoln

On Wednesday 27 August 2003 07:07 pm, Ewan Birney wrote:
> On Wed, 27 Aug 2003, Jason Stajich wrote:
> > In my mind there are enough things that have been fixed since 1.2.2 on
> > the branch to justify the effort in releasing another bugfix release on
> > the stable branch.  I would like to merge some of the
> > HTML|TextResultWriter fixes from the main trunk, otherwise I think could
> > be an easy push out the door.
>
> I'd agree. I also think we need to start on the 1.3 series. Heikki...
> feel free to chime in...?
>
>
> Jason - I am ok for some bug hunting for a while on either branch or trunk
> - any not-so-nasty-that-I-go-mad-but-useful-to-fix-bugs out there?
>
> > -jason
> >
> > --
> > Jason Stajich
> > Duke University
> > jason at cgt.mc.duke.edu
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

-- 
========================================================================
Lincoln D. Stein                           Cold Spring Harbor Laboratory
lstein@cshl.org			                  Cold Spring Harbor, NY
========================================================================


From brian_osborne at cognia.com  Fri Aug 29 12:45:21 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Fri Aug 29 12:48:26 2003
Subject: [Bioperl-l] aligning sequences with Bio::Tools::pSW
In-Reply-To: <Pine.LNX.4.50.0308291259020.20935-100000@tenero.duhs.duke.edu>
Message-ID: <GAEDKMGOKFBLJPKCLKCCCEGLDBAA.brian_osborne@cognia.com>

Jason,

I guess I'm asking something simpler, and I'm not an EMBOSS user. Which of
the EMBOSS alignment programs use this "default EMBOSS alignment" format,
aside from water, needle, and stretcher. All of them? Currently the docs
just say water and needle, which isn't exactly right.

Apart from the issue, admittedly important, about loss of the initial or
input coordinates.

Brian O.

-----Original Message-----
From: Jason Stajich [mailto:jason@cgt.duhs.duke.edu]
Sent: Friday, August 29, 2003 1:02 PM
To: Brian Osborne
Cc: william.j.burtle@gsk.com; Joshua Bronson; Bioperl list
Subject: RE: [Bioperl-l] aligning sequences with Bio::Tools::pSW

You can specify different output formats from the default EMBOSS alignment
report - specifically at least {msf, fasta}.

Local alignments are problematic because you cannot reconstruct where the
alignments came from in the whole seq because of the EMBOSS MSF and
FASTA output formats doesn't necessarily report start/end in the original
seq.

The EMBOSS alignment output format can be parsed with AlignIO::emboss can
parse this format although I still think there are some special cases
where it might not be parsing correctly for local alignments.

-jason
On Fri, 29 Aug 2003, Brian Osborne wrote:

> Bill,
>
> AlignIO does stretcher too? Cool. So that means water, needle, and
stretcher
> have the same output format. Are there any others in the EMBOSS suite with
> this output format?
>
> Thanks again,
>
> Brian O.
>
> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org
> [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of
> william.j.burtle@gsk.com
> Sent: Friday, August 29, 2003 7:56 AM
> To: Joshua Bronson
> Cc: Bioperl list
> Subject: Re: [Bioperl-l] aligning sequences with Bio::Tools::pSW
>
> Joshua,
>
> you might also try the EMBOSS tools (particularly stretcher and needle):
> http://www.emboss.org/
>
> and the bioperl interface:
> http://doc.bioperl.org/releases/bioperl-1.2/Bio/Factory/EMBOSS.html
>
> - Bill Burtle
>
>
>
>
>
>
>
> "Aaron J Mackey" <ajm6q@virginia.edu>
>
> Sent by: bioperl-l-bounces@portal.open-bio.org
> 29-Aug-2003 07:41
> Please respond to "Aaron J. Mackey" <amackey@virginia.edu>
>
>
>
>
>         To:     "Joshua Bronson" <jbronson@acsu.buffalo.edu>
>
>         cc:     "Bioperl list" <bioperl-l@bioperl.org>
>         Subject:        Re: [Bioperl-l] aligning sequences with
> Bio::Tools::pSW
>
>
> pSW.pm is an implementation of the Smith-Waterman algorithm, a *local*
> pairwise alignment algorithm, which means that the best alignment found
> need not start and finish at the beginning and ending of either sequence.
> You seem to want a *global* alignment algorithm, such as Needleman-Wunsch
> (with "free" end-gap penalties for globally aligning the larger sequence:
> this is how to achieve hybrid local/global pairwise alignments); ClustalW
> should be able to give you what you need.
>
> -Aaron
>
> On Thu, 28 Aug 2003, Joshua Bronson wrote:
>
> > I'm interested in the a portion of some virus polyproteins. To find
> > the portion, I'm aligning the polyprotein against other known
> > proteins. I want the computer to give me a best guess and align the
> > smaller protein end-to-end, but currently it's not doing that. It will
> > only give me portions of the protein that align strongly. None of the
> > proteins are aligning end-to-end, unless I align a protein against
> > itself.
> >
> > Bio::Tools:pSW is what I'm using currently. Bioperl doesn't seem to
> > have an interface to do pairwise alignments with Clustalw, and I'm
> > experiencing problems using standalone blast. Anyone have any ideas?
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
>
> --
>  Aaron J Mackey
>  Pearson Laboratory
>  University of Virginia
>  (434) 924-2821
>  amackey@virginia.edu
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu


From birney at ebi.ac.uk  Fri Aug 29 12:50:50 2003
From: birney at ebi.ac.uk (Ewan Birney)
Date: Fri Aug 29 12:49:29 2003
Subject: [Bioperl-l] doing a 1.2.3 release
In-Reply-To: <200308291247.25288.lstein@cshl.edu>
Message-ID: <Pine.OSX.4.44.0308291750150.452-100000@ewan-birneys-computer.local>



On Fri, 29 Aug 2003, Lincoln Stein wrote:

> What are the timetables for 1.2.3 and 1.3?
>


1.2.3 soon(ish)

1.3 Heikki should decide. I am not on campus at the moment, so will try to
track him down next week...


From birney at ebi.ac.uk  Fri Aug 29 12:56:41 2003
From: birney at ebi.ac.uk (Ewan Birney)
Date: Fri Aug 29 12:55:19 2003
Subject: [Bioperl-l] bugs on branch; tests on main trunk
Message-ID: <Pine.OSX.4.44.0308291752560.452-100000@ewan-birneys-computer.local>



I have fixed the translate() and pdb res bug on the branch.


On the main trunk I have put more external module protection into the new
tests. It would be nice if people writing new tests who knew they needed
external modules would do this directly.


