From cjfields at dev.open-bio.org Sun Sep 2 18:46:08 2007 From: cjfields at dev.open-bio.org (Christopher John Fields) Date: Sun, 02 Sep 2007 22:46:08 +0000 Subject: [Bioperl-guts-l] bioperl-db/t 12ontology.t,1.2,1.3 Message-ID: <200709022246.l82Mk82A009231@dev.open-bio.org> Update of /home/repository/bioperl/bioperl-db/t In directory dev.open-bio.org:/tmp/cvs-serv9196/t Modified Files: 12ontology.t Log Message: some fixes related to bioperl-live Ontology fixes Index: 12ontology.t =================================================================== RCS file: /home/repository/bioperl/bioperl-db/t/12ontology.t,v retrieving revision 1.2 retrieving revision 1.3 diff -C2 -d -r1.2 -r1.3 *** 12ontology.t 20 Aug 2005 01:17:15 -0000 1.2 --- 12ontology.t 2 Sep 2007 22:46:06 -0000 1.3 *************** *** 92,97 **** # dbxrefs (this version of SOFA doesn't come with any dbxrefs) $term->add_synonym("junk DNA"); ! $term->add_dblink(Bio::Annotation::DBLink->new(-database => "MYDB", ! -primary_id => "yaddayadda")); ok ($term->store()); $term = $term->adaptor->find_by_primary_key($term->primary_key); --- 92,98 ---- # dbxrefs (this version of SOFA doesn't come with any dbxrefs) $term->add_synonym("junk DNA"); ! my $linkobj = Bio::Annotation::DBLink->new(-database => "MYDB", ! -primary_id => "yaddayadda"); ! $term->add_dbxref(-dbxrefs => [$linkobj]); ok ($term->store()); $term = $term->adaptor->find_by_primary_key($term->primary_key); *************** *** 101,105 **** ok (scalar(@syns), 2); ok (scalar(grep { $_ eq "junk DNA"; } @syns), 1); ! ok (scalar($term->get_dblinks()), 1); # --- 102,106 ---- ok (scalar(@syns), 2); ok (scalar(grep { $_ eq "junk DNA"; } @syns), 1); ! ok (scalar($term->get_dbxrefs()), 1); # From cjfields at dev.open-bio.org Sun Sep 2 18:46:08 2007 From: cjfields at dev.open-bio.org (Christopher John Fields) Date: Sun, 02 Sep 2007 22:46:08 +0000 Subject: [Bioperl-guts-l] bioperl-db/Bio/DB/BioSQL TermAdaptor.pm, 1.12, 1.13 Message-ID: <200709022246.l82Mk8VM009228@dev.open-bio.org> Update of /home/repository/bioperl/bioperl-db/Bio/DB/BioSQL In directory dev.open-bio.org:/tmp/cvs-serv9196/Bio/DB/BioSQL Modified Files: TermAdaptor.pm Log Message: some fixes related to bioperl-live Ontology fixes Index: TermAdaptor.pm =================================================================== RCS file: /home/repository/bioperl/bioperl-db/Bio/DB/BioSQL/TermAdaptor.pm,v retrieving revision 1.12 retrieving revision 1.13 diff -C2 -d -r1.12 -r1.13 *** TermAdaptor.pm 4 Jul 2006 22:23:12 -0000 1.12 --- TermAdaptor.pm 2 Sep 2007 22:46:05 -0000 1.13 *************** *** 278,282 **** # we also possibly have db-xrefs to store my $dbladp = $self->db->get_object_adaptor("Bio::Annotation::DBLink"); ! foreach my $dbl ($obj->get_dblinks()) { # terms store dblinks as flat strings currently if(!ref($dbl)) { --- 278,282 ---- # we also possibly have db-xrefs to store my $dbladp = $self->db->get_object_adaptor("Bio::Annotation::DBLink"); ! foreach my $dbl ($obj->get_dbxrefs()) { # terms store dblinks as flat strings currently if(!ref($dbl)) { From cjfields at dev.open-bio.org Sun Sep 2 19:09:03 2007 From: cjfields at dev.open-bio.org (Christopher John Fields) Date: Sun, 02 Sep 2007 23:09:03 +0000 Subject: [Bioperl-guts-l] bioperl-db/t 12ontology.t,1.3,1.4 Message-ID: <200709022309.l82N93g4009293@dev.open-bio.org> Update of /home/repository/bioperl/bioperl-db/t In directory dev.open-bio.org:/tmp/cvs-serv9268/t Modified Files: 12ontology.t Log Message: more similar to original test Index: 12ontology.t =================================================================== RCS file: /home/repository/bioperl/bioperl-db/t/12ontology.t,v retrieving revision 1.3 retrieving revision 1.4 diff -C2 -d -r1.3 -r1.4 *** 12ontology.t 2 Sep 2007 22:46:06 -0000 1.3 --- 12ontology.t 2 Sep 2007 23:09:01 -0000 1.4 *************** *** 92,98 **** # dbxrefs (this version of SOFA doesn't come with any dbxrefs) $term->add_synonym("junk DNA"); ! my $linkobj = Bio::Annotation::DBLink->new(-database => "MYDB", ! -primary_id => "yaddayadda"); ! $term->add_dbxref(-dbxrefs => [$linkobj]); ok ($term->store()); $term = $term->adaptor->find_by_primary_key($term->primary_key); --- 92,97 ---- # dbxrefs (this version of SOFA doesn't come with any dbxrefs) $term->add_synonym("junk DNA"); ! $term->add_dbxref(-dbxrefs => [Bio::Annotation::DBLink->new(-database => "MYDB", ! -primary_id => "yaddayadda")]); ok ($term->store()); $term = $term->adaptor->find_by_primary_key($term->primary_key); From bugzilla-daemon at portal.open-bio.org Sun Sep 2 19:37:52 2007 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon at portal.open-bio.org) Date: Sun, 2 Sep 2007 19:37:52 -0400 Subject: [Bioperl-guts-l] [Bug 2355] New: recursion issues in bioperl-db tests Message-ID: http://bugzilla.open-bio.org/show_bug.cgi?id=2355 Summary: recursion issues in bioperl-db tests Product: BioPerl Version: main-trunk Platform: Macintosh OS/Version: MacOS X Status: NEW Severity: critical Priority: P2 Component: bioperl-db AssignedTo: bioperl-guts-l at bioperl.org ReportedBy: cjfields at uiuc.edu Using Mac OX X 10.4 (Intel), MySQL 5.0.41, bioperl-live (post-feature/annotation rollback). bioperl-db tests are showing serious recursion issues which seem to be related to Bio::Species/Bio::Taxon. If anyone can replicate this on other OS's please report. Attached are the relevant tests showing the error, using: ./Build tests --test-files t/xxtestfile.t --verbose The general errors that seems to be popping up is similar to: --------------------- WARNING --------------------- MSG: recursion detected for Bio::Taxon object STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:681 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:630 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:692 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:630 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:587 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:678 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:630 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:587 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:678 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:630 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:587 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:678 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:630 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:587 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:678 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:630 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:587 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:678 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:630 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:587 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:678 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:630 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:587 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:678 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:630 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:587 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:678 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:630 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:587 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:678 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:630 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:587 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:678 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:630 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:587 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:678 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:630 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:587 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:678 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:630 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:587 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:659 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:630 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create_persistent /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:587 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::store /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:253 STACK Bio::DB::BioSQL::PrimarySeqAdaptor::store_children /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/PrimarySeqAdaptor.pm:229 STACK Bio::DB::BioSQL::SeqAdaptor::store_children /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/SeqAdaptor.pm:217 STACK Bio::DB::BioSQL::BasePersistenceAdaptor::create /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm:214 STACK Bio::DB::Persistent::PersistentObject::create /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/Persistent/PersistentObject.pm:244 STACK toplevel t/04swiss.t:36 --------------------------------------------------- or : Deep recursion on subroutine "Bio::DB::BioSQL::BasePersistenceAdaptor::_create_persistent" at /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm line 587, line 1. Deep recursion on subroutine "Bio::DB::BioSQL::BasePersistenceAdaptor::_process_child" at /Users/cjfields/src/core/bioperl-db/blib/lib/Bio/DB/BioSQL/BasePersistenceAdaptor.pm line 630, line 1. swiss.t tests throw these warnings but eventually pass, however 15cluster.t and 13remove.t both appear to infinitely recurse. -- Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Sun Sep 2 19:40:23 2007 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon at portal.open-bio.org) Date: Sun, 2 Sep 2007 19:40:23 -0400 Subject: [Bioperl-guts-l] [Bug 2355] recursion issues in bioperl-db tests In-Reply-To: Message-ID: <200709022340.l82NeNwQ021409@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=2355 ------- Comment #1 from cjfields at uiuc.edu 2007-09-02 19:40 EST ------- Created an attachment (id=745) --> (http://bugzilla.open-bio.org/attachment.cgi?id=745&action=view) archive with test results test results from 04swiss.t, 13remove.t, 15cluster.t -- Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Sun Sep 2 21:43:02 2007 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon at portal.open-bio.org) Date: Sun, 2 Sep 2007 21:43:02 -0400 Subject: [Bioperl-guts-l] [Bug 2355] recursion issues in bioperl-db tests In-Reply-To: Message-ID: <200709030143.l831h2cM028671@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=2355 cjfields at uiuc.edu changed: What |Removed |Added ---------------------------------------------------------------------------- Status|NEW |RESOLVED Resolution| |INVALID ------- Comment #2 from cjfields at uiuc.edu 2007-09-02 21:43 EST ------- Invalid. A fresh CVS live/db installation and removing old bioperl installations cleared up the problem. -- Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From cjfields at dev.open-bio.org Sun Sep 2 21:45:37 2007 From: cjfields at dev.open-bio.org (Christopher John Fields) Date: Mon, 03 Sep 2007 01:45:37 +0000 Subject: [Bioperl-guts-l] bioperl-live/Bio/Index Blast.pm,1.31,1.32 Message-ID: <200709030145.l831jb5n009461@dev.open-bio.org> Update of /home/repository/bioperl/bioperl-live/Bio/Index In directory dev.open-bio.org:/tmp/cvs-serv9436/Bio/Index Modified Files: Blast.pm Log Message: doc fixes Index: Blast.pm =================================================================== RCS file: /home/repository/bioperl/bioperl-live/Bio/Index/Blast.pm,v retrieving revision 1.31 retrieving revision 1.32 diff -C2 -d -r1.31 -r1.32 *** Blast.pm 20 Aug 2007 11:21:02 -0000 1.31 --- Blast.pm 3 Sep 2007 01:45:35 -0000 1.32 *************** *** 41,44 **** --- 41,61 ---- This object allows one to build an index on a blast file (or files) and provide quick access to the blast report for that accession. + + This also allows for ID parsing using a callback: + + $inx->id_parser(\&get_id); + # make the index + $inx->make_index($file_name); + + # here is where the retrieval key is specified + sub get_id { + my $line = shift; + $line =~ /^>.