Bioperl: Bio::Root::RootI::_rearrange

James Gilbert jgrg@sanger.ac.uk
Tue, 6 Jun 2000 14:40:05 +0100 (BST)



The Bio::Root::RootI::_rearrange method, which is
used to parse arguments like:

	$obj = Class->new(
	    -id => 'foo',
	    -seq => 'acatgctagagctagcatcgacgatg',
	    );

doesn't do anything if you pass invalid options
(if, for example, "seq" isn't a valid option for
the "new" method above).  I think it should throw
an exception.  Does anyone object if I add this?
I can't see that it will break anything, unless
someone relies on this behaviour.

	James

James G.R. Gilbert
The Sanger Centre
Wellcome Trust Genome Campus
Hinxton
Cambridge                        Tel: 01223 494906
CB10 1SA                         Fax: 01223 494919

=========== Bioperl Project Mailing List Message Footer =======
Project URL: http://bio.perl.org/
For info about how to (un)subscribe, where messages are archived, etc:
http://www.techfak.uni-bielefeld.de/bcd/Perl/Bio/vsns-bcd-perl.html
====================================================================