Heikki or Rob --- does RestrictionEnzyme *really* need Storeable?
Storeable doesn't come by default on systems, so if it didn't need
it then it would be more useful not to use it. Any chance of this?


I put a require eval() in tutorial around the restriction enzyme stuff.




Chris (and the unflattening crew...) the Unflattener is issueing alot of
warnings with -w --- any chance of one of you looking at it?


However, I now have on the main trunk:


All tests successful, 33 subtests skipped.
Files=168, Tests=7643, 383 wallclock secs (287.31 cusr + 25.46 csys = 312.77 CPU)






Pretty darn impressive.










From jason at cgt.duhs.duke.edu  Fri Aug 29 13:19:53 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Fri Aug 29 12:57:06 2003
Subject: [Bioperl-l] EMBOSS Alignment program [was aligning sequences with
	Bio::Tools::pSW]
In-Reply-To: <GAEDKMGOKFBLJPKCLKCCCEGLDBAA.brian_osborne@cognia.com>
References: <GAEDKMGOKFBLJPKCLKCCCEGLDBAA.brian_osborne@cognia.com>
Message-ID: <Pine.LNX.4.50.0308291314090.20935-100000@tenero.duhs.duke.edu>

Any of the programs which provide the -aformat option I guess.  I don't
think demoalign is really part of the distro though so safe to ignore it.

[jason@sonogno acd]$ pwd
/usr/local/pkg/emboss/share/EMBOSS/acd

[jason@sonogno acd]$ grep "aformat:" *
demoalign.acd:  aformat: "SRS"
matcher.acd:  aformat: "markx0"
merger.acd:  aformat: "simple"
needle.acd:  aformat: "srspair"
stretcher.acd:  aformat: "markx0"
supermatcher.acd:  aformat: "simple"
water.acd:  aformat: "srspair"



On Fri, 29 Aug 2003, Brian Osborne wrote:

> Jason,
>
> I guess I'm asking something simpler, and I'm not an EMBOSS user. Which of
> the EMBOSS alignment programs use this "default EMBOSS alignment" format,
> aside from water, needle, and stretcher. All of them? Currently the docs
> just say water and needle, which isn't exactly right.
>
> Apart from the issue, admittedly important, about loss of the initial or
> input coordinates.
>
> Brian O.
>
> -----Original Message-----
> From: Jason Stajich [mailto:jason@cgt.duhs.duke.edu]
> Sent: Friday, August 29, 2003 1:02 PM
> To: Brian Osborne
> Cc: william.j.burtle@gsk.com; Joshua Bronson; Bioperl list
> Subject: RE: [Bioperl-l] aligning sequences with Bio::Tools::pSW
>
> You can specify different output formats from the default EMBOSS alignment
> report - specifically at least {msf, fasta}.
>
> Local alignments are problematic because you cannot reconstruct where the
> alignments came from in the whole seq because of the EMBOSS MSF and
> FASTA output formats doesn't necessarily report start/end in the original
> seq.
>
> The EMBOSS alignment output format can be parsed with AlignIO::emboss can
> parse this format although I still think there are some special cases
> where it might not be parsing correctly for local alignments.
>
> -jason
> On Fri, 29 Aug 2003, Brian Osborne wrote:
>
> > Bill,
> >
> > AlignIO does stretcher too? Cool. So that means water, needle, and
> stretcher
> > have the same output format. Are there any others in the EMBOSS suite with
> > this output format?
> >
> > Thanks again,
> >
> > Brian O.
> >
> > -----Original Message-----
> > From: bioperl-l-bounces@portal.open-bio.org
> > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of
> > william.j.burtle@gsk.com
> > Sent: Friday, August 29, 2003 7:56 AM
> > To: Joshua Bronson
> > Cc: Bioperl list
> > Subject: Re: [Bioperl-l] aligning sequences with Bio::Tools::pSW
> >
> > Joshua,
> >
> > you might also try the EMBOSS tools (particularly stretcher and needle):
> > http://www.emboss.org/
> >
> > and the bioperl interface:
> > http://doc.bioperl.org/releases/bioperl-1.2/Bio/Factory/EMBOSS.html
> >
> > - Bill Burtle
> >
> >
> >
> >
> >
> >
> >
> > "Aaron J Mackey" <ajm6q@virginia.edu>
> >
> > Sent by: bioperl-l-bounces@portal.open-bio.org
> > 29-Aug-2003 07:41
> > Please respond to "Aaron J. Mackey" <amackey@virginia.edu>
> >
> >
> >
> >
> >         To:     "Joshua Bronson" <jbronson@acsu.buffalo.edu>
> >
> >         cc:     "Bioperl list" <bioperl-l@bioperl.org>
> >         Subject:        Re: [Bioperl-l] aligning sequences with
> > Bio::Tools::pSW
> >
> >
> > pSW.pm is an implementation of the Smith-Waterman algorithm, a *local*
> > pairwise alignment algorithm, which means that the best alignment found
> > need not start and finish at the beginning and ending of either sequence.
> > You seem to want a *global* alignment algorithm, such as Needleman-Wunsch
> > (with "free" end-gap penalties for globally aligning the larger sequence:
> > this is how to achieve hybrid local/global pairwise alignments); ClustalW
> > should be able to give you what you need.
> >
> > -Aaron
> >
> > On Thu, 28 Aug 2003, Joshua Bronson wrote:
> >
> > > I'm interested in the a portion of some virus polyproteins. To find
> > > the portion, I'm aligning the polyprotein against other known
> > > proteins. I want the computer to give me a best guess and align the
> > > smaller protein end-to-end, but currently it's not doing that. It will
> > > only give me portions of the protein that align strongly. None of the
> > > proteins are aligning end-to-end, unless I align a protein against
> > > itself.
> > >
> > > Bio::Tools:pSW is what I'm using currently. Bioperl doesn't seem to
> > > have an interface to do pairwise alignments with Clustalw, and I'm
> > > experiencing problems using standalone blast. Anyone have any ideas?
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l@portal.open-bio.org
> > > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > >
> >
> > --
> >  Aaron J Mackey
> >  Pearson Laboratory
> >  University of Virginia
> >  (434) 924-2821
> >  amackey@virginia.edu
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
>
> --
> Jason Stajich
> Duke University
> jason at cgt.mc.duke.edu
>
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From brian_osborne at cognia.com  Fri Aug 29 12:59:27 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Fri Aug 29 13:02:33 2003
Subject: [Bioperl-l] EMBOSS Alignment program [was aligning sequences
	withBio::Tools::pSW]
In-Reply-To: <Pine.LNX.4.50.0308291314090.20935-100000@tenero.duhs.duke.edu>
Message-ID: <GAEDKMGOKFBLJPKCLKCCOEGMDBAA.brian_osborne@cognia.com>

Jason,

Excellent.