+gi\|(\d+)/; + $1; + } + + The indexer is capable of indexing based on multiple IDs passed back from the + callback; this is assuming of course all IDs are unique. + Note: for best results 'use strict'. From bugzilla-daemon at portal.open-bio.org Sun Sep 2 21:46:30 2007 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon at portal.open-bio.org) Date: Sun, 2 Sep 2007 21:46:30 -0400 Subject: [Bioperl-guts-l] [Bug 2123] Add id_parser() method to Bio::Index::Blast In-Reply-To: Message-ID: <200709030146.l831kUmu028865@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=2123 cjfields at uiuc.edu changed: What |Removed |Added ---------------------------------------------------------------------------- Status|NEW |RESOLVED Resolution| |FIXED ------- Comment #1 from cjfields at uiuc.edu 2007-09-02 21:46 EST ------- I made some significant changes to Bio::Index::Blast to speed up indexing and added this method in. Closing out... -- Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Sun Sep 2 22:33:17 2007 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon at portal.open-bio.org) Date: Sun, 2 Sep 2007 22:33:17 -0400 Subject: [Bioperl-guts-l] [Bug 2165] Bio::SeqIO does not write correct taxonomy data in SwissProt format In-Reply-To: Message-ID: <200709030233.l832XHKl030968@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=2165 ------- Comment #5 from cjfields at uiuc.edu 2007-09-02 22:33 EST ------- (In reply to comment #3) > Hi Chris, > > ... > Still, the formatting should (imho) be corrected; the specs of SwissProt do not > exclude the presence of "OS" alone (i.e. without "OC"). Note the table located here (after the sample record): http://ca.expasy.org/sprot/userman.html#entrystruc excerpt: ... GN Gene name(s) Optional OS Organism species Once OG Organelle Optional OC Organism classification Once or more ... The OS/OC lines are not 'optional'. As mentioned before, any organism with a common_name() should be accompanied by a valid scientific_name() or it isn't a completely valid Bio::Species object. We'll consider adding an exception/warning to the various write_seq() methods if an incomplete Bio::Species is used, but we won't fix output (GIGO applies here). -- Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Sun Sep 2 22:34:43 2007 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon at portal.open-bio.org) Date: Sun, 2 Sep 2007 22:34:43 -0400 Subject: [Bioperl-guts-l] [Bug 2184] segmentation error during BioPerl 1.5.2 installation In-Reply-To: Message-ID: <200709030234.l832YhPx031031@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=2184 ------- Comment #12 from cjfields at uiuc.edu 2007-09-02 22:34 EST ------- cecile, We'll give a couple more weeks for a response or we'll have to mark this as fixed. -- Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Mon Sep 3 01:26:38 2007 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon at portal.open-bio.org) Date: Mon, 3 Sep 2007 01:26:38 -0400 Subject: [Bioperl-guts-l] [Bug 2281] unable to copy a sequence from one namespace to another one In-Reply-To: Message-ID: <200709030526.l835Qca6013727@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=2281 ------- Comment #2 from cjfields at uiuc.edu 2007-09-03 01:26 EST ------- This is a feature, I believe. Since you are retrieving a persistent object and changing the namespace, the object is then 'moved' into the changed namespace (i.e. the namespace table data is simply changed upon committing). You would probably need to create another persistent obj instance (a clone) in order to copy it to another namespace while retaining the original data in the original namespace. Not sure but you might need to guarantee any clone has a unique key when stored (not sure how those are generated). This may pertain to your previous bug as well, bug 2280. -- Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From cjfields at dev.open-bio.org Mon Sep 3 01:36:20 2007 From: cjfields at dev.open-bio.org (Christopher John Fields) Date: Mon, 03 Sep 2007 05:36:20 +0000 Subject: [Bioperl-guts-l] bioperl-db/Bio/DB/BioSQL/mysql SpeciesAdaptorDriver.pm, 1.9, 1.10 Message-ID: <200709030536.l835aKOm009720@dev.open-bio.org> Update of /home/repository/bioperl/bioperl-db/Bio/DB/BioSQL/mysql In directory dev.open-bio.org:/tmp/cvs-serv9695/Bio/DB/BioSQL/mysql Modified Files: SpeciesAdaptorDriver.pm Log Message: bug 2287 Index: SpeciesAdaptorDriver.pm =================================================================== RCS file: /home/repository/bioperl/bioperl-db/Bio/DB/BioSQL/mysql/SpeciesAdaptorDriver.pm,v retrieving revision 1.9 retrieving revision 1.10 diff -C2 -d -r1.9 -r1.10 *** SpeciesAdaptorDriver.pm 14 Jun 2007 15:29:15 -0000 1.9 --- SpeciesAdaptorDriver.pm 3 Sep 2007 05:36:17 -0000 1.10 *************** *** 486,490 **** " FROM $node_table node, $node_table taxon, $name_table name". " WHERE name.$fkname = node.$pkname AND". ! " taxon.left_value BETWEEN node.left_value AND node.right_value". " AND taxon.$pkname = ?". " AND name.".$slotmap->{"name_class"}." = 'scientific name'". --- 486,490 ---- " FROM $node_table node, $node_table taxon, $name_table name". " WHERE name.$fkname = node.$pkname AND". ! " taxon.left_value >= node.left_value AND taxon.left_value <= node.right_value". " AND taxon.$pkname = ?". " AND name.".$slotmap->{"name_class"}." = 'scientific name'". From bugzilla-daemon at portal.open-bio.org Mon Sep 3 01:36:46 2007 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon at portal.open-bio.org) Date: Mon, 3 Sep 2007 01:36:46 -0400 Subject: [Bioperl-guts-l] [Bug 2287] performance problem with MySQL (SpeciesAdaptorDriver::get_classification) In-Reply-To: Message-ID: <200709030536.l835akB8014857@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=2287 cjfields at uiuc.edu changed: What |Removed |Added ---------------------------------------------------------------------------- Status|NEW |RESOLVED Resolution| |FIXED ------- Comment #2 from cjfields at uiuc.edu 2007-09-03 01:36 EST ------- Committed to CVS. Sorry about the wait! -- Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Mon Sep 3 21:46:14 2007 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon at portal.open-bio.org) Date: Mon, 3 Sep 2007 21:46:14 -0400 Subject: [Bioperl-guts-l] [Bug 2213] crashes on downloading NCBI records In-Reply-To: Message-ID: <200709040146.l841kEmq020276@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=2213 ------- Comment #9 from cjfields at uiuc.edu 2007-09-03 21:46 EST ------- I have retried this using an update bioperl-live and bioperl-db and can't reproduce the error. Can you try an update? -- Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Tue Sep 4 18:02:54 2007 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon at portal.open-bio.org) Date: Tue, 4 Sep 2007 18:02:54 -0400 Subject: [Bioperl-guts-l] [Bug 2213] crashes on downloading NCBI records In-Reply-To: Message-ID: <200709042202.l84M2sVs003023@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=2213 ------- Comment #10 from samborsky_d at yahoo.com 2007-09-04 18:02 EST ------- (In reply to comment #9) > I have retried this using an update bioperl-live and bioperl-db and can't > reproduce the error. Can you try an update? > I see. I've checked that it works due to changes in Bio::Species::classification() procedure. See lines 166-167 where the if() condition was changed (became less strict: 'ne' was replaced by '!~'). Also $self->throw("The supplied lineage does not start near '$name ... was turned into $self->warn("The supplied lineage does not start near '$name ... at line 175. But I am not sure that this bug fix was correct (not just a casual consequence of if() condition improvements). Also I see that the second test case (download of old NC_001846 record) still issues the same message (but now it's a warning - not a crash, thanks to the 'throw' => 'warn' substitution made in line 175). As I wrote before, in my opinion, the origin of the problem lies somewhere deeper: in the modern DB storage scheme used for taxonomy data (apparently, this scheme design led to necessity of "massaging" tricks in the SpeciesAdaptor::populate_from_row). I'm afraid that some logic fault could still trigger some problems later. @@ -163,7 +163,8 @@ # make sure the lineage contains us as first or second element # (lineage may have subspecies, species, genus ...) my $name = $self->node_name; - if ($name && ($name ne $vals[0] && $name ne $vals[1]) && $name ne "$val + my ($genus, $species) = (quotemeta($vals[1]), quotemeta($vals[0])); + if ($name && ($name !~ m{$species}i && $name !~ m{$genus}i) && $name !~ if ($name =~ /^$vals[1] $vals[0]\s*(.+)/) { # just assume the problem is someone tried to make a Bio::Speci #*** no idea if this is appropriate! just a possible fix relate@@ -171,7 +172,7 @@ $name = $self->node_name("$vals[1] $vals[0]"); } else { - $self->throw("The supplied lineage does not start near '$name' + $self->warn("The supplied lineage does not start near '$name' ( } } -- Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Tue Sep 4 18:05:03 2007 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon at portal.open-bio.org) Date: Tue, 4 Sep 2007 18:05:03 -0400 Subject: [Bioperl-guts-l] [Bug 2213] crashes on downloading NCBI records In-Reply-To: Message-ID: <200709042205.l84M53af003253@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=2213 ------- Comment #11 from samborsky_d at yahoo.com 2007-09-04 18:05 EST ------- Sorry for the patch-like garbage at the end of my last post. -- Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From bugzilla-daemon at portal.open-bio.org Tue Sep 4 18:46:21 2007 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon at portal.open-bio.org) Date: Tue, 4 Sep 2007 18:46:21 -0400 Subject: [Bioperl-guts-l] [Bug 2213] crashes on downloading NCBI records In-Reply-To: Message-ID: <200709042246.l84MkLA6005831@portal.open-bio.org> http://bugzilla.open-bio.org/show_bug.cgi?id=2213 ------- Comment #12 from cjfields at uiuc.edu 2007-09-04 18:46 EST ------- (In reply to comment #10) > (In reply to comment #9) > > I have retried this using an update bioperl-live and bioperl-db and can't > > reproduce the error. Can you try an update? > > > > I see. I've checked that it works due to changes in > Bio::Species::classification() procedure. > See lines 166-167 where the if() condition was changed (became less strict: > 'ne' was replaced by '!~'). > > Also $self->throw("The supplied lineage does not start near '$name ... > was turned into $self->warn("The supplied lineage does not start near '$name > ... > at line 175. > > But I am not sure that this bug fix was correct (not just a casual consequence > of if() condition improvements). > > Also I see that the second test case (download of old NC_001846 record) still > issues the same message (but now it's a warning - not a crash, thanks to > the 'throw' => 'warn' substitution made in line 175). > > As I wrote before, in my opinion, the origin of the problem lies somewhere > deeper: in the modern DB storage scheme used for taxonomy data (apparently, > this scheme design led to necessity of "massaging" tricks in the > SpeciesAdaptor::populate_from_row). I'm afraid that some logic fault could > still trigger some problems later. Right, I fully agree, particularly with the last bit. I still haven't heard from any of the other devs on this (particularly Hilmar). I may check into the other Bio* projects to see what they are doing re: BioSQL. -- Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From cjfields at dev.open-bio.org Tue Sep 4 22:57:50 2007 From: cjfields at dev.open-bio.org (Christopher John Fields) Date: Wed, 05 Sep 2007 02:57:50 +0000 Subject: [Bioperl-guts-l] bioperl-live/t/data purine_v081.infernal, NONE, 1.1 Message-ID: <200709050257.l852vod1014217@dev.open-bio.org> Update of /home/repository/bioperl/bioperl-live/t/data In directory dev.open-bio.org:/tmp/cvs-serv14178/t/data Added Files: purine_v081.infernal Log Message: parses 0.81 output (still throwing a warning...) --- NEW FILE: purine_v081.infernal --- CM 1: Purine CM statistics calculated with simulation of 100 samples of length 238 Random seed: 1186083728 No partition points Using CM E cutoff of 200.00 >gi|633168|emb|X83878.1| Plus strand results: Query = 1 - 102, Target = 168 - 267 Score = 79.36, E = 1.945e-07, P = 1.945e-07, GC = 46 :::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<< 1 aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaG 60 + A A++A AA A AA:AC+C:UAUAAU::CG:G AUAUGGC:CG::AGUUUCUACC:G 168 UUACAAUAUAAUAGGAACACUCAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGG 227 <<<<_______>>>>>>>,,)))))))):::::::::::::: 61 gcaaCCGUAAAuugcCuGACUAcGaGuaAauauuaaauauuu 102 CA CCGUAAA UG C:GACUA:G+GU:A A+U A+ 228 GCA-CCGUAAA-UGUCCGACUAUGGGUGAGCAAUGGAACCGC 267 Minus strand results: Query = 1 - 102, Target = 270 - 171 Score = 2.25, E = 6.802, P = 0.9989, GC = 48 :::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<< 1 aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaG 60 + + A +:AC C:UA +::: :: UA GG :: :::GU AC: G 270 CGUGCGGUUCCAUUGCUCACCCAUA-GUCGGACAU-UUACGG-UGCCCGGUAGAAACUUG 214 <<<<_______>>>>>>>,,.)))))))):::::::::::::: 61 gcaaCCGUAAAuugcCuGAC.UAcGaGuaAauauuaaauauuu 102 ::::CC UA ::::C : UA:G GU: + U+++AUAUU 213 CGUGCCAUAUCCACGCGAUUaUAUGAGUGUUCCUAUUAUAUUG 171 >gi|2239287|gb|U51115.1|BSU51115 Plus strand results: Query = 1 - 102, Target = 11655 - 11756 Score = 81.29, E = 1.259e-07, P = 1.259e-07, GC = 38 :::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<< 1 aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaG 60 A AAAU AAA+AA A+ : CGUAUAAU::CG:GAAUAUGGC:CG::AGU UCUACCA: 11655 AGAAAUCAAAUAAGAUGAAUUCGUAUAAUCGCGGGAAUAUGGCUCGCAAGUCUCUACCAA 11714 <<<<_______>>>>>>>,,)))))))):::::::::::::: 61 gcaaCCGUAAAuugcCuGACUAcGaGuaAauauuaaauauuu 102 GC ACCGUAAAU GC:UGACUACG : AU+U +++ UUU 11715 GCUACCGUAAAUGGCUUGACUACGUAAACAUUUCUUUCGUUU 11756 Query = 1 - 102, Target = 15589 - 15691 Score = 78.40, E = 2.415e-07, P = 2.415e-07, GC = 42 :::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<< 1 aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaG 60 A+ A+A+ AAAA A :CUC:UAUAAU: :GGGAAUAUGGCCC: :AGUUUCUACC:G 15589 CAUGAAAUCAAAACACGACCUCAUAUAAUCUUGGGAAUAUGGCCCAUAAGUUUCUACCCG 15648 <<<<_______>>>>>>>,,)))).)))):::::::::::::: 61 gcaaCCGUAAAuugcCuGACUAcG.aGuaAauauuaaauauuu 102 GCAACCGUAAAUUGCC:GACUA:G AG: AA + ++ +++++ 15649 GCAACCGUAAAUUGCCGGACUAUGcAGGGAAGUGAUCGAUAAA 15691 Query = 1 - 102, Target = 13198 - 13294 Score = 5.41, E = 3.338, P = 0.9645, GC = 34 :::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<< 1 aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaG 60 +A+ +U + AAAA AA : :U:::A AA:C::::G A UGGC::::G: UUU U :: 13198 UAUCUUCUUAAAAUAAGGAAUGAAAAAACCAGCUGCAC-UGGCAGCUGGUUUUUUUUGU- 13255 <<<<_______>>>>>>>,,)))))))):::::::::::::: 61 gcaaCCGUAAAuugcCuGACUAcGaGuaAauauuaaauauuu 102 : C AA :U+++:: U:::A: : AUAU+ U +U 13256 ---UGCAAAAGAUAAAACCAUUUCAUACGAUAUACCGUCAUG 13294 Minus strand results: Query = 1 - 102, Target = 11759 - 11658 Score = 9.64, E = 1.287, P = 0.7239, GC = 38 :::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<< 1 aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaG 60 A AA+ AAA AAA+ : CGUA +::::: : UA GG: :::::GU AC: G 11759 AUCAAACGAAAGAAAUGUUUACGUA-GUCAAGCCAUUUACGGUAGCUUGGUAGAGACUUG 11701 <<<<_______>>>>>>>,,.)))))))):::::::::::::: 61 gcaaCCGUAAAuugcCuGAC.UAcGaGuaAauauuaaauauuu 102 :: :CC UA : ::C : UACG : AU UUA++U +UU 11700 CGAGCCAUAUUCCCGCGAUUaUACGAAUUCAUCUUAUUUGAUU 11658 Query = 1 - 102, Target = 15695 - 15594 Score = 7.88, E = 1.911, P = 0.8521, GC = 43 :::::::::::::::::((((((((,,.,<<<<<<<_______>>>>>>>,,,,,,,,<< 1 aAaaauaaAaaaaaaaauaCuCgUAUA.aucucgggAAUAUGGcccgagaGUuUCUACCa 59 A ++U+A A A ++ C :: AUA +:C::::: UA GG:::::G:GU AC:: 15695 CAGUUUUAUCGAUCACUUCCCUGCAUAgUCCGGCAAUUUACGGUUGCCGGGUAGAAACUU 15636 <<<<<_______>>>>>>>,,)))))))):::::::::::::: 60 GgcaaCCGUAAAuugcCuGACUAcGaGuaAauauuaaauauuu 102 +::::CC UA :::: ::A U :: G + + U++++U +UU 15635 AUGGGCCAUAUUCCCA-AGAUUAUAUGAGGUCGUGUUUUGAUU 15594 Query = 1 - 102, Target = 13846 - 13740 Score = 6.35, E = 2.7, P = 0.9328, GC = 45 :::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,..... 