From sylvain.foisy at diploide.net Fri Jul 1 18:32:20 2011 From: sylvain.foisy at diploide.net (Sylvain Foisy) Date: Fri, 1 Jul 2011 18:32:20 -0400 (EDT) Subject: [Biojava-l] Help on NCBIQBlastService and BlastXMLQuery Message-ID: <60828.76.10.128.89.1309559540.squirrel@humboldt.cyberlogic.net> Hi, I am the main culprit for this code ;-) If you can bear waiting some days, I'll try my outmost to help you out on this. I am presently on vacation outside my country and I do not have access to a computer. However, my first guess: the XML code that you get from NCBI does not behave the way it is expected by the BlastXMLQuery class... The Javadocs for this class is rather slim :-( Back to you ASAP around July 11-12. Best regards and thank you for your patience. Sylvain =================================================================== Sylvain Foisy, Ph. D. Consultant Bio-informatique / Bioinformatics Diploide.net - TI pour la vie / IT for Life Courriel: sylvain.foisy at diploide.net Web: http://www.diploide.net =================================================================== From tariq_cp at hotmail.com Wed Jul 6 07:37:05 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Wed, 6 Jul 2011 11:37:05 +0000 Subject: [Biojava-l] No. of gaps in aligned sequences Message-ID: Hi, Dear all, I am working on the development of MSA application using BioJava. I want to make clear a thing. It is that when two or more protein sequences are aligned the '-' is shown more times in an aligned sequence than the gaps display by the method of alSeq.getNumGaps(). 'alSeq' is an aligned sequence. For example, if there are actual 50 '-' in an aligned sequence but the method shows it only 30. What is the difference between these two results. Best Regards Tariq, Phd Scholar From drd6y at virginia.edu Wed Jul 6 12:07:07 2011 From: drd6y at virginia.edu (Daniel Di Giulio) Date: Wed, 6 Jul 2011 12:07:07 -0400 Subject: [Biojava-l] BioJava Gene Hierarchies Message-ID: Hello, I'm currently using BioJava to upgrade a eukaryotic gene finder program (EVIGAN) to be compatible with the GFF3 formats. Your BioJava genome package is very useful, but I had a question about implementing a sort of gene hierarchy from parsed files. Essentially, I would like to be able to read in a GFF3 file of a region of interest, parse out the CDS segments, and then create a hierarchy of genes from the attribute tags, which I can then employ later in my program. It seems as if the org.biojava3.genome.parsers.gff class is good for this, but there doesn't seem to be a data structure for organizing related "Feature" objects into a higher grouping based on similar attributes. Does anyone know of a way to implement this, or a package within BioJava which could be useful? Thanks a lot, Daniel From tariq_cp at hotmail.com Thu Jul 7 04:48:08 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Thu, 7 Jul 2011 08:48:08 +0000 Subject: [Biojava-l] Page creation in Biojava Message-ID: Hi, All I want to contribute in BioJava CookBook. I have already login id/account. I can create internal/external links. But further what to do. How can i create a page and link to the internal/external link. Regards. Tariq, Phd Scholar From andreas at sdsc.edu Thu Jul 7 11:10:53 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Thu, 7 Jul 2011 08:10:53 -0700 Subject: [Biojava-l] No. of gaps in aligned sequences In-Reply-To: References: Message-ID: Hi Tariq, Can you send us the sample code / DB accession IDs so we can try to reproduce this? Andreas On Wed, Jul 6, 2011 at 4:37 AM, Muhammad Tariq Pervez wrote: > > > Hi, Dear all, > I am working on the development of MSA application using BioJava. I want to make clear a thing. It is that when two or more protein sequences are aligned the '-' is shown more times in an aligned sequence than the gaps display by the method of alSeq.getNumGaps(). 'alSeq' is an aligned sequence. For example, if there are actual 50 '-' in an aligned sequence but the method shows it only 30. What is the difference between these two results. > > Best Regards > > > Tariq, Phd Scholar > > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From mstewart at vbi.vt.edu Thu Jul 7 16:56:15 2011 From: mstewart at vbi.vt.edu (Mark Stewart) Date: Thu, 7 Jul 2011 16:56:15 -0400 Subject: [Biojava-l] Local DB BLAST Comparison/Search Message-ID: I'm a relatively new programmer, so I'm probably missing a number of obvious things, but if someone wouldn't mind pointing me in the right direction, that'd be great, because I'm having trouble figuring stuff out from the API. Just generally, which of the alignment/BLAST-related classes do I want to be looking over and using if I want to write some JAVA for doing similar sequence searches of a local database using the BLAST algorithm? -M From andreas at sdsc.edu Thu Jul 7 18:46:29 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Thu, 7 Jul 2011 15:46:29 -0700 Subject: [Biojava-l] Page creation in Biojava In-Reply-To: References: Message-ID: Hi Tariq, A easy way to create a new page is to create a link from an existing page and then click on that link. This should take you to the edit view of the new page. See also: http://meta.wikimedia.org/wiki/Help:Starting_a_new_page Andreas On Thu, Jul 7, 2011 at 1:48 AM, Muhammad Tariq Pervez wrote: > > Hi, All > I want to contribute in BioJava CookBook. I have already login id/account. I can create internal/external links. But further what to do. How can i create a page and link to the internal/external link. > > Regards. > > > Tariq, Phd Scholar > > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From tariq_cp at hotmail.com Fri Jul 8 01:09:08 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Fri, 8 Jul 2011 05:09:08 +0000 Subject: [Biojava-l] Biojava-l Digest, Vol 102, Issue 4 In-Reply-To: References: Message-ID: The code is as follows: Actually the code is taken from BioJavaCookbook with a little modification. The following method is called from another class. The method takes the names of the files or simply say files as an argument in the form of list. public void MSAFromFiles(List ids) throws Exception{ List lst = new ArrayList(); ProteinSequence pSeq=null; for (String id : ids) { pSeq=getSequenceFromFiles(id); lst.add(pSeq); //System.out.println("seq==" +pSeq); } profile = Alignments.getMultipleSequenceAlignment(lst); } getSequenceFromFiles() method is given below private ProteinSequence getSequenceFromFiles(String inputFile) throws Exception{ ProteinSequence seq=null; //System.out.println("inputFile==="+inputFile); FileInputStream is = new FileInputStream(inputFile); FastaReader fastaReader = new FastaReader(is, new GenericFastaHeaderParser(), new ProteinSequenceCreator(AminoAcidCompoundSet.getAminoAcidCompoundSet())); LinkedHashMap proteinSequences = fastaReader.process(); is.close(); //System.out.println( "proteinSequences=" + proteinSequences ); //LinkedHashMap a = FastaReaderHelper.readFastaProteinSequence(new File(fileName)); for ( Entry entry : proteinSequences.entrySet() ) { seq= new ProteinSequence(entry.getValue().getSequenceAsString()); seq.setAccession(entry.getValue().getAccession()); //System.out.println( "Inside getSequenceFromFile=" + seq ); //FastaReaderHelper.readFastaDNASequence for DNA sequences } return seq; } After getting the Profile object I wrote the following code to display the No. of gaps List> listOfalSeq=profile.getAlignedSequences(); AlignedSequence alSeq; int noOfcompounds=0; int numOfGaps=0; StringBuilder html= new StringBuilder(""); for (int i=0; i"); //System.out.println("accessionId==" +accessionId); //pSeq=new ProteinSequence(seq.getSequenceAsString(),seq.getCompoundSet()); //pSeq.setAccession(seq.getAccession()); //multipleSequenceAlignment.addAlignedSequence(pSeq); } html.append("
Accession IdNumber of gaps
"); html.append(accessionId); html.append(""); html.append(numOfGaps); html.append("
"); setText(html.toString()); setText() method is the method of JEditorPane or JTextPane Tariq, Phd Scholar > From: biojava-l-request at lists.open-bio.org > Subject: Biojava-l Digest, Vol 102, Issue 4 > To: biojava-l at lists.open-bio.org > Date: Thu, 7 Jul 2011 12:00:04 -0400 > > Send Biojava-l mailing list submissions to > biojava-l at lists.open-bio.org > > To subscribe or unsubscribe via the World Wide Web, visit > http://lists.open-bio.org/mailman/listinfo/biojava-l > or, via email, send a message with subject or body 'help' to > biojava-l-request at lists.open-bio.org > > You can reach the person managing the list at > biojava-l-owner at lists.open-bio.org > > When replying, please edit your Subject line so it is more specific > than "Re: Contents of Biojava-l digest..." > > > Today's Topics: > > 1. BioJava Gene Hierarchies (Daniel Di Giulio) > 2. Page creation in Biojava (Muhammad Tariq Pervez) > 3. Re: No. of gaps in aligned sequences (Andreas Prlic) > > > ---------------------------------------------------------------------- > > Message: 1 > Date: Wed, 6 Jul 2011 12:07:07 -0400 > From: Daniel Di Giulio > Subject: [Biojava-l] BioJava Gene Hierarchies > To: biojava-l at lists.open-bio.org > Message-ID: > > Content-Type: text/plain; charset=ISO-8859-1 > > Hello, > > I'm currently using BioJava to upgrade a eukaryotic gene finder program > (EVIGAN) to be compatible with the GFF3 formats. Your BioJava genome > package is very useful, but I had a question about implementing a sort of > gene hierarchy from parsed files. Essentially, I would like to be able to > read in a GFF3 file of a region of interest, parse out the CDS segments, and > then create a hierarchy of genes from the attribute tags, which I can then > employ later in my program. It seems as if the > org.biojava3.genome.parsers.gff class is good for this, but there doesn't > seem to be a data structure for organizing related "Feature" objects into a > higher grouping based on similar attributes. Does anyone know of a way to > implement this, or a package within BioJava which could be useful? > > Thanks a lot, > Daniel > > > ------------------------------ > > Message: 2 > Date: Thu, 7 Jul 2011 08:48:08 +0000 > From: Muhammad Tariq Pervez > Subject: [Biojava-l] Page creation in Biojava > To: > Message-ID: > Content-Type: text/plain; charset="iso-8859-1" > > > Hi, All > I want to contribute in BioJava CookBook. I have already login id/account. I can create internal/external links. But further what to do. How can i create a page and link to the internal/external link. > > Regards. > > > Tariq, Phd Scholar > > > > ------------------------------ > > Message: 3 > Date: Thu, 7 Jul 2011 08:10:53 -0700 > From: Andreas Prlic > Subject: Re: [Biojava-l] No. of gaps in aligned sequences > To: Muhammad Tariq Pervez > Cc: biojava-dev at biojava.org, biojava-l at biojava.org > Message-ID: > > Content-Type: text/plain; charset=ISO-8859-1 > > Hi Tariq, > > Can you send us the sample code / DB accession IDs so we can try to > reproduce this? > > Andreas > > On Wed, Jul 6, 2011 at 4:37 AM, Muhammad Tariq Pervez > wrote: > > > > > > Hi, Dear all, > > I am working on the development of MSA application using BioJava. I want to make clear a thing. It is that when two or more protein sequences are aligned the '-' is shown more times in an aligned sequence than the gaps display by the method of alSeq.getNumGaps(). 'alSeq' is an aligned sequence. For example, if there are actual 50 '-' in an aligned sequence but the method shows it only 30. What is the difference between these two results. > > > > Best Regards > > > > > > Tariq, Phd Scholar > > > > _______________________________________________ > > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/biojava-l > > > > > > ------------------------------ > > _______________________________________________ > Biojava-l mailing list - Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > > > End of Biojava-l Digest, Vol 102, Issue 4 > ***************************************** From tariq_cp at hotmail.com Fri Jul 8 01:09:51 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Fri, 8 Jul 2011 05:09:51 +0000 Subject: [Biojava-l] No. of gaps in aligned sequences In-Reply-To: References: , Message-ID: The code is as follows: Actually the code is taken from BioJavaCookbook with a little modification. The following method is called from another class. The method takes the names of the files or simply say files as an argument in the form of list. public void MSAFromFiles(List ids) throws Exception{ List lst = new ArrayList(); ProteinSequence pSeq=null; for (String id : ids) { pSeq=getSequenceFromFiles(id); lst.add(pSeq); //System.out.println("seq==" +pSeq); } profile = Alignments.getMultipleSequenceAlignment(lst); } getSequenceFromFiles() method is given below private ProteinSequence getSequenceFromFiles(String inputFile) throws Exception{ ProteinSequence seq=null; //System.out.println("inputFile==="+inputFile); FileInputStream is = new FileInputStream(inputFile); FastaReader fastaReader = new FastaReader(is, new GenericFastaHeaderParser(), new ProteinSequenceCreator(AminoAcidCompoundSet.getAminoAcidCompoundSet())); LinkedHashMap proteinSequences = fastaReader.process(); is.close(); //System.out.println( "proteinSequences=" + proteinSequences ); //LinkedHashMap a = FastaReaderHelper.readFastaProteinSequence(new File(fileName)); for ( Entry entry : proteinSequences.entrySet() ) { seq= new ProteinSequence(entry.getValue().getSequenceAsString()); seq.setAccession(entry.getValue().getAccession()); //System.out.println( "Inside getSequenceFromFile=" + seq ); //FastaReaderHelper.readFastaDNASequence for DNA sequences } return seq; } After getting the Profile object I wrote the following code to display the No. of gaps List> listOfalSeq=profile.getAlignedSequences(); AlignedSequence alSeq; int noOfcompounds=0; int numOfGaps=0; StringBuilder html= new StringBuilder(""); for (int i=0; i"); //System.out.println("accessionId==" +accessionId); //pSeq=new ProteinSequence(seq.getSequenceAsString(),seq.getCompoundSet()); //pSeq.setAccession(seq.getAccession()); //multipleSequenceAlignment.addAlignedSequence(pSeq); } html.append("
Accession IdNumber of gaps
"); html.append(accessionId); html.append(""); html.append(numOfGaps); html.append("
"); setText(html.toString()); setText() method is the method of JEditorPane or JTextPane Tariq, Phd Scholar Muhammad Tariq Pervez Assistant Professor, Department of Computer Science Virtual University of Pakistan, Lahore Tel: (042) 9203114-7 URL: www.vu.edu.pk Mobile: +923364120541, +923214602694 > Date: Thu, 7 Jul 2011 08:10:53 -0700 > Subject: Re: [Biojava-l] No. of gaps in aligned sequences > From: andreas at sdsc.edu > To: tariq_cp at hotmail.com > CC: biojava-l at biojava.org; biojava-dev at biojava.org > > Hi Tariq, > > Can you send us the sample code / DB accession IDs so we can try to > reproduce this? > > Andreas > > On Wed, Jul 6, 2011 at 4:37 AM, Muhammad Tariq Pervez > wrote: > > > > > > Hi, Dear all, > > I am working on the development of MSA application using BioJava. I want to make clear a thing. It is that when two or more protein sequences are aligned the '-' is shown more times in an aligned sequence than the gaps display by the method of alSeq.getNumGaps(). 'alSeq' is an aligned sequence. For example, if there are actual 50 '-' in an aligned sequence but the method shows it only 30. What is the difference between these two results. > > > > Best Regards > > > > > > Tariq, Phd Scholar > > > > _______________________________________________ > > Biojava-l mailing list - Biojava-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/biojava-l > > From tariq_cp at hotmail.com Fri Jul 8 03:11:12 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Fri, 8 Jul 2011 07:11:12 +0000 Subject: [Biojava-l] Page creation in Biojava In-Reply-To: References: , Message-ID: Hi, Andreas, I created the link with the following title and when i click this link the download dialogue box appears to download index.php file. After the reading the helping contents provided by the link sent by you I changed the name of the already existing page. A blank page appears and when i click the link of 'edit this page' again the download dialogue box appears and prompt to download the index.php file. What to do?? Kindly guide. I am afraid perhaps i don't have the right to create a page. How do I convert Profile object into Multiple Sequence Alignment object to be use in the TreeConstructor tariq, Phd Scholar > Date: Thu, 7 Jul 2011 15:46:29 -0700 > Subject: Re: [Biojava-l] Page creation in Biojava > From: andreas at sdsc.edu > To: tariq_cp at hotmail.com > CC: biojava-l at lists.open-bio.org > > Hi Tariq, > > A easy way to create a new page is to create a link from an existing > page and then click on that link. This should take you to the edit > view of the new page. > > See also: > http://meta.wikimedia.org/wiki/Help:Starting_a_new_page > > Andreas > > > > On Thu, Jul 7, 2011 at 1:48 AM, Muhammad Tariq Pervez > wrote: > > > > Hi, All > > I want to contribute in BioJava CookBook. I have already login id/account. I can create internal/external links. But further what to do. How can i create a page and link to the internal/external link. > > > > Regards. > > > > > > Tariq, Phd Scholar > > > > _______________________________________________ > > Biojava-l mailing list - Biojava-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/biojava-l > > From andreas at sdsc.edu Fri Jul 8 13:36:12 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Fri, 8 Jul 2011 10:36:12 -0700 Subject: [Biojava-l] Page creation in Biojava In-Reply-To: References: Message-ID: Hi Muhammad, - I don;t think that you already created a new page, and also I can't see on which wiki page you created the link? http://biojava.org/wiki/Special:RecentChanges Make sure you are logged in correctly and then you should have edit and create permissions... Andreas On Fri, Jul 8, 2011 at 12:11 AM, Muhammad Tariq Pervez wrote: > > Hi, Andreas, > > I created the link with the following title and when i click this link the download dialogue box appears to download index.php file. > After the reading the helping contents provided by > the link sent by you I changed the name of the already existing page. A blank page appears and when i click the link of 'edit this page' again the download dialogue box appears and prompt to download the index.php file. > > What to do?? Kindly guide. I am afraid perhaps i don't have the right to create a page. > > How > do I convert Profile object into Multiple Sequence Alignment object to be use in > the TreeConstructor > > tariq, Phd Scholar > > >> Date: Thu, 7 Jul 2011 15:46:29 -0700 >> Subject: Re: [Biojava-l] Page creation in Biojava >> From: andreas at sdsc.edu >> To: tariq_cp at hotmail.com >> CC: biojava-l at lists.open-bio.org >> >> Hi Tariq, >> >> A easy way to create a new page is to create a link from an existing >> page and then click on that link. This should take you to the edit >> view of the new page. >> >> See also: >> http://meta.wikimedia.org/wiki/Help:Starting_a_new_page >> >> Andreas >> >> >> >> On Thu, Jul 7, 2011 at 1:48 AM, Muhammad Tariq Pervez >> wrote: >> > >> > Hi, All >> > I want to contribute in BioJava CookBook. I have already login id/account. I can create internal/external links. But further what to do. How can i create a page and link to the internal/external link. >> > >> > Regards. >> > >> > >> > Tariq, Phd Scholar >> > >> > _______________________________________________ >> > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org >> > http://lists.open-bio.org/mailman/listinfo/biojava-l >> > > > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From tariq_cp at hotmail.com Mon Jul 11 02:59:28 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Mon, 11 Jul 2011 06:59:28 +0000 Subject: [Biojava-l] Page creation in Biojava In-Reply-To: References: , , , Message-ID: Hi Andreas, Now you can see changes on the following link made on July 11, 2011 with my nick name cp. http://biojava.org/wiki/Special:RecentChanges I am again facing the same problem. When i click the link a dialogue box appears that prompt to save the index. php page. Waiting for your guidance. Tariq, Phd Scholar > Date: Fri, 8 Jul 2011 10:36:12 -0700 > Subject: Re: [Biojava-l] Page creation in Biojava > From: andreas at sdsc.edu > To: tariq_cp at hotmail.com > CC: biojava-l at lists.open-bio.org > > Hi Muhammad, > > - I don;t think that you already created a new page, and also I can't > see on which wiki page you created the link? > > http://biojava.org/wiki/Special:RecentChanges > > Make sure you are logged in correctly and then you should have edit > and create permissions... > > Andreas > > > On Fri, Jul 8, 2011 at 12:11 AM, Muhammad Tariq Pervez > wrote: > > > > Hi, Andreas, > > > > I created the link with the following title and when i click this link the download dialogue box appears to download index.php file. > > After the reading the helping contents provided by > > the link sent by you I changed the name of the already existing page. A blank page appears and when i click the link of 'edit this page' again the download dialogue box appears and prompt to download the index.php file. > > > > What to do?? Kindly guide. I am afraid perhaps i don't have the right to create a page. > > > > How > > do I convert Profile object into Multiple Sequence Alignment object to be use in > > the TreeConstructor > > > > tariq, Phd Scholar > > > > > >> Date: Thu, 7 Jul 2011 15:46:29 -0700 > >> Subject: Re: [Biojava-l] Page creation in Biojava > >> From: andreas at sdsc.edu > >> To: tariq_cp at hotmail.com > >> CC: biojava-l at lists.open-bio.org > >> > >> Hi Tariq, > >> > >> A easy way to create a new page is to create a link from an existing > >> page and then click on that link. This should take you to the edit > >> view of the new page. > >> > >> See also: > >> http://meta.wikimedia.org/wiki/Help:Starting_a_new_page > >> > >> Andreas > >> > >> > >> > >> On Thu, Jul 7, 2011 at 1:48 AM, Muhammad Tariq Pervez > >> wrote: > >> > > >> > Hi, All > >> > I want to contribute in BioJava CookBook. I have already login id/account. I can create internal/external links. But further what to do. How can i create a page and link to the internal/external link. > >> > > >> > Regards. > >> > > >> > > >> > Tariq, Phd Scholar > >> > > >> > _______________________________________________ > >> > Biojava-l mailing list - Biojava-l at lists.open-bio.org > >> > http://lists.open-bio.org/mailman/listinfo/biojava-l > >> > > > > > _______________________________________________ > > Biojava-l mailing list - Biojava-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/biojava-l > > From tariq_cp at hotmail.com Mon Jul 11 04:00:27 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Mon, 11 Jul 2011 08:00:27 +0000 Subject: [Biojava-l] Calculating consensus sequence Message-ID: Hi, All, Is there any class/method in BioJava to calculate consensus sequences of the aligned sequences. Best Regards. Tariq, Phd Scholar From andreas at sdsc.edu Mon Jul 11 11:06:18 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Mon, 11 Jul 2011 08:06:18 -0700 Subject: [Biojava-l] Page creation in Biojava In-Reply-To: References: Message-ID: very strange... I created an empty page. Can you edit it? http://biojava.org/wiki/BioJava:CookBook:Phylo:ProfileToMSA Andreas On Sun, Jul 10, 2011 at 11:59 PM, Muhammad Tariq Pervez wrote: > > Hi Andreas, > Now you can see changes on the following link made on July 11, 2011 with my nick name cp. > > http://biojava.org/wiki/Special:RecentChanges > > I am again facing the same problem. When i click the link a dialogue box appears that prompt to save the index. php page. > > Waiting for your guidance. > > > Tariq, Phd Scholar > > >> Date: Fri, 8 Jul 2011 10:36:12 -0700 >> Subject: Re: [Biojava-l] Page creation in Biojava >> From: andreas at sdsc.edu >> To: tariq_cp at hotmail.com >> CC: biojava-l at lists.open-bio.org >> >> Hi Muhammad, >> >> - I don;t think that you already created a new page, and also I can't >> see on which wiki page you created the link? >> >> http://biojava.org/wiki/Special:RecentChanges >> >> Make sure you are logged in correctly and then you should have edit >> and create permissions... >> >> Andreas >> >> >> On Fri, Jul 8, 2011 at 12:11 AM, Muhammad Tariq Pervez >> wrote: >> > >> > Hi, Andreas, >> > >> > I created the link with the following title and when i click this link the download dialogue box appears to download index.php file. >> > After the reading the helping contents provided by >> > the link sent by you I changed the name of the already existing page. A blank page appears and when i click the link of 'edit this page' again the download dialogue box appears and prompt to download the index.php file. >> > >> > What to do?? Kindly guide. I am afraid perhaps i don't have the right to create a page. >> > >> > How >> > do I convert Profile object into Multiple Sequence Alignment object to be use in >> > the TreeConstructor >> > >> > tariq, Phd Scholar >> > >> > >> >> Date: Thu, 7 Jul 2011 15:46:29 -0700 >> >> Subject: Re: [Biojava-l] Page creation in Biojava >> >> From: andreas at sdsc.edu >> >> To: tariq_cp at hotmail.com >> >> CC: biojava-l at lists.open-bio.org >> >> >> >> Hi Tariq, >> >> >> >> A easy way to create a new page is to create a link from an existing >> >> page and then click on that link. This should take you to the edit >> >> view of the new page. >> >> >> >> See also: >> >> http://meta.wikimedia.org/wiki/Help:Starting_a_new_page >> >> >> >> Andreas >> >> >> >> >> >> >> >> On Thu, Jul 7, 2011 at 1:48 AM, Muhammad Tariq Pervez >> >> wrote: >> >> > >> >> > Hi, All >> >> > I want to contribute in BioJava CookBook. I have already login id/account. I can create internal/external links. But further what to do. How can i create a page and link to the internal/external link. >> >> > >> >> > Regards. >> >> > >> >> > >> >> > Tariq, Phd Scholar >> >> > >> >> > _______________________________________________ >> >> > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org >> >> > http://lists.open-bio.org/mailman/listinfo/biojava-l >> >> > >> > >> > _______________________________________________ >> > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org >> > http://lists.open-bio.org/mailman/listinfo/biojava-l >> > > > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From kohchuanhock at gmail.com Mon Jul 11 23:36:05 2011 From: kohchuanhock at gmail.com (Chuan Hock Koh) Date: Tue, 12 Jul 2011 11:36:05 +0800 Subject: [Biojava-l] GSoC:AAPropertiesComputation Updates Message-ID: Hi all, I am a student for this year Google Summer of Code. We are working on developing tools and APIs for the calculation of physico-chemical properties via BioJava. We have come to an end of the second phase of this project. In the first two phase of the projects, we have developed APIs, test the APIs and also wrote up documentation (in Cookbook of BioWiki under "Physico-Chemical Proerties Computation"). We are writing this email to invite for comments/suggestions on the project. The next few phases of the project can be found here ( http://biojava.org/wiki/GSoC:AAPropertiesComputation#Timeline). Previously, it was suggested in this mailing list that we should allow users to define the mass of amino acids instead of always using the standard mass. We have done so and have documentation on how to do it here ( http://biojava.org/wiki/BioJava:CookBook:AAPROP:xmlfiles). However, we face a problem here regarding the definition of modified amino acids. That is in the class of ProteinSequence, it ensures a symbol must be define in AminoAcidCompoundSet. This would limit the possibilities in defining the symbol for modified amino acids. Looking forward to hear from you guys, AAPropertiesComputation Team Student: Chuan Hock KOH Mentors: Peter Troshin & Andreas Prlic -- http://compbio.ddns.comp.nus.edu.sg/~ChuanHockKoh From HWillis at scripps.edu Tue Jul 12 07:37:32 2011 From: HWillis at scripps.edu (Scooter Willis) Date: Tue, 12 Jul 2011 07:37:32 -0400 Subject: [Biojava-l] GSoC:AAPropertiesComputation Updates In-Reply-To: Message-ID: Chuan Currently for Nucleotides and Amino Acids we used a single instance of each when building a ProteinSequence or DNASequence to minimize memory. We will need to come up with an approach that allows an amino acid to have a modified mass via a PTM designation that takes care of creating/replacing the amino acid with a new instance. This is complicated so it may be better to simply work from an expanded list of amino acids with known PTMs. We also need a way to describe a PTM as part of a simple string so that proper ProteinSequence is created and will still work in code that doesn't understand that a PTM is represented. Sequence alignment as an example. Each PTM type should have a short and long name. In the following example for possible/known PTMs of Cysteine(not a complete list) forces the PTMs to be a child of the amino acid. The short name and name should come from well established Mass Spec services such as Mascot. This way we should be able to create a ProteinSequence with a PTM by doing this ProteinSequence ps = new ProteinSequence("DE[capC]CK"); The parser will need to change to support parsing PTMs. I have included the compounds.xml file that I used for an internal project for code that finds peptides in mass spec files. Once all this is in place should be easy enough to add in code to get the mass of a protein sequence. Andy Yates put the code together that loads the current amino acid definitions from a config file. We should probably look at modifying that process to support loading a more complete list of possible amino acids and the properties. Is the plan to load the physio-chemical properties as well from an XML file? Are the code changes for amino acid properties going into Core? I realized last week that an old email I turned off was getting emails from Biojava-l so I have been out of the loop on current progress. Thanks Scooter On 7/11/11 11:36 PM, "Chuan Hock Koh" wrote: >Hi all, > >I am a student for this year Google Summer of Code. We are working on >developing tools and APIs for the calculation of physico-chemical >properties >via BioJava. > >We have come to an end of the second phase of this project. In the first >two >phase of the projects, we have developed APIs, test the APIs and also >wrote >up documentation (in Cookbook of BioWiki under "Physico-Chemical Proerties >Computation"). > >We are writing this email to invite for comments/suggestions on the >project. >The next few phases of the project can be found here ( >http://biojava.org/wiki/GSoC:AAPropertiesComputation#Timeline). > >Previously, it was suggested in this mailing list that we should allow >users >to define the mass of amino acids instead of always using the standard >mass. >We have done so and have documentation on how to do it here ( >http://biojava.org/wiki/BioJava:CookBook:AAPROP:xmlfiles). > >However, we face a problem here regarding the definition of modified amino >acids. That is in the class of ProteinSequence, it ensures a symbol must >be >define in AminoAcidCompoundSet. This would limit the possibilities in >defining the symbol for modified amino acids. > > >Looking forward to hear from you guys, > >AAPropertiesComputation Team >Student: Chuan Hock KOH >Mentors: Peter Troshin & Andreas Prlic > >-- >http://compbio.ddns.comp.nus.edu.sg/~ChuanHockKoh.nus.edu.sg/~ChuanHockKoh/index.html> >_______________________________________________ >Biojava-l mailing list - Biojava-l at lists.open-bio.org >http://lists.open-bio.org/mailman/listinfo/biojava-l -------------- next part -------------- A non-text attachment was scrubbed... Name: compounds.xml Type: application/xml Size: 10760 bytes Desc: compounds.xml URL: From andreas at sdsc.edu Wed Jul 13 04:05:33 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Wed, 13 Jul 2011 01:05:33 -0700 Subject: [Biojava-l] Local DB BLAST Comparison/Search In-Reply-To: References: Message-ID: Hi Mark, regarding Blast, our recommendation is generally to get the XML output and then just parse the data that you are interested in. Andreas On Thu, Jul 7, 2011 at 1:56 PM, Mark Stewart wrote: > I'm a relatively new programmer, so I'm probably missing a number of obvious > things, but if someone wouldn't mind pointing me in the right direction, > that'd be great, because I'm having trouble figuring stuff out from the API. > > Just generally, which of the alignment/BLAST-related classes do I want to be > looking over and using if I want to write some JAVA for doing similar > sequence searches of a local database using the BLAST algorithm? > > -M > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From p.j.a.cock at googlemail.com Mon Jul 18 02:29:50 2011 From: p.j.a.cock at googlemail.com (Peter Cock) Date: Mon, 18 Jul 2011 07:29:50 +0100 Subject: [Biojava-l] help with short reads ? In-Reply-To: References: Message-ID: On Saturday, June 25, 2011, Jay Vyas wrote: > Hi everyone. ?A collaborator sent me some short reads in GZ format for 2 > bacterial genomes. Files names something.gz are compressed, a bit like the .zip format used on windows. If it ends with .tar.gz (or the short hand .tgz) then you have a collection of files (Unix tool tar), which have then been compressed (with gzip or a similar tool). What operating system do you have? Even on Windows you can deal with these files. > I have NO IDEA how to process this data or convert it. ?Any help or utilies > out there ? ?If you're interested in collaborating on a publication , let me > know. ? We can get you're name on it. ?And it won't be much work for those > of you that know about contig assembly..... > > For me, its out of my league, im a protein guy.... > [This seems rather tangential to BioJava and I don't think this mailing list is the best place to discuss this.] That sounds like it will be tough/hard. If you can find a local team or bioinformatician working with NextGen sequencing I would help. Try asking your sequencing center/provider if they have any kind local sequencing group. See also http://seqanswers.com Good luck, Peter From daniel.quest at gmail.com Thu Jul 21 13:47:53 2011 From: daniel.quest at gmail.com (Daniel Quest) Date: Thu, 21 Jul 2011 13:47:53 -0400 Subject: [Biojava-l] maven question Message-ID: Hey all, not sure what the maven dependancy should be to get biojava to work in a maven project. I tried: org.biojava biojava 3.0.1 But that does not appear to be working in intellij I did do: biojava-maven-repo BioJava repository http://www.biojava.org/download/maven/ does someone have an example pom.xml file for projects that use BioJava? Thanks -Daniel From andreas at sdsc.edu Thu Jul 21 13:55:45 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Thu, 21 Jul 2011 10:55:45 -0700 Subject: [Biojava-l] maven question In-Reply-To: References: Message-ID: Hi Daniel, you correctly specify where to get the .jars from, but you also need to specify which of the modules you want to depend on. e.g.: org.biojava biojava3-core 3.0.1 jar compile Andreas On Thu, Jul 21, 2011 at 10:47 AM, Daniel Quest wrote: > Hey all, > > not sure what the maven dependancy should be to get biojava to work in a > maven project. > > I tried: > > ? > ? ? ? ? > ? ? ? ? ? ?org.biojava > ? ? ? ? ? ?biojava > ? ? ? ?3.0.1 > ? ? ? ? > ? > > But that does not appear to be working in intellij > > I did do: > ? > ? ? > biojava-maven-repo > BioJava repository > http://www.biojava.org/download/maven/ > ? > > > does someone have an example pom.xml file for projects that use BioJava? > Thanks > -Daniel > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > -- ----------------------------------------------------------------------- Dr. Andreas Prlic Senior Scientist, RCSB PDB Protein Data Bank University of California, San Diego (+1) 858.246.0526 ----------------------------------------------------------------------- From daniel.quest at gmail.com Thu Jul 21 14:13:03 2011 From: daniel.quest at gmail.com (Daniel Quest) Date: Thu, 21 Jul 2011 14:13:03 -0400 Subject: [Biojava-l] maven question In-Reply-To: References: Message-ID: Thanks for the tip Andreas, It is still not working for me. here is a POM.xml 4.0.0 gov.ornl foo 1.0-SNAPSHOT jar foo http://maven.apache.org UTF-8 org.biojava biojava3-core 3.0.1 jar compile biojava-maven-repo BioJava repository http://www.biojava.org/download/maven/ and here is the code that does not recognize: import org.biojava3.core.sequence.ProteinSequence; import org.biojava3.core.sequence.compound.AminoAcidCompound; import org.biojava3.core.sequence.compound.AminoAcidCompoundSet; import org.biojava3.core.sequence.io.FastaReader; import org.biojava3.core.sequence.io.FastaReaderHelper; import org.biojava3.core.sequence.io.GenericFastaHeaderParser; import org.biojava3.core.sequence.io.ProteinSequenceCreator; nothing fancy yet. Any other ideas? Thanks -Daniel On Thu, Jul 21, 2011 at 1:55 PM, Andreas Prlic wrote: > Hi Daniel, > > you correctly specify where to get the .jars from, but you also need > to specify which of the modules you want to depend on. e.g.: > > > org.biojava > biojava3-core > 3.0.1 > jar > compile > > > Andreas > > > > On Thu, Jul 21, 2011 at 10:47 AM, Daniel Quest > wrote: > > Hey all, > > > > not sure what the maven dependancy should be to get biojava to work in a > > maven project. > > > > I tried: > > > > > > > > org.biojava > > biojava > > 3.0.1 > > > > > > > > But that does not appear to be working in intellij > > > > I did do: > > > > > > biojava-maven-repo > > BioJava repository > > http://www.biojava.org/download/maven/ > > > > > > > > does someone have an example pom.xml file for projects that use BioJava? > > Thanks > > -Daniel > > _______________________________________________ > > Biojava-l mailing list - Biojava-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/biojava-l > > > > > > -- > ----------------------------------------------------------------------- > Dr. Andreas Prlic > Senior Scientist, RCSB PDB Protein Data Bank > University of California, San Diego > (+1) 858.246.0526 > ----------------------------------------------------------------------- > From andreas at sdsc.edu Thu Jul 21 17:24:05 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Thu, 21 Jul 2011 14:24:05 -0700 Subject: [Biojava-l] maven question In-Reply-To: References: Message-ID: Hi Daniel, your pom works fine in my eclipse setup (did a basic maven project and copy and pasted your pom XML). - Where is your .java file located? It should be somewhere under .../src/main/java - Did you try a "mvn clean package install" ? Andreas On Thu, Jul 21, 2011 at 11:13 AM, Daniel Quest wrote: > Thanks for the tip Andreas, > It is still not working for me. ?here is a POM.xml > xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" > ??xsi:schemaLocation="http://maven.apache.org/POM/4.0.0 > http://maven.apache.org/xsd/maven-4.0.0.xsd"> > ??4.0.0 > ??gov.ornl > ??foo > ??1.0-SNAPSHOT > ??jar > ??foo > ??http://maven.apache.org > ?? > ?? ?UTF-8 > ?? > ?? > ?? ? ? > ?? ? ? ? ? ?org.biojava > ?? ? ? ? ? ?biojava3-core > ?? ? ? ? ? ?3.0.1 > ?? ? ? ? ? ?jar > ?? ? ? ? ? ?compile > ?? ? ? ? > ?? > ?? > ?? ? > biojava-maven-repo > BioJava repository > http://www.biojava.org/download/maven/ > > > > > and here is the code that does not recognize: > import org.biojava3.core.sequence.ProteinSequence; > import org.biojava3.core.sequence.compound.AminoAcidCompound; > import org.biojava3.core.sequence.compound.AminoAcidCompoundSet; > import org.biojava3.core.sequence.io.FastaReader; > import org.biojava3.core.sequence.io.FastaReaderHelper; > import org.biojava3.core.sequence.io.GenericFastaHeaderParser; > import org.biojava3.core.sequence.io.ProteinSequenceCreator; > nothing fancy yet. ?Any other ideas? > Thanks > -Daniel > On Thu, Jul 21, 2011 at 1:55 PM, Andreas Prlic wrote: >> >> Hi Daniel, >> >> you correctly specify where to get the .jars from, but you also need >> to specify which of the modules you want to depend on. e.g.: >> >> ? ? ? ? >> ? ? ? ? ? ? ? ? ? ? ? ?org.biojava >> ? ? ? ? ? ? ? ? ? ? ? ?biojava3-core >> ? ? ? ? ? ? ? ? ? ? ? ?3.0.1 >> ? ? ? ? ? ? ? ? ? ? ? ?jar >> ? ? ? ? ? ? ? ? ? ? ? ?compile >> ? ? ? ? ? ? ? ? >> >> Andreas >> >> >> >> On Thu, Jul 21, 2011 at 10:47 AM, Daniel Quest >> wrote: >> > Hey all, >> > >> > not sure what the maven dependancy should be to get biojava to work in a >> > maven project. >> > >> > I tried: >> > >> > ? >> > ? ? ? ? >> > ? ? ? ? ? ?org.biojava >> > ? ? ? ? ? ?biojava >> > ? ? ? ?3.0.1 >> > ? ? ? ? >> > ? >> > >> > But that does not appear to be working in intellij >> > >> > I did do: >> > ? >> > ? ? >> > biojava-maven-repo >> > BioJava repository >> > http://www.biojava.org/download/maven/ >> > ? >> > >> > >> > does someone have an example pom.xml file for projects that use BioJava? >> > Thanks >> > -Daniel >> > _______________________________________________ >> > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org >> > http://lists.open-bio.org/mailman/listinfo/biojava-l >> > >> >> >> >> -- >> ----------------------------------------------------------------------- >> Dr. Andreas Prlic >> Senior Scientist, RCSB PDB Protein Data Bank >> University of California, San Diego >> (+1) 858.246.0526 >> ----------------------------------------------------------------------- > > From