Brian O.

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Jason Stajich
Sent: Friday, August 29, 2003 1:20 PM
To: Brian Osborne
Cc: william.j.burtle@gsk.com; Bioperl list; Joshua Bronson
Subject: [Bioperl-l] EMBOSS Alignment program [was aligning sequences
withBio::Tools::pSW]

Any of the programs which provide the -aformat option I guess.  I don't
think demoalign is really part of the distro though so safe to ignore it.

[jason@sonogno acd]$ pwd
/usr/local/pkg/emboss/share/EMBOSS/acd

[jason@sonogno acd]$ grep "aformat:" *
demoalign.acd:  aformat: "SRS"
matcher.acd:  aformat: "markx0"
merger.acd:  aformat: "simple"
needle.acd:  aformat: "srspair"
stretcher.acd:  aformat: "markx0"
supermatcher.acd:  aformat: "simple"
water.acd:  aformat: "srspair"



On Fri, 29 Aug 2003, Brian Osborne wrote:

> Jason,
>
> I guess I'm asking something simpler, and I'm not an EMBOSS user. Which of
> the EMBOSS alignment programs use this "default EMBOSS alignment" format,
> aside from water, needle, and stretcher. All of them? Currently the docs
> just say water and needle, which isn't exactly right.
>
> Apart from the issue, admittedly important, about loss of the initial or
> input coordinates.
>
> Brian O.
>
> -----Original Message-----
> From: Jason Stajich [mailto:jason@cgt.duhs.duke.edu]
> Sent: Friday, August 29, 2003 1:02 PM
> To: Brian Osborne
> Cc: william.j.burtle@gsk.com; Joshua Bronson; Bioperl list
> Subject: RE: [Bioperl-l] aligning sequences with Bio::Tools::pSW
>
> You can specify different output formats from the default EMBOSS alignment
> report - specifically at least {msf, fasta}.
>
> Local alignments are problematic because you cannot reconstruct where the
> alignments came from in the whole seq because of the EMBOSS MSF and
> FASTA output formats doesn't necessarily report start/end in the original
> seq.
>
> The EMBOSS alignment output format can be parsed with AlignIO::emboss can
> parse this format although I still think there are some special cases
> where it might not be parsing correctly for local alignments.
>
> -jason
> On Fri, 29 Aug 2003, Brian Osborne wrote:
>
> > Bill,
> >
> > AlignIO does stretcher too? Cool. So that means water, needle, and
> stretcher
> > have the same output format. Are there any others in the EMBOSS suite
with
> > this output format?
> >
> > Thanks again,
> >
> > Brian O.
> >
> > -----Original Message-----
> > From: bioperl-l-bounces@portal.open-bio.org
> > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of
> > william.j.burtle@gsk.com
> > Sent: Friday, August 29, 2003 7:56 AM
> > To: Joshua Bronson
> > Cc: Bioperl list
> > Subject: Re: [Bioperl-l] aligning sequences with Bio::Tools::pSW
> >
> > Joshua,
> >
> > you might also try the EMBOSS tools (particularly stretcher and needle):
> > http://www.emboss.org/
> >
> > and the bioperl interface:
> > http://doc.bioperl.org/releases/bioperl-1.2/Bio/Factory/EMBOSS.html
> >
> > - Bill Burtle
> >
> >
> >
> >
> >
> >
> >
> > "Aaron J Mackey" <ajm6q@virginia.edu>
> >
> > Sent by: bioperl-l-bounces@portal.open-bio.org
> > 29-Aug-2003 07:41
> > Please respond to "Aaron J. Mackey" <amackey@virginia.edu>
> >
> >
> >
> >
> >         To:     "Joshua Bronson" <jbronson@acsu.buffalo.edu>
> >
> >         cc:     "Bioperl list" <bioperl-l@bioperl.org>
> >         Subject:        Re: [Bioperl-l] aligning sequences with
> > Bio::Tools::pSW
> >
> >
> > pSW.pm is an implementation of the Smith-Waterman algorithm, a *local*
> > pairwise alignment algorithm, which means that the best alignment found
> > need not start and finish at the beginning and ending of either
sequence.
> > You seem to want a *global* alignment algorithm, such as
Needleman-Wunsch
> > (with "free" end-gap penalties for globally aligning the larger
sequence:
> > this is how to achieve hybrid local/global pairwise alignments);
ClustalW
> > should be able to give you what you need.
> >
> > -Aaron
> >
> > On Thu, 28 Aug 2003, Joshua Bronson wrote:
> >
> > > I'm interested in the a portion of some virus polyproteins. To find
> > > the portion, I'm aligning the polyprotein against other known
> > > proteins. I want the computer to give me a best guess and align the
> > > smaller protein end-to-end, but currently it's not doing that. It will
> > > only give me portions of the protein that align strongly. None of the
> > > proteins are aligning end-to-end, unless I align a protein against
> > > itself.
> > >
> > > Bio::Tools:pSW is what I'm using currently. Bioperl doesn't seem to
> > > have an interface to do pairwise alignments with Clustalw, and I'm
> > > experiencing problems using standalone blast. Anyone have any ideas?
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l@portal.open-bio.org
> > > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > >
> >
> > --
> >  Aaron J Mackey
> >  Pearson Laboratory
> >  University of Virginia
> >  (434) 924-2821
> >  amackey@virginia.edu
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
>
> --
> Jason Stajich
> Duke University
> jason at cgt.mc.duke.edu
>
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From lstein at cshl.edu  Fri Aug 29 13:10:39 2003
From: lstein at cshl.edu (Lincoln Stein)
Date: Fri Aug 29 13:09:39 2003
Subject: [Bioperl-l] doing a 1.2.3 release
In-Reply-To: <Pine.OSX.4.44.0308291750150.452-100000@ewan-birneys-computer.local>
References: <Pine.OSX.4.44.0308291750150.452-100000@ewan-birneys-computer.local>
Message-ID: <200308291310.39582.lstein@cshl.edu>

What branch should I commit to for 1.2.3? branch-1-2?

Lincoln

On Friday 29 August 2003 12:50 pm, Ewan Birney wrote:
> On Fri, 29 Aug 2003, Lincoln Stein wrote:
> > What are the timetables for 1.2.3 and 1.3?
>
> 1.2.3 soon(ish)
>
> 1.3 Heikki should decide. I am not on campus at the moment, so will try to
> track him down next week...
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

-- 
========================================================================
Lincoln D. Stein                           Cold Spring Harbor Laboratory
lstein@cshl.org			                  Cold Spring Harbor, NY
========================================================================


From jason at cgt.duhs.duke.edu  Fri Aug 29 13:39:45 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Fri Aug 29 13:17:10 2003
Subject: [Bioperl-l] doing a 1.2.3 release
In-Reply-To: <200308291310.39582.lstein@cshl.edu>
References: <Pine.OSX.4.44.0308291750150.452-100000@ewan-birneys-computer.local>
	<200308291310.39582.lstein@cshl.edu>
Message-ID: <Pine.LNX.4.50.0308291335360.20935-100000@tenero.duhs.duke.edu>

yes.
stable branch tag                        -----> branch-1-2
main trunk
(where 1.3 will branch/release from      -----> HEAD (default)

Fixes made should thus go in two places.