1 aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCU..... 55 A A+A+A A AA AA:A :::A A :C ::::A A G :::: G: UUCU 13846 CAGCAAAUACACAAGAACAACUAAAAACCCGUCAUAGAAAGCAUGAUGGCGUUCUccgaa 13787 ,,<<<<<<<_______>>>>>>>,,)))))))):::::::::::::: 56 ACCaGgcaaCCGUAAAuugcCuGACUAcGaGuaAauauuaaauauuu 102 ACC::GC :CCG : GC::G CU::: U:AA+ +A++ ++ 13786 ACCGAGCGGCCGAUUCCAGCUUGCCUUUAACUGAAACCAAUUCCCAA 13740 Query = 1 - 102, Target = 825 - 748 Score = 2.84, E = 5.952, P = 0.9974, GC = 30 :::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<< 1 aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaG 60 +AAAA+ AA AAAA A: ::C:U:U A UG C+ A A UCUAC 825 UAAAAACAACAAAAGGAGCUGCUUUUUA-----------UGCUCACACACGAUCUAC--- 780 <<<<_______>>>>>>>,,)))))))):::::::::::::: 61 gcaaCCGUAAAuugcCuGACUAcGaGuaAauauuaaauauuu 102 G AAA +AC:A:G:: :A ++UU AU+U+U 779 ----AUGAAAA------AACAAAGCAUUACAUUUCCAUUUAU 748 Query = 1 - 102, Target = 8105 - 8018 Score = 1.70, E = 7.686, P = 0.9995, GC = 36 :::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<< 1 aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaG 60 A+A A +A AA U:::AU A UAUGGC ++A+ GU UC A 8105 GAUACGGAUUACGGCAAAAGUGGCAUCA---------UAUGGCGUAAAGGUAUCAAG--- 8058 <<<<_______>>>>>>>,,)))))))):::::::::::::: 61 gcaaCCGUAAAuugcCuGACUAcGaGuaAauauuaaauauuu 102 A CGUAA U+C ACU:::A AA+A +AAA+ +++ 8057 --AAUCGUAAUAUACGCUACUGUCAUCAAAAAGAAAAACAAA 8018 Query = 1 - 102, Target = 4125 - 4023 Score = 1.38, E = 8.261, P = 0.9997, GC = 25 :::::::::::::::::((((((((,,,<<<<<<<_______.>>>.>>>>,,,,,,,,< 1 aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGG.ccc.gagaGUuUCUACC 58 AAA +AAA A A AA: :U:::AUAA :+:G:: AU U ::C :+: UUUC AC 4125 CAAACAAAACACUACAAAUUUGAAAUAAGCUGGUAUAUUUUCuUACaCGAAUUUUCGAC- 4067 <<<<<<_______>>>...>>>>,,)))))))):::::::::::::: 59 aGgcaaCCGUAAAuug...cCuGACUAcGaGuaAauauuaaauauuu 102 :AAC GUA AUU: + +GA U:::A: :A+ AU+A+AU+ + 4066 ---AAACUGUAUAUUUaugAUAGAGUUUCAAUUAUCAUAAUAUUCAG 4023 Query = 1 - 102, Target = 14215 - 14125 Score = 0.90, E = 9.203, P = 0.9999, GC = 45 :::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<< 1 aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaG 60 AA AA AA A :+ :UAUA+U: :+++ A A GG : :AGU 14215 AAGCGGAAUCAACGACGCCGUAAUAUAUUCAGAAAUAAACGG---CCAAGUCA------- 14166 <<<<_______>>>>>>>,,)))))))):::::::::::::: 61 gcaaCCGUAAAuugcCuGACUAcGaGuaAauauuaaauauuu 102 C::CCGUAAA::GC+ CUA: +: ++ U+ AA+++ + 14165 -CUGCCGUAAACAGCAGCGCUAUCGCAACUACUGCAAAUACA 14125 Query = 1 - 102, Target = 13350 - 13253 Score = 0.79, E = 9.449, P = 0.9999, GC = 37 :::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<< 1 aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaG 60 +AA UA AA A + :A +C:U: C::: AA :::G G C C:A 13350 UAAGGUACCGAACAGUCAAGUCAUU---UCCAUUUAAGUAAAGCAUGGCGGCACAUCUAC 13294 <<<<_______>>>>>>>,,)))))))):::::::::::::: 61 gcaaCCGUAAAuugcCuGACUAcGaGuaAauauuaaauauuu 102 : :AC GUA AU: : U:A :A:G+ U: AU UU++ A+ + 13293 AUGACGGUAUAUCGUAUGA-AAUGGUUUUAUCUUUUGCAACA 13253 >gi|633168|emb|X83878.1| Plus strand results: Query = 1 - 102, Target = 168 - 267 Score = 79.36, E = 1.945e-07, P = 1.945e-07, GC = 46 :::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<< 1 aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaG 60 + A A++A AA A AA:AC+C:UAUAAU::CG:G AUAUGGC:CG::AGUUUCUACC:G 168 UUACAAUAUAAUAGGAACACUCAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGG 227 <<<<_______>>>>>>>,,)))))))):::::::::::::: 61 gcaaCCGUAAAuugcCuGACUAcGaGuaAauauuaaauauuu 102 CA CCGUAAA UG C:GACUA:G+GU:A A+U A+ 228 GCA-CCGUAAA-UGUCCGACUAUGGGUGAGCAAUGGAACCGC 267 Minus strand results: Query = 1 - 102, Target = 270 - 171 Score = 2.25, E = 6.802, P = 0.9989, GC = 48 :::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<< 1 aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaG 60 + + A +:AC C:UA +::: :: UA GG :: :::GU AC: G 270 CGUGCGGUUCCAUUGCUCACCCAUA-GUCGGACAU-UUACGG-UGCCCGGUAGAAACUUG 214 <<<<_______>>>>>>>,,.)))))))):::::::::::::: 61 gcaaCCGUAAAuugcCuGAC.UAcGaGuaAauauuaaauauuu 102 ::::CC UA ::::C : UA:G GU: + U+++AUAUU 213 CGUGCCAUAUCCACGCGAUUaUAUGAGUGUUCCUAUUAUAUUG 171 // Fin From cjfields at dev.open-bio.org Tue Sep 4 22:57:50 2007 From: cjfields at dev.open-bio.org (Christopher John Fields) Date: Wed, 05 Sep 2007 02:57:50 +0000 Subject: [Bioperl-guts-l] bioperl-live/t RNA_SearchIO.t,1.6,1.7 Message-ID: <200709050257.l852voOb014219@dev.open-bio.org> Update of /home/repository/bioperl/bioperl-live/t In directory dev.open-bio.org:/tmp/cvs-serv14178/t Modified Files: RNA_SearchIO.t Log Message: parses 0.81 output (still throwing a warning...) Index: RNA_SearchIO.t =================================================================== RCS file: /home/repository/bioperl/bioperl-live/t/RNA_SearchIO.t,v retrieving revision 1.6 retrieving revision 1.7 diff -C2 -d -r1.6 -r1.7 *** RNA_SearchIO.t 29 Aug 2007 21:39:49 -0000 1.6 --- RNA_SearchIO.t 5 Sep 2007 02:57:48 -0000 1.7 *************** *** 8,12 **** use BioperlTest; ! test_begin(-tests => 326); use_ok('Bio::SearchIO'); --- 8,12 ---- use BioperlTest; ! test_begin(-tests => 496); use_ok('Bio::SearchIO'); *************** *** 340,343 **** --- 340,625 ---- is($meta, ':::::::::::::::::((((((((:::(((((((:::::::)))))))::::::::(((((((:::::::)))))))::))))))))::::::::::::::'); + ## Infernal 0.81 parsing ## + + $searchio = Bio::SearchIO->new( -format => 'infernal', + -file => test_input_file('purine_v081.infernal'), + # version is reset to the correct one by parser + -version => 0.7, + -model => 'Purine', + -query_acc => 'RF00167', + -query_desc => 'Purine riboswitch', + -database => 'b_sub.fas', + -convert_meta => 0, + -verbose => 2 + ); + + $result = $searchio->next_result; + isa_ok($result, 'Bio::Search::Result::ResultI'); + $algorithm = $result->algorithm; + is($result->algorithm, 'CMSEARCH', "Result $algorithm"); + is($result->algorithm_reference, undef, "Result $algorithm reference"); + is($result->algorithm_version, 0.81, "Result $algorithm version"); + is($result->available_parameters, 0, "Result parameters"); + is($result->available_statistics, 0, "Result statistics"); + is($result->database_entries, '', "Result entries"); + is($result->database_letters, '', "Result letters"); + is($result->database_name, 'b_sub.fas', "Result database_name"); + is($result->num_hits, 3, "Result num_hits"); + is($result->program_reference, undef, "Result program_reference"); + is($result->query_accession, 'RF00167', "Result query_accession"); + is($result->query_description, 'Purine riboswitch', "Result query_description"); + is($result->query_length, 102, "Result query_length"); + is($result->query_name, 'Purine', "Result query_name"); + + $hit = $result->next_hit; + isa_ok($hit, 'Bio::Search::Hit::HitI'); + is($hit->ncbi_gi, '633168', "Hit GI"); + is($hit->accession, 'X83878.1', "Hit accession"); + is($hit->algorithm, 'CMSEARCH', "Hit algorithm"); + is($hit->bits, 79.36, "Hit bits"); + is($hit->description, '', "Hit description"); # no hit descs yet + is($hit->locus, '', "Hit locus"); + is($hit->n, 2, "Hit n"); + is($hit->name, 'gi|633168|emb|X83878.1|', "Hit name"); + is($hit->num_hsps, 2, "Hit num_hsps"); + + # These Bio::Search::Hit::HitI methods are currently unimplemented in + # Bio::Search::Hit::ModelHit; they may be integrated over time but will require + # some reconfiguring for Model-based searches + + eval { $hit->length_aln() }; + like($@, qr'length_aln not implemented for Model-based searches', + "Hit length_aln() not implemented"); + eval {$hit->num_unaligned_hit}; + like($@, qr'num_unaligned_hit/num_unaligned_sbjct not implemented for Model-based searches', + "Hit num_unaligned_hit() not implemented"); + eval {$hit->num_unaligned_query}; + like($@, qr'num_unaligned_query not implemented for Model-based searches', + "Hit num_unaligned_query() not implemented"); + eval {$hit->num_unaligned_sbjct}; + like($@, qr'num_unaligned_hit/num_unaligned_sbjct not implemented for Model-based searches', + "Hit num_unaligned_sbjct() not implemented"); + eval {$hit->start}; + like($@, qr'start not implemented for Model-based searches','Hit start not implemented'); + eval {$hit->end}; + like($@, qr'end not implemented for Model-based searches','Hit end not implemented'); + eval {$hit->strand}; + like($@, qr'strand not implemented for Model-based searches','Hit strand not implemented'); + eval {$hit->logical_length}; + like($@, qr'logical_length not implemented for Model-based searches','Hit logical_length not implemented'); + eval {$hit->frac_aligned_hit}; + like($@, qr'frac_aligned_hit not implemented for Model-based searches','Hit frac_aligned_hit not implemented'); + eval{$hit->frac_aligned_query}; + like($@, qr'frac_aligned_query not implemented for Model-based searches','Hit frac_aligned_query not implemented'); + eval {$hit->frac_conserved}; + like($@, qr'frac_conserved not implemented for Model-based searches','Hit frac_conserved not implemented'); + eval{$hit->frac_identical}; + like($@, qr'frac_identical not implemented for Model-based searches','Hit frac_identical not implemented'); + eval{$hit->matches}; + like($@, qr'matches not implemented for Model-based searches','Hit matches not implemented'); + eval{$hit->gaps}; + like($@, qr'gaps not implemented for Model-based searches','Hit gaps not implemented'); + eval{$hit->frame}; + like($@, qr'frame not implemented for Model-based searches','Hit frame not implemented'); + eval {$hit->range}; + like($@, qr'range not implemented for Model-based searches','Hit range not implemented'); + eval {$hit->seq_inds}; + like($@, qr'seq_inds not implemented for Model-based searches','Hit seq_inds not implemented'); + + # p() works but there are no evalues yet for Infernal output, so catch and check... + eval {$hit->p}; + like($@, qr'P-value not defined. Using expect\(\) instead', + "No p values"); + + is($hit->length, 0, "Hit length"); + is($hit->overlap, 0, "Hit overlap"); + is($hit->query_length, 102, "Hit query_length"); + is($hit->rank, 1, "Hit rank"); + is($hit->raw_score, 79.36, "Hit raw_score"); + is($hit->score, 79.36, "Hit score"); + is($hit->significance, 1.945e-07, "Hit significance"); + + $hsp = $hit->next_hsp; + isa_ok($hsp, 'Bio::Search::HSP::HSPI'); + is($hsp->algorithm, 'CMSEARCH', "HSP algorithm"); + is($hsp->evalue, 1.945e-07, "HSP evalue"); + isa_ok($hsp->feature1, 'Bio::SeqFeature::Similarity'); + isa_ok($hsp->feature2, 'Bio::SeqFeature::Similarity'); + ($meta) = $hsp->feature1->get_tag_values('meta'); + is($meta, ':::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<<<<<<_______>>>>>>>,,))))))))::::::::::::::'); + ($meta) = $hsp->feature2->get_tag_values('meta'); + is($meta, ':::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<<<<<<_______>>>>>>>,,))))))))::::::::::::::'); + + is($hsp->frame, 0, "HSP frame"); + is($hsp->gaps, 2, "HSP gaps"); + is($hit->length, 0, "Hit length"); + isa_ok($hsp->get_aln, 'Bio::Align::AlignI'); + isa_ok($hsp->hit, 'Bio::SeqFeature::Similarity', "HSP hit"); + is($hsp->hit_string, + 'UUACAAUAUAAUAGGAACACUCAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCA-CCGUAAA-UGUCCGACUAUGGGUGAGCAAUGGAACCGC', + "HSP hit_string"); + is($hsp->homology_string, + '+ A A++A AA A AA:AC+C:UAUAAU::CG:G AUAUGGC:CG::AGUUUCUACC:G CA CCGUAAA UG C:GACUA:G+GU:A A+U A+ ', + "HSP homology_string"); + is($hsp->hsp_group, undef, "HSP hsp_group"); + is($hsp->hsp_length,102, "HSP hsp_length"); + is($hsp->length, 102, "HSP length"); + is($hsp->links, undef, "HSP links"); + is($hsp->n, '', "HSP n"); + is($hsp->pvalue, 1.945e-07, "HSP pvalue"); + isa_ok($hsp->query, 'Bio::SeqFeature::Similarity', "HSP query"); + is($hsp->query_string, + 'aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaGgcaaCCGUAAAuugcCuGACUAcGaGuaAauauuaaauauuu', + "HSP query_string"); + is($hsp->range, 102, "HSP range"); + is($hsp->rank, 1, "HSP rank"); + is($hsp->seq_inds, 64, "HSP seq_inds"); + is($hsp->significance, 1.945e-07, "HSP significance"); + is($hsp->end, 102, "HSP end"); + is($hsp->expect, 1.945e-07, "HSP expect"); + + # These Bio::Search::HSP::HSPI methods are currently unimplemented in + # Bio::Search::HSP::ModelHSP; they may be integrated over time but will require + # some reconfiguring for Model-based searches + + eval {$hsp->matches}; + like($@, qr'matches not implemented for Model-based searches','HSP matches not implemented'); + eval {$hsp->frac_conserved}; + like($@, qr'frac_conserved not implemented for Model-based searches','HSP frac_conserved not implemented'); + eval {$hsp->frac_identical}; + like($@, qr'frac_identical not implemented for Model-based searches','HSP frac_identical not implemented'); + eval {$hsp->num_conserved}; + like($@, qr'num_conserved not implemented for Model-based searches','HSP num_conserved not implemented'); + eval {$hsp->num_identical}; + like($@, qr'num_identical not implemented for Model-based searches','HSP num_identical not implemented'); + eval {$hsp->percent_identity}; + like($@, qr'percent_identity not implemented for Model-based searches','HSP percent_identity not implemented'); + eval {$hsp->cigar_string}; + like($@, qr'cigar_string not implemented for Model-based searches','HSP cigar_string not implemented'); + eval {$hsp->generate_cigar_string}; + like($@, qr'generate_cigar_string not implemented for Model-based searches','HSP cigar_string not implemented'); + + isa_ok($hsp->seq, 'Bio::LocatableSeq'); + is($hsp->seq_str, + 'aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaGgcaaCCGUAAAuugcCuGACUAcGaGuaAauauuaaauauuu', + "HSP seq_str"); + is($hsp->start, 1, "HSP start"); + is($hsp->custom_score, undef, "HSP custom_score"); + is($hsp->meta, + ':::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<<<<<<_______>>>>>>>,,))))))))::::::::::::::', + "HSP meta"); + is($hsp->strand, 1, "HSP strand"); + + $hsp = $hit->next_hsp; + isa_ok($hsp, 'Bio::Search::HSP::HSPI'); + is($hsp->algorithm, 'CMSEARCH', "HSP