tariq_cp at hotmail.com Fri Jul 22 07:56:52 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Fri, 22 Jul 2011 11:56:52 +0000 Subject: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment Message-ID: Dear all, I faced the NullPointerException exception while creating the DNA MultipleSequenceAlignment. The same goes right with protein sequence. Exception is thrown at the following line dnaProfile = Alignments.getMultipleSequenceAlignment(tmpLst); tmpLst is list of DNA sequences created/declared as follows List tmpLst=new ArrayList(); Note: the tmpLst is filled/populated with two or more two sequences. I traced the exception by going into Alignments.getMultipleSequenceAlignmen method of the Alignments class and found the following line of code the cause of exception. static List getListFromFutures(List> futures) { List list = new ArrayList(); for (Future f : futures) { // TODO when added to ConcurrencyTools, log completions and exceptions instead of printing stack traces try { list.add(f.get());** } catch (InterruptedException e) { e.printStackTrace(); } catch (ExecutionException e) { e.printStackTrace(); } } return list; } ** is the cause of exception. All is right with the protein sequences. Can any body help/guide me regarding the problem. Best Regards. Tariq, PhD Scholar From HWillis at scripps.edu Fri Jul 22 08:11:34 2011 From: HWillis at scripps.edu (Scooter Willis) Date: Fri, 22 Jul 2011 08:11:34 -0400 Subject: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment In-Reply-To: Message-ID: Can you include the output of the stack trace as well as a small working example that causes the exception? On 7/22/11 7:56 AM, "Muhammad Tariq Pervez" wrote: > > > >Dear all, > >I faced the NullPointerException exception while creating the DNA >MultipleSequenceAlignment. The same goes right with protein sequence. >Exception is thrown at the following line > >dnaProfile = Alignments.getMultipleSequenceAlignment(tmpLst); > >tmpLst is list of DNA sequences created/declared as follows >List tmpLst=new ArrayList(); > >Note: the tmpLst is filled/populated with two or more two sequences. > >I traced the exception by going into >Alignments.getMultipleSequenceAlignmen method of the Alignments class and >found the following line of code the cause of exception. > >static List getListFromFutures(List> futures) { > List list = new ArrayList(); > for (Future f : futures) { > // TODO when added to ConcurrencyTools, log completions and >exceptions instead of printing stack traces > try { > > list.add(f.get());** > } catch (InterruptedException e) { > e.printStackTrace(); > } catch (ExecutionException e) { > e.printStackTrace(); > } > } > return list; > } >** is the cause of exception. All is right with the protein sequences. >Can any body help/guide me regarding the problem. > >Best Regards. > > > >Tariq, PhD Scholar > >_______________________________________________ >Biojava-l mailing list - Biojava-l at lists.open-bio.org >http://lists.open-bio.org/mailman/listinfo/biojava-l From tariq_cp at hotmail.com Mon Jul 25 06:27:02 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Mon, 25 Jul 2011 10:27:02 +0000 Subject: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment In-Reply-To: References: , Message-ID: Following is tmpLst filled with two DNA sequences. Scorers object is displayed from inside the object of Alignments (getMultipleSequenceAlignment method). All==1 is displayed from inside the method of public static , C extends Compound> int[] runPairwiseScorers( List> scorers) { (class is Alignments) as follows all = scorers.size(); But the line System.out.println("futures==="+futures.get(0).get()); causes NullPointer Exception. List> futures = new ArrayList>(); for (PairwiseSequenceScorer scorer : scorers) { futures.add(ConcurrencyTools.submit(new CallablePairwiseSequenceScorer(scorer), String.format("Scoring pair %d of %d", n++, all))); } try{ // perhaps this code is not working fine. System.out.println("futures==="+futures.get(0).get()); tmpLst==[GAATCTATAGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCAGGTAGTCGACTCAGATTCTTGTAGTGGCTCTCATCTGATCAAGGGTATTATTCCCAAGCCATAGTAAGGTCTTCTGTTGTGCCTTTTGCTTATACATCAGGTAACATGATAGAACTAGGCTAAGTG, ATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTAATGCTGATCACTCGGACTATGCTGATATTGAGCTGTATCCGTCTGACAAGCTCTCTTGACGGCAGGCCCCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGAGATAAGGAGGCATGTGCAAAAGCCCCATTGGAGGCATATAACAGAACACTGACTACTCTGCTCACTC] sequences=== [GAATCTATAGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCAGGTAGTCGACTCAGATTCTTGTAGTGGCTCTCATCTGATCAAGGGTATTATTCCCAAGCCATAGTAAGGTCTTCTGTTGTGCCTTTTGCTTATACATCAGGTAACATGATAGAACTAGGCTAAGTG, ATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTAATGCTGATCACTCGGACTATGCTGATATTGAGCTGTATCCGTCTGACAAGCTCTCTTGACGGCAGGCCCCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGAGATAAGGAGGCATGTGCAAAAGCCCCATTGGAGGCATATAACAGAACACTGACTACTCTGCTCACTC] scorers=== [org.biojava3.alignment.FractionalIdentityScorer at d337d3] all===1 scorers===org.biojava3.alignment.FractionalIdentityScorer at d337d3 java.util.concurrent.ExecutionException: java.lang.NullPointerException at java.util.concurrent.FutureTask$Sync.innerGet(FutureTask.java:222) at java.util.concurrent.FutureTask.get(FutureTask.java:83) at pakjalphiew.Alignments.getListFromFutures(Alignments.java:304) at pakjalphiew.Alignments.runPairwiseScorers(Alignments.java:631) at pakjalphiew.Alignments.getMultipleSequenceAlignment(Alignments.java:194) at pakjalphiew.MSA.msaDNAFromFiles(MSA.java:109) at pakjalphiew.MSACalculation.calculateDNAMSAFromFiles(MSACalculation.java:42) at pakjalphiew.MSAInterFrame.(MSAInterFrame.java:60) at pakjalphiew.LaunchingFrame.newDNAFromFileActionPerformed(LaunchingFrame.java:265) at pakjalphiew.LaunchingFrame.access$000(LaunchingFrame.java:26) at pakjalphiew.LaunchingFrame$1.actionPerformed(LaunchingFrame.java:83) at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995) at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318) at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387) at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242) at javax.swing.AbstractButton.doClick(AbstractButton.java:357) at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:809) at javax.swing.plaf.basic.BasicMenuItemUI$Handler.mouseReleased(BasicMenuItemUI.java:850) at java.awt.Component.processMouseEvent(Component.java:6288) at javax.swing.JComponent.processMouseEvent(JComponent.java:3267) at java.awt.Component.processEvent(Component.java:6053) at java.awt.Container.processEvent(Container.java:2041) at java.awt.Component.dispatchEventImpl(Component.java:4651) at java.awt.Container.dispatchEventImpl(Container.java:2099) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4577) at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238) at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168) at java.awt.Container.dispatchEventImpl(Container.java:2085) at java.awt.Window.dispatchEventImpl(Window.java:2478) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.EventQueue.dispatchEventImpl(EventQueue.java:643) at java.awt.EventQueue.access$000(EventQueue.java:84) at java.awt.EventQueue$1.run(EventQueue.java:602) at java.awt.EventQueue$1.run(EventQueue.java:600) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:98) at java.awt.EventQueue$2.run(EventQueue.java:616) at java.awt.EventQueue$2.run(EventQueue.java:614) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.awt.EventQueue.dispatchEvent(EventQueue.java:613) at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269) at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184) at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161) at java.awt.EventDispatchThread.run(EventDispatchThread.java:122) Caused by: java.lang.NullPointerException at org.biojava3.alignment.FractionalIdentityScorer.align(FractionalIdentityScorer.java:112) at org.biojava3.alignment.FractionalIdentityScorer.getScore(FractionalIdentityScorer.java:105) at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:53) at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:38) at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:303) at java.util.concurrent.FutureTask.run(FutureTask.java:138) at java.util.concurrent.ThreadPoolExecutor$Worker.runTask(ThreadPoolExecutor.java:886) at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:908) at java.lang.Thread.run(Thread.java:662) Exception in thread "AWT-EventQueue-0" java.lang.NullPointerException at pakjalphiew.AlignmentRuler.getRuler(AlignmentRuler.java:34) at pakjalphiew.AlignmentRuler.(AlignmentRuler.java:26) at pakjalphiew.MSAInterFrame.initComponents(MSAInterFrame.java:81) at pakjalphiew.MSAInterFrame.(MSAInterFrame.java:62) at pakjalphiew.LaunchingFrame.newDNAFromFileActionPerformed(LaunchingFrame.java:265) at pakjalphiew.LaunchingFrame.access$000(LaunchingFrame.java:26) at pakjalphiew.LaunchingFrame$1.actionPerformed(LaunchingFrame.java:83) at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995) at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318) at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387) at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242) at javax.swing.AbstractButton.doClick(AbstractButton.java:357) at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:809) at javax.swing.plaf.basic.BasicMenuItemUI$Handler.mouseReleased(BasicMenuItemUI.java:850) at java.awt.Component.processMouseEvent(Component.java:6288) at javax.swing.JComponent.processMouseEvent(JComponent.java:3267) at java.awt.Component.processEvent(Component.java:6053) at java.awt.Container.processEvent(Container.java:2041) at java.awt.Component.dispatchEventImpl(Component.java:4651) at java.awt.Container.dispatchEventImpl(Container.java:2099) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4577) at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238) at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168) at java.awt.Container.dispatchEventImpl(Container.java:2085) at java.awt.Window.dispatchEventImpl(Window.java:2478) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.EventQueue.dispatchEventImpl(EventQueue.java:643) at java.awt.EventQueue.access$000(EventQueue.java:84) at java.awt.EventQueue$1.run(EventQueue.java:602) at java.awt.EventQueue$1.run(EventQueue.java:600) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:98) at java.awt.EventQueue$2.run(EventQueue.java:616) at java.awt.EventQueue$2.run(EventQueue.java:614) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.awt.EventQueue.dispatchEvent(EventQueue.java:613) at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269) at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184) at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161) at java.awt.EventDispatchThread.run(EventDispatchThread.java:122) Muhammad Tariq Pervez Assistant Professor, Department of Computer Science Virtual University of Pakistan, Lahore Tel: (042) 9203114-7 URL: www.vu.edu.pk Mobile: +923364120541, +923214602694 > From: HWillis at scripps.edu > To: tariq_cp at hotmail.com; biojava-l at lists.open-bio.org > Date: Fri, 22 Jul 2011 08:11:34 -0400 > Subject: Re: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment > > Can you include the output of the stack trace as well as a small working > example that causes the exception? > > On 7/22/11 7:56 AM, "Muhammad Tariq Pervez" wrote: > > > > > > > > >Dear all, > > > >I faced the NullPointerException exception while creating the DNA > >MultipleSequenceAlignment. The same goes right with protein sequence. > >Exception is thrown at the following line > > > >dnaProfile = Alignments.getMultipleSequenceAlignment(tmpLst); > > > >tmpLst is list of DNA sequences created/declared as follows > >List tmpLst=new ArrayList(); > > > >Note: the tmpLst is filled/populated with two or more two sequences. > > > >I traced the exception by going into > >Alignments.getMultipleSequenceAlignmen method of the Alignments class and > >found the following line of code the cause of exception. > > > >static List getListFromFutures(List> futures) { > > List list = new ArrayList(); > > for (Future f : futures) { > > // TODO when added to ConcurrencyTools, log completions and > >exceptions instead of printing stack traces > > try { > > > > list.add(f.get());** > > } catch (InterruptedException e) { > > e.printStackTrace(); > > } catch (ExecutionException e) { > > e.printStackTrace(); > > } > > } > > return list; > > } > >** is the cause of exception. All is right with the protein sequences. > >Can any body help/guide me regarding the problem. > > > >Best Regards. > > > > > > > >Tariq, PhD Scholar > > > >_______________________________________________ > >Biojava-l mailing list - Biojava-l at lists.open-bio.org > >http://lists.open-bio.org/mailman/listinfo/biojava-l > From HWillis at scripps.edu Mon Jul 25 09:44:23 2011 From: HWillis at scripps.edu (Scooter Willis) Date: Mon, 25 Jul 2011 09:44:23 -0400 Subject: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment In-Reply-To: Message-ID: Not sure if this is an issue with the MultipleSequenceAlignment code versus the way you are doing pairwise is simply throwing a concurrency exception. Can you complete all pairwise comparisons independently to rule out a problem related to the code and the sequences you are trying to align? From: Muhammad Tariq Pervez > Date: Mon, 25 Jul 2011 06:27:02 -0400 To: Scooter Willis >, "Biojava-l at lists.open-bio.org" > Subject: RE: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment Following is tmpLst filled with two DNA sequences. Scorers object is displayed from inside the object of Alignments (getMultipleSequenceAlignment method). All==1 is displayed from inside the method of public static , C extends Compound> int[] runPairwiseScorers( List> scorers) { (class is Alignments) as follows all = scorers.size(); But the line System.out.println("futures==="+futures.get(0).get()); causes NullPointer Exception. List> futures = new ArrayList>(); for (PairwiseSequenceScorer scorer : scorers) { futures.add(ConcurrencyTools.submit(new CallablePairwiseSequenceScorer(scorer), String.format("Scoring pair %d of %d", n++, all))); } try{ // perhaps this code is not working fine. System.out.println("futures==="+futures.get(0).get()); tmpLst==[GAATCTATAGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCAGGTAGTCGACTCAGATTCTTGTAGTGGCTCTCATCTGATCAAGGGTATTATTCCCAAGCCATAGTAAGGTCTTCTGTTGTGCCTTTTGCTTATACATCAGGTAACATGATAGAACTAGGCTAAGTG, ATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTAATGCTGATCACTCGGACTATGCTGATATTGAGCTGTATCCGTCTGACAAGCTCTCTTGACGGCAGGCCCCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGAGATAAGGAGGCATGTGCAAAAGCCCCATTGGAGGCATATAACAGAACACTGACTACTCTGCTCACTC] sequences=== [GAATCTATAGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCAGGTAGTCGACTCAGATTCTTGTAGTGGCTCTCATCTGATCAAGGGTATTATTCCCAAGCCATAGTAAGGTCTTCTGTTGTGCCTTTTGCTTATACATCAGGTAACATGATAGAACTAGGCTAAGTG, ATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTAATGCTGATCACTCGGACTATGCTGATATTGAGCTGTATCCGTCTGACAAGCTCTCTTGACGGCAGGCCCCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGAGATAAGGAGGCATGTGCAAAAGCCCCATTGGAGGCATATAACAGAACACTGACTACTCTGCTCACTC] scorers=== [org.biojava3.alignment.FractionalIdentityScorer at d337d3] all===1 scorers===org.biojava3.alignment.FractionalIdentityScorer at d337d3 java.util.concurrent.ExecutionException: java.lang.NullPointerException at java.util.concurrent.FutureTask$Sync.innerGet(FutureTask.java:222) at java.util.concurrent.FutureTask.get(FutureTask.java:83) at pakjalphiew.Alignments.getListFromFutures(Alignments.java:304) at pakjalphiew.Alignments.runPairwiseScorers(Alignments.java:631) at pakjalphiew.Alignments.getMultipleSequenceAlignment(Alignments.java:194) at pakjalphiew.MSA.msaDNAFromFiles(MSA.java:109) at pakjalphiew.MSACalculation.calculateDNAMSAFromFiles(MSACalculation.java:42) at pakjalphiew.MSAInterFrame.(MSAInterFrame.java:60) at pakjalphiew.LaunchingFrame.newDNAFromFileActionPerformed(LaunchingFrame.java:265) at pakjalphiew.LaunchingFrame.access$000(LaunchingFrame.java:26) at pakjalphiew.LaunchingFrame$1.actionPerformed(LaunchingFrame.java:83) at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995) at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318) at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387) at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242) at javax.swing.AbstractButton.doClick(AbstractButton.java:357) at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:809) at javax.swing.plaf.basic.BasicMenuItemUI$Handler.mouseReleased(BasicMenuItemUI.java:850) at java.awt.Component.processMouseEvent(Component.java:6288) at javax.swing.JComponent.processMouseEvent(JComponent.java:3267) at java.awt.Component.processEvent(Component.java:6053) at java.awt.Container.processEvent(Container.java:2041) at java.awt.Component.dispatchEventImpl(Component.java:4651) at java.awt.Container.dispatchEventImpl(Container.java:2099) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4577) at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238) at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168) at java.awt.Container.dispatchEventImpl(Container.java:2085) at java.awt.Window.dispatchEventImpl(Window.java:2478) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.EventQueue.dispatchEventImpl(EventQueue.java:643) at java.awt.EventQueue.access$000(EventQueue.java:84) at java.awt.EventQueue$1.run(EventQueue.java:602) at java.awt.EventQueue$1.run(EventQueue.java:600) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:98) at java.awt.EventQueue$2.run(EventQueue.java:616) at java.awt.EventQueue$2.run(EventQueue.java:614) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.awt.EventQueue.dispatchEvent(EventQueue.java:613) at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269) at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184) at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161) at java.awt.EventDispatchThread.run(EventDispatchThread.java:122) Caused by: java.lang.NullPointerException at org.biojava3.alignment.FractionalIdentityScorer.align(FractionalIdentityScorer.java:112) at org.biojava3.alignment.FractionalIdentityScorer.getScore(FractionalIdentityScorer.java:105) at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:53) at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:38) at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:303) at java.util.concurrent.FutureTask.run(FutureTask.java:138) at java.util.concurrent.ThreadPoolExecutor$Worker.runTask(ThreadPoolExecutor.java:886) at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:908) at java.lang.Thread.run(Thread.java:662) Exception in thread "AWT-EventQueue-0" java.lang.NullPointerException at pakjalphiew.AlignmentRuler.getRuler(AlignmentRuler.java:34) at pakjalphiew.AlignmentRuler.(AlignmentRuler.java:26) at pakjalphiew.MSAInterFrame.initComponents(MSAInterFrame.java:81) at pakjalphiew.MSAInterFrame.