For those unfamiliar how to get access to the branch and the main trunk:

cvs -d:...:bioperl co -d bioperl-1.2-branch -r branch-1-2 bioperl-live
cvs -d:...:bioperl co -d bioperl-live                     bioperl-live

This will create 2 directories, one called bioperl-1.2-branch and one
called bioperl-live


----

Let's try for 1.2.3 in 2 weeks?  We need to check out some of the keywords
problems one more time on the branch -there were problems in how the
RichSeq object implemented keywords and we need to make sure the SeqIO
parsers/writers do the right thing.

-jason


On Fri, 29 Aug 2003, Lincoln Stein wrote:

> What branch should I commit to for 1.2.3? branch-1-2?
>
> Lincoln

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu
From cjfields at uiuc.edu  Fri Aug 29 13:26:01 2003
From: cjfields at uiuc.edu (Christopher Fields)
Date: Fri Aug 29 13:26:03 2003
Subject: [Bioperl-l] Bio::Graphics
In-Reply-To: <200308291139.59003.lstein@cshl.edu>
References: <5.1.1.6.0.20030806090354.00b28208@valmont>
	<200308291139.59003.lstein@cshl.edu>
Message-ID: <1062178023.3695.110.camel@chrisfields.life.uiuc.edu>

I tried the tutorial on RedHat Linux 9.0 and it works, but I tried it on
my wife's IBook (Mac OSX 10.2.6) and couldn't get the labels to come up
either.  I posted a reply here (bioperl-l) a while back about it but
didn't get a reply.  Could it be a font problem or LANG setting?  My RH
9.0 system has LANG=en_US, but I think the IBook (OS X) has LANG=C
(neither set to UTF-8; I had problems with this in the past on both
systems).

On Fri, 2003-08-29 at 10:39, Lincoln Stein wrote:
> Sorry for responding so late to this e-mail.  You were looking at an out of 
> date tutorial that no longer matches the code base.  However, the tutorial 
> has now been updated and the examples should work.
> 
> Lincoln
> 
> On Wednesday 06 August 2003 03:09 am, Laurence Amilhat wrote:
> > Hi,
> >
> > I try to learn how to use the module Bio::Graphics.
> > I found he How To from Lincoln Stein on the web. I try to practice with the
> > examples, it's working except for the labels of the features that don't
> > appear on my figure.
> > Does anybody ever use this module?
> >
> > This is the example:
> > #!/usr/local/public/bin/perl
> >
> > use strict;
> > use lib
> > '/homej/bioinf/lamilhat/PERL_MODULE/lib/perl5/site_perl/5.005/BIOPERL/lib/s
> >ite_perl/5.6.1/'; use Bio::Graphics;
> > use Bio::SeqFeature::Generic;
> >
> > my $panel= Bio::Graphics::Panel->new(-length =>1000,-width =>800);
> > my $track=$panel->add_track(-glyph =>'generic',-label =>1);
> >
> >
> > while (<>)
> > {
> >          chomp;
> >          next if /^\#/;
> >          my ($name,$score,$start,$end)=split /\t+/;
> >          print STDERR "$name\n";
> >          my $feature=
> > Bio::SeqFeature::Generic->new(-display_name=>$name,-score=>$score,-start=>$
> >start,-end=>$end); $track->add_feature($feature);
> > }
> >
> > print $panel->png;
> >
> >
> > And this is the Data to parse with the example:
> > #hit    score   start   end
> > truc1   381     2       200
> > truc2   210     2       210
> > truc3   800     2       200
> > truc4   1000    380     921
> > truc5   812     402     972
> > truc6   1200    400     970
> > bum     400     300     620
> > pres1   127     310     700
> >
> >
> > Thanks,
> >
> > Laurence.
> >
> > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> > INRA, UMR INRA/UBP Am?lioration et Sant? des Plantes
> > 234 avenue du Br?zet
> > 63039 Clermont-Ferrand Cedex 2
> >
> > Tel 04 73 62 48 37
> > Fax 04 73 62 44 53
> > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
-- 
________________________
Christopher Fields
Postdoctoral Researcher - Dept. of Biochemistry
University of Illinois at Urbana-Champaign

From lstein at cshl.edu  Fri Aug 29 15:30:57 2003
From: lstein at cshl.edu (Lincoln Stein)
Date: Fri Aug 29 15:30:25 2003
Subject: [Bioperl-l] Bio::Graphics
In-Reply-To: <1062178023.3695.110.camel@chrisfields.life.uiuc.edu>
References: <5.1.1.6.0.20030806090354.00b28208@valmont>
	<200308291139.59003.lstein@cshl.edu>
	<1062178023.3695.110.camel@chrisfields.life.uiuc.edu>
Message-ID: <200308291530.57893.lstein@cshl.edu>

Are you sure that you are using the same version of bioperl on both boxes?  
The fonts are compiled in and LANG is ignored by Bio::Graphics.