algorithm"); + is($hsp->evalue, 6.802, "HSP evalue"); + isa_ok($hsp->feature1, 'Bio::SeqFeature::Similarity'); + isa_ok($hsp->feature2, 'Bio::SeqFeature::Similarity'); + is($hsp->frame, 0, "HSP frame"); + is($hsp->gaps, 3, "HSP gaps"); + # infernal can return alignment data + isa_ok($hsp->get_aln, 'Bio::Align::AlignI'); + isa_ok($hsp->hit, 'Bio::SeqFeature::Similarity', "HSP hit"); + is($hsp->hit_string, + 'CGUGCGGUUCCAUUGCUCACCCAUA-GUCGGACAU-UUACGG-UGCCCGGUAGAAACUUGCGUGCCAUAUCCACGCGAUUaUAUGAGUGUUCCUAUUAUAUUG', + "HSP hit_string"); + is($hsp->homology_string, + ' + + A +:AC C:UA +::: :: UA GG :: :::GU AC: G::::CC UA ::::C : UA:G GU: + U+++AUAUU ', + "HSP homology_string"); + is($hsp->hsp_group, undef, "HSP hsp_group"); + is($hsp->hsp_length, 102, "HSP hsp_length"); + is($hsp->length, 102, "HSP length"); + is($hsp->links, undef, "HSP links"); + is($hsp->n, '', "HSP n"); + is($hsp->pvalue, 0.9989, "HSP pvalue"); + isa_ok($hsp->query, 'Bio::SeqFeature::Similarity', "HSP query"); + is($hsp->query_string, + 'aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaGgcaaCCGUAAAuugcCuGAC.UAcGaGuaAauauuaaauauuu', + "HSP query_string"); + is($hsp->range, 102, "HSP range"); + is($hsp->rank, 2, "HSP rank"); + is($hsp->seq_inds, 31, "HSP seq_inds"); + is($hsp->significance, 6.802, "HSP significance"); + is($hsp->end, 102, "HSP end"); + is($hsp->expect, 6.802, "HSP expect"); + #is($hsp->matches, 2, "HSP matches"); + isa_ok($hsp->seq, 'Bio::LocatableSeq'); + # this should probably default to the hit string + is($hsp->seq_str, + 'aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaGgcaaCCGUAAAuugcCuGAC.UAcGaGuaAauauuaaauauuu', + "HSP seq_str"); + is($hsp->start, 1, "HSP start"); + is($hsp->custom_score, undef, "HSP custom_score"); + is($hsp->meta, + ':::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<<<<<<_______>>>>>>>,,.))))))))::::::::::::::', + "HSP meta"); + is($hsp->strand, -1, "HSP strand"); + + # one more hit... + + $hit = $result->next_hit; + isa_ok($hit, 'Bio::Search::Hit::HitI'); + is($hit->accession, 'U51115.1', "Hit accession"); + is($hit->ncbi_gi, '2239287', "Hit GI"); + is($hit->algorithm, 'CMSEARCH', "Hit algorithm"); + is($hit->bits, 81.29, "Hit bits"); + is($hit->description, '', "Hit description"); # no hit descs yet + is($hit->length, 0, "Hit length"); + is($hit->locus, 'BSU51115', "Hit locus"); + is($hit->n, 11, "Hit n"); + is($hit->name, 'gi|2239287|gb|U51115.1|BSU51115', "Hit name"); + is($hit->num_hsps, 11, "Hit num_hsps"); + is($hit->overlap, 0, "Hit overlap"); + is($hit->query_length, 102, "Hit query_length"); + is($hit->rank, 2, "Hit rank"); + is($hit->raw_score, 81.29, "Hit raw_score"); + is($hit->score, 81.29, "Hit score"); + is($hit->significance, 1.259e-07, "Hit significance"); + + # one more HSP... + + $hsp = $hit->next_hsp; + isa_ok($hsp, 'Bio::Search::HSP::HSPI'); + is($hsp->algorithm, 'CMSEARCH', "HSP algorithm"); + is($hsp->evalue, 1.259e-07, "HSP evalue"); + isa_ok($hsp->feature1, 'Bio::SeqFeature::Similarity'); + isa_ok($hsp->feature2, 'Bio::SeqFeature::Similarity'); + is($hsp->frame, 0, "HSP frame"); + is($hsp->gaps, 0, "HSP gaps"); + isa_ok($hsp->get_aln, 'Bio::Align::AlignI'); + isa_ok($hsp->hit, 'Bio::SeqFeature::Similarity', "HSP hit"); + is($hsp->hit_string, + 'AGAAAUCAAAUAAGAUGAAUUCGUAUAAUCGCGGGAAUAUGGCUCGCAAGUCUCUACCAAGCUACCGUAAAUGGCUUGACUACGUAAACAUUUCUUUCGUUU', + "HSP hit_string"); + is($hsp->homology_string, + 'A AAAU AAA+AA A+ : CGUAUAAU::CG:GAAUAUGGC:CG::AGU UCUACCA:GC ACCGUAAAU GC:UGACUACG : AU+U +++ UUU', + "HSP homology_string"); + is($hsp->hsp_group, undef, "HSP hsp_group"); + is($hsp->hsp_length, 102, "HSP hsp_length"); + is($hsp->length, 102, "HSP length"); + is($hsp->links, undef, "HSP links"); + is($hsp->n, '', "HSP n"); + isa_ok($hsp->query, 'Bio::SeqFeature::Similarity', "HSP query"); + is($hsp->query_string, + 'aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaGgcaaCCGUAAAuugcCuGACUAcGaGuaAauauuaaauauuu', + "HSP query_string"); + is($hsp->range, 102, "HSP range"); + is($hsp->rank, 1, "HSP rank"); + is($hsp->seq_inds, 69, "HSP seq_inds"); + is($hsp->significance, 1.259e-07, "HSP significance"); + is($hsp->end, 102, "HSP end"); + is($hsp->expect, 1.259e-07, "HSP expect"); + isa_ok($hsp->seq, 'Bio::LocatableSeq'); + is($hsp->seq_str, + 'aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaGgcaaCCGUAAAuugcCuGACUAcGaGuaAauauuaaauauuu', + "HSP seq_str"); + is($hsp->start, 1, "HSP start"); + is($hsp->custom_score, undef, "HSP custom_score"); + is($hsp->meta, + ':::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<<<<<<_______>>>>>>>,,))))))))::::::::::::::', + "HSP meta"); + is($hsp->strand, 1, "HSP strand"); + #### RNAMotif #### From cjfields at dev.open-bio.org Tue Sep 4 22:57:50 2007 From: cjfields at dev.open-bio.org (Christopher John Fields) Date: Wed, 05 Sep 2007 02:57:50 +0000 Subject: [Bioperl-guts-l] bioperl-live/Bio/SearchIO infernal.pm,1.9,1.10 Message-ID: <200709050257.l852voSB014226@dev.open-bio.org> Update of /home/repository/bioperl/bioperl-live/Bio/SearchIO In directory dev.open-bio.org:/tmp/cvs-serv14178/Bio/SearchIO Modified Files: infernal.pm Log Message: parses 0.81 output (still throwing a warning...) Index: infernal.pm =================================================================== RCS file: /home/repository/bioperl/bioperl-live/Bio/SearchIO/infernal.pm,v retrieving revision 1.9 retrieving revision 1.10 diff -C2 -d -r1.9 -r1.10 *** infernal.pm 29 Aug 2007 15:01:02 -0000 1.9 --- infernal.pm 5 Sep 2007 02:57:48 -0000 1.10 *************** *** 75,79 **** 'Hsp_bit-score' => 'HSP-bits', 'Hsp_score' => 'HSP-score', ! 'Hsp_evalue' => 'HSP-evalue', # no evalues yet 'Hsp_query-from' => 'HSP-query_start', 'Hsp_query-to' => 'HSP-query_end', --- 75,80 ---- 'Hsp_bit-score' => 'HSP-bits', 'Hsp_score' => 'HSP-score', ! 'Hsp_evalue' => 'HSP-evalue', # evalues only in v0.81, optional ! 'Hsp_pvalue' => 'HSP-pvalue', # pvalues only in v0.81, optional 'Hsp_query-from' => 'HSP-query_start', 'Hsp_query-to' => 'HSP-query_end', *************** *** 94,98 **** 'Hit_accession' => 'HIT-accession', 'Hit_def' => 'HIT-description', ! 'Hit_signif' => 'HIT-significance', # no evalues yet 'Hit_score' => 'HIT-score', # best HSP bit score 'Hit_bits' => 'HIT-bits', # best HSP bit score --- 95,99 ---- 'Hit_accession' => 'HIT-accession', 'Hit_def' => 'HIT-description', ! 'Hit_signif' => 'HIT-significance', # evalues only in v0.81, optional 'Hit_score' => 'HIT-score', # best HSP bit score 'Hit_bits' => 'HIT-bits', # best HSP bit score *************** *** 212,215 **** --- 213,217 ---- unless ($self->{'_handlerset'}) { $self->_set_handler; + $self->{'_handlerset'} = 1; } return $self->_next_result; *************** *** 649,654 **** sub _set_handler { my $self = shift; - #*_next_result = \&_parse_old; - #return; my $line; while ($line = $self->_readline) { --- 651,654 ---- *************** *** 670,694 **** sub _parse_new { my ($self) = @_; - #$self->throw("Parsing of v.0.81 output not implemented yet!"); my $seentop = 0; local $/ = "\n"; ! my ($accession, $db, $algorithm, $model, $description, $version) = ($self->query_accession, $self->database, $self->algorithm, ! $self->model, $self->query_description, $self->version); ! my $maxscore; ! my $cutoff = $self->hsp_minscore; $self->start_document(); ! local ($_); ! my $line; ! my ($lasthit, $lastscore, $laststart, $lastend); ! my $hitline; PARSER: while (my $line = $self->_readline) { next if $line =~ m{^\s+$}; ! # sequence starts with > now ! # >gi|633168|emb|X83878.1| ! if ($line =~ m{CM\s\d+:}) { ! } ! if ($line =~ m{^>\s*(\S+)} ){ if (!$self->within_element('result')) { $seentop = 1; --- 670,687 ---- sub _parse_new { my ($self) = @_; my $seentop = 0; local $/ = "\n"; ! my ($accession, $db, $algorithm, $description, $version) = ($self->query_accession, $self->database, $self->algorithm, ! $self->query_description, $self->version); ! my ($maxscore, $mineval, $minpval); $self->start_document(); ! my ($lasthit, $lastscore, $lasteval, $lastpval, $laststart, $lastend); PARSER: while (my $line = $self->_readline) { next if $line =~ m{^\s+$}; ! # stats aren't parsed yet... ! if ($line =~ m{CM\s\d+:\s*(\S+)}xms) { ! #$self->debug("Start Result: Found model:$1\n"); if (!$self->within_element('result')) { $seentop = 1; *************** *** 696,700 **** $self->element_hash({ 'Infernal_program' => $algorithm, ! 'Infernal_query-def' => $model, 'Infernal_query-acc' => $accession, 'Infernal_querydesc' => $description, --- 689,693 ---- $self->element_hash({ 'Infernal_program' => $algorithm, ! 'Infernal_query-def' => $1, # present in output now 'Infernal_query-acc' => $accession, 'Infernal_querydesc' => $description, *************** *** 702,743 **** }); } if ($self->in_element('hit')) { $self->element_hash({'Hit_score' => $maxscore, 'Hit_bits' => $maxscore}); ! $maxscore = undef; $self->end_element({'Name' => 'Hit'}); ! } $lasthit = $1; ! ! # hit line is more BLAST-like ! # Plus strand results: ! # ! #Query = 1 - 102, Target = 168 - 267 ! #Score = 79.36, E = 7.876e-09, P = 7.876e-09, GC = 46 ! ! } elsif ($line =~ m{^hit\s+\d+\s+:\s+(\d+)\s+(\d+)\s+(\d+\.\d+)\s+bits}xms) { ! ($laststart, $lastend, $lastscore) = ($1, $2, $3); ! $maxscore = $lastscore unless $maxscore; ! if ($lastscore > $cutoff) { ! if (!$self->within_element('hit')) { ! my ($gi, $acc, $ver) = $self->_get_seq_identifiers($lasthit); ! $self->start_element({'Name' => 'Hit'}); ! $self->element_hash({ ! 'Hit_id' => $lasthit, ! 'Hit_accession' => $ver ? "$acc.$ver" : ! $acc ? $acc : $lasthit, ! 'Hit_gi' => $gi ! }); ! } ! # necessary as infernal 0.71 has repeated hit line ! if (!$self->in_element('hsp')) { ! $self->start_element({'Name' => 'Hsp'}); ! } ! $maxscore = ($maxscore < $lastscore) ? $lastscore : ! $maxscore; } # hsp is similar to older output } elsif ($line =~ m{^(\s+)[<>\{\}\(\)\[\]:_,-\.]+}xms) { # start of HSP $self->_pushback($line); # set up for loop # what is length of the gap to the structure data? my $offset = length($1); --- 695,754 ---- }); } + } elsif ($line =~ m{^>\s*(\S+)} ){ + #$self->debug("Start Hit: Found hit:$1\n"); if ($self->in_element('hit')) { $self->element_hash({'Hit_score' => $maxscore, 'Hit_bits' => $maxscore}); ! ($maxscore, $minpval, $mineval) = undef; $self->end_element({'Name' => 'Hit'}); ! } $lasthit = $1; ! } ! elsif ($line =~ m{ ! ^\sQuery\s=\s\d+\s-\s\d+,\s # Query start/end ! Target\s=\s(\d+)\s-\s(\d+) # Target start/end ! }xmso) { ! # Query (model) start/end always the same, determined from ! # the HSP length ! ($laststart, $lastend) = ($1, $2); ! #$self->debug("Found hit coords:$laststart - $lastend\n"); ! } elsif ($line =~ m{ ! ^\sScore\s=\s([\d\.]+),\s # Score = Bitscore (for now) ! (?:E\s=\s([\d\.e-]+),\s # E-val optional ! P\s=\s([\d\.e-]+),\s)? # P-val optional ! GC\s= # GC not captured ! }xmso ! ) { ! ($lastscore, $lasteval, $lastpval) = ($1, $2, $3); ! #$self->debug(sprintf("Found hit data:Score:%s,Eval:%s,Pval:%s\n",$lastscore, $lasteval||'', $lastpval||'')); ! $maxscore ||= $lastscore; ! if ($lasteval && $lastpval) { ! $mineval ||= $lasteval; ! $minpval ||= $lastpval; ! $mineval = ($mineval > $lasteval) ? $lasteval : ! $mineval; ! $minpval = ($minpval > $lastpval) ? $lastpval : ! $minpval; } + $maxscore = ($maxscore < $lastscore) ? $lastscore : + $maxscore; + if (!$self->within_element('hit')) { + my ($gi, $acc, $ver) = $self->_get_seq_identifiers($lasthit); + $self->start_element({'Name' => 'Hit'}); + $self->element_hash({ + 'Hit_id' => $lasthit, + 'Hit_accession' => $ver ? "$acc.$ver" : + $acc ? $acc : $lasthit, + 'Hit_gi' => $gi + }); + } + if (!$self->in_element('hsp')) { + $self->start_element({'Name' => 'Hsp'}); + } + # hsp is similar to older output } elsif ($line =~ m{^(\s+)[<>\{\}\(\)\[\]:_,-\.]+}xms) { # start of HSP $self->_pushback($line); # set up for loop + #$self->debug("Start HSP\n"); # what is length of the gap to the structure data? my $offset = length($1); *************** *** 750,758 **** '3' => 'hit'); HSP: ! while ($line = $self->_readline) { next if $line =~ m{^\s*$}; # toss empty lines chomp $line; # exit loop if at end of file or upon next hit/HSP ! if (!defined($line) || $line =~ m{^\S+}) { $self->_pushback($line); last HSP; --- 761,769 ---- '3' => 'hit'); HSP: ! while (defined ($line = $self->_readline)) { next if $line =~ m{^\s*$}; # toss empty lines chomp $line; # exit loop if at end of file or upon next hit/HSP ! if ($line =~ m{^\s{0,2}\S+}) { $self->_pushback($line); last HSP; *************** *** 775,779 **** my $metastr; - # Ugh...these should be passed in a hash $metastr = ($self->convert_meta) ? ($self->simple_meta($hsp->{'meta'})) : ($hsp->{'meta'}); --- 786,789 ---- *************** *** 789,798 **** 'Hsp_hit-to' => $lastend, 'Hsp_score' => $lastscore, ! 'Hsp_bit-score' => $lastscore }); $self->end_element({'Name' => 'Hsp'}); } # result now ends with // and 'Fin' ! } elsif ($line =~ m{^memory}xms || $line =~ m{^CYK\smemory}xms ) { if ($self->within_element('result') && $seentop) { $self->element( --- 799,812 ---- 'Hsp_hit-to' => $lastend, 'Hsp_score' => $lastscore, ! 'Hsp_bit-score' => $lastscore, }); + $self->element_hash( + {'Hsp_evalue' => $lasteval, + 'Hsp_pvalue' => $lastpval, + }) if ($lasteval && $lastpval); $self->end_element({'Name' => 'Hsp'}); } # result now ends with // and 'Fin' ! } elsif ($line =~ m{^//}xms ) { if ($self->within_element('result') && $seentop) { $self->element( *************** *** 803,806 **** --- 817,822 ---- $self->element_hash({'Hit_score' => $maxscore, 'Hit_bits' => $maxscore}); + # don't know where to put minpval yet + $self->element_hash({'Hit_signif' => $mineval}) if $mineval; $self->end_element({'Name' => 'Hit'}); } From cjfields at dev.open-bio.org Tue Sep 4 23:59:54 2007 From: cjfields at dev.open-bio.org (Christopher John Fields) Date: Wed, 05 Sep 2007 03:59:54 +0000 Subject: [Bioperl-guts-l] bioperl-live/Bio/SearchIO infernal.pm,1.10,1.11 Message-ID: <200709050359.l853xsFx014336@dev.open-bio.org> Update of /home/repository/bioperl/bioperl-live/Bio/SearchIO In directory dev.open-bio.org:/tmp/cvs-serv14304/Bio/SearchIO Modified Files: infernal.pm Log Message: change sub redefining to to simple handler dispatch Index: infernal.pm =================================================================== RCS file: /home/repository/bioperl/bioperl-live/Bio/SearchIO/infernal.pm,v retrieving revision 1.10 retrieving revision 1.11 diff -C2 -d -r1.10 -r1.11 *** infernal.pm 5 Sep 2007 02:57:48 -0000 1.10 --- infernal.pm 5 Sep 2007 03:59:52 -0000 1.11 *************** *** 211,219 **** sub next_result { my ($self) = @_; ! unless ($self->{'_handlerset'}) { ! $self->_set_handler; ! $self->{'_handlerset'} = 1; } ! return $self->_next_result; } --- 211,230 ---- sub next_result { my ($self) = @_; ! unless (exists $self->{'_handlerset'}) { ! my $line; ! while ($line = $self->_readline) { ! # advance to first line ! next if $line =~ m{^\s*$}; ! # newer output starts with model name ! if ($line =~ m{^CM\s\d+:}) { ! $self->{'_handlerset'} = 'new'; ! } else { ! $self->{'_handlerset'} ='old'; ! } ! last; ! } ! $self->_pushback($line); } ! return $self->{'_handlerset'} eq 'new' ? $self->_parse_new : $self->_parse_old; } *************** *** 647,669 **** # this is a hack which guesses the format and sets the handler for parsing in ! # an instance ! ! sub _set_handler { ! my $self = shift; ! my $line; ! while ($line = $self->_readline) { ! # advance to first line ! next if $line =~ m{^\s*$}; ! # newer output starts with model name ! if ($line =~ m{^CM\s\d+:}) { ! *_next_result = \&_parse_new; ! $self->version(0.81); ! } else { ! *_next_result = \&_parse_old; ! } ! last; ! } ! $self->_pushback($line); ! } # cmsearch 0.81 --- 658,662 ---- # this is a hack which guesses the format and sets the handler for parsing in ! # an instance; it'll be taken out when infernal 1.0 is released # cmsearch 0.81 *************** *** 674,678 **** my ($accession, $db, $algorithm, $description, $version) = ($self->query_accession, $self->database, $self->algorithm, ! $self->query_description, $self->version); my ($maxscore, $mineval, $minpval); $self->start_document(); --- 667,671 ---- my ($accession, $db, $algorithm, $description, $version) = ($self->query_accession, $self->database, $self->algorithm, ! $self->query_description, '0.81'); my ($maxscore, $mineval, $minpval); $self->start_document(); From cjfields at dev.open-bio.org Tue Sep 4 23:59:54 2007 From: cjfields at dev.open-bio.org (Christopher John Fields) Date: Wed, 05 Sep 2007 03:59:54 +0000 Subject: [Bioperl-guts-l] bioperl-live/t RNA_SearchIO.t,1.7,1.8 Message-ID: <200709050359.l853xsk1014341@dev.open-bio.org> Update of /home/repository/bioperl/bioperl-live/t In directory dev.open-bio.org:/tmp/cvs-serv14304/t Modified Files: RNA_SearchIO.t Log Message: change sub redefining to to simple handler dispatch Index: RNA_SearchIO.t =================================================================== RCS file: /home/repository/bioperl/bioperl-live/t/RNA_SearchIO.t,v retrieving revision 1.7 retrieving revision 1.8 diff -C2 -d -r1.7 -r1.8 *** RNA_SearchIO.t 5 Sep 2007 02:57:48 -0000 1.7 --- RNA_SearchIO.t 5 Sep 2007 03:59:52 -0000 1.8 *************** *** 345,350 **** -file => test_input_file('purine_v081.infernal'), # version is reset to the correct one by parser - -version => 0.7, - -model => 'Purine', -query_acc => 'RF00167', -query_desc => 'Purine riboswitch', --- 345,348 ---- *************** *** 355,358 **** --- 353,357 ---- $result = $searchio->next_result; + isa_ok($result, 'Bio::Search::Result::ResultI'); $algorithm = $result->algorithm; From bugzilla-daemon at portal.open-bio.org Wed Sep 5 00:20:35 2007 From: bugzilla-daemon at portal.open-bio.org (bugzilla-daemon at portal.open-bio.org) Date: Wed, 5 Sep 2007 00:20:35 -0400 Subject: [Bioperl-guts-l] [Bug 2356] New: Bio::TreeIO::pag outputs Message-ID: http://bugzilla.open-bio.org/show_bug.cgi?id=2356 Summary: Bio::TreeIO::pag outputs Product: BioPerl Version: unspecified Platform: Macintosh URL: http://search.cpan.org/~sendu/bioperl/Bio/TreeIO/pag.pm OS/Version: Mac OS Status: UNCONFIRMED Severity: normal Priority: P2 Component: bioperl-pipeline AssignedTo: bioperl-guts-l at bioperl.org ReportedBy: simorita at ncsu.edu Bio::TreeIO::pag seems to parse fine but only outputs every other tree if nexus file has more than one. -- Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?tab=email ------- You are receiving this mail because: ------- You are the assignee for the bug, or are watching the assignee. From sendu at dev.open-bio.org Wed Sep 5 07:00:44 2007 From: sendu at dev.open-bio.org (Senduran Balasubramaniam) Date: Wed, 05 Sep 2007 11:00:44 +0000 Subject: [Bioperl-guts-l] bioperl-live Build.PL,1.23,1.24 Message-ID: <200709051100.l85B0iBe015401@dev.open-bio.org> Update of /home/repository/bioperl/bioperl-live In directory dev.open-bio.org:/tmp/cvs-serv15376 Modified Files: Build.PL Log Message: changed license to "perl", ie. artistic or GPL Index: Build.PL =================================================================== RCS file: /home/repository/bioperl/bioperl-live/Build.PL,v retrieving revision 1.23 retrieving revision 1.24 diff -C2 -d -r1.23 -r1.24 *** Build.PL 18 Jun 2007 09:46:30 -0000 1.23 --- Build.PL 5 Sep 2007 11:00:41 -0000 1.24 *************** *** 23,27 **** dist_author => 'Bioperl Team ', dist_abstract => 'Bioinformatics Toolkit', ! license => 'artistic', requires => { 'perl' => '5.6.1', --- 23,27 ---- dist_author => 'Bioperl Team ', dist_abstract => 'Bioinformatics Toolkit', ! license => 'perl', requires => { 'perl' => '5.6.1', From sendu at dev.open-bio.org Wed Sep 5 07:00:53 2007 From: sendu at dev.open-bio.org (Senduran Balasubramaniam) Date: Wed, 05 Sep 2007 11:00:53 +0000 Subject: [Bioperl-guts-l] bioperl-run Build.PL,1.4,1.5 Message-ID: <200709051100.l85B0rj9015434@dev.open-bio.org> Update of /home/repository/bioperl/bioperl-run In directory dev.open-bio.org:/tmp/cvs-serv15409 Modified Files: Build.PL Log Message: changed license to "perl", ie. artistic or GPL Index: Build.PL =================================================================== RCS file: /home/repository/bioperl/bioperl-run/Build.PL,v retrieving revision 1.4 retrieving revision 1.5 diff -C2 -d -r1.4 -r1.5 *** Build.PL 13 Mar 2007 22:04:25 -0000 1.4 --- Build.PL 5 Sep 2007 11:00:51 -0000 1.5 *************** *** 17,21 **** dist_author => 'Bioperl Team ', dist_abstract => 'bioperl-run - wrapper toolkit', ! license => 'artistic', requires => { 'perl' => '5.6.1', --- 17,21 ---- dist_author => 'Bioperl Team ', dist_abstract => 'bioperl-run - wrapper toolkit', ! license => 'perl', requires => { 'perl' => '5.6.1', From sendu at dev.open-bio.org Wed Sep 5 07:01:03 2007 From: sendu at dev.open-bio.org (Senduran Balasubramaniam) Date: Wed, 05 Sep 2007 11:01:03 +0000 Subject: [Bioperl-guts-l] bioperl-db Build.PL,1.5,1.6 Message-ID: <200709051101.l85B13BI015469@dev.open-bio.org> Update of /home/repository/bioperl/bioperl-db In directory dev.open-bio.org:/tmp/cvs-serv15442 Modified Files: Build.PL Log Message: changed license to "perl", ie. artistic or GPL Index: Build.PL =================================================================== RCS file: /home/repository/bioperl/bioperl-db/Build.PL,v retrieving revision 1.5 retrieving revision 1.6 diff -C2 -d -r1.5 -r1.6 *** Build.PL 19 Jan 2007 11:24:44 -0000 1.5 --- Build.PL 5 Sep 2007 11:01:01 -0000 1.6 *************** *** 17,21 **** dist_author => 'Bioperl Team ', dist_abstract => 'bioperl-db - package for biological databases', ! license => 'artistic', requires => { 'perl' => '5.6.1', --- 17,21 ---- dist_author => 'Bioperl Team ', dist_abstract => 'bioperl-db - package for biological databases', ! license => 'perl', requires => { 'perl' => '5.6.1', From sendu at dev.open-bio.org Wed Sep 5 07:01:11 2007 From: sendu at dev.open-bio.org (Senduran Balasubramaniam) Date: Wed, 05 Sep 2007 11:01:11 +0000 Subject: [Bioperl-guts-l] bioperl-network Build.PL,1.3,1.4 Message-ID: <200709051101.l85B1BVR015502@dev.open-bio.org> Update of /home/repository/bioperl/bioperl-network In directory dev.open-bio.org:/tmp/cvs-serv15477 Modified Files: Build.PL Log Message: changed license to "perl", ie. artistic or GPL Index: Build.PL =================================================================== RCS file: /home/repository/bioperl/bioperl-network/Build.PL,v retrieving revision 1.3 retrieving revision 1.4 diff -C2 -d -r1.3 -r1.4 *** Build.PL 19 Jan 2007 11:26:35 -0000 1.3 --- Build.PL 5 Sep 2007 11:01:09 -0000 1.4 *************** *** 17,21 **** dist_author => 'Bioperl Team ', dist_abstract => 'bioperl-network - package for biological networks', ! license => 'artistic', requires => { 'perl' => '5.6.1', --- 17,21 ---- dist_author => 'Bioperl Team ', dist_abstract => 'bioperl-network - package for biological networks', ! license => 'perl', requires => { 'perl' => '5.6.1', From sendu at dev.open-bio.org Wed Sep 5 08:14:42 2007 From: sendu at dev.open-bio.org (Senduran Balasubramaniam) Date: Wed, 05 Sep 2007 12:14:42 +0000 Subject: [Bioperl-guts-l] bioperl-live LICENSE,1.1,1.2 Message-ID: <200709051214.l85CEgip015585@dev.open-bio.org> Update of /home/repository/bioperl/bioperl-live In directory dev.open-bio.org:/tmp/cvs-serv15560 Modified Files: LICENSE Log Message: added GPL License Index: LICENSE =================================================================== RCS file: /home/repository/bioperl/bioperl-live/LICENSE,v retrieving revision 1.1 retrieving revision 1.2 diff -C2 -d -r1.1 -r1.2 *** LICENSE 14 Jun 2001 14:13:03 -0000 1.1 --- LICENSE 5 Sep 2007 12:14:40 -0000 1.2 *************** *** 1,4 **** ! --- 1,6 ---- + BioPerl is licensed under the same terms as Perl itself, which means it is + dually-licensed under either the Artistic or GPL licenses. ! Below are details of the Artistic License and, following it, the GPL. *************** *** 130,131 **** --- 132,812 ---- The End + + + + + + GNU GENERAL PUBLIC LICENSE + Version 3, 29 June 2007 + + Copyright (C) 2007 Free Software Foundation, Inc. + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + Preamble + + The GNU General Public License is a free, copyleft license for + software and other kinds of works. + + The licenses for most software and other practical works are designed + to take away your freedom to share and change the works. By contrast, + the GNU General Public License is intended to guarantee your freedom to + share and change all versions of a program--to make sure it remains free + software for all its users. We, the Free Software Foundation, use the + GNU General Public License for most of our software; it applies also to + any other work released this way by its authors. You can apply it to + your programs, too. + + When we speak of free software, we are referring to freedom, not + price. Our General Public Licenses are designed to make sure that you + have the freedom to distribute copies of free software (and charge for + them if you wish), that you receive source code or can get it if you + want it, that you can change the software or use pieces of it in new + free programs, and that you know you can do these things. + + To protect your rights, we need to prevent others from denying you + these rights or asking you to surrender the rights. Therefore, you have + certain responsibilities if you distribute copies of the software, or if + you modify it: responsibilities to respect the freedom of others. + + For example, if you distribute copies of such a program, whether + gratis or for a fee, you must pass on to the recipients the same + freedoms that you received. You must make sure that they, too, receive + or can get the source code. And you must show them these terms so they + know their rights. + + Developers that use the GNU GPL protect your rights with two steps: + (1) assert copyright on the software, and (2) offer you this License + giving you legal permission to copy, distribute and/or modify it. + + For the developers' and authors' protection, the GPL clearly explains + that there is no warranty for this free software. For both users' and + authors' sake, the GPL requires that modified versions be marked as + changed, so that their problems will not be attributed erroneously to + authors of previous versions. + + Some devices are designed to deny users access to install or run + modified versions of the software inside them, although the manufacturer + can do so. This is fundamentally incompatible with the aim of + protecting users' freedom to change the software. The systematic + pattern of such abuse occurs in the area of products for individuals to + use, which is precisely where it is most unacceptable. Therefore, we + have designed this version of the GPL to prohibit the practice for those + products. If such problems arise substantially in other domains, we + stand ready to extend this provision to those domains in future versions + of the GPL, as needed to protect the freedom of users. + + Finally, every program is threatened constantly by software patents. + States should not allow patents to restrict development and use of + software on general-purpose computers, but in those that do, we wish to + avoid the special danger that patents applied to a free program could + make it effectively proprietary. To prevent this, the GPL assures that + patents cannot be used to render the program non-free. + + The precise terms and conditions for copying, distribution and + modification follow. + + TERMS AND CONDITIONS + + 0. Definitions. + + "This License" refers to version 3 of the GNU General Public License. + + "Copyright" also means copyright-like laws that apply to other kinds of + works, such as semiconductor masks. + + "The Program" refers to any copyrightable work licensed under this + License. Each licensee is addressed as "you". "Licensees" and + "recipients" may be individuals or organizations. + + To "modify" a work means to copy from or adapt all or part of the work + in a fashion requiring copyright permission, other than the making of an + exact copy. The resulting work is called a "modified version" of