(MSAInterFrame.java:62) at pakjalphiew.LaunchingFrame.newDNAFromFileActionPerformed(LaunchingFrame.java:265) at pakjalphiew.LaunchingFrame.access$000(LaunchingFrame.java:26) at pakjalphiew.LaunchingFrame$1.actionPerformed(LaunchingFrame.java:83) at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995) at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318) at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387) at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242) at javax.swing.AbstractButton.doClick(AbstractButton.java:357) at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:809) at javax.swing.plaf.basic.BasicMenuItemUI$Handler.mouseReleased(BasicMenuItemUI.java:850) at java.awt.Component.processMouseEvent(Component.java:6288) at javax.swing.JComponent.processMouseEvent(JComponent.java:3267) at java.awt.Component.processEvent(Component.java:6053) at java.awt.Container.processEvent(Container.java:2041) at java.awt.Component.dispatchEventImpl(Component.java:4651) at java.awt.Container.dispatchEventImpl(Container.java:2099) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4577) at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238) at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168) at java.awt.Container.dispatchEventImpl(Container.java:2085) at java.awt.Window.dispatchEventImpl(Window.java:2478) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.EventQueue.dispatchEventImpl(EventQueue.java:643) at java.awt.EventQueue.access$000(EventQueue.java:84) at java.awt.EventQueue$1.run(EventQueue.java:602) at java.awt.EventQueue$1.run(EventQueue.java:600) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:98) at java.awt.EventQueue$2.run(EventQueue.java:616) at java.awt.EventQueue$2.run(EventQueue.java:614) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.awt.EventQueue.dispatchEvent(EventQueue.java:613) at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269) at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184) at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161) at java.awt.EventDispatchThread.run(EventDispatchThread.java:122) Muhammad Tariq Pervez Assistant Professor, Department of Computer Science Virtual University of Pakistan, Lahore Tel: (042) 9203114-7 URL: www.vu.edu.pk Mobile: +923364120541, +923214602694 > From: HWillis at scripps.edu > To: tariq_cp at hotmail.com; biojava-l at lists.open-bio.org > Date: Fri, 22 Jul 2011 08:11:34 -0400 > Subject: Re: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment > > Can you include the output of the stack trace as well as a small working > example that causes the exception? > > On 7/22/11 7:56 AM, "Muhammad Tariq Pervez" > wrote: > > > > > > > > >Dear all, > > > >I faced the NullPointerException exception while creating the DNA > >MultipleSequenceAlignment. The same goes right with protein sequence. > >Exception is thrown at the following line > > > >dnaProfile = Alignments.getMultipleSequenceAlignment(tmpLst); > > > >tmpLst is list of DNA sequences created/declared as follows > >List tmpLst=new ArrayList(); > > > >Note: the tmpLst is filled/populated with two or more two sequences. > > > >I traced the exception by going into > >Alignments.getMultipleSequenceAlignmen method of the Alignments class and > >found the following line of code the cause of exception. > > > >static List getListFromFutures(List> futures) { > > List list = new ArrayList(); > > for (Future f : futures) { > > // TODO when added to ConcurrencyTools, log completions and > >exceptions instead of printing stack traces > > try { > > > > list.add(f.get());** > > } catch (InterruptedException e) { > > e.printStackTrace(); > > } catch (ExecutionException e) { > > e.printStackTrace(); > > } > > } > > return list; > > } > >** is the cause of exception. All is right with the protein sequences. > >Can any body help/guide me regarding the problem. > > > >Best Regards. > > > > > > > >Tariq, PhD Scholar > > > >_______________________________________________ > >Biojava-l mailing list - Biojava-l at lists.open-bio.org > >http://lists.open-bio.org/mailman/listinfo/biojava-l > From tariq_cp at hotmail.com Tue Jul 26 08:14:37 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Tue, 26 Jul 2011 12:14:37 +0000 Subject: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment In-Reply-To: References: , Message-ID: Eventaully, I succeeded in finding the exact location of exception and fixes it as well. The problem is with that in getMultipleSequenceAlignment Method of Alignments class there are two 'if' statements as follows: if (cs == AminoAcidCompoundSet.getAminoAcidCompoundSet()) { @SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getBlosum62(); subMatrix = temp; }else if (cs == AmbiguityDNACompoundSet.getDNACompoundSet()) { @SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getNuc4_4(); subMatrix = temp; System.out.println("Inside getMSA===" +subMatrix); } and 'subMatrix' remains null when we try to DNA sequences. But when i added the third 'if' statement as follows the problem fixes and DNA sequences are aligned correctly. if (cs == AminoAcidCompoundSet.getAminoAcidCompoundSet()) { @SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getBlosum62(); subMatrix = temp; } else if (cs == DNACompoundSet.getDNACompoundSet()) { @SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getNuc4_4(); subMatrix = temp; System.out.println("Inside getMSA===" +subMatrix); } else if (cs == AmbiguityDNACompoundSet.getDNACompoundSet()) { @SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getNuc4_4(); subMatrix = temp; System.out.println("Inside getMSA===" +subMatrix); } Tariq, Phd Scholar From: HWillis at scripps.edu To: tariq_cp at hotmail.com; biojava-l at lists.open-bio.org Date: Mon, 25 Jul 2011 09:44:23 -0400 Subject: Re: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment Not sure if this is an issue with the MultipleSequenceAlignment code versus the way you are doing pairwise is simply throwing a concurrency exception. Can you complete all pairwise comparisons independently to rule out a problem related to the code and the sequences you are trying to align? From: Muhammad Tariq Pervez Date: Mon, 25 Jul 2011 06:27:02 -0400 To: Scooter Willis , "Biojava-l at lists.open-bio.org" Subject: RE: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment Following is tmpLst filled with two DNA sequences. Scorers object is displayed from inside the object of Alignments (getMultipleSequenceAlignment method). All==1 is displayed from inside the method of public static , C extends Compound> int[] runPairwiseScorers( List> scorers) { (class is Alignments) as follows all = scorers.size(); But the line System.out.println("futures==="+futures.get(0).get()); causes NullPointer Exception. List> futures = new ArrayList>(); for (PairwiseSequenceScorer scorer : scorers) { futures.add(ConcurrencyTools.submit(new CallablePairwiseSequenceScorer(scorer), String.format("Scoring pair %d of %d", n++, all))); } try{ // perhaps this code is not working fine. System.out.println("futures==="+futures.get(0).get()); tmpLst==[GAATCTATAGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCAGGTAGTCGACTCAGATTCTTGTAGTGGCTCTCATCTGATCAAGGGTATTATTCCCAAGCCATAGTAAGGTCTTCTGTTGTGCCTTTTGCTTATACATCAGGTAACATGATAGAACTAGGCTAAGTG, ATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTAATGCTGATCACTCGGACTATGCTGATATTGAGCTGTATCCGTCTGACAAGCTCTCTTGACGGCAGGCCCCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGAGATAAGGAGGCATGTGCAAAAGCCCCATTGGAGGCATATAACAGAACACTGACTACTCTGCTCACTC] sequences=== [GAATCTATAGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCAGGTAGTCGACTCAGATTCTTGTAGTGGCTCTCATCTGATCAAGGGTATTATTCCCAAGCCATAGTAAGGTCTTCTGTTGTGCCTTTTGCTTATACATCAGGTAACATGATAGAACTAGGCTAAGTG, ATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTAATGCTGATCACTCGGACTATGCTGATATTGAGCTGTATCCGTCTGACAAGCTCTCTTGACGGCAGGCCCCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGAGATAAGGAGGCATGTGCAAAAGCCCCATTGGAGGCATATAACAGAACACTGACTACTCTGCTCACTC] scorers=== [org.biojava3.alignment.FractionalIdentityScorer at d337d3] all===1 scorers===org.biojava3.alignment.FractionalIdentityScorer at d337d3 java.util.concurrent.ExecutionException: java.lang.NullPointerException at java.util.concurrent.FutureTask$Sync.innerGet(FutureTask.java:222) at java.util.concurrent.FutureTask.get(FutureTask.java:83) at pakjalphiew.Alignments.getListFromFutures(Alignments.java:304) at pakjalphiew.Alignments.runPairwiseScorers(Alignments.java:631) at pakjalphiew.Alignments.getMultipleSequenceAlignment(Alignments.java:194) at pakjalphiew.MSA.msaDNAFromFiles(MSA.java:109) at pakjalphiew.MSACalculation.calculateDNAMSAFromFiles(MSACalculation.java:42) at pakjalphiew.MSAInterFrame.(MSAInterFrame.java:60) at pakjalphiew.LaunchingFrame.newDNAFromFileActionPerformed(LaunchingFrame.java:265) at pakjalphiew.LaunchingFrame.access$000(LaunchingFrame.java:26) at pakjalphiew.LaunchingFrame$1.actionPerformed(LaunchingFrame.java:83) at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995) at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318) at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387) at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242) at javax.swing.AbstractButton.doClick(AbstractButton.java:357) at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:809) at javax.swing.plaf.basic.BasicMenuItemUI$Handler.mouseReleased(BasicMenuItemUI.java:850) at java.awt.Component.processMouseEvent(Component.java:6288) at javax.swing.JComponent.processMouseEvent(JComponent.java:3267) at java.awt.Component.processEvent(Component.java:6053) at java.awt.Container.processEvent(Container.java:2041) at java.awt.Component.dispatchEventImpl(Component.java:4651) at java.awt.Container.dispatchEventImpl(Container.java:2099) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4577) at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238) at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168) at java.awt.Container.dispatchEventImpl(Container.java:2085) at java.awt.Window.dispatchEventImpl(Window.java:2478) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.EventQueue.dispatchEventImpl(EventQueue.java:643) at java.awt.EventQueue.access$000(EventQueue.java:84) at java.awt.EventQueue$1.run(EventQueue.java:602) at java.awt.EventQueue$1.run(EventQueue.java:600) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:98) at java.awt.EventQueue$2.run(EventQueue.java:616) at java.awt.EventQueue$2.run(EventQueue.java:614) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.awt.EventQueue.dispatchEvent(EventQueue.java:613) at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269) at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184) at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161) at java.awt.EventDispatchThread.run(EventDispatchThread.java:122) Caused by: java.lang.NullPointerException at org.biojava3.alignment.FractionalIdentityScorer.align(FractionalIdentityScorer.java:112) at org.biojava3.alignment.FractionalIdentityScorer.getScore(FractionalIdentityScorer.java:105) at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:53) at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:38) at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:303) at java.util.concurrent.FutureTask.run(FutureTask.java:138) at java.util.concurrent.ThreadPoolExecutor$Worker.runTask(ThreadPoolExecutor.java:886) at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:908) at java.lang.Thread.run(Thread.java:662) Exception in thread "AWT-EventQueue-0" java.lang.NullPointerException at pakjalphiew.AlignmentRuler.getRuler(AlignmentRuler.java:34) at pakjalphiew.AlignmentRuler.(AlignmentRuler.java:26) at pakjalphiew.MSAInterFrame.initComponents(MSAInterFrame.java:81) at pakjalphiew.MSAInterFrame.(MSAInterFrame.java:62) at pakjalphiew.LaunchingFrame.newDNAFromFileActionPerformed(LaunchingFrame.java:265) at pakjalphiew.LaunchingFrame.access$000(LaunchingFrame.java:26) at pakjalphiew.LaunchingFrame$1.actionPerformed(LaunchingFrame.java:83) at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995) at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318) at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387) at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242) at javax.swing.AbstractButton.doClick(AbstractButton.java:357) at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:809) at javax.swing.plaf.basic.BasicMenuItemUI$Handler.mouseReleased(BasicMenuItemUI.java:850) at java.awt.Component.processMouseEvent(Component.java:6288) at javax.swing.JComponent.processMouseEvent(JComponent.java:3267) at java.awt.Component.processEvent(Component.java:6053) at java.awt.Container.processEvent(Container.java:2041) at java.awt.Component.dispatchEventImpl(Component.java:4651) at java.awt.Container.dispatchEventImpl(Container.java:2099) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4577) at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238) at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168) at java.awt.Container.dispatchEventImpl(Container.java:2085) at java.awt.Window.dispatchEventImpl(Window.java:2478) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.EventQueue.dispatchEventImpl(EventQueue.java:643) at java.awt.EventQueue.access$000(EventQueue.java:84) at java.awt.EventQueue$1.run(EventQueue.java:602) at java.awt.EventQueue$1.run(EventQueue.java:600) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:98) at java.awt.EventQueue$2.run(EventQueue.java:616) at java.awt.EventQueue$2.run(EventQueue.java:614) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.awt.EventQueue.dispatchEvent(EventQueue.java:613) at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269) at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184) at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161) at java.awt.EventDispatchThread.run(EventDispatchThread.java:122) Muhammad Tariq Pervez Assistant Professor, Department of Computer Science Virtual University of Pakistan, Lahore Tel: (042) 9203114-7 URL: www.vu.edu.pk Mobile: +923364120541, +923214602694 > From: HWillis at scripps.edu > To: tariq_cp at hotmail.com; biojava-l at lists.open-bio.org > Date: Fri, 22 Jul 2011 08:11:34 -0400 > Subject: Re: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment > > Can you include the output of the stack trace as well as a small working > example that causes the exception? > > On 7/22/11 7:56 AM, "Muhammad Tariq Pervez" wrote: > > > > > > > > >Dear all, > > > >I faced the NullPointerException exception while creating the DNA > >MultipleSequenceAlignment. The same goes right with protein sequence. > >Exception is thrown at the following line > > > >dnaProfile = Alignments.getMultipleSequenceAlignment(tmpLst); > > > >tmpLst is list of DNA sequences created/declared as follows > >List tmpLst=new ArrayList(); > > > >Note: the tmpLst is filled/populated with two or more two sequences. > > > >I traced the exception by going into > >Alignments.getMultipleSequenceAlignmen method of the Alignments class and > >found the following line of code the cause of exception. > > > >static List getListFromFutures(List> futures) { > > List list = new ArrayList(); > > for (Future f : futures) { > > // TODO when added to ConcurrencyTools, log completions and > >exceptions instead of printing stack traces > > try { > > > > list.add(f.get());** > > } catch (InterruptedException e) { > > e.printStackTrace(); > > } catch (ExecutionException e) { > > e.printStackTrace(); > > } > > } > > return list; > > } > >** is the cause of exception. All is right with the protein sequences. > >Can any body help/guide me regarding the problem. > > > >Best Regards. > > > > > > > >Tariq, PhD Scholar > > > >_______________________________________________ > >Biojava-l mailing list - Biojava-l at lists.open-bio.org > >http://lists.open-bio.org/mailman/listinfo/biojava-l > From peter.penzov at gmail.com Tue Jul 26 13:43:52 2011 From: peter.penzov at gmail.com (Peter Penzov) Date: Tue, 26 Jul 2011 20:43:52 +0300 Subject: [Biojava-l] Invitation for Open Source Project Message-ID: Hi, I'm starting an open source project which involves web based Java, JBoss application server and JBoss Seam 3. I'm a student and I work on the project in my free time for training. Every one who want to take a part in this hobby project in his free time is invited. Send me e-mail. peter. penzov(at)gmail. com Regards Peter From tr3nton at gmail.com Thu Jul 28 19:32:43 2011 From: tr3nton at gmail.com (Trent Schafer) Date: Fri, 29 Jul 2011 09:32:43 +1000 Subject: [Biojava-l] ab1 files Message-ID: Hi, Not sure if anyone can help or advise - still just trying to figure it out. We are using this database software to manage our clinical studies, and we want to add the functionality to store sequencing files, and hopefully some useful information extracted from the files we upload. I found in the legacy cookbooks the following: http://biojava.org/wiki/BioJava:Cookbook:SeqIO:ABItoSequence and based on an AB1 file I have on my workstation, was able to successfully run the code listed - I presume its also possible to extract the quality scores? Anyway, was trying to see if these files can be read in BioJava 3.x? I was trying the 2 examples listed here: http://biojava.org/wiki/BioJava:CookBook:Core:FastaReadWrite but the exception is thrown: Exception in thread "main" org.biojava3.core.exceptions.CompoundNotFoundError: Compound not found for: Cannot find compound for: So my assumption is that it just doesn't know how to read AB1 files? To summarise, is it only possible read AB1 files in the legacy version of the software? I assume its better to be using 3.x if possible? There is a section of the 3.x cookbook: http://biojava.org/wiki/BioJava:CookBook:Core:Sequences is it that this hasn't been implemented yet, or is just undocumented? Any information is much appreciated. Thx, Trent From HWillis at scripps.edu Thu Jul 28 21:11:46 2011 From: HWillis at scripps.edu (Scooter Willis) Date: Thu, 28 Jul 2011 21:11:46 -0400 Subject: [Biojava-l] ab1 files In-Reply-To: Message-ID: Trent We do not have support for AB1 files in Biojava3. Do you have any interest in working/migrating the code for the AB1 file parser? I can assist if you want to work on it. Scooter On 7/28/11 7:32 PM, "Trent Schafer" wrote: >Hi, > >Not sure if anyone can help or advise - still just trying to figure it >out. > >We are using this database software to manage our clinical studies, and we >want to add the functionality to store sequencing files, and hopefully >some >useful information extracted from the files we upload. > >I found in the legacy cookbooks the following: >http://biojava.org/wiki/BioJava:Cookbook:SeqIO:ABItoSequence and based on >an >AB1 file I have on my workstation, was able to successfully run the code >listed - I presume its also possible to extract the quality scores? > >Anyway, was trying to see if these files can be read in BioJava 3.x? > >I was trying the 2 examples listed here: >http://biojava.org/wiki/BioJava:CookBook:Core:FastaReadWrite but the >exception is thrown: Exception in thread "main" >org.biojava3.core.exceptions.CompoundNotFoundError: Compound not found >for: >Cannot find compound for: > >So my assumption is that it just doesn't know how to read AB1 files? > >To summarise, is it only possible read AB1 files in the legacy version of >the software? I assume its better to be using 3.x if possible? There is a >section of the 3.x cookbook: >http://biojava.org/wiki/BioJava:CookBook:Core:Sequences is it that this >hasn't been implemented yet, or is just undocumented? > >Any information is much appreciated. > >Thx, >Trent >_______________________________________________ >Biojava-l mailing list - Biojava-l at lists.open-bio.org >http://lists.open-bio.org/mailman/listinfo/biojava-l From amr_alhossary at hotmail.com Thu Jul 28 21:42:01 2011 From: amr_alhossary at hotmail.com (Amr AL-Hossary) Date: Fri, 29 Jul 2011 03:42:01 +0200 Subject: [Biojava-l] ab1 files In-Reply-To: References: Message-ID: If we agreed on migrating the code to Biojava3, I can do it. especially as I haven't done something useful on the group for a while. Amr -------------------------------------------------- From: "Scooter Willis" Sent: Friday, July 29, 2011 3:11 AM To: "Trent Schafer" ; "Biojava-l at lists.open-bio.org" Subject: Re: [Biojava-l] ab1 files > Trent > > We do not have support for AB1 files in Biojava3. Do you have any interest > in working/migrating the code for the AB1 file parser? I can assist if you > want to work on it. > > Scooter > > On 7/28/11 7:32 PM, "Trent Schafer" wrote: > >>Hi, >> >>Not sure if anyone can help or advise - still just trying to figure it >>out. >> >>We are using this database software to manage our clinical studies, and we >>want to add the functionality to store sequencing files, and hopefully >>some >>useful information extracted from the files we upload. >> >>I found in the legacy cookbooks the following: >>http://biojava.org/wiki/BioJava:Cookbook:SeqIO:ABItoSequence and based on >>an >>AB1 file I have on my workstation, was able to successfully run the code >>listed - I presume its also possible to extract the quality scores? >> >>Anyway, was trying to see if these files can be read in BioJava 3.x? >> >>I was trying the 2 examples listed here: >>http://biojava.org/wiki/BioJava:CookBook:Core:FastaReadWrite but the >>exception is thrown: Exception in thread "main" >>org.biojava3.core.exceptions.CompoundNotFoundError: Compound not found >>for: >>Cannot find compound for: >> >>So my assumption is that it just doesn't know how to read AB1 files? >> >>To summarise, is it only possible read AB1 files in the legacy version of >>the software? I assume its better to be using 3.x if possible? There is a >>section of the 3.x cookbook: >>http://biojava.org/wiki/BioJava:CookBook:Core:Sequences is it that this >>hasn't been implemented yet, or is just undocumented? >> >>Any information is much appreciated. >> >>Thx, >>Trent >>_______________________________________________ >>Biojava-l mailing list - Biojava-l at lists.open-bio.org >>http://lists.open-bio.org/mailman/listinfo/biojava-l > > > _______________________________________________ > Biojava-l mailing list - Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From sylvain.foisy at diploide.net Fri Jul 1 22:32:20 2011 From: sylvain.foisy at diploide.net (Sylvain Foisy) Date: Fri, 1 Jul 2011 18:32:20 -0400 (EDT) Subject: [Biojava-l] Help on NCBIQBlastService and BlastXMLQuery Message-ID: <60828.76.10.128.89.1309559540.squirrel@humboldt.cyberlogic.net> Hi, I am the main culprit for this code ;-) If you can bear waiting some days, I'll try my outmost to help you out on this. I am presently on vacation outside my country and I do not have access to a computer. However, my first guess: the XML code that you get from NCBI does not behave the way it is expected by the BlastXMLQuery class... The Javadocs for this class is rather slim :-( Back to you ASAP around July 11-12. Best regards and thank you for your patience. Sylvain =================================================================== Sylvain Foisy, Ph. D. Consultant Bio-informatique / Bioinformatics Diploide.net - TI pour la vie / IT for Life Courriel: sylvain.foisy at diploide.net Web: http://www.diploide.net =================================================================== From tariq_cp at hotmail.com Wed Jul 6 11:37:05 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Wed, 6 Jul 2011 11:37:05 +0000 Subject: [Biojava-l] No. of gaps in aligned sequences Message-ID: Hi, Dear all, I am working on the development of MSA application using BioJava. I want to make clear a thing. It is that when two or more protein sequences are aligned the '-' is shown more times in an aligned sequence than the gaps display by the method of alSeq.getNumGaps(). 'alSeq' is an aligned sequence. For example, if there are actual 50 '-' in an aligned sequence but the method shows it only 30. What is the difference between these two results. Best Regards Tariq, Phd Scholar From drd6y at virginia.edu Wed Jul 6 16:07:07 2011 From: drd6y at virginia.edu (Daniel Di Giulio) Date: Wed, 6 Jul 2011 12:07:07 -0400 Subject: [Biojava-l] BioJava Gene Hierarchies Message-ID: Hello, I'm currently using BioJava to upgrade a eukaryotic gene finder program (EVIGAN) to be compatible with the GFF3 formats. Your BioJava genome package is very useful, but I had a question about implementing a sort of gene hierarchy from parsed files. Essentially, I would like to be able to read in a GFF3 file of a region of interest, parse out the CDS segments, and then create a hierarchy of genes from the attribute tags, which I can then employ later in my program. It seems as if the org.biojava3.genome.parsers.gff class is good for this, but there doesn't seem to be a data structure for organizing related "Feature" objects into a higher grouping based on similar attributes. Does anyone know of a way to implement this, or a package within BioJava which could be useful? Thanks a lot, Daniel From tariq_cp at hotmail.com Thu Jul 7 08:48:08 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Thu, 7 Jul 2011 08:48:08 +0000 Subject: [Biojava-l] Page creation in Biojava Message-ID: Hi, All I want to contribute in BioJava CookBook. I have already login id/account. I can create internal/external links. But further what to do. How can i create a page and link to the internal/external link. Regards. Tariq, Phd Scholar From andreas at sdsc.edu Thu Jul 7 15:10:53 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Thu, 7 Jul 2011 08:10:53 -0700 Subject: [Biojava-l] No. of gaps in aligned sequences In-Reply-To: References: Message-ID: Hi Tariq, Can you send us the sample code / DB accession IDs so we can try to reproduce this? Andreas On Wed, Jul 6, 2011 at 4:37 AM, Muhammad Tariq Pervez wrote: > > > Hi, Dear all, > I am working on the development of MSA application using BioJava. I want to make clear a thing. It is that when two or more protein sequences are aligned the '-' is shown more times in an aligned sequence than the gaps display by the method of alSeq.getNumGaps(). 'alSeq' is an aligned sequence. For example, if there are actual 50 '-' in an aligned sequence but the method shows it only 30. What is the difference between these two results. > > Best Regards > > > Tariq, Phd Scholar > > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From mstewart at vbi.vt.edu Thu Jul 7 20:56:15 2011 From: mstewart at vbi.vt.edu (Mark Stewart) Date: Thu, 7 Jul 2011 16:56:15 -0400 Subject: [Biojava-l] Local DB BLAST Comparison/Search Message-ID: I'm a relatively new programmer, so I'm probably missing a number of obvious things, but if someone wouldn't mind pointing me in the right direction, that'd be great, because I'm having trouble figuring stuff out from the API. Just generally, which of the alignment/BLAST-related classes do I want to be looking over and using if I want to write some JAVA for doing similar sequence searches of a local database using the BLAST algorithm? -M From andreas at sdsc.edu Thu Jul 7 22:46:29 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Thu, 7 Jul 2011 15:46:29 -0700 Subject: [Biojava-l] Page creation in Biojava In-Reply-To: References: Message-ID: Hi Tariq, A easy way to create a new page is to create a link from an existing page and then click on that link. This should take you to the edit view of the new page. See also: http://meta.wikimedia.org/wiki/Help:Starting_a_new_page Andreas On Thu, Jul 7, 2011 at 1:48 AM, Muhammad Tariq Pervez wrote: > > Hi, All > I want to contribute in BioJava CookBook. I have already login id/account. I can create internal/external links. But further what to do. How can i create a page and link to the internal/external link. > > Regards. > > > Tariq, Phd Scholar > > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From tariq_cp at hotmail.com Fri Jul 8 05:09:08 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Fri, 8 Jul 2011 05:09:08 +0000 Subject: [Biojava-l] Biojava-l Digest, Vol 102, Issue 4 In-Reply-To: References: Message-ID: The code is as follows: Actually the code is taken from BioJavaCookbook with a little modification. The following method is called from another class. The method takes the names of the files or simply say files as an argument in the form of list. public void MSAFromFiles(List ids) throws Exception{ List lst = new ArrayList(); ProteinSequence pSeq=null; for (String id : ids) { pSeq=getSequenceFromFiles(id); lst.add(pSeq); //System.out.println("seq==" +pSeq); } profile = Alignments.getMultipleSequenceAlignment(lst); } getSequenceFromFiles() method is given below private ProteinSequence getSequenceFromFiles(String inputFile) throws Exception{ ProteinSequence seq=null; //System.out.println("inputFile==="+inputFile); FileInputStream is = new FileInputStream(inputFile); FastaReader fastaReader = new FastaReader(is, new GenericFastaHeaderParser(), new ProteinSequenceCreator(AminoAcidCompoundSet.getAminoAcidCompoundSet())); LinkedHashMap proteinSequences = fastaReader.process(); is.close(); //System.out.println( "proteinSequences=" + proteinSequences ); //LinkedHashMap a = FastaReaderHelper.readFastaProteinSequence(new File(fileName)); for ( Entry entry : proteinSequences.entrySet() ) { seq= new ProteinSequence(entry.getValue().getSequenceAsString()); seq.setAccession(entry.getValue().getAccession()); //System.out.println( "Inside getSequenceFromFile=" + seq ); //FastaReaderHelper.readFastaDNASequence for DNA sequences } return seq; } After getting the Profile object I wrote the following code to display the No. of gaps List> listOfalSeq=profile.getAlignedSequences(); AlignedSequence alSeq; int noOfcompounds=0; int numOfGaps=0; StringBuilder html= new StringBuilder(""); for (int i=0; i"); //System.out.println("accessionId==" +accessionId); //pSeq=new ProteinSequence(seq.getSequenceAsString(),seq.getCompoundSet()); //pSeq.setAccession(seq.getAccession()); //multipleSequenceAlignment.addAlignedSequence(pSeq); } html.append("
Accession IdNumber of gaps
"); html.append(accessionId); html.append(""); html.append(numOfGaps); html.append("
"); setText(html.toString()); setText() method is the method of JEditorPane or JTextPane Tariq, Phd Scholar > From: biojava-l-request at lists.open-bio.org > Subject: Biojava-l Digest, Vol 102, Issue 4 > To: biojava-l at lists.open-bio.org > Date: Thu, 7 Jul 2011 12:00:04 -0400 > > Send Biojava-l mailing list submissions to > biojava-l at lists.open-bio.org > > To subscribe or unsubscribe via the World Wide Web, visit > http://lists.open-bio.org/mailman/listinfo/biojava-l > or, via email, send a message with subject or body 'help' to > biojava-l-request at lists.open-bio.org > > You can reach the person managing the list at > biojava-l-owner at lists.open-bio.org > > When replying, please edit your Subject line so it is more specific > than "Re: Contents of Biojava-l digest..." > > > Today's Topics: > > 1. BioJava Gene Hierarchies (Daniel Di Giulio) > 2. Page creation in Biojava (Muhammad Tariq Pervez) > 3. Re: No. of gaps in aligned sequences (Andreas Prlic) > > > ---------------------------------------------------------------------- > > Message: 1 > Date: Wed, 6 Jul 2011 12:07:07 -0400 > From: Daniel Di Giulio > Subject: [Biojava-l] BioJava Gene Hierarchies > To: biojava-l at lists.open-bio.org > Message-ID: > > Content-Type: text/plain; charset=ISO-8859-1 > > Hello, > > I'm currently using BioJava to upgrade a eukaryotic gene finder program > (EVIGAN) to be compatible with the GFF3 formats. Your BioJava genome > package is very useful, but I had a question about implementing a sort of > gene hierarchy from parsed files. Essentially, I would like to be able to > read in a GFF3 file of a region of interest, parse out the CDS segments, and > then create a hierarchy of genes from the attribute tags, which I can then > employ later in my program. It seems as if the > org.biojava3.genome.parsers.gff class is good for this, but there doesn't > seem to be a data structure for organizing related "Feature" objects into a > higher grouping based on similar attributes. Does anyone know of a way to > implement this, or a package within BioJava which could be useful? > > Thanks a lot, > Daniel > > > ------------------------------ > > Message: 2 > Date: Thu, 7 Jul 2011 08:48:08 +0000 > From: Muhammad Tariq Pervez > Subject: [Biojava-l] Page creation in Biojava > To: > Message-ID: > Content-Type: text/plain; charset="iso-8859-1" > > > Hi, All > I want to contribute in BioJava CookBook. I have already login id/account. I can create internal/external links. But further what to do. How can i create a page and link to the internal/external link. > > Regards. > > > Tariq, Phd Scholar > > > > ------------------------------ > > Message: 3 > Date: Thu, 7 Jul 2011 08:10:53 -0700 > From: Andreas Prlic > Subject: Re: [Biojava-l] No. of gaps in aligned sequences > To: Muhammad Tariq Pervez > Cc: biojava-dev at biojava.org, biojava-l at biojava.org > Message-ID: > > Content-Type: text/plain; charset=ISO-8859-1 > > Hi Tariq, > > Can you send us the sample code / DB accession IDs so we can try to > reproduce this? > > Andreas > > On Wed, Jul 6, 2011 at 4:37 AM, Muhammad Tariq Pervez > wrote: > > > > > > Hi, Dear all, > > I am working on the development of MSA application using BioJava. I want to make clear a thing. It is that when two or more protein sequences are aligned the '-' is shown more times in an aligned sequence than the gaps display by the method of alSeq.getNumGaps(). 'alSeq' is an aligned sequence. For example, if there are actual 50 '-' in an aligned sequence but the method shows it only 30. What is the difference between these two results. > > > > Best Regards > > > > > > Tariq, Phd Scholar > > > > _______________________________________________ > > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/biojava-l > > > > > > ------------------------------ > > _______________________________________________ > Biojava-l mailing list - Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > > > End of Biojava-l Digest, Vol 102, Issue 4 > ***************************************** From tariq_cp at hotmail.com Fri Jul 8 05:09:51 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Fri, 8 Jul 2011 05:09:51 +0000 Subject: [Biojava-l] No. of gaps in aligned sequences In-Reply-To: References: , Message-ID: The code is as follows: Actually the code is taken from BioJavaCookbook with a little modification. The following method is called from another class. The method takes the names of the files or simply say files as an argument in the form of list. public void MSAFromFiles(List ids) throws Exception{ List lst = new ArrayList(); ProteinSequence pSeq=null; for (String id : ids) { pSeq=getSequenceFromFiles(id); lst.add(pSeq); //System.out.println("seq==" +pSeq); } profile = Alignments.getMultipleSequenceAlignment(lst); } getSequenceFromFiles() method is given below private ProteinSequence getSequenceFromFiles(String inputFile) throws Exception{ ProteinSequence seq=null; //System.out.println("inputFile==="+inputFile); FileInputStream is = new FileInputStream(inputFile); FastaReader fastaReader = new FastaReader(is, new GenericFastaHeaderParser(), new ProteinSequenceCreator(AminoAcidCompoundSet.getAminoAcidCompoundSet())); LinkedHashMap proteinSequences = fastaReader.process(); is.close(); //System.out.println( "proteinSequences=" + proteinSequences ); //LinkedHashMap a = FastaReaderHelper.readFastaProteinSequence(new File(fileName)); for ( Entry entry : proteinSequences.entrySet() ) { seq= new ProteinSequence(entry.getValue().getSequenceAsString()); seq.setAccession(entry.getValue().getAccession()); //System.out.println( "Inside getSequenceFromFile=" + seq ); //FastaReaderHelper.readFastaDNASequence for DNA sequences } return seq; } After getting the Profile object I wrote the following code to display the No. of gaps List> listOfalSeq=profile.getAlignedSequences(); AlignedSequence alSeq; int noOfcompounds=0; int numOfGaps=0; StringBuilder html= new StringBuilder(""); for (int i=0; i"); //System.out.println("accessionId==" +accessionId); //pSeq=new ProteinSequence(seq.getSequenceAsString(),seq.getCompoundSet()); //pSeq.setAccession(seq.getAccession()); //multipleSequenceAlignment.addAlignedSequence(pSeq); } html.append("
Accession IdNumber of gaps
"); html.append(accessionId); html.append(""); html.append(numOfGaps); html.append("
"); setText(html.toString()); setText() method is the method of JEditorPane or JTextPane Tariq, Phd Scholar Muhammad Tariq Pervez Assistant Professor, Department of Computer Science Virtual University of Pakistan, Lahore Tel: (042) 9203114-7 URL: www.vu.edu.pk Mobile: +923364120541, +923214602694 > Date: Thu, 7 Jul 2011 08:10:53 -0700 > Subject: Re: [Biojava-l] No. of gaps in aligned sequences > From: andreas at sdsc.edu > To: tariq_cp at hotmail.com > CC: biojava-l at biojava.org; biojava-dev at biojava.org > > Hi Tariq, > > Can you send us the sample code / DB accession IDs so we can try to > reproduce this? > > Andreas > > On Wed, Jul 6, 2011 at 4:37 AM, Muhammad Tariq Pervez > wrote: > > > > > > Hi, Dear all, > > I am working on the development of MSA application using BioJava. I want to make clear a thing. It is that when two or more protein sequences are aligned the '-' is shown more times in an aligned sequence than the gaps display by the method of alSeq.getNumGaps(). 'alSeq' is an aligned sequence. For example, if there are actual 50 '-' in an aligned sequence but the method shows it only 30. What is the difference between these two results. > > > > Best Regards > > > > > > Tariq, Phd Scholar > > > > _______________________________________________ > > Biojava-l mailing list - Biojava-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/biojava-l > > From tariq_cp at hotmail.com Fri Jul 8 07:11:12 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Fri, 8 Jul 2011 07:11:12 +0000 Subject: [Biojava-l] Page creation in Biojava In-Reply-To: References: , Message-ID: Hi, Andreas, I created the link with the following title and when i click this link the download dialogue box appears to download index.php file. After the reading the helping contents provided by the link sent by you I changed the name of the already existing page. A blank page appears and when i click the link of 'edit this page' again the download dialogue box appears and prompt to download the index.php file. What to do?? Kindly guide. I am afraid perhaps i don't have the right to create a page. How do I convert Profile object into Multiple Sequence Alignment object to be use in the TreeConstructor tariq, Phd Scholar > Date: Thu, 7 Jul 2011 15:46:29 -0700 > Subject: Re: [Biojava-l] Page creation in Biojava > From: andreas at sdsc.edu > To: tariq_cp at hotmail.com > CC: biojava-l at lists.open-bio.org > > Hi Tariq, > > A easy way to create a new page is to create a link from an existing > page and then click on that link. This should take you to the edit > view of the new page. > > See also: > http://meta.wikimedia.org/wiki/Help:Starting_a_new_page > > Andreas > > > > On Thu, Jul 7, 2011 at 1:48 AM, Muhammad Tariq Pervez > wrote: > > > > Hi, All > > I want to contribute in BioJava CookBook. I have already login id/account. I can create internal/external links. But further what to do. How can i create a page and link to the internal/external link. > > > > Regards. > > > > > > Tariq, Phd Scholar > > > > _______________________________________________ > > Biojava-l mailing list - Biojava-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/biojava-l > > From andreas at sdsc.edu Fri Jul 8 17:36:12 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Fri, 8 Jul 2011 10:36:12 -0700 Subject: [Biojava-l] Page creation in Biojava In-Reply-To: References: Message-ID: Hi Muhammad, - I don;t think that you already created a new page, and also I can't see on which wiki page you created the link? http://biojava.org/wiki/Special:RecentChanges Make sure you are logged in correctly and then you should have edit and create permissions... Andreas On Fri, Jul 8, 2011 at 12:11 AM, Muhammad Tariq Pervez wrote: > > Hi, Andreas, > > I created the link with the following title and when i click this link the download dialogue box appears to download index.php file. > After the reading the helping contents provided by > the link sent by you I changed the name of the already existing page. A blank page appears and when i click the link of 'edit this page' again the download dialogue box appears and prompt to download the index.php file. > > What to do?? Kindly guide. I am afraid perhaps i don't have the right to create a page. > > How > do I convert Profile object into Multiple Sequence Alignment object to be use in > the TreeConstructor > > tariq, Phd Scholar > > >> Date: Thu, 7 Jul 2011 15:46:29 -0700 >> Subject: Re: [Biojava-l] Page creation in Biojava >> From: andreas at sdsc.edu >> To: tariq_cp at hotmail.com >> CC: biojava-l at lists.open-bio.org >> >> Hi Tariq, >> >> A easy way to create a new page is to create a link from an existing >> page and then click on that link. This should take you to the edit >> view of the new page. >> >> See also: >> http://meta.wikimedia.org/wiki/Help:Starting_a_new_page >> >> Andreas >> >> >> >> On Thu, Jul 7, 2011 at 1:48 AM, Muhammad Tariq Pervez >> wrote: >> > >> > Hi, All >> > I want to contribute in BioJava CookBook. I have already login id/account. I can create internal/external links. But further what to do. How can i create a page and link to the internal/external link. >> > >> > Regards. >> > >> > >> > Tariq, Phd Scholar >> > >> > _______________________________________________ >> > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org >> > http://lists.open-bio.org/mailman/listinfo/biojava-l >> > > > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From tariq_cp at hotmail.com Mon Jul 11 06:59:28 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Mon, 11 Jul 2011 06:59:28 +0000 Subject: [Biojava-l] Page creation in Biojava In-Reply-To: References: , , , Message-ID: Hi Andreas, Now you can see changes on the following link made on July 11, 2011 with my nick name cp. http://biojava.org/wiki/Special:RecentChanges I am again facing the same problem. When i click the link a dialogue box appears that prompt to save the index. php page. Waiting for your guidance. Tariq, Phd Scholar > Date: Fri, 8 Jul 2011 10:36:12 -0700 > Subject: Re: [Biojava-l] Page creation in Biojava > From: andreas at sdsc.edu > To: tariq_cp at hotmail.com > CC: biojava-l at lists.open-bio.org > > Hi Muhammad, > > - I don;t think that you already created a new page, and also I can't > see on which wiki page you created the link? > > http://biojava.org/wiki/Special:RecentChanges > > Make sure you are logged in correctly and then you should have edit > and create permissions... > > Andreas > > > On Fri, Jul 8, 2011 at 12:11 AM, Muhammad Tariq Pervez > wrote: > > > > Hi, Andreas, > > > > I created the link with the following title and when i click this link the download dialogue box appears to download index.php file. > > After the reading the helping contents provided by > > the link sent by you I changed the name of the already existing page. A blank page appears and when i click the link of 'edit this page' again the download dialogue box appears and prompt to download the index.php file. > > > > What to do?? Kindly guide. I am afraid perhaps i don't have the right to create a page. > > > > How > > do I convert Profile object into Multiple Sequence Alignment object to be use in > > the TreeConstructor > > > > tariq, Phd Scholar > > > > > >> Date: Thu, 7 Jul 2011 15:46:29 -0700 > >> Subject: Re: [Biojava-l] Page creation in Biojava > >> From: andreas at sdsc.edu > >> To: tariq_cp at hotmail.com > >> CC: biojava-l at lists.open-bio.org > >> > >> Hi Tariq, > >> > >> A easy way to create a new page is to create a link from an existing > >> page and then click on that link. This should take you to the edit > >> view of the new page. > >> > >> See also: > >> http://meta.wikimedia.org/wiki/Help:Starting_a_new_page > >> > >> Andreas > >> > >> > >> > >> On Thu, Jul 7, 2011 at 1:48 AM, Muhammad Tariq Pervez > >> wrote: > >> > > >> > Hi, All > >> > I want to contribute in BioJava CookBook. I have already login id/account. I can create internal/external links. But further what to do. How can i create a page and link to the internal/external link. > >> > > >> > Regards. > >> > > >> > > >> > Tariq, Phd Scholar > >> > > >> > _______________________________________________ > >> > Biojava-l mailing list - Biojava-l at lists.open-bio.org > >> > http://lists.open-bio.org/mailman/listinfo/biojava-l > >> > > > > > _______________________________________________ > > Biojava-l mailing list - Biojava-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/biojava-l > > From tariq_cp at hotmail.com Mon Jul 11 08:00:27 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Mon, 11 Jul 2011 08:00:27 +0000 Subject: [Biojava-l] Calculating consensus sequence Message-ID: Hi, All, Is there any class/method in BioJava to calculate consensus sequences of the aligned sequences. Best Regards. Tariq, Phd Scholar From andreas at sdsc.edu Mon Jul 11 15:06:18 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Mon, 11 Jul 2011 08:06:18 -0700 Subject: [Biojava-l] Page creation in Biojava In-Reply-To: References: Message-ID: very strange... I created an empty page. Can you edit it? http://biojava.org/wiki/BioJava:CookBook:Phylo:ProfileToMSA Andreas On Sun, Jul 10, 2011 at 11:59 PM, Muhammad Tariq Pervez wrote: > > Hi Andreas, > Now you can see changes on the following link made on July 11, 2011 with my nick name cp. > > http://biojava.org/wiki/Special:RecentChanges > > I am again facing the same problem. When i click the link a dialogue box appears that prompt to save the index. php page. > > Waiting for your guidance. > > > Tariq, Phd Scholar > > >> Date: Fri, 8 Jul 2011 10:36:12 -0700 >> Subject: Re: [Biojava-l] Page creation in Biojava >> From: andreas at sdsc.edu >> To: tariq_cp at hotmail.com >> CC: biojava-l at lists.open-bio.org >> >> Hi Muhammad, >> >> - I don;t think that you already created a new page, and also I can't >> see on which wiki page you created the link? >> >> http://biojava.org/wiki/Special:RecentChanges >> >> Make sure you are logged in correctly and then you should have edit >> and create permissions... >> >> Andreas >> >> >> On Fri, Jul 8, 2011 at 12:11 AM, Muhammad Tariq Pervez >> wrote: >> > >> > Hi, Andreas, >> > >> > I created the link with the following title and when i click this link the download dialogue box appears to download index.php file. >> > After the reading the helping contents provided by >> > the link sent by you I changed the name of the already existing page. A blank page appears and when i click the link of 'edit this page' again the download dialogue box appears and prompt to download the index.php file. >> > >> > What to do?? Kindly guide. I am afraid perhaps i don't have the right to create a page. >> > >> > How >> > do I convert Profile object into Multiple Sequence Alignment object to be use in >> > the TreeConstructor >> > >> > tariq, Phd Scholar >> > >> > >> >> Date: Thu, 7 Jul 2011 15:46:29 -0700 >> >> Subject: Re: [Biojava-l] Page creation in Biojava >> >> From: andreas at sdsc.edu >> >> To: tariq_cp at hotmail.com >> >> CC: biojava-l at lists.open-bio.org >> >> >> >> Hi Tariq, >> >> >> >> A easy way to create a new page is to create a link from an existing >> >> page and then click on that link. This should take you to the edit >> >> view of the new page. >> >> >> >> See also: >> >> http://meta.wikimedia.org/wiki/Help:Starting_a_new_page >> >> >> >> Andreas >> >> >> >> >> >> >> >> On Thu, Jul 7, 2011 at 1:48 AM, Muhammad Tariq Pervez >> >> wrote: >> >> > >> >> > Hi, All >> >> > I want to contribute in BioJava CookBook. I have already login id/account. I can create internal/external links. But further what to do. How can i create a page and link to the internal/external link. >> >> > >> >> > Regards. >> >> > >> >> > >> >> > Tariq, Phd Scholar >> >> > >> >> > _______________________________________________ >> >> > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org >> >> > http://lists.open-bio.org/mailman/listinfo/biojava-l >> >> > >> > >> > _______________________________________________ >> > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org >> > http://lists.open-bio.org/mailman/listinfo/biojava-l >> > > > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From kohchuanhock at gmail.com Tue Jul 12 03:36:05 2011 From: kohchuanhock at gmail.com (Chuan Hock Koh) Date: Tue, 12 Jul 2011 11:36:05 +0800 Subject: [Biojava-l] GSoC:AAPropertiesComputation Updates Message-ID: Hi all, I am a student for this year Google Summer of Code. We are working on developing tools and APIs for the calculation of physico-chemical properties via BioJava. We have come to an end of the second phase of this project. In the first two phase of the projects, we have developed APIs, test the APIs and also wrote up documentation (in Cookbook of BioWiki under "Physico-Chemical Proerties Computation"). We are writing this email to invite for comments/suggestions on the project. The next few phases of the project can be found here ( http://biojava.org/wiki/GSoC:AAPropertiesComputation#Timeline). Previously, it was suggested in this mailing list that we should allow users to define the mass of amino acids instead of always using the standard mass. We have done so and have documentation on how to do it here ( http://biojava.org/wiki/BioJava:CookBook:AAPROP:xmlfiles). However, we face a problem here regarding the definition of modified amino acids. That is in the class of ProteinSequence, it ensures a symbol must be define in AminoAcidCompoundSet. This would limit the possibilities in defining the symbol for modified amino acids. Looking forward to hear from you guys, AAPropertiesComputation Team Student: Chuan Hock KOH Mentors: Peter Troshin & Andreas Prlic -- http://compbio.ddns.comp.nus.edu.sg/~ChuanHockKoh From HWillis at scripps.edu Tue Jul 12 11:37:32 2011 From: HWillis at scripps.edu (Scooter Willis) Date: Tue, 12 Jul 2011 07:37:32 -0400 Subject: [Biojava-l] GSoC:AAPropertiesComputation Updates In-Reply-To: Message-ID: Chuan Currently for Nucleotides and Amino Acids we used a single instance of each when building a ProteinSequence or DNASequence to minimize memory. We will need to come up with an approach that allows an amino acid to have a modified mass via a PTM designation that takes care of creating/replacing the amino acid with a new instance. This is complicated so it may be better to simply work from an expanded list of amino acids with known PTMs. We also need a way to describe a PTM as part of a simple string so that proper ProteinSequence is created and will still work in code that doesn't understand that a PTM is represented. Sequence alignment as an example. Each PTM type should have a short and long name. In the following example for possible/known PTMs of Cysteine(not a complete list) forces the PTMs to be a child of the amino acid. The short name and name should come from well established Mass Spec services such as Mascot. This way we should be able to create a ProteinSequence with a PTM by doing this ProteinSequence ps = new ProteinSequence("DE[capC]CK"); The parser will need to change to support parsing PTMs. I have included the compounds.xml file that I used for an internal project for code that finds peptides in mass spec files. Once all this is in place should be easy enough to add in code to get the mass of a protein sequence. Andy Yates put the code together that loads the current amino acid definitions from a config file. We should probably look at modifying that process to support loading a more complete list of possible amino acids and the properties. Is the plan to load the physio-chemical properties as well from an XML file? Are the code changes for amino acid properties going into Core? I realized last week that an old email I turned off was getting emails from Biojava-l so I have been out of the loop on current progress. Thanks Scooter On 7/11/11 11:36 PM, "Chuan Hock Koh" wrote: >Hi all, > >I am a student for this year Google Summer of Code. We are working on >developing tools and APIs for the calculation of physico-chemical >properties >via BioJava. > >We have come to an end of the second phase of this project. In the first >two >phase of the projects, we have developed APIs, test the APIs and also >wrote >up documentation (in Cookbook of BioWiki under "Physico-Chemical Proerties >Computation"). > >We are writing this email to invite for comments/suggestions on the >project. >The next few phases of the project can be found here ( >http://biojava.org/wiki/GSoC:AAPropertiesComputation#Timeline). > >Previously, it was suggested in this mailing list that we should allow >users >to define the mass of amino acids instead of always using the standard >mass. >We have done so and have documentation on how to do it here ( >http://biojava.org/wiki/BioJava:CookBook:AAPROP:xmlfiles). > >However, we face a problem here regarding the definition of modified amino >acids. That is in the class of ProteinSequence, it ensures a symbol must >be >define in AminoAcidCompoundSet. This would limit the possibilities in >defining the symbol for modified amino acids. > > >Looking forward to hear from you guys, > >AAPropertiesComputation Team >Student: Chuan Hock KOH >Mentors: Peter Troshin & Andreas Prlic > >-- >http://compbio.ddns.comp.nus.edu.sg/~ChuanHockKoh.nus.edu.sg/~ChuanHockKoh/index.html> >_______________________________________________ >Biojava-l mailing list - Biojava-l at lists.open-bio.org >http://lists.open-bio.org/mailman/listinfo/biojava-l -------------- next part -------------- A non-text attachment was scrubbed... Name: compounds.xml Type: application/xml Size: 10760 bytes Desc: compounds.xml URL: From andreas at sdsc.edu Wed Jul 13 08:05:33 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Wed, 13 Jul 2011 01:05:33 -0700 Subject: [Biojava-l] Local DB BLAST Comparison/Search In-Reply-To: References: Message-ID: Hi Mark, regarding Blast, our recommendation is generally to get the XML output and then just parse the data that you are interested in. Andreas On Thu, Jul 7, 2011 at 1:56 PM, Mark Stewart wrote: > I'm a relatively new programmer, so I'm probably missing a number of obvious > things, but if someone wouldn't mind pointing me in the right direction, > that'd be great, because I'm having trouble figuring stuff out from the API. > > Just generally, which of the alignment/BLAST-related classes do I want to be > looking over and using if I want to write some JAVA for doing similar > sequence searches of a local database using the BLAST algorithm? > > -M > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From p.j.a.cock at googlemail.com Mon Jul 18 06:29:50 2011 From: p.j.a.cock at googlemail.com (Peter Cock) Date: Mon, 18 Jul 2011 07:29:50 +0100 Subject: [Biojava-l] help with short reads ? In-Reply-To: References: Message-ID: On Saturday, June 25, 2011, Jay Vyas wrote: > Hi everyone. ?A collaborator sent me some short reads in GZ format for 2 > bacterial genomes. Files names something.gz are compressed, a bit like the .zip format used on windows. If it ends with .tar.gz (or the short hand .tgz) then you have a collection of files (Unix tool tar), which have then been compressed (with gzip or a similar tool). What operating system do you have? Even on Windows you can deal with these files. > I have NO IDEA how to process this data or convert it. ?Any help or utilies > out there ? ?If you're interested in collaborating on a publication , let me > know. ? We can get you're name on it. ?And it won't be much work for those > of you that know about contig assembly..... > > For me, its out of my league, im a protein guy.... > [This seems rather tangential to BioJava and I don't think this mailing list is the best place to discuss this.] That sounds like it will be tough/hard. If you can find a local team or bioinformatician working with NextGen sequencing I would help. Try asking your sequencing center/provider if they have any kind local sequencing group. See also http://seqanswers.com Good luck, Peter From daniel.quest at gmail.com Thu Jul 21 17:47:53 2011 From: daniel.quest at gmail.com (Daniel Quest) Date: Thu, 21 Jul 2011 13:47:53 -0400 Subject: [Biojava-l] maven question Message-ID: Hey all, not sure what the maven dependancy should be to get biojava to work in a maven project. I tried: org.biojava biojava 3.0.1 But that does not appear to be working in intellij I did do: biojava-maven-repo BioJava repository http://www.biojava.org/download/maven/ does someone have an example pom.xml file for projects that use BioJava? Thanks -Daniel From andreas at sdsc.edu Thu Jul 21 17:55:45 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Thu, 21 Jul 2011 10:55:45 -0700 Subject: [Biojava-l] maven question In-Reply-To: References: Message-ID: Hi Daniel, you correctly specify where to get the .jars from, but you also need to specify which of the modules you want to depend on. e.g.: org.biojava biojava3-core 3.0.1 jar compile Andreas On Thu, Jul 21, 2011 at 10:47 AM, Daniel Quest wrote: > Hey all, > > not sure what the maven dependancy should be to get biojava to work in a > maven project. > > I tried: > > ? > ? ? ? ? > ? ? ? ? ? ?org.biojava > ? ? ? ? ? ?biojava > ? ? ? ?3.0.1 > ? ? ? ? > ? > > But that does not appear to be working in intellij > > I did do: > ? > ? ? > biojava-maven-repo > BioJava repository > http://www.biojava.org/download/maven/ > ? > > > does someone have an example pom.xml file for projects that use BioJava? > Thanks > -Daniel > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > -- ----------------------------------------------------------------------- Dr. Andreas Prlic Senior Scientist, RCSB PDB Protein Data Bank University of California, San Diego (+1) 858.246.0526 ----------------------------------------------------------------------- From daniel.quest at gmail.com Thu Jul 21 18:13:03 2011 From: daniel.quest at gmail.com (Daniel Quest) Date: Thu, 21 Jul 2011 14:13:03 -0400 Subject: [Biojava-l] maven question In-Reply-To: References: Message-ID: Thanks for the tip Andreas, It is still not working for me. here is a POM.xml 4.0.0 gov.ornl foo 1.0-SNAPSHOT jar foo http://maven.apache.org UTF-8 org.biojava biojava3-core 3.0.1 jar compile biojava-maven-repo BioJava repository http://www.biojava.org/download/maven/ and here is the code that does not recognize: import org.biojava3.core.sequence.ProteinSequence; import org.biojava3.core.sequence.compound.AminoAcidCompound; import org.biojava3.core.sequence.compound.AminoAcidCompoundSet; import org.biojava3.core.sequence.io.FastaReader; import org.biojava3.core.sequence.io.FastaReaderHelper; import org.biojava3.core.sequence.io.GenericFastaHeaderParser; import org.biojava3.core.sequence.io.ProteinSequenceCreator; nothing fancy yet. Any other ideas? Thanks -Daniel On Thu, Jul 21, 2011 at 1:55 PM, Andreas Prlic wrote: > Hi Daniel, > > you correctly specify where to get the .jars from, but you also need > to specify which of the modules you want to depend on. e.g.: > > > org.biojava > biojava3-core > 3.0.1 > jar > compile > > > Andreas > > > > On Thu, Jul 21, 2011 at 10:47 AM, Daniel Quest > wrote: > > Hey all, > > > > not sure what the maven dependancy should be to get biojava to work in a > > maven project. > > > > I tried: > > > > > > > > org.biojava > > biojava > > 3.0.1 > > > > > > > > But that does not appear to be working in intellij > > > > I did do: > > > > > > biojava-maven-repo > > BioJava repository > > http://www.biojava.org/download/maven/ > > > > > > > > does someone have an example pom.xml file for projects that use BioJava? > > Thanks > > -Daniel > > _______________________________________________ > > Biojava-l mailing list - Biojava-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/biojava-l > > > > > > -- > ----------------------------------------------------------------------- > Dr. Andreas Prlic > Senior Scientist, RCSB PDB Protein Data Bank > University of California, San Diego > (+1) 858.246.0526 > ----------------------------------------------------------------------- > From andreas at sdsc.edu Thu Jul 21 21:24:05 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Thu, 21 Jul 2011 14:24:05 -0700 Subject: [Biojava-l] maven question In-Reply-To: References: Message-ID: Hi Daniel, your pom works fine in my eclipse setup (did a basic maven project and copy and pasted your pom XML). - Where is your .java file located? It should be somewhere under .../src/main/java - Did you try a "mvn clean package install" ? Andreas On Thu, Jul 21, 2011 at 11:13 AM, Daniel Quest wrote: > Thanks for the tip Andreas, > It is still not working for me. ?here is a POM.xml > xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" > ??xsi:schemaLocation="http://maven.apache.org/POM/4.0.0 > http://maven.apache.org/xsd/maven-4.0.0.xsd"> > ??4.0.0 > ??gov.ornl > ??foo > ??1.0-SNAPSHOT > ??jar > ??foo > ??http://maven.apache.org > ?? > ?? ?UTF-8 > ?? > ?? > ?? ? ? > ?? ? ? ? ? ?org.biojava > ?? ? ? ? ? ?biojava3-core > ?? ? ? ? ? ?3.0.1 > ?? ? ? ? ? ?jar > ?? ? ? ? ? ?compile > ?? ? ? ? > ?? > ?? > ?? ? > biojava-maven-repo > BioJava repository > http://www.biojava.org/download/maven/ > > > > > and here is the code that does not recognize: > import org.biojava3.core.sequence.ProteinSequence; > import org.biojava3.core.sequence.compound.AminoAcidCompound; > import org.biojava3.core.sequence.compound.AminoAcidCompoundSet; > import org.biojava3.core.sequence.io.FastaReader; > import org.biojava3.core.sequence.io.FastaReaderHelper; > import org.biojava3.core.sequence.io.GenericFastaHeaderParser; > import org.biojava3.core.sequence.io.ProteinSequenceCreator; > nothing fancy yet. ?Any other ideas? > Thanks > -Daniel > On Thu, Jul 21, 2011 at 1:55 PM, Andreas Prlic wrote: >> >> Hi Daniel, >> >> you correctly specify where to get the .jars from, but you also need >> to specify which of the modules you want to depend on. e.g.: >> >> ? ? ? ? >> ? ? ? ? ? ? ? ? ? ? ? ?org.biojava >> ? ? ? ? ? ? ? ? ? ? ? ?biojava3-core >> ? ? ? ? ? ? ? ? ? ? ? ?3.0.1 >> ? ? ? ? ? ? ? ? ? ? ? ?jar >> ? ? ? ? ? ? ? ? ? ? ? ?compile >> ? ? ? ? ? ? ? ? >> >> Andreas >> >> >> >> On Thu, Jul 21, 2011 at 10:47 AM, Daniel Quest >> wrote: >> > Hey all, >> > >> > not sure what the maven dependancy should be to get biojava to work in a >> > maven project. >> > >> > I tried: >> > >> > ? >> > ? ? ? ? >> > ? ? ? ? ? ?org.biojava >> > ? ? ? ? ? ?biojava >> > ? ? ? ?3.0.1 >> > ? ? ? ? >> > ? >> > >> > But that does not appear to be working in intellij >> > >> > I did do: >> > ? >> > ? ? >> > biojava-maven-repo >> > BioJava repository >> > http://www.biojava.org/download/maven/ >> > ? >> > >> > >> > does someone have an example pom.xml file for projects that use BioJava? >> > Thanks >> > -Daniel >> > _______________________________________________ >> > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org >> > http://lists.open-bio.org/mailman/listinfo/biojava-l >> > >> >> >> >> -- >> ----------------------------------------------------------------------- >> Dr. Andreas Prlic >> Senior Scientist, RCSB PDB Protein Data Bank >> University of California, San Diego >> (+1) 858.246.0526 >> ----------------------------------------------------------------------- > > From tariq_cp at hotmail.com Fri Jul 22 11:56:52 