Lincoln

On Friday 29 August 2003 01:27 pm, Christopher Fields wrote:
> I tried the tutorial on RedHat Linux 9.0 and it works, but I tried it on
> my wife's IBook (Mac OSX 10.2.6) and couldn't get the labels to come up
> either.  I posted a reply here (bioperl-l) a while back about it but
> didn't get a reply.  Could it be a font problem or LANG setting?  My RH
> 9.0 system has LANG=en_US, but I think the IBook (OS X) has LANG=C
> (neither set to UTF-8; I had problems with this in the past on both
> systems).
>
> On Fri, 2003-08-29 at 10:39, Lincoln Stein wrote:
> > Sorry for responding so late to this e-mail.  You were looking at an out
> > of date tutorial that no longer matches the code base.  However, the
> > tutorial has now been updated and the examples should work.
> >
> > Lincoln
> >
> > On Wednesday 06 August 2003 03:09 am, Laurence Amilhat wrote:
> > > Hi,
> > >
> > > I try to learn how to use the module Bio::Graphics.
> > > I found he How To from Lincoln Stein on the web. I try to practice with
> > > the examples, it's working except for the labels of the features that
> > > don't appear on my figure.
> > > Does anybody ever use this module?
> > >
> > > This is the example:
> > > #!/usr/local/public/bin/perl
> > >
> > > use strict;
> > > use lib
> > > '/homej/bioinf/lamilhat/PERL_MODULE/lib/perl5/site_perl/5.005/BIOPERL/l
> > >ib/s ite_perl/5.6.1/'; use Bio::Graphics;
> > > use Bio::SeqFeature::Generic;
> > >
> > > my $panel= Bio::Graphics::Panel->new(-length =>1000,-width =>800);
> > > my $track=$panel->add_track(-glyph =>'generic',-label =>1);
> > >
> > >
> > > while (<>)
> > > {
> > >          chomp;
> > >          next if /^\#/;
> > >          my ($name,$score,$start,$end)=split /\t+/;
> > >          print STDERR "$name\n";
> > >          my $feature=
> > > Bio::SeqFeature::Generic->new(-display_name=>$name,-score=>$score,-star
> > >t=>$ start,-end=>$end); $track->add_feature($feature);
> > > }
> > >
> > > print $panel->png;
> > >
> > >
> > > And this is the Data to parse with the example:
> > > #hit    score   start   end
> > > truc1   381     2       200
> > > truc2   210     2       210
> > > truc3   800     2       200
> > > truc4   1000    380     921
> > > truc5   812     402     972
> > > truc6   1200    400     970
> > > bum     400     300     620
> > > pres1   127     310     700
> > >
> > >
> > > Thanks,
> > >
> > > Laurence.
> > >
> > > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
> > > INRA, UMR INRA/UBP Am?lioration et Sant? des Plantes
> > > 234 avenue du Br?zet
> > > 63039 Clermont-Ferrand Cedex 2
> > >
> > > Tel 04 73 62 48 37
> > > Fax 04 73 62 44 53
> > > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

-- 
========================================================================
Lincoln D. Stein                           Cold Spring Harbor Laboratory
lstein@cshl.org			                  Cold Spring Harbor, NY
========================================================================


From avilella at lycos.es  Fri Aug 29 16:49:51 2003
From: avilella at lycos.es (avilella)
Date: Fri Aug 29 16:49:52 2003
Subject: [Bioperl-l] Problem with load_seqdatabase -> Redhat9 problem
In-Reply-To: <38D196D0-97B0-11D7-BF5D-000393B4BFF6@gnf.org>
References: <38D196D0-97B0-11D7-BF5D-000393B4BFF6@gnf.org>
Message-ID: <1062190245.4812.19.camel@localhost.localdomain>

Hi,

I finally came up with the cause for the strange swissprot parsing
problem that I was having (on a Redhat9), and that it wasn't
reproducible on a different (Mandrake9.1) linux box:

It's due to the Redhat9 bad UTF-8 handling:

Michael G Schwern says:

RedHat 9 shipped with a prerelease version of Perl 5.8.1 with broken
UTF-8 handling.  If you set your LANG environment variable to something
which is not UTF8 (de_DE should work, or C) things should start working
again.
https://bugzilla.redhat.com/bugzilla/show_bug.cgi?id=87682

I solved the problem setting LANG to, for example:

export LANG=en_US

and the swissprot problem disappeared...

I hope it helps somebody,

Best regards,

Albert Vilella

P.D.: this problem affects other perl module installations, so be aware
of that...


On Fri, 2003-06-06 at 01:48, Hilmar Lapp wrote:
> Strange. Why should there be a difference I'm wondering, since they 
> both use the same module for parsing. I've downloaded sprot41 and 
> investigate as soon as I get to it. I think there was a similar report 
> not long ago that was then resolved somehow.
> 
> 	-hilmar
> 
> On Wednesday, June 4, 2003, at 07:53  AM, albert vilella wrote:
> 
> > Hi,
> >
> > I've been trying to load a swissprot dataset into a biosql database
> > using load_seqdatabase.pl, but I get an error:
> >
> > ./load_seqdatabase.pl -host localhost -dbname biosql -dbuser root
> > -dbpass '*******' -namespace bioperl -format swiss
> > /data/database/sprot41.dat
> >
> > ------------- EXCEPTION  -------------
> > MSG: swissprot stream with no ID. Not swissprot in my book
> > STACK Bio::SeqIO::swiss::next_seq
> > /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/swiss.pm:180
> > STACK toplevel ./load_seqdatabase.pl:386
> >
> > --------------------------------------
> >
> > Apparently, the next_seq subrutine gets stucked in the first entry 
> > while
> > parsing the ID field:
> >
> > swiss.pm
> > ----------------------------------------------------------------------
> >
> > $line =~ /^ID\s+([^\s_]+)(_([^\s_]+))?\s+([^\s;]+);\s+([^\s;]+);/ ||
> > $self->throw("swissprot stream with no ID. Not swissprot in my book");
> >
> > ----------------------------------------------------------------------
> >
> > This is strange because I can read the same entry in the same file 
> > with:
> >
> > #! /usr/bin/perl -w
> >
> > use strict;
> > use Bio::SeqIO;
> > use Bio::Seq;
> >
> > my $file = shift @ARGV;
> > my $in = Bio::SeqIO->new ( -file => $file,
> > 			   -format => 'swiss');
> > my $seq = $in->next_seq();
> > print "Seq: ", $seq->accession_number(), " -- ", $seq->desc(), "\n\n";
> >
> > Anybody experiencing similar problems? Any guess of what is happening?
> >
> > Thanks in advance,
> >
> > Albert Vilella
> > Molecular Evolution - Dept. Genetics
> > Universitat de Barcelona
> > <signature.asc>_______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l

From brian_osborne at cognia.com  Fri Aug 29 13:00:08 2003
From: brian_osborne at cognia.com (Brian Osborne)
Date: Fri Aug 29 17:16:06 2003
Subject: [Bioperl-l] aligning sequences with Bio::Tools::pSW
In-Reply-To: <OF66798ED0.222032FC-ON85256D91.005BD58F@sb.com>
Message-ID: <GAEDKMGOKFBLJPKCLKCCCEGNDBAA.brian_osborne@cognia.com>

Bill,

Useful snippet, thank you.

Brian O.