the + earlier work or a work "based on" the earlier work. + + A "covered work" means either the unmodified Program or a work based + on the Program. + + To "propagate" a work means to do anything with it that, without + permission, would make you directly or secondarily liable for + infringement under applicable copyright law, except executing it on a + computer or modifying a private copy. Propagation includes copying, + distribution (with or without modification), making available to the + public, and in some countries other activities as well. + + To "convey" a work means any kind of propagation that enables other + parties to make or receive copies. Mere interaction with a user through + a computer network, with no transfer of a copy, is not conveying. + + An interactive user interface displays "Appropriate Legal Notices" + to the extent that it includes a convenient and prominently visible + feature that (1) displays an appropriate copyright notice, and (2) + tells the user that there is no warranty for the work (except to the + extent that warranties are provided), that licensees may convey the + work under this License, and how to view a copy of this License. If + the interface presents a list of user commands or options, such as a + menu, a prominent item in the list meets this criterion. + + 1. Source Code. + + The "source code" for a work means the preferred form of the work + for making modifications to it. "Object code" means any non-source + form of a work. + + A "Standard Interface" means an interface that either is an official + standard defined by a recognized standards body, or, in the case of + interfaces specified for a particular programming language, one that + is widely used among developers working in that language. + + The "System Libraries" of an executable work include anything, other + than the work as a whole, that (a) is included in the normal form of + packaging a Major Component, but which is not part of that Major + Component, and (b) serves only to enable use of the work with that + Major Component, or to implement a Standard Interface for which an + implementation is available to the public in source code form. A + "Major Component", in this context, means a major essential component + (kernel, window system, and so on) of the specific operating system + (if any) on which the executable work runs, or a compiler used to + produce the work, or an object code interpreter used to run it. + + The "Corresponding Source" for a work in object code form means all + the source code needed to generate, install, and (for an executable + work) run the object code and to modify the work, including scripts to + control those activities. However, it does not include the work's + System Libraries, or general-purpose tools or generally available free + programs which are used unmodified in performing those activities but + which are not part of the work. For example, Corresponding Source + includes interface definition files associated with source files for + the work, and the source code for shared libraries and dynamically + linked subprograms that the work is specifically designed to require, + such as by intimate data communication or control flow between those + subprograms and other parts of the work. + + The Corresponding Source need not include anything that users + can regenerate automatically from other parts of the Corresponding + Source. + + The Corresponding Source for a work in source code form is that + same work. + + 2. Basic Permissions. + + All rights granted under this License are granted for the term of + copyright on the Program, and are irrevocable provided the stated + conditions are met. This License explicitly affirms your unlimited + permission to run the unmodified Program. The output from running a + covered work is covered by this License only if the output, given its + content, constitutes a covered work. This License acknowledges your + rights of fair use or other equivalent, as provided by copyright law. + + You may make, run and propagate covered works that you do not + convey, without conditions so long as your license otherwise remains + in force. You may convey covered works to others for the sole purpose + of having them make modifications exclusively for you, or provide you + with facilities for running those works, provided that you comply with + the terms of this License in conveying all material for which you do + not control copyright. Those thus making or running the covered works + for you must do so exclusively on your behalf, under your direction + and control, on terms that prohibit them from making any copies of + your copyrighted material outside their relationship with you. + + Conveying under any other circumstances is permitted solely under + the conditions stated below. Sublicensing is not allowed; section 10 + makes it unnecessary. + + 3. Protecting Users' Legal Rights From Anti-Circumvention Law. + + No covered work shall be deemed part of an effective technological + measure under any applicable law fulfilling obligations under article + 11 of the WIPO copyright treaty adopted on 20 December 1996, or + similar laws prohibiting or restricting circumvention of such + measures. + + When you convey a covered work, you waive any legal power to forbid + circumvention of technological measures to the extent such circumvention + is effected by exercising rights under this License with respect to + the covered work, and you disclaim any intention to limit operation or + modification of the work as a means of enforcing, against the work's + users, your or third parties' legal rights to forbid circumvention of + technological measures. + + 4. Conveying Verbatim Copies. + + You may convey verbatim copies of the Program's source code as you + receive it, in any medium, provided that you conspicuously and + appropriately publish on each copy an appropriate copyright notice; + keep intact all notices stating that this License and any + non-permissive terms added in accord with section 7 apply to the code; + keep intact all notices of the absence of any warranty; and give all + recipients a copy of this License along with the Program. + + You may charge any price or no price for each copy that you convey, + and you may offer support or warranty protection for a fee. + + 5. Conveying Modified Source Versions. + + You may convey a work based on the Program, or the modifications to + produce it from the Program, in the form of source code under the + terms of section 4, provided that you also meet all of these conditions: + + a) The work must carry prominent notices stating that you modified + it, and giving a relevant date. + + b) The work must carry prominent notices stating that it is + released under this License and any conditions added under section + 7. This requirement modifies the requirement in section 4 to + "keep intact all notices". + + c) You must license the entire work, as a whole, under this + License to anyone who comes into possession of a copy. This + License will therefore apply, along with any applicable section 7 + additional terms, to the whole of the work, and all its parts, + regardless of how they are packaged. This License gives no + permission to license the work in any other way, but it does not + invalidate such permission if you have separately received it. + + d) If the work has interactive user interfaces, each must display + Appropriate Legal Notices; however, if the Program has interactive + interfaces that do not display Appropriate Legal Notices, your + work need not make them do so. + + A compilation of a covered work with other separate and independent + works, which are not by their nature extensions of the covered work, + and which are not combined with it such as to form a larger program, + in or on a volume of a storage or distribution medium, is called an + "aggregate" if the compilation and its resulting copyright are not + used to limit the access or legal rights of the compilation's users + beyond what the individual works permit. Inclusion of a covered work + in an aggregate does not cause this License to apply to the other + parts of the aggregate. + + 6. Conveying Non-Source Forms. + + You may convey a covered work in object code form under the terms + of sections 4 and 5, provided that you also convey the + machine-readable Corresponding Source under the terms of this License, + in one of these ways: + + a) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by the + Corresponding Source fixed on a durable physical medium + customarily used for software interchange. + + b) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by a + written offer, valid for at least three years and valid for as + long as you offer spare parts or customer support for that product + model, to give anyone who possesses the object code either (1) a + copy of the Corresponding Source for all the software in the + product that is covered by this License, on a durable physical + medium customarily used for software interchange, for a price no + more than your reasonable cost of physically performing this + conveying of source, or (2) access to copy the + Corresponding Source from a network server at no charge. + + c) Convey individual copies of the object code with a copy of the + written offer to provide the Corresponding Source. This + alternative is allowed only occasionally and noncommercially, and + only if you received the object code with such an offer, in accord + with subsection 6b. + + d) Convey the object code by offering access from a designated + place (gratis or for a charge), and offer equivalent access to the + Corresponding Source in the same way through the same place at no + further charge. You need not require recipients to copy the + Corresponding Source along with the object code. If the place to + copy the object code is a network server, the Corresponding Source + may be on a different server (operated by you or a third party) + that supports equivalent copying facilities, provided you maintain + clear directions next to the object code saying where to find the + Corresponding Source. Regardless of what server hosts the + Corresponding Source, you remain obligated to ensure that it is + available for as long as needed to satisfy these requirements. + + e) Convey the object code using peer-to-peer transmission, provided + you inform other peers where the object code and Corresponding + Source of the work are being offered to the general public at no + charge under subsection 6d. + + A separable portion of the object code, whose source code is excluded + from the Corresponding Source as a System Library, need not be + included in conveying the object code work. + + A "User Product" is either (1) a "consumer product", which means any + tangible personal property which is normally used for personal, family, + or household purposes, or (2) anything designed or sold for incorporation + into a dwelling. In determining whether a product is a consumer product, + doubtful cases shall be resolved in favor of coverage. For a particular + product received by a particular user, "normally used" refers to a + typical or common use of that class of product, regardless of the status + of the particular user or of the way in which the particular user + actually uses, or expects or is expected to use, the product. A product + is a consumer product regardless of whether the product has substantial + commercial, industrial or non-consumer uses, unless such uses represent + the only significant mode of use of the product. + + "Installation Information" for a User Product means any methods, + procedures, authorization keys, or other information required to install + and execute modified versions of a covered work in that User Product from + a modified version of its Corresponding Source. The information must + suffice to ensure that the continued functioning of the modified object + code is in no case prevented or interfered with solely because + modification has been made. + + If you convey an object code work under this section in, or with, or + specifically for use in, a User Product, and the conveying occurs as + part of a transaction in which the right of possession and use of the + User Product is transferred to the recipient in perpetuity or for a + fixed term (regardless of how the transaction is characterized), the + Corresponding Source conveyed under this section must be accompanied + by the Installation Information. But this requirement does not apply + if neither you nor any third party retains the ability to install + modified object code on the User Product (for example, the work has + been installed in ROM). + + The requirement to provide Installation Information does not include a + requirement to continue to provide support service, warranty, or updates + for a work that has been modified or installed by the recipient, or for + the User Product in which it has been modified or installed. Access to a + network may be denied when the modification itself materially and + adversely affects the operation of the network or violates the rules and + protocols for communication across the network. + + Corresponding Source conveyed, and Installation Information provided, + in accord with this section must be in a format that is publicly + documented (and with an implementation available to the public in + source code form), and must require no special password or key for + unpacking, reading or copying. + + 7. Additional Terms. + + "Additional permissions" are terms that supplement the terms of this + License by making exceptions from one or more of its conditions. + Additional permissions that are applicable to the entire Program shall + be treated as though they were included in this License, to the extent + that they are valid under applicable law. If additional permissions + apply only to part of the Program, that part may be used separately + under those permissions, but the entire Program remains governed by + this License without regard to the additional permissions. + + When you convey a copy of a covered work, you may at your option + remove any additional permissions from that copy, or from any part of + it. (Additional permissions may be written to require their own + removal in certain cases when you modify the work.) You may place + additional permissions on material, added by you to a covered work, + for which you have or can give appropriate copyright permission. + + Notwithstanding any other provision of this License, for material you + add to a covered work, you may (if authorized by the copyright holders of + that material) supplement the terms of this License with terms: + + a) Disclaiming warranty or limiting liability differently from the + terms of sections 15 and 16 of this License; or + + b) Requiring preservation of specified reasonable legal notices or + author attributions in that material or in the Appropriate Legal + Notices displayed by works containing it; or + + c) Prohibiting misrepresentation of the origin of that material, or + requiring that modified versions of such material be marked in + reasonable ways as different from the original version; or + + d) Limiting the use for publicity purposes of names of licensors or + authors of the material; or + + e) Declining to grant rights under trademark law for use of some + trade names, trademarks, or service marks; or + + f) Requiring indemnification of licensors and authors of that + material by anyone who conveys the material (or modified versions of + it) with contractual assumptions of liability to the recipient, for + any liability that these contractual assumptions directly impose on + those licensors and authors. + + All other non-permissive additional terms are considered "further + restrictions" within the meaning of section 10. If the Program as you + received it, or any part of it, contains a notice stating that it is + governed by this License along with a term that is a further + restriction, you may remove that term. If a license document contains + a further restriction but permits relicensing or conveying under this + License, you may add to a covered work material governed by the terms + of that license document, provided that the further restriction does + not survive such relicensing or conveying. + + If you add terms to a covered work in accord with this section, you + must place, in the relevant source files, a statement of the + additional terms that apply to those files, or a notice indicating + where to find the applicable terms. + + Additional terms, permissive or non-permissive, may be stated in the + form of a separately written license, or stated as exceptions; + the above requirements apply either way. + + 8. Termination. + + You may not propagate or modify a covered work except as expressly + provided under this License. Any attempt otherwise to propagate or + modify it is void, and will automatically terminate your rights under + this License (including any patent licenses granted under the third + paragraph of section 11). + + However, if you cease all violation of this License, then your + license from a particular copyright holder is reinstated (a) + provisionally, unless and until the copyright holder explicitly and + finally terminates your license, and (b) permanently, if the copyright + holder fails to notify you of the violation by some reasonable means + prior to 60 days after the cessation. + + Moreover, your license from a particular copyright holder is + reinstated permanently if the copyright holder notifies you of the + violation by some reasonable means, this is the first time you have + received notice of violation of this License (for any work) from that + copyright holder, and you cure the violation prior to 30 days after + your receipt of the notice. + + Termination of your rights under this section does not terminate the + licenses of parties who have received copies or rights from you under + this License. If your rights have been terminated and not permanently + reinstated, you do not qualify to receive new licenses for the same + material under section 10. + + 9. Acceptance Not Required for Having Copies. + + You are not required to accept this License in order to receive or + run a copy of the Program. Ancillary propagation of a covered work + occurring solely as a consequence of using peer-to-peer transmission + to receive a copy likewise does not require acceptance. However, + nothing other than this License grants you permission to propagate or + modify any covered work. These actions infringe copyright if you do + not accept this License. Therefore, by modifying or propagating a + covered work, you indicate your acceptance of this License to do so. + + 10. Automatic Licensing of Downstream Recipients. + + Each time you convey a covered work, the recipient automatically + receives a license from the original licensors, to run, modify and + propagate that work, subject to this License. You are not responsible + for enforcing compliance by third parties with this License. + + An "entity transaction" is a transaction transferring control of an + organization, or substantially all assets of one, or subdividing an + organization, or merging organizations. If propagation of a covered + work results from an entity transaction, each party to that + transaction who receives a copy of the work also receives whatever + licenses to the work the party's predecessor in interest had or could + give under the previous paragraph, plus a right to possession of the + Corresponding Source of the work from the predecessor in interest, if + the predecessor has it or can get it with reasonable efforts. + + You may not impose any further restrictions on the exercise of the + rights granted or affirmed under this License. For example, you may + not impose a license fee, royalty, or other charge for exercise of + rights granted under this License, and you may not initiate litigation + (including a cross-claim or counterclaim in a lawsuit) alleging that + any patent claim is infringed by making, using, selling, offering for + sale, or importing the Program or any portion of it. + + 11. Patents. + + A "contributor" is a copyright holder who authorizes use under this + License of the Program or a work on which the Program is based. The + work thus licensed is called the contributor's "contributor version". + + A contributor's "essential patent claims" are all patent claims + owned or controlled by the contributor, whether already acquired or + hereafter acquired, that would be infringed by some manner, permitted + by this License, of making, using, or selling its contributor version, + but do not include claims that would be infringed only as a + consequence of further modification of the contributor version. For + purposes of this definition, "control" includes the right to grant + patent sublicenses in a manner consistent with the requirements of + this License. + + Each contributor grants you a non-exclusive, worldwide, royalty-free + patent license under the contributor's essential patent claims, to + make, use, sell, offer for sale, import and otherwise run, modify and + propagate the contents of its contributor version. + + In the following three paragraphs, a "patent license" is any express + agreement or commitment, however denominated, not to enforce a patent + (such as an express permission to practice a patent or covenant not to + sue for patent infringement). To "grant" such a patent license to a + party means to make such an agreement or commitment not to enforce a + patent against the party. + + If you convey a covered work, knowingly relying on a patent license, + and the Corresponding Source of the work is not available for anyone + to copy, free of charge and under the terms of this License, through a + publicly available network server or other readily accessible means, + then you must either (1) cause the Corresponding Source to be so + available, or (2) arrange to deprive yourself of the benefit of the + patent license for this particular work, or (3) arrange, in a manner + consistent with the requirements of this License, to extend the patent + license to downstream recipients. "Knowingly relying" means you have + actual knowledge that, but for the patent license, your conveying the + covered work in a country, or your recipient's use of the covered work + in a country, would infringe one or more identifiable patents in that + country that you have reason to believe are valid. + + If, pursuant to or in connection with a single transaction or + arrangement, you convey, or propagate by procuring conveyance of, a + covered work, and grant a patent license to some of the parties + receiving the covered work authorizing them to use, propagate, modify + or convey a specific copy of the covered work, then the patent license + you grant is automatically extended to all recipients of the covered + work and works based on it. + + A patent license is "discriminatory" if it does not include within + the scope of its coverage, prohibits the exercise of, or is + conditioned on the non-exercise of one or more of the rights that are + specifically granted under this License. You may not convey a covered + work if you are a party to an arrangement with a third party that is + in the business of distributing software, under which you make payment + to the third party based on the extent of your activity of conveying + the work, and under which the third party grants, to any of the + parties who would receive the covered work from you, a discriminatory + patent license (a) in connection with copies of the covered work + conveyed by you (or copies made from those copies), or (b) primarily + for and in connection with specific products or compilations that + contain the covered work, unless you entered into that arrangement, + or that patent license was granted, prior to 28 March 2007. + + Nothing in this License shall be construed as excluding or limiting + any implied license or other defenses to infringement that may + otherwise be available to you under applicable patent law. + + 12. No Surrender of Others' Freedom. + + If conditions are imposed on you (whether by court order, agreement or + otherwise) that contradict the conditions of this License, they do not + excuse you from the conditions of this License. If you cannot convey a + covered work so as to satisfy simultaneously your obligations under this + License and any other pertinent obligations, then as a consequence you may + not convey it at all. For example, if you agree to terms that obligate you + to collect a royalty for further conveying from those to whom you convey + the Program, the only way you could satisfy both those terms and this + License would be to refrain entirely from conveying the Program. + + 13. Use with the GNU Affero General Public License. + + Notwithstanding any other provision of this License, you have + permission to link or combine any covered work with a work licensed + under version 3 of the GNU Affero General Public License into a single + combined work, and to convey the resulting work. The terms of this + License will continue to apply to the part which is the covered work, + but the special requirements of the GNU Affero General Public License, + section 13, concerning interaction through a network will apply to the + combination as such. + + 14. Revised Versions of this License. + + The Free Software Foundation may publish revised and/or new versions of + the GNU General Public License from time to time. Such new versions will + be similar in spirit to the present version, but may differ in detail to + address new problems or concerns. + + Each version is given a distinguishing version number. If the + Program specifies that a certain numbered version of the GNU General + Public License "or any later version" applies to it, you have the + option of following the terms and conditions either of that numbered + version or of any later version published by the Free Software + Foundation. If the Program does not specify a version number of the + GNU General Public License, you may choose any version ever published + by the Free Software Foundation. + + If the Program specifies that a proxy can decide which future + versions of the GNU General Public License can be used, that proxy's + public statement of acceptance of a version permanently authorizes you + to choose that version for the Program. + + Later license versions may give you additional or different + permissions. However, no additional obligations are imposed on any + author or copyright holder as a result of your choosing to follow a + later version. + + 15. Disclaimer of Warranty. + + THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY + APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT + HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY + OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, + THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR + PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM + IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF + ALL NECESSARY SERVICING, REPAIR OR CORRECTION. + + 16. Limitation of Liability. + + IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING + WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS + THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY + GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE + USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF + DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD + PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), + EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF + SUCH DAMAGES. + + 17. Interpretation of Sections 15 and 16. + + If the disclaimer of warranty and limitation of liability provided + above cannot be given local legal effect according to their terms, + reviewing courts shall apply local law that most closely approximates + an absolute waiver of all civil liability in connection with the + Program, unless a warranty or assumption of liability accompanies a + copy of the Program in return for a fee. + + END OF TERMS AND CONDITIONS + + How to Apply These Terms to Your New Programs + + If you develop a new program, and you want it to be of the greatest + possible use to the public, the best way to achieve this is to make it + free software which everyone can redistribute and change under these terms. + + To do so, attach the following notices to the program. It is safest + to attach them to the start of each source file to most effectively + state the exclusion of warranty; and each file should have at least + the "copyright" line and a pointer to where the full notice is found. + + + Copyright (C) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU General Public License as published by + the Free Software Foundation, either version 3 of the License, or + (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU General Public License for more details. + + You should have received a copy of the GNU General Public License + along with this program. If not, see . + + Also add information on how to contact you by electronic and paper mail. + + If the program does terminal interaction, make it output a short + notice like this when it starts in an interactive mode: + + Copyright (C) + This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'. + This is free software, and you are welcome to redistribute it + under certain conditions; type `show c' for details. + + The hypothetical commands `show w' and `show c' should show the appropriate + parts of the General Public License. Of course, your program's commands + might be different; for a GUI interface, you would use an "about box". + + You should also get your employer (if you work as a programmer) or school, + if any, to sign a "copyright disclaimer" for the program, if necessary. + For more information on this, and how to apply and follow the GNU GPL, see + . + + The GNU General Public License does not permit incorporating your program + into proprietary programs. If your program is a subroutine library, you + may consider it more useful to permit linking proprietary applications with + the library. If this is what you want to do, use the GNU Lesser General + Public License instead of this License. But first, please read + . From sendu at dev.open-bio.org Wed Sep 5 08:15:49 2007 From: sendu at dev.open-bio.org (Senduran Balasubramaniam) Date: Wed, 05 Sep 2007 12:15:49 +0000 Subject: [Bioperl-guts-l] bioperl-run LICENSE,NONE,1.1 Message-ID: <200709051215.l85CFnC8015639@dev.open-bio.org> Update of /home/repository/bioperl/bioperl-run In directory dev.open-bio.org:/tmp/cvs-serv15614 Added Files: LICENSE Log Message: text of Artistic and GPL License --- NEW FILE: LICENSE --- BioPerl is licensed under the same terms as Perl itself, which means it is dually-licensed under either the Artistic or GPL licenses. Below are details of the Artistic License and, following it, the GPL. The "Artistic License" Preamble The intent of this document is to state the conditions under which a Package may be copied, such that the Copyright Holder maintains some semblance of artistic control over the development of the package, while giving the users of the package the right to use and distribute the Package in a more-or-less customary fashion, plus the right to make reasonable modifications. Definitions: "Package" refers to the collection of files distributed by the Copyright Holder, and derivatives of that collection of files created through textual modification. "Standard Version" refers to such a Package if it has not been modified, or has been modified in accordance with the wishes of the Copyright Holder as specified below. "Copyright Holder" is whoever is named in the copyright or copyrights for the package. "You" is you, if you're thinking about copying or distributing this Package. "Reasonable copying fee" is whatever you can justify on the basis of media cost, duplication charges, time of people involved, and so on. (You will not be required to justify it to the Copyright Holder, but only to the computing community at large as a market that must bear the fee.) "Freely Available" means that no fee is charged for the item itself, though there may be fees involved in handling the item. It also means that recipients of the item may redistribute it under the same conditions they received it. 1. You may make and give away verbatim copies of the source form of the Standard Version of this Package without restriction, provided that you duplicate all of the original copyright notices and associated disclaimers. 2. You may apply bug fixes, portability fixes and other modifications derived from the Public Domain or from the Copyright Holder. A Package modified in such a way shall still be considered the Standard Version. 3. You may otherwise modify your copy of this Package in any way, provided that you insert a prominent notice in each changed file stating how and when you changed that file, and provided that you do at least ONE of the following: a) place your modifications in the Public Domain or otherwise make them Freely Available, such as by posting said modifications to Usenet or an equivalent medium, or placing the modifications on a major archive site such as uunet.uu.net, or by allowing the Copyright Holder to include your modifications in the Standard Version of the Package. b) use the modified Package only within your corporation or organization. c) rename any non-standard executables so the names do not conflict with standard executables, which must also be provided, and provide a separate manual page for each non-standard executable that clearly documents how it differs from the Standard Version. d) make other distribution arrangements with the Copyright Holder. 4. You may distribute the programs of this Package in object code or executable form, provided that you do at least ONE of the following: a) distribute a Standard Version of the executables and library files, together with instructions (in the manual page or equivalent) on where to get the Standard Version. b) accompany the distribution with the machine-readable source of the Package with your modifications. c) give non-standard executables non-standard names, and clearly document the differences in manual pages (or equivalent), together with instructions on where to get the Standard Version. d) make other distribution arrangements with the Copyright Holder. 5. You may charge a reasonable copying fee for any distribution of this Package. You may charge any fee you choose for support of this Package. You may not charge a fee for this Package itself. However, you may distribute this Package in aggregate with other (possibly commercial) programs as part of a larger (possibly commercial) software distribution provided that you do not advertise this Package as a product of your own. You may embed this Package's interpreter within an executable of yours (by linking); this shall be construed as a mere form of aggregation, provided that the complete Standard Version of the interpreter is so embedded. 6. The scripts and library files supplied as input to or produced as output from the programs of this Package do not automatically fall under the copyright of this Package, but belong to whoever generated them, and may be sold commercially, and may be aggregated with this Package. If such scripts or library files are aggregated with this Package via the so-called "undump" or "unexec" methods of producing a binary executable image, then distribution of such an image shall neither be construed as a distribution of this Package nor shall it fall under the restrictions of Paragraphs 3 and 4, provided that you do not represent such an executable image as a Standard Version of this Package. 7. C subroutines (or comparably compiled subroutines in other languages) supplied by you and linked into this Package in order to emulate subroutines and variables of the language defined by this Package shall not be considered part of this Package, but are the equivalent of input as in Paragraph 6, provided these subroutines do not change the language in any way that would cause it to fail the regression tests for the language. 8. Aggregation of this Package with a commercial distribution is always permitted provided that the use of this Package is embedded; that is, when no overt attempt is made to make this Package's interfaces visible to the end user of the commercial distribution. Such use shall not be construed as a distribution of this Package. 9. The name of the Copyright Holder may not be used to endorse or promote products derived from this software without specific prior written permission. 10. THIS PACKAGE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED WARRANTIES OF MERCHANTIBILITY AND FITNESS FOR A PARTICULAR PURPOSE. The End GNU GENERAL PUBLIC LICENSE Version 3, 29 June 2007 Copyright (C) 2007 Free Software Foundation, Inc. Everyone is permitted to copy and distribute verbatim copies of this license document, but changing it is not allowed. Preamble The GNU General Public License is a free, copyleft license for software and other kinds of works. The licenses for most software and other practical works are designed to take away your freedom to share and change the works. By contrast, the GNU General Public License is intended to guarantee your freedom to share and change all versions of a program--to make sure it remains free software for all its users. We, the Free Software Foundation, use the GNU General Public License for most of our software; it applies also to any other work released this way by its authors. You can apply it to your programs, too. When we speak of free software, we are referring to freedom, not price. Our General Public Licenses are designed to make sure that you have the freedom to distribute copies of free software (and charge for them if you wish), that you receive source code or can get it if you want it, that you can change the software or use pieces of it in new free programs, and that you know you can do these things. To protect your rights, we need to prevent others from denying you these rights or asking you to surrender the rights. Therefore, you have certain responsibilities if you distribute copies of the software, or if you modify it: responsibilities to respect the freedom of others. For example, if you distribute copies of such a program, whether gratis or for a fee, you must pass on to the recipients the same freedoms that you received. You must make sure that they, too, receive or can get the source code. And you must show them these terms so they know their rights. Developers that use the GNU GPL protect your rights with two steps: (1) assert copyright on the software, and (2) offer you this License giving you legal permission to copy, distribute and/or modify it. For the developers' and authors' protection, the GPL clearly explains that there is no warranty for this free software. For both users' and authors' sake, the GPL requires that modified versions be marked as changed, so that their problems will not be attributed erroneously to authors of previous versions. Some devices are designed to deny users access to install or run modified versions of the software inside them, although the manufacturer can do so. This is fundamentally incompatible with the aim of protecting users' freedom to change the software. The systematic pattern of such abuse occurs in the area of products for individuals to use, which is precisely where it is most unacceptable. Therefore, we have designed this version of the GPL to prohibit the practice for those products. If such problems arise substantially in other domains, we stand ready to extend this provision to those domains in future versions of the GPL, as needed to protect the freedom of users. Finally, every program is threatened constantly by software patents. States should not allow patents to restrict development and use of software on general-purpose computers, but in those that do, we wish to avoid the special danger that patents applied to a free program could make it effectively proprietary. To prevent this, the GPL assures that patents cannot be used to render the program non-free. The precise terms and conditions for copying, distribution and modification follow. TERMS AND CONDITIONS 0. Definitions. "This License" refers to version 3 of the GNU General Public License. "Copyright" also means copyright-like laws that apply to other kinds of works, such as semiconductor masks. "The Program" refers to any copyrightable work licensed under this License. Each licensee is addressed as "you". "Licensees" and "recipients" may be individuals or organizations. To "modify" a work means to copy from or adapt all or part of the work in a fashion requiring copyright permission, other than the making of an exact copy. The resulting work is called a "modified version" of the earlier work or a work "based on" the earlier work. A "covered work" means either the unmodified Program or a work based on the Program. To "propagate" a work means to do anything with it that, without permission, would make you directly or secondarily liable for infringement under applicable copyright law, except executing it on a computer or modifying a private copy. Propagation includes copying, distribution (with or without modification), making available to the public, and in some countries other activities as well. To "convey" a work means any kind of propagation that enables other parties to make or receive copies. Mere interaction with a user through a computer network, with no transfer of a copy, is not conveying. An interactive user interface displays "Appropriate Legal Notices" to the extent that it includes a convenient and prominently visible feature that (1) displays an appropriate copyright notice,