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Fri, 22 Jul 2011 11:56:52 +0000 Subject: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment Message-ID: Dear all, I faced the NullPointerException exception while creating the DNA MultipleSequenceAlignment. The same goes right with protein sequence. Exception is thrown at the following line dnaProfile = Alignments.getMultipleSequenceAlignment(tmpLst); tmpLst is list of DNA sequences created/declared as follows List tmpLst=new ArrayList(); Note: the tmpLst is filled/populated with two or more two sequences. I traced the exception by going into Alignments.getMultipleSequenceAlignmen method of the Alignments class and found the following line of code the cause of exception. static List getListFromFutures(List> futures) { List list = new ArrayList(); for (Future f : futures) { // TODO when added to ConcurrencyTools, log completions and exceptions instead of printing stack traces try { list.add(f.get());** } catch (InterruptedException e) { e.printStackTrace(); } catch (ExecutionException e) { e.printStackTrace(); } } return list; } ** is the cause of exception. All is right with the protein sequences. Can any body help/guide me regarding the problem. Best Regards. Tariq, PhD Scholar From HWillis at scripps.edu Fri Jul 22 12:11:34 2011 From: HWillis at scripps.edu (Scooter Willis) Date: Fri, 22 Jul 2011 08:11:34 -0400 Subject: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment In-Reply-To: Message-ID: Can you include the output of the stack trace as well as a small working example that causes the exception? On 7/22/11 7:56 AM, "Muhammad Tariq Pervez" wrote: > > > >Dear all, > >I faced the NullPointerException exception while creating the DNA >MultipleSequenceAlignment. The same goes right with protein sequence. >Exception is thrown at the following line > >dnaProfile = Alignments.getMultipleSequenceAlignment(tmpLst); > >tmpLst is list of DNA sequences created/declared as follows >List tmpLst=new ArrayList(); > >Note: the tmpLst is filled/populated with two or more two sequences. > >I traced the exception by going into >Alignments.getMultipleSequenceAlignmen method of the Alignments class and >found the following line of code the cause of exception. > >static List getListFromFutures(List> futures) { > List list = new ArrayList(); > for (Future f : futures) { > // TODO when added to ConcurrencyTools, log completions and >exceptions instead of printing stack traces > try { > > list.add(f.get());** > } catch (InterruptedException e) { > e.printStackTrace(); > } catch (ExecutionException e) { > e.printStackTrace(); > } > } > return list; > } >** is the cause of exception. All is right with the protein sequences. >Can any body help/guide me regarding the problem. > >Best Regards. > > > >Tariq, PhD Scholar > >_______________________________________________ >Biojava-l mailing list - Biojava-l at lists.open-bio.org >http://lists.open-bio.org/mailman/listinfo/biojava-l From tariq_cp at hotmail.com Mon Jul 25 10:27:02 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Mon, 25 Jul 2011 10:27:02 +0000 Subject: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment In-Reply-To: References: , Message-ID: Following is tmpLst filled with two DNA sequences. Scorers object is displayed from inside the object of Alignments (getMultipleSequenceAlignment method). All==1 is displayed from inside the method of public static , C extends Compound> int[] runPairwiseScorers( List> scorers) { (class is Alignments) as follows all = scorers.size(); But the line System.out.println("futures==="+futures.get(0).get()); causes NullPointer Exception. List> futures = new ArrayList>(); for (PairwiseSequenceScorer scorer : scorers) { futures.add(ConcurrencyTools.submit(new CallablePairwiseSequenceScorer(scorer), String.format("Scoring pair %d of %d", n++, all))); } try{ // perhaps this code is not working fine. System.out.println("futures==="+futures.get(0).get()); tmpLst==[GAATCTATAGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCAGGTAGTCGACTCAGATTCTTGTAGTGGCTCTCATCTGATCAAGGGTATTATTCCCAAGCCATAGTAAGGTCTTCTGTTGTGCCTTTTGCTTATACATCAGGTAACATGATAGAACTAGGCTAAGTG, ATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTAATGCTGATCACTCGGACTATGCTGATATTGAGCTGTATCCGTCTGACAAGCTCTCTTGACGGCAGGCCCCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGAGATAAGGAGGCATGTGCAAAAGCCCCATTGGAGGCATATAACAGAACACTGACTACTCTGCTCACTC] sequences=== [GAATCTATAGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCAGGTAGTCGACTCAGATTCTTGTAGTGGCTCTCATCTGATCAAGGGTATTATTCCCAAGCCATAGTAAGGTCTTCTGTTGTGCCTTTTGCTTATACATCAGGTAACATGATAGAACTAGGCTAAGTG, ATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTAATGCTGATCACTCGGACTATGCTGATATTGAGCTGTATCCGTCTGACAAGCTCTCTTGACGGCAGGCCCCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGAGATAAGGAGGCATGTGCAAAAGCCCCATTGGAGGCATATAACAGAACACTGACTACTCTGCTCACTC] scorers=== [org.biojava3.alignment.FractionalIdentityScorer at d337d3] all===1 scorers===org.biojava3.alignment.FractionalIdentityScorer at d337d3 java.util.concurrent.ExecutionException: java.lang.NullPointerException at java.util.concurrent.FutureTask$Sync.innerGet(FutureTask.java:222) at java.util.concurrent.FutureTask.get(FutureTask.java:83) at pakjalphiew.Alignments.getListFromFutures(Alignments.java:304) at pakjalphiew.Alignments.runPairwiseScorers(Alignments.java:631) at pakjalphiew.Alignments.getMultipleSequenceAlignment(Alignments.java:194) at pakjalphiew.MSA.msaDNAFromFiles(MSA.java:109) at pakjalphiew.MSACalculation.calculateDNAMSAFromFiles(MSACalculation.java:42) at pakjalphiew.MSAInterFrame.(MSAInterFrame.java:60) at pakjalphiew.LaunchingFrame.newDNAFromFileActionPerformed(LaunchingFrame.java:265) at pakjalphiew.LaunchingFrame.access$000(LaunchingFrame.java:26) at pakjalphiew.LaunchingFrame$1.actionPerformed(LaunchingFrame.java:83) at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995) at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318) at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387) at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242) at javax.swing.AbstractButton.doClick(AbstractButton.java:357) at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:809) at javax.swing.plaf.basic.BasicMenuItemUI$Handler.mouseReleased(BasicMenuItemUI.java:850) at java.awt.Component.processMouseEvent(Component.java:6288) at javax.swing.JComponent.processMouseEvent(JComponent.java:3267) at java.awt.Component.processEvent(Component.java:6053) at java.awt.Container.processEvent(Container.java:2041) at java.awt.Component.dispatchEventImpl(Component.java:4651) at java.awt.Container.dispatchEventImpl(Container.java:2099) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4577) at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238) at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168) at java.awt.Container.dispatchEventImpl(Container.java:2085) at java.awt.Window.dispatchEventImpl(Window.java:2478) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.EventQueue.dispatchEventImpl(EventQueue.java:643) at java.awt.EventQueue.access$000(EventQueue.java:84) at java.awt.EventQueue$1.run(EventQueue.java:602) at java.awt.EventQueue$1.run(EventQueue.java:600) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:98) at java.awt.EventQueue$2.run(EventQueue.java:616) at java.awt.EventQueue$2.run(EventQueue.java:614) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.awt.EventQueue.dispatchEvent(EventQueue.java:613) at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269) at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184) at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161) at java.awt.EventDispatchThread.run(EventDispatchThread.java:122) Caused by: java.lang.NullPointerException at org.biojava3.alignment.FractionalIdentityScorer.align(FractionalIdentityScorer.java:112) at org.biojava3.alignment.FractionalIdentityScorer.getScore(FractionalIdentityScorer.java:105) at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:53) at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:38) at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:303) at java.util.concurrent.FutureTask.run(FutureTask.java:138) at java.util.concurrent.ThreadPoolExecutor$Worker.runTask(ThreadPoolExecutor.java:886) at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:908) at java.lang.Thread.run(Thread.java:662) Exception in thread "AWT-EventQueue-0" java.lang.NullPointerException at pakjalphiew.AlignmentRuler.getRuler(AlignmentRuler.java:34) at pakjalphiew.AlignmentRuler.(AlignmentRuler.java:26) at pakjalphiew.MSAInterFrame.initComponents(MSAInterFrame.java:81) at pakjalphiew.MSAInterFrame.(MSAInterFrame.java:62) at pakjalphiew.LaunchingFrame.newDNAFromFileActionPerformed(LaunchingFrame.java:265) at pakjalphiew.LaunchingFrame.access$000(LaunchingFrame.java:26) at pakjalphiew.LaunchingFrame$1.actionPerformed(LaunchingFrame.java:83) at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995) at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318) at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387) at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242) at javax.swing.AbstractButton.doClick(AbstractButton.java:357) at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:809) at javax.swing.plaf.basic.BasicMenuItemUI$Handler.mouseReleased(BasicMenuItemUI.java:850) at java.awt.Component.processMouseEvent(Component.java:6288) at javax.swing.JComponent.processMouseEvent(JComponent.java:3267) at java.awt.Component.processEvent(Component.java:6053) at java.awt.Container.processEvent(Container.java:2041) at java.awt.Component.dispatchEventImpl(Component.java:4651) at java.awt.Container.dispatchEventImpl(Container.java:2099) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4577) at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238) at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168) at java.awt.Container.dispatchEventImpl(Container.java:2085) at java.awt.Window.dispatchEventImpl(Window.java:2478) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.EventQueue.dispatchEventImpl(EventQueue.java:643) at java.awt.EventQueue.access$000(EventQueue.java:84) at java.awt.EventQueue$1.run(EventQueue.java:602) at java.awt.EventQueue$1.run(EventQueue.java:600) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:98) at java.awt.EventQueue$2.run(EventQueue.java:616) at java.awt.EventQueue$2.run(EventQueue.java:614) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.awt.EventQueue.dispatchEvent(EventQueue.java:613) at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269) at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184) at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161) at java.awt.EventDispatchThread.run(EventDispatchThread.java:122) Muhammad Tariq Pervez Assistant Professor, Department of Computer Science Virtual University of Pakistan, Lahore Tel: (042) 9203114-7 URL: www.vu.edu.pk Mobile: +923364120541, +923214602694 > From: HWillis at scripps.edu > To: tariq_cp at hotmail.com; biojava-l at lists.open-bio.org > Date: Fri, 22 Jul 2011 08:11:34 -0400 > Subject: Re: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment > > Can you include the output of the stack trace as well as a small working > example that causes the exception? > > On 7/22/11 7:56 AM, "Muhammad Tariq Pervez" wrote: > > > > > > > > >Dear all, > > > >I faced the NullPointerException exception while creating the DNA > >MultipleSequenceAlignment. The same goes right with protein sequence. > >Exception is thrown at the following line > > > >dnaProfile = Alignments.getMultipleSequenceAlignment(tmpLst); > > > >tmpLst is list of DNA sequences created/declared as follows > >List tmpLst=new ArrayList(); > > > >Note: the tmpLst is filled/populated with two or more two sequences. > > > >I traced the exception by going into > >Alignments.getMultipleSequenceAlignmen method of the Alignments class and > >found the following line of code the cause of exception. > > > >static List getListFromFutures(List> futures) { > > List list = new ArrayList(); > > for (Future f : futures) { > > // TODO when added to ConcurrencyTools, log completions and > >exceptions instead of printing stack traces > > try { > > > > list.add(f.get());** > > } catch (InterruptedException e) { > > e.printStackTrace(); > > } catch (ExecutionException e) { > > e.printStackTrace(); > > } > > } > > return list; > > } > >** is the cause of exception. All is right with the protein sequences. > >Can any body help/guide me regarding the problem. > > > >Best Regards. > > > > > > > >Tariq, PhD Scholar > > > >_______________________________________________ > >Biojava-l mailing list - Biojava-l at lists.open-bio.org > >http://lists.open-bio.org/mailman/listinfo/biojava-l > From HWillis at scripps.edu Mon Jul 25 13:44:23 2011 From: HWillis at scripps.edu (Scooter Willis) Date: Mon, 25 Jul 2011 09:44:23 -0400 Subject: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment In-Reply-To: Message-ID: Not sure if this is an issue with the MultipleSequenceAlignment code versus the way you are doing pairwise is simply throwing a concurrency exception. Can you complete all pairwise comparisons independently to rule out a problem related to the code and the sequences you are trying to align? From: Muhammad Tariq Pervez > Date: Mon, 25 Jul 2011 06:27:02 -0400 To: Scooter Willis >, "Biojava-l at lists.open-bio.org" > Subject: RE: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment Following is tmpLst filled with two DNA sequences. Scorers object is displayed from inside the object of Alignments (getMultipleSequenceAlignment method). All==1 is displayed from inside the method of public static , C extends Compound> int[] runPairwiseScorers( List> scorers) { (class is Alignments) as follows all = scorers.size(); But the line System.out.println("futures==="+futures.get(0).get()); causes NullPointer Exception. List> futures = new ArrayList>(); for (PairwiseSequenceScorer scorer : scorers) { futures.add(ConcurrencyTools.submit(new CallablePairwiseSequenceScorer(scorer), String.format("Scoring pair %d of %d", n++, all))); } try{ // perhaps this code is not working fine. System.out.println("futures==="+futures.get(0).get()); tmpLst==[GAATCTATAGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCAGGTAGTCGACTCAGATTCTTGTAGTGGCTCTCATCTGATCAAGGGTATTATTCCCAAGCCATAGTAAGGTCTTCTGTTGTGCCTTTTGCTTATACATCAGGTAACATGATAGAACTAGGCTAAGTG, ATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTAATGCTGATCACTCGGACTATGCTGATATTGAGCTGTATCCGTCTGACAAGCTCTCTTGACGGCAGGCCCCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGAGATAAGGAGGCATGTGCAAAAGCCCCATTGGAGGCATATAACAGAACACTGACTACTCTGCTCACTC] sequences=== [GAATCTATAGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCAGGTAGTCGACTCAGATTCTTGTAGTGGCTCTCATCTGATCAAGGGTATTATTCCCAAGCCATAGTAAGGTCTTCTGTTGTGCCTTTTGCTTATACATCAGGTAACATGATAGAACTAGGCTAAGTG, ATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTAATGCTGATCACTCGGACTATGCTGATATTGAGCTGTATCCGTCTGACAAGCTCTCTTGACGGCAGGCCCCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGAGATAAGGAGGCATGTGCAAAAGCCCCATTGGAGGCATATAACAGAACACTGACTACTCTGCTCACTC] scorers=== [org.biojava3.alignment.FractionalIdentityScorer at d337d3] all===1 scorers===org.biojava3.alignment.FractionalIdentityScorer at d337d3 java.util.concurrent.ExecutionException: java.lang.NullPointerException at java.util.concurrent.FutureTask$Sync.innerGet(FutureTask.java:222) at java.util.concurrent.FutureTask.get(FutureTask.java:83) at pakjalphiew.Alignments.getListFromFutures(Alignments.java:304) at pakjalphiew.Alignments.runPairwiseScorers(Alignments.java:631) at pakjalphiew.Alignments.getMultipleSequenceAlignment(Alignments.java:194) at pakjalphiew.MSA.msaDNAFromFiles(MSA.java:109) at pakjalphiew.MSACalculation.calculateDNAMSAFromFiles(MSACalculation.java:42) at pakjalphiew.MSAInterFrame.(MSAInterFrame.java:60) at pakjalphiew.LaunchingFrame.newDNAFromFileActionPerformed(LaunchingFrame.java:265) at pakjalphiew.LaunchingFrame.access$000(LaunchingFrame.java:26) at pakjalphiew.LaunchingFrame$1.actionPerformed(LaunchingFrame.java:83) at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995) at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318) at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387) at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242) at javax.swing.AbstractButton.doClick(AbstractButton.java:357) at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:809) at javax.swing.plaf.basic.BasicMenuItemUI$Handler.mouseReleased(BasicMenuItemUI.java:850) at java.awt.Component.processMouseEvent(Component.java:6288) at javax.swing.JComponent.processMouseEvent(JComponent.java:3267) at java.awt.Component.processEvent(Component.java:6053) at java.awt.Container.processEvent(Container.java:2041) at java.awt.Component.dispatchEventImpl(Component.java:4651) at java.awt.Container.dispatchEventImpl(Container.java:2099) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4577) at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238) at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168) at java.awt.Container.dispatchEventImpl(Container.java:2085) at java.awt.Window.dispatchEventImpl(Window.java:2478) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.EventQueue.dispatchEventImpl(EventQueue.java:643) at java.awt.EventQueue.access$000(EventQueue.java:84) at java.awt.EventQueue$1.run(EventQueue.java:602) at java.awt.EventQueue$1.run(EventQueue.java:600) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:98) at java.awt.EventQueue$2.run(EventQueue.java:616) at java.awt.EventQueue$2.run(EventQueue.java:614) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.awt.EventQueue.dispatchEvent(EventQueue.java:613) at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269) at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184) at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161) at java.awt.EventDispatchThread.run(EventDispatchThread.java:122) Caused by: java.lang.NullPointerException at org.biojava3.alignment.FractionalIdentityScorer.align(FractionalIdentityScorer.java:112) at org.biojava3.alignment.FractionalIdentityScorer.getScore(FractionalIdentityScorer.java:105) at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:53) at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:38) at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:303) at java.util.concurrent.FutureTask.run(FutureTask.java:138) at java.util.concurrent.ThreadPoolExecutor$Worker.runTask(ThreadPoolExecutor.java:886) at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:908) at java.lang.Thread.run(Thread.java:662) Exception in thread "AWT-EventQueue-0" java.lang.NullPointerException at pakjalphiew.AlignmentRuler.getRuler(AlignmentRuler.java:34) at pakjalphiew.AlignmentRuler.(AlignmentRuler.java:26) at pakjalphiew.MSAInterFrame.initComponents(MSAInterFrame.java:81) at pakjalphiew.MSAInterFrame.(MSAInterFrame.java:62) at pakjalphiew.LaunchingFrame.newDNAFromFileActionPerformed(LaunchingFrame.java:265) at pakjalphiew.LaunchingFrame.access$000(LaunchingFrame.java:26) at pakjalphiew.LaunchingFrame$1.actionPerformed(LaunchingFrame.java:83) at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995) at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318) at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387) at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242) at javax.swing.AbstractButton.doClick(AbstractButton.java:357) at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:809) at javax.swing.plaf.basic.BasicMenuItemUI$Handler.mouseReleased(BasicMenuItemUI.java:850) at java.awt.Component.processMouseEvent(Component.java:6288) at javax.swing.JComponent.processMouseEvent(JComponent.java:3267) at java.awt.Component.processEvent(Component.java:6053) at java.awt.Container.processEvent(Container.java:2041) at java.awt.Component.dispatchEventImpl(Component.java:4651) at java.awt.Container.dispatchEventImpl(Container.java:2099) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4577) at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238) at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168) at java.awt.Container.dispatchEventImpl(Container.java:2085) at java.awt.Window.dispatchEventImpl(Window.java:2478) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.EventQueue.dispatchEventImpl(EventQueue.java:643) at java.awt.EventQueue.access$000(EventQueue.java:84) at java.awt.EventQueue$1.run(EventQueue.java:602) at java.awt.EventQueue$1.run(EventQueue.java:600) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:98) at java.awt.EventQueue$2.run(EventQueue.java:616) at java.awt.EventQueue$2.run(EventQueue.java:614) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.awt.EventQueue.dispatchEvent(EventQueue.java:613) at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269) at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184) at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161) at java.awt.EventDispatchThread.run(EventDispatchThread.java:122) Muhammad Tariq Pervez Assistant Professor, Department of Computer Science Virtual University of Pakistan, Lahore Tel: (042) 9203114-7 URL: www.vu.edu.pk Mobile: +923364120541, +923214602694 > From: HWillis at scripps.edu > To: tariq_cp at hotmail.com; biojava-l at lists.open-bio.org > Date: Fri, 22 Jul 2011 08:11:34 -0400 > Subject: Re: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment > > Can you include the output of the stack trace as well as a small working > example that causes the exception? > > On 7/22/11 7:56 AM, "Muhammad Tariq Pervez" > wrote: > > > > > > > > >Dear all, > > > >I faced the NullPointerException exception while creating the DNA > >MultipleSequenceAlignment. The same goes right with protein sequence. > >Exception is thrown at the following line > > > >dnaProfile = Alignments.getMultipleSequenceAlignment(tmpLst); > > > >tmpLst is list of DNA sequences created/declared as follows > >List tmpLst=new ArrayList(); > > > >Note: the tmpLst is filled/populated with two or more two sequences. > > > >I traced the exception by going into > >Alignments.getMultipleSequenceAlignmen method of the Alignments class and > >found the following line of code the cause of exception. > > > >static List getListFromFutures(List> futures) { > > List list = new ArrayList(); > > for (Future f : futures) { > > // TODO when added to ConcurrencyTools, log completions and > >exceptions instead of printing stack traces > > try { > > > > list.add(f.get());** > > } catch (InterruptedException e) { > > e.printStackTrace(); > > } catch (ExecutionException e) { > > e.printStackTrace(); > > } > > } > > return list; > > } > >** is the cause of exception. All is right with the protein sequences. > >Can any body help/guide me regarding the problem. > > > >Best Regards. > > > > > > > >Tariq, PhD Scholar > > > >_______________________________________________ > >Biojava-l mailing list - Biojava-l at lists.open-bio.org > >http://lists.open-bio.org/mailman/listinfo/biojava-l > From tariq_cp at hotmail.com Tue Jul 26 12:14:37 2011 From: tariq_cp at hotmail.com (Muhammad Tariq Pervez) Date: Tue, 26 Jul 2011 12:14:37 +0000 Subject: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment In-Reply-To: References: , Message-ID: Eventaully, I succeeded in finding the exact location of exception and fixes it as well. The problem is with that in getMultipleSequenceAlignment Method of Alignments class there are two 'if' statements as follows: if (cs == AminoAcidCompoundSet.getAminoAcidCompoundSet()) { @SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getBlosum62(); subMatrix = temp; }else if (cs == AmbiguityDNACompoundSet.getDNACompoundSet()) { @SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getNuc4_4(); subMatrix = temp; System.out.println("Inside getMSA===" +subMatrix); } and 'subMatrix' remains null when we try to DNA sequences. But when i added the third 'if' statement as follows the problem fixes and DNA sequences are aligned correctly. if (cs == AminoAcidCompoundSet.getAminoAcidCompoundSet()) { @SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getBlosum62(); subMatrix = temp; } else if (cs == DNACompoundSet.getDNACompoundSet()) { @SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getNuc4_4(); subMatrix = temp; System.out.println("Inside getMSA===" +subMatrix); } else if (cs == AmbiguityDNACompoundSet.getDNACompoundSet()) { @SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getNuc4_4(); subMatrix = temp; System.out.println("Inside getMSA===" +subMatrix); } Tariq, Phd Scholar From: HWillis at scripps.edu To: tariq_cp at hotmail.com; biojava-l at lists.open-bio.org Date: Mon, 25 Jul 2011 09:44:23 -0400 Subject: Re: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment Not sure if this is an issue with the MultipleSequenceAlignment code versus the way you are doing pairwise is simply throwing a concurrency exception. Can you complete all pairwise comparisons independently to rule out a problem related to the code and the sequences you are trying to align? From: Muhammad Tariq Pervez Date: Mon, 25 Jul 2011 06:27:02 -0400 To: Scooter Willis , "Biojava-l at lists.open-bio.org" Subject: RE: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment Following is tmpLst filled with two DNA sequences. Scorers object is displayed from inside the object of Alignments (getMultipleSequenceAlignment method). All==1 is displayed from inside the method of public static , C extends Compound> int[] runPairwiseScorers( List> scorers) { (class is Alignments) as follows all = scorers.size(); But the line System.out.println("futures==="+futures.get(0).get()); causes NullPointer Exception. List> futures = new ArrayList>(); for (PairwiseSequenceScorer scorer : scorers) { futures.add(ConcurrencyTools.submit(new CallablePairwiseSequenceScorer(scorer), String.format("Scoring pair %d of %d", n++, all))); } try{ // perhaps this code is not working fine. System.out.println("futures==="+futures.get(0).get()); tmpLst==[GAATCTATAGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCAGGTAGTCGACTCAGATTCTTGTAGTGGCTCTCATCTGATCAAGGGTATTATTCCCAAGCCATAGTAAGGTCTTCTGTTGTGCCTTTTGCTTATACATCAGGTAACATGATAGAACTAGGCTAAGTG, ATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTAATGCTGATCACTCGGACTATGCTGATATTGAGCTGTATCCGTCTGACAAGCTCTCTTGACGGCAGGCCCCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGAGATAAGGAGGCATGTGCAAAAGCCCCATTGGAGGCATATAACAGAACACTGACTACTCTGCTCACTC] sequences=== [GAATCTATAGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCAGGTAGTCGACTCAGATTCTTGTAGTGGCTCTCATCTGATCAAGGGTATTATTCCCAAGCCATAGTAAGGTCTTCTGTTGTGCCTTTTGCTTATACATCAGGTAACATGATAGAACTAGGCTAAGTG, ATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTAATGCTGATCACTCGGACTATGCTGATATTGAGCTGTATCCGTCTGACAAGCTCTCTTGACGGCAGGCCCCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGAGATAAGGAGGCATGTGCAAAAGCCCCATTGGAGGCATATAACAGAACACTGACTACTCTGCTCACTC] scorers=== [org.biojava3.alignment.FractionalIdentityScorer at d337d3] all===1 scorers===org.biojava3.alignment.FractionalIdentityScorer at d337d3 java.util.concurrent.ExecutionException: java.lang.NullPointerException at java.util.concurrent.FutureTask$Sync.innerGet(FutureTask.java:222) at java.util.concurrent.FutureTask.get(FutureTask.java:83) at pakjalphiew.Alignments.getListFromFutures(Alignments.java:304) at pakjalphiew.Alignments.runPairwiseScorers(Alignments.java:631) at pakjalphiew.Alignments.getMultipleSequenceAlignment(Alignments.java:194) at pakjalphiew.MSA.msaDNAFromFiles(MSA.java:109) at pakjalphiew.MSACalculation.calculateDNAMSAFromFiles(MSACalculation.java:42) at pakjalphiew.MSAInterFrame.(MSAInterFrame.java:60) at pakjalphiew.LaunchingFrame.newDNAFromFileActionPerformed(LaunchingFrame.java:265) at pakjalphiew.LaunchingFrame.access$000(LaunchingFrame.java:26) at pakjalphiew.LaunchingFrame$1.actionPerformed(LaunchingFrame.java:83) at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995) at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318) at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387) at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242) at javax.swing.AbstractButton.doClick(AbstractButton.java:357) at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:809) at javax.swing.plaf.basic.BasicMenuItemUI$Handler.mouseReleased(BasicMenuItemUI.java:850) at java.awt.Component.processMouseEvent(Component.java:6288) at javax.swing.JComponent.processMouseEvent(JComponent.java:3267) at java.awt.Component.processEvent(Component.java:6053) at java.awt.Container.processEvent(Container.java:2041) at java.awt.Component.dispatchEventImpl(Component.java:4651) at java.awt.Container.dispatchEventImpl(Container.java:2099) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4577) at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238) at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168) at java.awt.Container.dispatchEventImpl(Container.java:2085) at java.awt.Window.dispatchEventImpl(Window.java:2478) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.EventQueue.dispatchEventImpl(EventQueue.java:643) at java.awt.EventQueue.access$000(EventQueue.java:84) at java.awt.EventQueue$1.run(EventQueue.java:602) at java.awt.EventQueue$1.run(EventQueue.java:600) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:98) at java.awt.EventQueue$2.run(EventQueue.java:616) at java.awt.EventQueue$2.run(EventQueue.java:614) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.awt.EventQueue.dispatchEvent(EventQueue.java:613) at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269) at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184) at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161) at java.awt.EventDispatchThread.run(EventDispatchThread.java:122) Caused by: java.lang.NullPointerException at org.biojava3.alignment.FractionalIdentityScorer.align(FractionalIdentityScorer.java:112) at org.biojava3.alignment.FractionalIdentityScorer.getScore(FractionalIdentityScorer.java:105) at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:53) at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:38) at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:303) at java.util.concurrent.FutureTask.run(FutureTask.java:138) at java.util.concurrent.ThreadPoolExecutor$Worker.runTask(ThreadPoolExecutor.java:886) at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:908) at java.lang.Thread.run(Thread.java:662) Exception in thread "AWT-EventQueue-0" java.lang.NullPointerException at pakjalphiew.AlignmentRuler.getRuler(AlignmentRuler.java:34) at pakjalphiew.AlignmentRuler.(AlignmentRuler.java:26) at pakjalphiew.MSAInterFrame.initComponents(MSAInterFrame.java:81) at pakjalphiew.MSAInterFrame.(MSAInterFrame.java:62) at pakjalphiew.LaunchingFrame.newDNAFromFileActionPerformed(LaunchingFrame.java:265) at pakjalphiew.LaunchingFrame.access$000(LaunchingFrame.java:26) at pakjalphiew.LaunchingFrame$1.actionPerformed(LaunchingFrame.java:83) at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995) at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318) at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387) at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242) at javax.swing.AbstractButton.doClick(AbstractButton.java:357) at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:809) at javax.swing.plaf.basic.BasicMenuItemUI$Handler.mouseReleased(BasicMenuItemUI.java:850) at java.awt.Component.processMouseEvent(Component.java:6288) at javax.swing.JComponent.processMouseEvent(JComponent.java:3267) at java.awt.Component.processEvent(Component.java:6053) at java.awt.Container.processEvent(Container.java:2041) at java.awt.Component.dispatchEventImpl(Component.java:4651) at java.awt.Container.dispatchEventImpl(Container.java:2099) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4577) at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238) at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168) at java.awt.Container.dispatchEventImpl(Container.java:2085) at java.awt.Window.dispatchEventImpl(Window.java:2478) at java.awt.Component.dispatchEvent(Component.java:4481) at java.awt.EventQueue.dispatchEventImpl(EventQueue.java:643) at java.awt.EventQueue.access$000(EventQueue.java:84) at java.awt.EventQueue$1.run(EventQueue.java:602) at java.awt.EventQueue$1.run(EventQueue.java:600) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:98) at java.awt.EventQueue$2.run(EventQueue.java:616) at java.awt.EventQueue$2.run(EventQueue.java:614) at java.security.AccessController.doPrivileged(Native Method) at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) at java.awt.EventQueue.dispatchEvent(EventQueue.java:613) at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269) at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184) at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169) at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161) at java.awt.EventDispatchThread.run(EventDispatchThread.java:122) Muhammad Tariq Pervez Assistant Professor, Department of Computer Science Virtual University of Pakistan, Lahore Tel: (042) 9203114-7 URL: www.vu.edu.pk Mobile: +923364120541, +923214602694 > From: HWillis at scripps.edu > To: tariq_cp at hotmail.com; biojava-l at lists.open-bio.org > Date: Fri, 22 Jul 2011 08:11:34 -0400 > Subject: Re: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment > > Can you include the output of the stack trace as well as a small working > example that causes the exception? > > On 7/22/11 7:56 AM, "Muhammad Tariq Pervez" wrote: > > > > > > > > >Dear all, > > > >I faced the NullPointerException exception while creating the DNA > >MultipleSequenceAlignment. The same goes right with protein sequence. > >Exception is thrown at the following line > > > >dnaProfile = Alignments.getMultipleSequenceAlignment(tmpLst); > > > >tmpLst is list of DNA sequences created/declared as follows > >List tmpLst=new ArrayList(); > > > >Note: the tmpLst is filled/populated with two or more two sequences. > > > >I traced the exception by going into > >Alignments.getMultipleSequenceAlignmen method of the Alignments class and > >found the following line of code the cause of exception. > > > >static List getListFromFutures(List> futures) { > > List list = new ArrayList(); > > for (Future f : futures) { > > // TODO when added to ConcurrencyTools, log completions and > >exceptions instead of printing stack traces > > try { > > > > list.add(f.get());** > > } catch (InterruptedException e) { > > e.printStackTrace(); > > } catch (ExecutionException e) { > > e.printStackTrace(); > > } > > } > > return list; > > } > >** is the cause of exception. All is right with the protein sequences. > >Can any body help/guide me regarding the problem. > > > >Best Regards. > > > > > > > >Tariq, PhD Scholar > > > >_______________________________________________ > >Biojava-l mailing list - Biojava-l at lists.open-bio.org > >http://lists.open-bio.org/mailman/listinfo/biojava-l > From peter.penzov at gmail.com Tue Jul 26 17:43:52 2011 From: peter.penzov at gmail.com (Peter Penzov) Date: Tue, 26 Jul 2011 20:43:52 +0300 Subject: [Biojava-l] Invitation for Open Source Project Message-ID: Hi, I'm starting an open source project which involves web based Java, JBoss application server and JBoss Seam 3. I'm a student and I work on the project in my free time for training. Every one who want to take a part in this hobby project in his free time is invited. Send me e-mail. peter. penzov(at)gmail. com Regards Peter From tr3nton at gmail.com Thu Jul 28 23:32:43 2011 From: tr3nton at gmail.com (Trent Schafer) Date: Fri, 29 Jul 2011 09:32:43 +1000 Subject: [Biojava-l] ab1 files Message-ID: Hi, Not sure if anyone can help or advise - still just trying to figure it out. We are using this database software to manage our clinical studies, and we want to add the functionality to store sequencing files, and hopefully some useful information extracted from the files we upload. I found in the legacy cookbooks the following: http://biojava.org/wiki/BioJava:Cookbook:SeqIO:ABItoSequence and based on an AB1 file I have on my workstation, was able to successfully run the code listed - I presume its also possible to extract the quality scores? Anyway, was trying to see if these files can be read in BioJava 3.x? I was trying the 2 examples listed here: http://biojava.org/wiki/BioJava:CookBook:Core:FastaReadWrite but the exception is thrown: Exception in thread "main" org.biojava3.core.exceptions.CompoundNotFoundError: Compound not found for: Cannot find compound for: So my assumption is that it just doesn't know how to read AB1 files? To summarise, is it only possible read AB1 files in the legacy version of the software? I assume its better to be using 3.x if possible? There is a section of the 3.x cookbook: http://biojava.org/wiki/BioJava:CookBook:Core:Sequences is it that this hasn't been implemented yet, or is just undocumented? Any information is much appreciated. Thx, Trent From HWillis at scripps.edu Fri Jul 29 01:11:46 2011 From: HWillis at scripps.edu (Scooter Willis) Date: Thu, 28 Jul 2011 21:11:46 -0400 Subject: [Biojava-l] ab1 files In-Reply-To: Message-ID: Trent We do not have support for AB1 files in Biojava3. Do you have any interest in working/migrating the code for the AB1 file parser? I can assist if you want to work on it. Scooter On 7/28/11 7:32 PM, "Trent Schafer" wrote: >Hi, > >Not sure if anyone can help or advise - still just trying to figure it >out. > >We are using this database software to manage our clinical studies, and we >want to add the functionality to store sequencing files, and hopefully >some >useful information extracted from the files we upload. > >I found in the legacy cookbooks the following: >http://biojava.org/wiki/BioJava:Cookbook:SeqIO:ABItoSequence and based on >an >AB1 file I have on my workstation, was able to successfully run the code >listed - I presume its also possible to extract the quality scores? > >Anyway, was trying to see if these files can be read in BioJava 3.x? > >I was trying the 2 examples listed here: >http://biojava.org/wiki/BioJava:CookBook:Core:FastaReadWrite but the >exception is thrown: Exception in thread "main" >org.biojava3.core.exceptions.CompoundNotFoundError: Compound not found >for: >Cannot find compound for: > >So my assumption is that it just doesn't know how to read AB1 files? > >To summarise, is it only possible read AB1 files in the legacy version of >the software? I assume its better to be using 3.x if possible? There is a >section of the 3.x cookbook: >http://biojava.org/wiki/BioJava:CookBook:Core:Sequences is it that this >hasn't been implemented yet, or is just undocumented? > >Any information is much appreciated. > >Thx, >Trent >_______________________________________________ >Biojava-l mailing list - Biojava-l at lists.open-bio.org >http://lists.open-bio.org/mailman/listinfo/biojava-l From amr_alhossary at hotmail.com Fri Jul 29 01:42:01 2011 From: amr_alhossary at hotmail.com (Amr AL-Hossary) Date: Fri, 29 Jul 2011 03:42:01 +0200 Subject: [Biojava-l] ab1 files In-Reply-To: References: Message-ID: If we agreed on migrating the code to Biojava3, I can do it. especially as I haven't done something useful on the group for a while. Amr -------------------------------------------------- From: "Scooter Willis" Sent: Friday, July 29, 2011 3:11 AM To: "Trent Schafer" ; "Biojava-l at lists.open-bio.org" Subject: Re: [Biojava-l] ab1 files > Trent > > We do not have support for AB1 files in Biojava3. Do you have any interest > in working/migrating the code for the AB1 file parser? I can assist if you > want to work on it. > > Scooter > > On 7/28/11 7:32 PM, "Trent Schafer" wrote: > >>Hi, >> >>Not sure if anyone can help or advise - still just trying to figure it >>out. >> >>We are using this database software to manage our clinical studies, and we >>want to add the functionality to store sequencing files, and hopefully >>some >>useful information extracted from the files we upload. >> >>I found in the legacy cookbooks the following: >>http://biojava.org/wiki/BioJava:Cookbook:SeqIO:ABItoSequence and based on >>an >>AB1 file I have on my workstation, was able to successfully run the code >>listed - I presume its also possible to extract the quality scores? >> >>Anyway, was trying to see if these files can be read in BioJava 3.x? >> >>I was trying the 2 examples listed here: >>http://biojava.org/wiki/BioJava:CookBook:Core:FastaReadWrite but the >>exception is thrown: Exception in thread "main" >>org.biojava3.core.exceptions.CompoundNotFoundError: Compound not found >>for: >>Cannot find compound for: >> >>So my assumption is that it just doesn't know how to read AB1 files? >> >>To summarise, is it only possible read AB1 files in the legacy version of >>the software? I assume its better to be using 3.x if possible? There is a >>section of the 3.x cookbook: >>http://biojava.org/wiki/BioJava:CookBook:Core:Sequences is it that this >>hasn't been implemented yet, or is just undocumented? >> >>Any information is much appreciated. >> >>Thx, >>Trent >>_______________________________________________ >>Biojava-l mailing list - Biojava-l at lists.open-bio.org >>http://lists.open-bio.org/mailman/listinfo/biojava-l > > > _______________________________________________ > Biojava-l mailing list - Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l >