-----Original Message-----
From: william.j.burtle@gsk.com [mailto:william.j.burtle@gsk.com]
Sent: Friday, August 29, 2003 12:50 PM
To: Brian Osborne
Cc: Bioperl list
Subject: RE: [Bioperl-l] aligning sequences with Bio::Tools::pSW


Most of the EMBOSS tools let you specify an "aformat" flag.  See toward the
bottom of:

http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Themes/AlignFormats.html


Here is a code snippet (using 'matcher').  In this particular case, I had
specified "pair" format, and 2 alternatives (i.e., the top two hits):


  my $factory = new Bio::Factory::EMBOSS(-verbose => undef);
  my $prog = $factory->program('matcher');

  $prog->run({ '-sequencea' => Bio::Seq->new(-id => "seq1", -seq => $seq1),
               '-sequenceb' => Bio::Seq->new(-id => "seq2", -seq => $seq2),
               '-aformat'   => "pair",
               '-alternatives' => 2,
               '-outfile'   => $outfile});


## later in the program.....

  my $alignio_fmt = "emboss";
  my $align_res = new Bio::AlignIO(-format => $alignio_fmt,
                                   -file   => $outfile);




- Bill





"Brian Osborne" <brian_osborne@cognia.com>

Sent by: bioperl-l-bounces@portal.open-bio.org
29-Aug-2003 12:25



        To:        william.j.burtle@gsk.com, "Joshua Bronson"
<jbronson@acsu.buffalo.edu>

        cc:        "Bioperl list" <bioperl-l@bioperl.org>
        Subject:        RE: [Bioperl-l] aligning sequences with
Bio::Tools::pSW


Bill,

AlignIO does stretcher too? Cool. So that means water, needle, and stretcher
have the same output format. Are there any others in the EMBOSS suite with
this output format?

Thanks again,

Brian O.

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of
william.j.burtle@gsk.com
Sent: Friday, August 29, 2003 7:56 AM
To: Joshua Bronson
Cc: Bioperl list
Subject: Re: [Bioperl-l] aligning sequences with Bio::Tools::pSW

Joshua,

you might also try the EMBOSS tools (particularly stretcher and needle):
http://www.emboss.org/

and the bioperl interface:
http://doc.bioperl.org/releases/bioperl-1.2/Bio/Factory/EMBOSS.html

- Bill Burtle







"Aaron J Mackey" <ajm6q@virginia.edu>

Sent by: bioperl-l-bounces@portal.open-bio.org
29-Aug-2003 07:41
Please respond to "Aaron J. Mackey" <amackey@virginia.edu>




       To:     "Joshua Bronson" <jbronson@acsu.buffalo.edu>

       cc:     "Bioperl list" <bioperl-l@bioperl.org>
       Subject:        Re: [Bioperl-l] aligning sequences with
Bio::Tools::pSW


pSW.pm is an implementation of the Smith-Waterman algorithm, a *local*
pairwise alignment algorithm, which means that the best alignment found
need not start and finish at the beginning and ending of either sequence.
You seem to want a *global* alignment algorithm, such as Needleman-Wunsch
(with "free" end-gap penalties for globally aligning the larger sequence:
this is how to achieve hybrid local/global pairwise alignments); ClustalW
should be able to give you what you need.

-Aaron

On Thu, 28 Aug 2003, Joshua Bronson wrote:

> I'm interested in the a portion of some virus polyproteins. To find
> the portion, I'm aligning the polyprotein against other known
> proteins. I want the computer to give me a best guess and align the
> smaller protein end-to-end, but currently it's not doing that. It will
> only give me portions of the protein that align strongly. None of the
> proteins are aligning end-to-end, unless I align a protein against
> itself.
>
> Bio::Tools:pSW is what I'm using currently. Bioperl doesn't seem to
> have an interface to do pairwise alignments with Clustalw, and I'm
> experiencing problems using standalone blast. Anyone have any ideas?
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Aaron J Mackey
Pearson Laboratory
University of Virginia
(434) 924-2821
amackey@virginia.edu


_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l




_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l



From william.j.burtle at gsk.com  Fri Aug 29 12:50:21 2003
From: william.j.burtle at gsk.com (william.j.burtle@gsk.com)
Date: Fri Aug 29 17:16:34 2003
Subject: [Bioperl-l] aligning sequences with Bio::Tools::pSW
Message-ID: <OF66798ED0.222032FC-ON85256D91.005BD58F@sb.com>

Most of the EMBOSS tools let you specify an "aformat" flag.  See toward 
the bottom of:

http://www.hgmp.mrc.ac.uk/Software/EMBOSS/Themes/AlignFormats.html


Here is a code snippet (using 'matcher').  In this particular case, I had 
specified "pair" format, and 2 alternatives (i.e., the top two hits):


  my $factory = new Bio::Factory::EMBOSS(-verbose => undef);
  my $prog = $factory->program('matcher');

  $prog->run({ '-sequencea' => Bio::Seq->new(-id => "seq1", -seq => 
$seq1),
               '-sequenceb' => Bio::Seq->new(-id => "seq2", -seq => 
$seq2),
               '-aformat'   => "pair",
               '-alternatives' => 2,
               '-outfile'   => $outfile});


## later in the program.....

  my $alignio_fmt = "emboss";
  my $align_res = new Bio::AlignIO(-format => $alignio_fmt,
                                   -file   => $outfile);




- Bill






"Brian Osborne" <brian_osborne@cognia.com>

Sent by: bioperl-l-bounces@portal.open-bio.org
29-Aug-2003 12:25

 
 

        To:     william.j.burtle@gsk.com, "Joshua Bronson" <jbronson@acsu.buffalo.edu>

        cc:     "Bioperl list" <bioperl-l@bioperl.org>
        Subject:        RE: [Bioperl-l] aligning sequences with Bio::Tools::pSW

Bill,

AlignIO does stretcher too? Cool. So that means water, needle, and 
stretcher
have the same output format. Are there any others in the EMBOSS suite with
this output format?

Thanks again,

Brian O.

-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of
william.j.burtle@gsk.com
Sent: Friday, August 29, 2003 7:56 AM
To: Joshua Bronson
Cc: Bioperl list
Subject: Re: [Bioperl-l] aligning sequences with Bio::Tools::pSW

Joshua,

you might also try the EMBOSS tools (particularly stretcher and needle):
http://www.emboss.org/

and the bioperl interface:
http://doc.bioperl.org/releases/bioperl-1.2/Bio/Factory/EMBOSS.html

- Bill Burtle







"Aaron J Mackey" <ajm6q@virginia.edu>

Sent by: bioperl-l-bounces@portal.open-bio.org
29-Aug-2003 07:41
Please respond to "Aaron J. Mackey" <amackey@virginia.edu>




        To:     "Joshua Bronson" <jbronson@acsu.buffalo.edu>

        cc:     "Bioperl list" <bioperl-l@bioperl.org>
        Subject:        Re: [Bioperl-l] aligning sequences with
Bio::Tools::pSW


pSW.pm is an implementation of the Smith-Waterman algorithm, a *local*
pairwise alignment algorithm, which means that the best alignment found
need not start and finish at the beginning and ending of either sequence.
You seem to want a *global* alignment algorithm, such as Needleman-Wunsch
(with "free" end-gap penalties for globally aligning the larger sequence:
this is how to achieve hybrid local/global pairwise alignments); ClustalW
should be able to give you what you need.

-Aaron

On Thu, 28 Aug 2003, Joshua Bronson wrote:

> I'm interested in the a portion of some virus polyproteins. To find
> the portion, I'm aligning the polyprotein against other known
> proteins. I want the computer to give me a best guess and align the
> smaller protein end-to-end, but currently it's not doing that. It will
> only give me portions of the protein that align strongly. None of the
> proteins are aligning end-to-end, unless I align a protein against
> itself.
>
> Bio::Tools:pSW is what I'm using currently. Bioperl doesn't seem to
> have an interface to do pairwise alignments with Clustalw, and I'm
> experiencing problems using standalone blast. Anyone have any ideas?
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
 Aaron J Mackey
 Pearson Laboratory
 University of Virginia
 (434) 924-2821
 amackey@virginia.edu


_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l




_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l



From rpraca1 at yahoo.com  Sun Aug 31 05:00:38 2003
From: rpraca1 at yahoo.com (Resume)
Date: Sun Aug 31 08:00:10 2003
Subject: [Bioperl-l] Engineer
Message-ID: <200308311200.h7VC01fg021186@localhost.localdomain>



OBJECTIVE: 			


Richard's 	Resume	 for Job, 	Consulting or Service


	Sr.  MECHANICAL  &  DESIGN    ENGINEER


Project Mgr, Electro-Mechanical Design, Mfg, Product Development, R&D, CADD


Tel: ( 408)  309-7006 	rpraca9@yahoo.com


EXPERIENCE:


08/93-present          Sr. MECHANICAL & DESIGN ENGINEER, CADD Mgr "Mech-Tronic" 

                   
Engineering, Design & Product Development Service; Project Management, Mfg, Tooling, Product Improvement; Developing Working Product, Design and Prototype Production;  Controlling & Managing testing,  redesign, manufacturing documentation preparation;  and full realization of Task using technical approach, schedules,  and budget to achieve Final Product.  Selecting vendors and specialist to supply performance  satisfying customers expectation and to create a new, modern product with advanced properties, quality and market desirable working abilities and sellable values.

Preparing propositions & presentations, Review Manufacturing Process and Quality Control, Inspecting standards, Engineering Computations and Technical Improvements,  Supplying and Production Automation. Project Management & Development. Preparing technical documentation, calculations, engineering, design, layouts, drawings, 3D and Solid Modeling, development & propositions. Hard Drive Design, testing, balancing, recalculating and redesign. Manufacturing and Assembly Equipment design and build.  Systems Integration.

Tooling and Operations Development, Implementation & Automation for mass production.  Energy, Electric Vehicles and Computerized Transportation System Design & Implement. Solar Panels. Solid Works, Pro-E, CAD Management and Operations, Analyzing, Micro Station, ACAD 10-2002 & LT, Win 3x & 2000', Net, Internet, Softdesk, Structural Design. Network, Security, Electrical Design & Installations; Commercial, Industrial, Residential, Fire Alarms, Smoke Detectors, Lights, Plugs, Panels, Power Supply,  Electro - Solar Installations, CADD automation. Dynamics, Kinematics, thermodynamics / heat transfer & FEA analyzing.

Manufacturing hydraulic & pneumatic equipment, machinery and control systems, mechanisms, robotics device, precision machine elements.  Inspecting and control manufacturing standards, analyzing stresses and tolerances, selecting materials, engineering computations and technical improvements, documentation, projects development, supplying.  Automation, Conveyors, Spiral Elevator, Fast Cannery Transportation, Electronic and Electrical Components, Master Control Center, Sheet Metal Oven Rebuilding Project. 

Power Systems, UPS. Automation equipment and machine control using for machines and robotics precision mechanisms motion programming, fluid mechanics, pneumatics systems, mounting and positioning devices, electro-mechanical and vacuum mechanisms, design and analysis of structures, castings, welded frames, mechanical detailing. Computers: DOS, SUN UNIX, MAC, WP, dB, Lotus, Network, Windows & Applications; MS Project, Excel, Access, Word, PFS, Graphics, CAD / CAM, Excel, Basic, C, Fortran, Analyzes. CADD systems, Algor, VAX, Net.  MCAD, Acad's 2002 & Softdesk, Script, Nastran, Infusoft, LAN, Tektronix, Cadkey,  Lisp, Personal Designer, ACAD / Computer Instructor, 

Machine Design, Robotics & Automation, WIND, SOLAR, METRIC.


EDUCATION:

Institute for Business & Technology, California
CADD Engineer,  Programming,  Design,  Management

Electro - Mechanical  College
Mechanical Engineering - BSME,   ASEE,  MBA


Open for Travel  *  Salary open *  Permanent  preferred  or Consulting


From rpraca1 at yahoo.com  Sun Aug 31 05:00:38 2003
From: rpraca1 at yahoo.com (Resume)
Date: Sun Aug 31 08:00:28 2003
Subject: [Bioperl-l] Engineer
Message-ID: <200308311200.h7VC01fg021185@localhost.localdomain>



OBJECTIVE: 			


Richard's 	Resume	 for Job, 	Consulting or Service


	Sr.  MECHANICAL  &  DESIGN    ENGINEER


Project Mgr, Electro-Mechanical Design, Mfg, Product Development, R&D, CADD


Tel: ( 408)  309-7006 	rpraca9@yahoo.com


EXPERIENCE:


08/93-present          Sr. MECHANICAL & DESIGN ENGINEER, CADD Mgr "Mech-Tronic" 

                   
Engineering, Design & Product Development Service; Project Management, Mfg, Tooling, Product Improvement; Developing Working Product, Design and Prototype Production;  Controlling & Managing testing,  redesign, manufacturing documentation preparation;  and full realization of Task using technical approach, schedules,  and budget to achieve Final Product.  Selecting vendors and specialist to supply performance  satisfying customers expectation and to create a new, modern product with advanced properties, quality and market desirable working abilities and sellable values.

Preparing propositions & presentations, Review Manufacturing Process and Quality Control, Inspecting standards, Engineering Computations and Technical Improvements,  Supplying and Production Automation. Project Management & Development. Preparing technical documentation, calculations, engineering, design, layouts, drawings, 3D and Solid Modeling, development & propositions. Hard Drive Design, testing, balancing, recalculating and redesign. Manufacturing and Assembly Equipment design and build.  Systems Integration.

Tooling and Operations Development, Implementation & Automation for mass production.  Energy, Electric Vehicles and Computerized Transportation System Design & Implement. Solar Panels. Solid Works, Pro-E, CAD Management and Operations, Analyzing, Micro Station, ACAD 10-2002 & LT, Win 3x & 2000', Net, Internet, Softdesk, Structural Design. Network, Security, Electrical Design & Installations; Commercial, Industrial, Residential, Fire Alarms, Smoke Detectors, Lights, Plugs, Panels, Power Supply,  Electro - Solar Installations, CADD automation. Dynamics, Kinematics, thermodynamics / heat transfer & FEA analyzing.

Manufacturing hydraulic & pneumatic equipment, machinery and control systems, mechanisms, robotics device, precision machine elements.  Inspecting and control manufacturing standards, analyzing stresses and tolerances, selecting materials, engineering computations and technical improvements, documentation, projects development, supplying.  Automation, Conveyors, Spiral Elevator, Fast Cannery Transportation, Electronic and Electrical Components, Master Control Center, Sheet Metal Oven Rebuilding Project. 

Power Systems, UPS. Automation equipment and machine control using for machines and robotics precision mechanisms motion programming, fluid mechanics, pneumatics systems, mounting and positioning devices, electro-mechanical and vacuum mechanisms, design and analysis of structures, castings, welded frames, mechanical detailing. Computers: DOS, SUN UNIX, MAC, WP, dB, Lotus, Network, Windows & Applications; MS Project, Excel, Access, Word, PFS, Graphics, CAD / CAM, Excel, Basic, C, Fortran, Analyzes. CADD systems, Algor, VAX, Net.  MCAD, Acad's 2002 & Softdesk, Script, Nastran, Infusoft, LAN, Tektronix, Cadkey,  Lisp, Personal Designer, ACAD / Computer Instructor, 

Machine Design, Robotics & Automation, WIND, SOLAR, METRIC.


EDUCATION:

Institute for Business & Technology, California
CADD Engineer,  Programming,  Design,  Management

Electro - Mechanical  College
Mechanical Engineering - BSME,   ASEE,  MBA


Open for Travel  *  Salary open *  Permanent  preferred  or Consulting


From wes.barris at csiro.au  Sun Aug 31 18:49:19 2003
From: wes.barris at csiro.au (Wes Barris)
Date: Sun Aug 31 18:48:25 2003
Subject: [Bioperl-l] ace to msf format?
In-Reply-To: <GAEDKMGOKFBLJPKCLKCCOEGJDBAA.brian_osborne@cognia.com>
References: <GAEDKMGOKFBLJPKCLKCCOEGJDBAA.brian_osborne@cognia.com>
Message-ID: <3F527B6F.5030206@csiro.au>

Brian Osborne wrote:

> Wes,
> 
> I don't think this is possible in Bioperl. To put it more generally, AlignIO
> can't accommodate Assembly objects currently. AlignIO is the module that
> takes in a variety of alignment formats and interconverts them, analogous to
> SeqIO. I'll be corrected if I'm wrong.
> 
> Brian O.

I am kind of new to this so I could be wrong but isn't an Assembly a group
of alignments?  So, from one assemble, a group of alignments could be
generated?

> 
> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org
> [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Wes Barris
> Sent: Thursday, August 28, 2003 7:58 PM
> To: Bioperl Mailing List
> Subject: [Bioperl-l] ace to msf format?
> 
> Can anyone give me a hint as to how I could use bioperl to read in
> an ACE assembly and write out an MSF formatted alignment?  This shows
> what I have figured out so far:
> 
> #!/usr/local/bin/perl -w
> #
> use strict;
> use Bio::Assembly::IO;
> #
> my $usage = "Usage: $0 <infile.ace>\n";
> my $infile = shift or die $usage;
> 
> my $io = new Bio::Assembly::IO(-file=>$infile, -format=>'ace');
> my $assembly = $io->next_assembly;
> 
> my $aln = $assembly->all_contigs();
> 
> --
> Wes Barris
> E-Mail: Wes.Barris@csiro.au
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 


-- 
Wes Barris
E-Mail: Wes.Barris@csiro.au

From jason at cgt.duhs.duke.edu  Sun Aug 31 22:28:43 2003
From: jason at cgt.duhs.duke.edu (Jason Stajich)
Date: Sun Aug 31 22:05:06 2003
Subject: [Bioperl-l] ace to msf format?
In-Reply-To: <3F527B6F.5030206@csiro.au>
References: <GAEDKMGOKFBLJPKCLKCCOEGJDBAA.brian_osborne@cognia.com>
	<3F527B6F.5030206@csiro.au>
Message-ID: <Pine.LNX.4.50.0308312218520.15179-100000@tenero.duhs.duke.edu>

Each Contig is a Bio::Align::AlignI - so in theory you can manipulate
them as if they are Bio::SimpleAlign objects.  Robson can clarify if there
are any caveats there.


But you want to do this to have access to each contig in the scaffold:
foreach my $contig ( $scaffold->all_contigs ) {
 # process Bio::Assembly::Contig object here
}

Your code below is calling it in scalar context which will just have $aln
being set to the length of the returned array.

-jason

On Mon, 1 Sep 2003, Wes Barris wrote:

> Brian Osborne wrote:
>
> > Wes,
> >
> > I don't think this is possible in Bioperl. To put it more generally, AlignIO
> > can't accommodate Assembly objects currently. AlignIO is the module that
> > takes in a variety of alignment formats and interconverts them, analogous to
> > SeqIO. I'll be corrected if I'm wrong.
> >
> > Brian O.
>
> I am kind of new to this so I could be wrong but isn't an Assembly a group
> of alignments?  So, from one assemble, a group of alignments could be
> generated?
>
> >
> > -----Original Message-----
> > From: bioperl-l-bounces@portal.open-bio.org
> > [mailto:bioperl-l-bounces@portal.open-bio.org]On Behalf Of Wes Barris
> > Sent: Thursday, August 28, 2003 7:58 PM
> > To: Bioperl Mailing List
> > Subject: [Bioperl-l] ace to msf format?
> >
> > Can anyone give me a hint as to how I could use bioperl to read in
> > an ACE assembly and write out an MSF formatted alignment?  This shows
> > what I have figured out so far:
> >
> > #!/usr/local/bin/perl -w
> > #
> > use strict;
> > use Bio::Assembly::IO;
> > #
> > my $usage = "Usage: $0 <infile.ace>\n";
> > my $infile = shift or die $usage;
> >
> > my $io = new Bio::Assembly::IO(-file=>$infile, -format=>'ace');
> > my $assembly = $io->next_assembly;
> >
> > my $aln = $assembly->all_contigs();
> >
> > --
> > Wes Barris
> > E-Mail: Wes.Barris@csiro.au
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
>
>
>

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu