From hlapp at drycafe.net Mon Aug 1 18:36:27 2011 From: hlapp at drycafe.net (Hilmar Lapp) Date: Mon, 1 Aug 2011 18:36:27 -0400 Subject: [Biojava-l] Job opportunity: User Interface Design and Web Application Developer Message-ID: <7F0AE58E-6052-469B-ACD0-207FAD060472@drycafe.net> (Apologies if you have received this already or if this is considered spam - we're trying to reach out as broad as possible and I know that quite a few in the Bio* communities would be well qualified. Please feel free to pass on to anyone who might be interested, or might know someone who is.) User Interface Design and Web Application Developer The National Evolutionary Synthesis Center (NESCent) seeks a creative and enthusiastic individual to design user interfaces and web applications for scientific applications that manage, analyze, visualize and share data in support of evolutionary research. The incumbent will work as part of a small informatics team in close collaboration with domain scientists. NESCent (http://nescent.org) is an NSF-funded center dedicated to cross-disciplinary research in evolutionary science. Our informatics team works closely with visiting and resident scientists to support their custom software and database development needs (http://informatics.nescent.org ), and collaborates broadly with other biodiversity informatics projects. All NESCent software products are open-source, and the Center has a number of initiatives to actively promote collaborative development of community software resources. Above all, we are enthusiastic about our work, about the mission of the Center, and about the contribution of informatics to that mission. Job description: The incumbent will design and develop user interfaces and web applications for databases and other software tools for sponsored scientists and staff. The job responsibilities include all stages of the software development process, including requirements gathering, design, implementation, release packaging and documentation, as part of a small team (typically 2-3 individuals). We expect the incumbent to present their work at conferences and contribute to publications with scientific collaborators; interact regularly with visiting and resident scientists, other members of the informatics team and Center staff; and generally serve as an expert resource for Center personnel. The position provides opportunities for professional development and encourages research into new technologies. Most informatics staff work at our Durham NC offices, located adjacent to Duke University, but we support a wide range of technologies for virtual communication with off-site staff and collaborators. Salary range: $70,000 - $80,000, depending on education and experience Required Qualifications: * Demonstrated success collaborating with clients on custom software solutions * Experience with various stages of the software development cycle * Expertise in development and testing of user interface designs * Excellent communication skills, both virtual and face-to-face Preferred Qualifications: * M.S. or Ph.D. in Computer Science, Bioinformatics or related field * Demonstrated interest in science, particularly biology * Expertise in dynamic and interactive web technologies (JavaScript, CGI) * Expertise in rapid application development and respective programming technologies and languages (e.g., modern scripting languages and web-application frameworks such as Python/Django, Ruby/ Ruby-on-Rails, and Perl/Catalyst). * Expertise in graphic design * Expertise in data visualization and/or scientific data integration * Expertise in software usability design and assessment * Expertise in web service (SOAP, REST, XML, JSON) and semantic web technologies * Fluency in Java programming * Prior experience in relational database programming (PostgreSQL or MySQL) * Experience with open-source, and collaborative, software development How to apply: Please send cover letter, resume and contact information for three references to Dr. Karen Cranston, Training Coordinator and Bioinformatics Project Manager (karen.cranston at nescent.org); Please also complete the online application at the University of North Carolina HR website: http://bit.ly/r9HQ8r. Informal inquires or requests for additional information may be directed to Dr. Cranston by email or phone (+1-919-613-2275). Closing date is August 15, 2011. -- =========================================================== : Hilmar Lapp -:- Durham, NC -:- hlapp at drycafe dot net : =========================================================== From jayunit100 at gmail.com Wed Aug 3 17:45:54 2011 From: jayunit100 at gmail.com (Jay Vyas) Date: Wed, 3 Aug 2011 17:45:54 -0400 Subject: [Biojava-l] bioclojure Message-ID: Hi guys : We are working on extending biojava w/ a Clojure API for building bioinformatics workflows. Anyone out there interested in doing some functional bioinformatics ? Right now, we are looking for contributors for various modules and planning at a higher level. Lee Hinnman, has been helping me so far, and will be helping to drive the low-level, highly clojure specific design issues... so you don't have to be an "Expert" in clojure to contribute. -- Jay Vyas MMSB/UCHC From andreas at sdsc.edu Wed Aug 3 18:47:40 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Wed, 3 Aug 2011 15:47:40 -0700 Subject: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment In-Reply-To: References: Message-ID: Hi Tariq, thanks for the patch, I committed it to SVN. Please verify that it works for you now. (If you provide me with a junit test case for this, I can add that as well). Andreas On Tue, Jul 26, 2011 at 5:14 AM, Muhammad Tariq Pervez wrote: > > Eventaully, I succeeded in finding the exact location of exception and fixes it as well. The problem is with that in getMultipleSequenceAlignment Method of Alignments class there are two 'if' statements as follows: > > if (cs == AminoAcidCompoundSet.getAminoAcidCompoundSet()) { > ? ? ? ? ? ?@SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal > ? ? ? ? ? ?SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getBlosum62(); > ? ? ? ? ? ?subMatrix = temp; > ? ? ? ?}else if (cs == AmbiguityDNACompoundSet.getDNACompoundSet()) { > ? ? ? ? ? ?@SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal > ? ? ? ? ? ?SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getNuc4_4(); > ? ? ? ? ? ?subMatrix = temp; > ? ? ? ? ? ?System.out.println("Inside getMSA===" +subMatrix); > ? ? ? ?} > and 'subMatrix' remains null when we try to DNA sequences. But when i added the third 'if' statement as follows the problem fixes and DNA sequences are aligned correctly. > > if (cs == AminoAcidCompoundSet.getAminoAcidCompoundSet()) { > ? ? ? ? ? ?@SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal > ? ? ? ? ? ?SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getBlosum62(); > ? ? ? ? ? ?subMatrix = temp; > ? ? ? ?} else if (cs == DNACompoundSet.getDNACompoundSet()) { > ? ? ? ? ? ?@SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal > ? ? ? ? ? ?SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getNuc4_4(); > ? ? ? ? ? ?subMatrix = temp; > ? ? ? ? ? ?System.out.println("Inside getMSA===" +subMatrix); > ? ? ? ?} > ? ? ? else if (cs == AmbiguityDNACompoundSet.getDNACompoundSet()) { > ? ? ? ? ? ?@SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal > ? ? ? ? ? ?SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getNuc4_4(); > ? ? ? ? ? ?subMatrix = temp; > ? ? ? ? ? ?System.out.println("Inside getMSA===" +subMatrix); > ? ? ? ?} > > Tariq, Phd Scholar > > > From: HWillis at scripps.edu > To: tariq_cp at hotmail.com; biojava-l at lists.open-bio.org > Date: Mon, 25 Jul 2011 09:44:23 -0400 > Subject: Re: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment > > > > Not sure if this is an issue with the MultipleSequenceAlignment code versus the way you are doing pairwise is simply throwing a concurrency exception. Can you complete all pairwise comparisons independently to rule out a problem related to the code and the sequences you are trying to align? > From: ?Muhammad Tariq Pervez > Date: ?Mon, 25 Jul 2011 06:27:02 -0400 > To: ?Scooter Willis , "Biojava-l at lists.open-bio.org" > Subject: ?RE: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment > > > Following is tmpLst filled with two DNA sequences. Scorers object is displayed from inside the object of Alignments (getMultipleSequenceAlignment method). ?All==1 is displayed from inside the method of public static , C extends Compound> int[] runPairwiseScorers( > ? ? ? ? ? ?List> scorers) { (class is Alignments) ?as follows > > all = scorers.size(); > > But the line System.out.println("futures==="+futures.get(0).get()); causes NullPointer Exception. > > List> futures = new ArrayList>(); > ? ? ? ?for (PairwiseSequenceScorer scorer : scorers) { > ? ? ? ? ? ?futures.add(ConcurrencyTools.submit(new CallablePairwiseSequenceScorer(scorer), > ? ? ? ? ? ? ? ? ? ?String.format("Scoring pair %d of %d", n++, all))); > ? ? ? ?} > ? ? ? ?try{ // perhaps this code is not working fine. > ? ? ? ?System.out.println("futures==="+futures.get(0).get()); > > tmpLst==[GAATCTATAGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCAGGTAGTCGACTCAGATTCTTGTAGTGGCTCTCATCTGATCAAGGGTATTATTCCCAAGCCATAGTAAGGTCTTCTGTTGTGCCTTTTGCTTATACATCAGGTAACATGATAGAACTAGGCTAAGTG, ATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTAATGCTGATCACTCGGACTATGCTGATATTGAGCTGTATCCGTCTGACAAGCTCTCTTGACGGCAGGCCCCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGAGATAAGGAGGCATGTGCAAAAGCCCCATTGGAGGCATATAACAGAACACTGACTACTCTGCTCACTC] > sequences=== [GAATCTATAGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCAGGTAGTCGACTCAGATTCTTGTAGTGGCTCTCATCTGATCAAGGGTATTATTCCCAAGCCATAGTAAGGTCTTCTGTTGTGCCTTTTGCTTATACATCAGGTAACATGATAGAACTAGGCTAAGTG, ATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTAATGCTGATCACTCGGACTATGCTGATATTGAGCTGTATCCGTCTGACAAGCTCTCTTGACGGCAGGCCCCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGAGATAAGGAGGCATGTGCAAAAGCCCCATTGGAGGCATATAACAGAACACTGACTACTCTGCTCACTC] > scorers=== [org.biojava3.alignment.FractionalIdentityScorer at d337d3] > all===1 > scorers===org.biojava3.alignment.FractionalIdentityScorer at d337d3 > java.util.concurrent.ExecutionException: java.lang.NullPointerException > ? ?at java.util.concurrent.FutureTask$Sync.innerGet(FutureTask.java:222) > ? ?at java.util.concurrent.FutureTask.get(FutureTask.java:83) > ? ?at pakjalphiew.Alignments.getListFromFutures(Alignments.java:304) > ? ?at pakjalphiew.Alignments.runPairwiseScorers(Alignments.java:631) > ? ?at pakjalphiew.Alignments.getMultipleSequenceAlignment(Alignments.java:194) > ? ?at pakjalphiew.MSA.msaDNAFromFiles(MSA.java:109) > ? ?at pakjalphiew.MSACalculation.calculateDNAMSAFromFiles(MSACalculation.java:42) > ? ?at pakjalphiew.MSAInterFrame.(MSAInterFrame.java:60) > ? ?at pakjalphiew.LaunchingFrame.newDNAFromFileActionPerformed(LaunchingFrame.java:265) > ? ?at pakjalphiew.LaunchingFrame.access$000(LaunchingFrame.java:26) > ? ?at pakjalphiew.LaunchingFrame$1.actionPerformed(LaunchingFrame.java:83) > ? ?at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995) > ? ?at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318) > ? ?at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387) > ? ?at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242) > ? ?at javax.swing.AbstractButton.doClick(AbstractButton.java:357) > ? ?at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:809) > ? ?at javax.swing.plaf.basic.BasicMenuItemUI$Handler.mouseReleased(BasicMenuItemUI.java:850) > ? ?at java.awt.Component.processMouseEvent(Component.java:6288) > ? ?at javax.swing.JComponent.processMouseEvent(JComponent.java:3267) > ? ?at java.awt.Component.processEvent(Component.java:6053) > ? ?at java.awt.Container.processEvent(Container.java:2041) > ? ?at java.awt.Component.dispatchEventImpl(Component.java:4651) > ? ?at java.awt.Container.dispatchEventImpl(Container.java:2099) > ? ?at java.awt.Component.dispatchEvent(Component.java:4481) > ? ?at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4577) > ? ?at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238) > ? ?at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168) > ? ?at java.awt.Container.dispatchEventImpl(Container.java:2085) > ? ?at java.awt.Window.dispatchEventImpl(Window.java:2478) > ? ?at java.awt.Component.dispatchEvent(Component.java:4481) > ? ?at java.awt.EventQueue.dispatchEventImpl(EventQueue.java:643) > ? ?at java.awt.EventQueue.access$000(EventQueue.java:84) > ? ?at java.awt.EventQueue$1.run(EventQueue.java:602) > ? ?at java.awt.EventQueue$1.run(EventQueue.java:600) > ? ?at java.security.AccessController.doPrivileged(Native Method) > ? ?at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) > ? ?at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:98) > ? ?at java.awt.EventQueue$2.run(EventQueue.java:616) > ? ?at java.awt.EventQueue$2.run(EventQueue.java:614) > ? ?at java.security.AccessController.doPrivileged(Native Method) > ? ?at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) > ? ?at java.awt.EventQueue.dispatchEvent(EventQueue.java:613) > ? ?at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269) > ? ?at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184) > ? ?at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174) > ? ?at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169) > ? ?at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161) > ? ?at java.awt.EventDispatchThread.run(EventDispatchThread.java:122) > Caused by: java.lang.NullPointerException > ? ?at org.biojava3.alignment.FractionalIdentityScorer.align(FractionalIdentityScorer.java:112) > ? ?at org.biojava3.alignment.FractionalIdentityScorer.getScore(FractionalIdentityScorer.java:105) > ? ?at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:53) > ? ?at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:38) > ? ?at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:303) > ? ?at java.util.concurrent.FutureTask.run(FutureTask.java:138) > ? ?at java.util.concurrent.ThreadPoolExecutor$Worker.runTask(ThreadPoolExecutor.java:886) > ? ?at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:908) > ? ?at java.lang.Thread.run(Thread.java:662) > Exception in thread "AWT-EventQueue-0" java.lang.NullPointerException > ? ?at pakjalphiew.AlignmentRuler.getRuler(AlignmentRuler.java:34) > ? ?at pakjalphiew.AlignmentRuler.(AlignmentRuler.java:26) > ? ?at pakjalphiew.MSAInterFrame.initComponents(MSAInterFrame.java:81) > ? ?at pakjalphiew.MSAInterFrame.(MSAInterFrame.java:62) > ? ?at pakjalphiew.LaunchingFrame.newDNAFromFileActionPerformed(LaunchingFrame.java:265) > ? ?at pakjalphiew.LaunchingFrame.access$000(LaunchingFrame.java:26) > ? ?at pakjalphiew.LaunchingFrame$1.actionPerformed(LaunchingFrame.java:83) > ? ?at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995) > ? ?at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318) > ? ?at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387) > ? ?at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242) > ? ?at javax.swing.AbstractButton.doClick(AbstractButton.java:357) > ? ?at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:809) > ? ?at javax.swing.plaf.basic.BasicMenuItemUI$Handler.mouseReleased(BasicMenuItemUI.java:850) > ? ?at java.awt.Component.processMouseEvent(Component.java:6288) > ? ?at javax.swing.JComponent.processMouseEvent(JComponent.java:3267) > ? ?at java.awt.Component.processEvent(Component.java:6053) > ? ?at java.awt.Container.processEvent(Container.java:2041) > ? ?at java.awt.Component.dispatchEventImpl(Component.java:4651) > ? ?at java.awt.Container.dispatchEventImpl(Container.java:2099) > ? ?at java.awt.Component.dispatchEvent(Component.java:4481) > ? ?at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4577) > ? ?at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238) > ? ?at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168) > ? ?at java.awt.Container.dispatchEventImpl(Container.java:2085) > ? ?at java.awt.Window.dispatchEventImpl(Window.java:2478) > ? ?at java.awt.Component.dispatchEvent(Component.java:4481) > ? ?at java.awt.EventQueue.dispatchEventImpl(EventQueue.java:643) > ? ?at java.awt.EventQueue.access$000(EventQueue.java:84) > ? ?at java.awt.EventQueue$1.run(EventQueue.java:602) > ? ?at java.awt.EventQueue$1.run(EventQueue.java:600) > ? ?at java.security.AccessController.doPrivileged(Native Method) > ? ?at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) > ? ?at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:98) > ? ?at java.awt.EventQueue$2.run(EventQueue.java:616) > ? ?at java.awt.EventQueue$2.run(EventQueue.java:614) > ? ?at java.security.AccessController.doPrivileged(Native Method) > ? ?at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) > ? ?at java.awt.EventQueue.dispatchEvent(EventQueue.java:613) > ? ?at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269) > ? ?at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184) > ? ?at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174) > ? ?at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169) > ? ?at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161) > ? ?at java.awt.EventDispatchThread.run(EventDispatchThread.java:122) > > > Muhammad Tariq Pervez > > Assistant Professor, > Department of Computer Science > Virtual University of Pakistan, Lahore > Tel: (042) 9203114-7 > URL: www.vu.edu.pk > Mobile: +923364120541, +923214602694 > > >> From: HWillis at scripps.edu >> To: tariq_cp at hotmail.com; biojava-l at lists.open-bio.org >> Date: Fri, 22 Jul 2011 08:11:34 -0400 >> Subject: Re: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment >> >> Can you include the output of the stack trace as well as a small working >> example that causes the exception? >> >> On 7/22/11 7:56 AM, "Muhammad Tariq Pervez" wrote: >> >> > >> > >> > >> >Dear all, >> > >> >I faced the NullPointerException exception while creating the DNA >> >MultipleSequenceAlignment. The same goes right with protein sequence. >> >Exception is thrown at the following line >> > >> >dnaProfile = Alignments.getMultipleSequenceAlignment(tmpLst); >> > >> >tmpLst is list of DNA sequences created/declared as follows >> >List tmpLst=new ArrayList(); >> > >> >Note: the tmpLst is filled/populated with two or more two sequences. >> > >> >I traced the exception by going into >> >Alignments.getMultipleSequenceAlignmen method of the Alignments class and >> >found the following line of code the cause of exception. >> > >> >static List getListFromFutures(List> futures) { >> > ? ? ? ?List list = new ArrayList(); >> > ? ? ? ?for (Future f : futures) { >> > ? ? ? ? ? ?// TODO when added to ConcurrencyTools, log completions and >> >exceptions instead of printing stack traces >> > ? ? ? ? ? ?try { >> > >> > ? ? ? ? ? ? ? ?list.add(f.get());** >> > ? ? ? ? ? ?} catch (InterruptedException e) { >> > ? ? ? ? ? ? ? ?e.printStackTrace(); >> > ? ? ? ? ? ?} catch (ExecutionException e) { >> > ? ? ? ? ? ? ? ?e.printStackTrace(); >> > ? ? ? ? ? ?} >> > ? ? ? ?} >> > ? ? ? ?return list; >> > ? ?} >> >** is the cause of exception. All is right with the protein sequences. >> >Can any body help/guide me regarding the problem. >> > >> >Best Regards. >> > >> > >> > >> >Tariq, PhD Scholar >> > >> >_______________________________________________ >> >Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org >> >http://lists.open-bio.org/mailman/listinfo/biojava-l >> > > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From chapmanb at 50mail.com Thu Aug 4 07:53:25 2011 From: chapmanb at 50mail.com (Brad Chapman) Date: Thu, 4 Aug 2011 07:53:25 -0400 Subject: [Biojava-l] bioclojure In-Reply-To: References: Message-ID: <20110804115325.GB30407@sobchak> Jay; Awesome that you and Lee are working on this. I've been doing more in Clojure recently and am really enjoying it. There are a few people I'm aware of doing biology related programming in Clojure that you might want to get in touch with: - Jan Aerts -- he has some bioclojure code on GitHub (https://github.com/jandot/bioclojure) and he's been leading some discussions about having a more formal collection of biological Clojure code. Definitely send him and e-mail and coordinate; it would be excellent to have a centralized community for this. - Ray Miller -- Ray has a BioMart Clojure interface on GitHub (https://github.com/ray1729) - Christopher Maier -- He's had a few recent blog posts talking about Clojure in the context of biological work: http://christophermaier.name/ Thanks again for taking this on, Brad > Hi guys : We are working on extending biojava w/ a Clojure API for building > bioinformatics workflows. > > Anyone out there interested in doing some functional bioinformatics ? > > Right now, we are looking for contributors for various modules and planning > at a higher level. > > Lee Hinnman, has been helping me so far, and will be helping to drive the > low-level, highly clojure specific design issues... so you don't have to be > an "Expert" in clojure to contribute. > > -- > Jay Vyas > MMSB/UCHC > _______________________________________________ > Biojava-l mailing list - Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l From daniel.quest at gmail.com Thu Aug 4 08:50:36 2011 From: daniel.quest at gmail.com (Daniel Quest) Date: Thu, 4 Aug 2011 08:50:36 -0400 Subject: [Biojava-l] bioclojure In-Reply-To: <20110804115325.GB30407@sobchak> References: <20110804115325.GB30407@sobchak> Message-ID: Hey guys, before you get too far into this you may want to consider Sun's JSR223. In theory JSR223 would allow you to write some code in Clojure, then write some code in plain old Java, then write some code in python (Jython actually). This would probably open up your technology stack and allow others to play. I successfully write code in Groovy using BioJava and that is kind of fun. One important thing to consider: As far as I know ScriptEngine implementations are is incorrect for Clojure and jRuby. They are not using bindings correctly. You may want to nag the authors about this. Rhino, Groovy, AppleScript, and Gremlin are all languages that are correctly implementing the specification. Jython apparently recently updated its implementations of JSR 223 to also be compliant. Just thought I would pass this information along. -Daniel On Thu, Aug 4, 2011 at 7:53 AM, Brad Chapman wrote: > Jay; > Awesome that you and Lee are working on this. I've been doing more > in Clojure recently and am really enjoying it. > > There are a few people I'm aware of doing biology related > programming in Clojure that you might want to get in touch with: > > - Jan Aerts -- he has some bioclojure code on GitHub > ?(https://github.com/jandot/bioclojure) and he's been leading some > ?discussions about having a more formal collection of biological > ?Clojure code. Definitely send him and e-mail and coordinate; it > ?would be excellent to have a centralized community for this. > > - Ray Miller -- Ray has a BioMart Clojure interface on GitHub > ?(https://github.com/ray1729) > > - Christopher Maier -- He's had a few recent blog posts talking about > ?Clojure in the context of biological work: http://christophermaier.name/ > > Thanks again for taking this on, > Brad > >> ?Hi guys : We are working on extending biojava w/ a Clojure API for building >> bioinformatics workflows. >> >> Anyone out there interested in doing some functional bioinformatics ? >> >> Right now, we are looking for contributors for various modules and planning >> at a higher level. >> >> Lee Hinnman, has been helping me so far, and will be helping to drive the >> low-level, highly clojure specific design issues... so you don't have to be >> an "Expert" in clojure to contribute. >> >> -- >> Jay Vyas >> MMSB/UCHC >> _______________________________________________ >> Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/biojava-l > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From andreas at sdsc.edu Thu Aug 4 12:02:09 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Thu, 4 Aug 2011 09:02:09 -0700 Subject: [Biojava-l] improving biojava documentation Message-ID: Hi, Is anybody interested in joining in an application for the Google Doc Sprint Summit? This would be a perfect opportunity to meet and write a BioJava 3 tutorial. Applications are due tomorrow. more about the Google Doc Sprint Summit: https://sites.google.com/site/docsprintsummit/ Let us know if you would be interested in this. Andreas From dasarnow at gmail.com Wed Aug 10 20:15:17 2011 From: dasarnow at gmail.com (Daniel Asarnow) Date: Wed, 10 Aug 2011 17:15:17 -0700 Subject: [Biojava-l] structure alignment display Message-ID: Hello everyone, I need to display alignments in an application and would like to do via the toPdb() of a "fake" structure containing the alignment. It appears that there are potentially a few ways to do this using the utility / display methods in structure-gui. I was wondering if I need to build from trunk to do this; the commit messages imply that there might have been some problems with some of the methods in StructureAlignmentDisplay and DisplayAFP at the time of the release. If it isn't necessary to build the libraries for that reason, I was planning on copying the code from DisplayAFP.createArtificialStructure(), as that method wasn't present at the time of the release. Thanks in advance and best regards, -da From andreas at sdsc.edu Wed Aug 10 20:55:42 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Wed, 10 Aug 2011 17:55:42 -0700 Subject: [Biojava-l] structure alignment display In-Reply-To: References: Message-ID: Hi Daniel, > I was wondering if I need to build from trunk to do this; No. There are several alternatives available for accessing the code. Are you using Maven? There is a public Maven repository at http://www.biojava.org/download/maven/ from which you could get the latest "snapshot" builds/releases. Alternatively there is also a compiled and bundled version of the structure alignment tools (for command line execution) available at http://source.rcsb.org/download.jsp which is usually not too far behind the latest trunk. the commit > messages imply that there might have been some problems with some of the > methods in StructureAlignmentDisplay and DisplayAFP at the time of the > release. There was an issue at some point causing problems with the display of flexible and circular permutated alignments, but I don't remember if that was also the case in the release. ?If it isn't necessary to build the libraries for that reason, I > was planning on copying the code from > DisplayAFP.createArtificialStructure(), as that method wasn't present at the > time of the release. If you are using Jmol, I recommend using StructureAlignmentDisplay.display(). If you want to export to another viewer, use DisplayAFP.createArtificialStructure() and then structure.toPDB(). You are right, that method is more recent, so try to get one of the builds as described above. Your comments suggest that we should tag another stable BioJava release soon. I guess a good time will be shortly after Google summer of code is over (in 2 weeks)... Andreas From dasarnow at gmail.com Sun Aug 14 15:08:52 2011 From: dasarnow at gmail.com (Daniel Asarnow) Date: Sun, 14 Aug 2011 12:08:52 -0700 Subject: [Biojava-l] exception in DisplayAFP.createArtificialStructure Message-ID: Hello again, I'm getting a null value from DisplayAFP.createArtificialStructure after a successful alignment. It appears that the Groups in hetatms aren't set or are missing their Atom; There is a StructureException ("no atom found at position 0") thrown from the Group.getAtom call at DisplayAFP line 487 (inside the getAtomArray call at line 679). Here is my code: Structure structure1 = cache.getStructure("2hhb.A"); // Hb A chain Structure structure2 = cache.getStructure("2v1k.A"); // Mb Atom[] ca1 = StructureTools.getAtomCAArray(structure1); Atom[] ca2 = StructureTools.getAtomCAArray(structure2); StructureAlignment alignment = StructureAlignmentFactory.getAlgorithm(algorithmName); AFPChain afpChain = alignment.align(ca1, ca2, params); // successful w/ correct alignment score artificial = DisplayAFP.createArtificalStructure(afpChain, ca1, ca2); // returns null This is with the 3.0.2 snapshot JARs. I'm a missing something or is this a bug? Thanks! -da From andreas at sdsc.edu Mon Aug 15 01:09:04 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Sun, 14 Aug 2011 22:09:04 -0700 Subject: [Biojava-l] exception in DisplayAFP.createArtificialStructure In-Reply-To: References: Message-ID: Hi Daniel, having problems to reproduce this... What is the algorithmName you are using and any non standard parameters? Also, any parameters you are setting on AtomCache? Andreas On Sun, Aug 14, 2011 at 12:08 PM, Daniel Asarnow wrote: > Hello again, > I'm getting a null value from DisplayAFP.createArtificialStructure after a > successful alignment. ?It appears that the Groups in hetatms aren't set or > are missing their Atom; There is a StructureException ("no atom found at > position 0") thrown from the Group.getAtom call at DisplayAFP line 487 > (inside the getAtomArray call at line 679). > > Here is my code: > > Structure structure1 = cache.getStructure("2hhb.A"); // Hb A chain > Structure structure2 = cache.getStructure("2v1k.A"); // Mb > Atom[] ca1 = StructureTools.getAtomCAArray(structure1); > Atom[] ca2 = StructureTools.getAtomCAArray(structure2); > StructureAlignment alignment = > StructureAlignmentFactory.getAlgorithm(algorithmName); > AFPChain afpChain = alignment.align(ca1, ca2, params); // successful w/ > correct alignment score > artificial = DisplayAFP.createArtificalStructure(afpChain, ca1, ca2); // > returns null > > This is with the 3.0.2 snapshot JARs. > I'm a missing something or is this a bug? > > Thanks! > > -da > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From dasarnow at gmail.com Mon Aug 15 04:02:41 2011 From: dasarnow at gmail.com (Daniel Asarnow) Date: Mon, 15 Aug 2011 01:02:41 -0700 Subject: [Biojava-l] exception in DisplayAFP.createArtificialStructure In-Reply-To: References: Message-ID: I create the AtomCache as follows: AtomCache cache = new AtomCache(pdbPath, divided); FileParsingParameters params = new FileParsingParameters(); params.setAlignSeqRes(false); params.setParseSecStruc(false); params.setLoadChemCompInfo(false); params.setParseCAOnly(true); cache.setFileParsingParams(params); My algorithmName is simply from CeMain.algorithmName or FatCatFlexible.algorithmName, and I use the default CeParameters or FatCatParameters. I get the StructureException I described, and then a NullPointerException when trying to access the artificial structure (I also test specifically that the artificial structure is null). My apologies for not adding that (about the NPE) previously, I made a bare bones version of my method to remove my application-specific code and looking at the output made me realize I hadn't mentioned it. -da On Sun, Aug 14, 2011 at 22:09, Andreas Prlic wrote: > Hi Daniel, > > having problems to reproduce this... What is the algorithmName you are > using and any non standard parameters? Also, any parameters you are > setting on AtomCache? > > Andreas > > > On Sun, Aug 14, 2011 at 12:08 PM, Daniel Asarnow > wrote: > > Hello again, > > I'm getting a null value from DisplayAFP.createArtificialStructure after > a > > successful alignment. It appears that the Groups in hetatms aren't set > or > > are missing their Atom; There is a StructureException ("no atom found at > > position 0") thrown from the Group.getAtom call at DisplayAFP line 487 > > (inside the getAtomArray call at line 679). > > > > Here is my code: > > > > Structure structure1 = cache.getStructure("2hhb.A"); // Hb A chain > > Structure structure2 = cache.getStructure("2v1k.A"); // Mb > > Atom[] ca1 = StructureTools.getAtomCAArray(structure1); > > Atom[] ca2 = StructureTools.getAtomCAArray(structure2); > > StructureAlignment alignment = > > StructureAlignmentFactory.getAlgorithm(algorithmName); > > AFPChain afpChain = alignment.align(ca1, ca2, params); // successful w/ > > correct alignment score > > artificial = DisplayAFP.createArtificalStructure(afpChain, ca1, ca2); // > > returns null > > > > This is with the 3.0.2 snapshot JARs. > > I'm a missing something or is this a bug? > > > > Thanks! > > > > -da > > _______________________________________________ > > Biojava-l mailing list - Biojava-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/biojava-l > > > From andreas at sdsc.edu Mon Aug 15 10:15:11 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Mon, 15 Aug 2011 07:15:11 -0700 Subject: [Biojava-l] exception in DisplayAFP.createArtificialStructure In-Reply-To: References: Message-ID: Ok, got it. This happened, since you are using a Calpha-only representation of the molecule. If you update the DisplayAFPChain class, this should be fixed now. Since you are not using all atoms for the alignment, ligands won't get superimposed This is something that some users find useful... Andreas On Mon, Aug 15, 2011 at 1:02 AM, Daniel Asarnow wrote: > I create the AtomCache as follows: > AtomCache cache = new AtomCache(pdbPath, divided); > FileParsingParameters params = new FileParsingParameters(); > params.setAlignSeqRes(false); > params.setParseSecStruc(false); > params.setLoadChemCompInfo(false); > params.setParseCAOnly(true); > cache.setFileParsingParams(params); > My algorithmName is simply from CeMain.algorithmName or > FatCatFlexible.algorithmName, and I use the default CeParameters or > FatCatParameters. > I get the StructureException I described, and then a NullPointerException > when trying to access the artificial structure (I also test specifically > that the artificial structure is null). > My apologies for not adding that (about the NPE) previously, I made a bare > bones version of my method to remove my application-specific code and > looking at the output made me realize I hadn't mentioned it. > -da > On Sun, Aug 14, 2011 at 22:09, Andreas Prlic wrote: >> >> Hi Daniel, >> >> having problems to reproduce this... What is the algorithmName you are >> using and any non standard parameters? Also, any parameters you are >> setting on AtomCache? >> >> Andreas >> >> >> On Sun, Aug 14, 2011 at 12:08 PM, Daniel Asarnow >> wrote: >> > Hello again, >> > I'm getting a null value from DisplayAFP.createArtificialStructure after >> > a >> > successful alignment. ?It appears that the Groups in hetatms aren't set >> > or >> > are missing their Atom; There is a StructureException ("no atom found at >> > position 0") thrown from the Group.getAtom call at DisplayAFP line 487 >> > (inside the getAtomArray call at line 679). >> > >> > Here is my code: >> > >> > Structure structure1 = cache.getStructure("2hhb.A"); // Hb A chain >> > Structure structure2 = cache.getStructure("2v1k.A"); // Mb >> > Atom[] ca1 = StructureTools.getAtomCAArray(structure1); >> > Atom[] ca2 = StructureTools.getAtomCAArray(structure2); >> > StructureAlignment alignment = >> > StructureAlignmentFactory.getAlgorithm(algorithmName); >> > AFPChain afpChain = alignment.align(ca1, ca2, params); // successful w/ >> > correct alignment score >> > artificial = DisplayAFP.createArtificalStructure(afpChain, ca1, ca2); // >> > returns null >> > >> > This is with the 3.0.2 snapshot JARs. >> > I'm a missing something or is this a bug? >> > >> > Thanks! >> > >> > -da >> > _______________________________________________ >> > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org >> > http://lists.open-bio.org/mailman/listinfo/biojava-l >> > > > From dasarnow at gmail.com Wed Aug 24 03:06:11 2011 From: dasarnow at gmail.com (Daniel Asarnow) Date: Wed, 24 Aug 2011 00:06:11 -0700 Subject: [Biojava-l] exception in DisplayAFP.createArtificialStructure In-Reply-To: References: Message-ID: Sorry for the delay in replying, but I can confirm your fix is working. Thanks again for all your help. -da On Mon, Aug 15, 2011 at 07:15, Andreas Prlic wrote: > Ok, got it. This happened, since you are using a Calpha-only > representation of the molecule. If you update the DisplayAFPChain > class, this should be fixed now. Since you are not using all atoms for > the alignment, ligands won't get superimposed This is something that > some users find useful... > > Andreas > > > On Mon, Aug 15, 2011 at 1:02 AM, Daniel Asarnow > wrote: > > I create the AtomCache as follows: > > AtomCache cache = new AtomCache(pdbPath, divided); > > FileParsingParameters params = new FileParsingParameters(); > > params.setAlignSeqRes(false); > > params.setParseSecStruc(false); > > params.setLoadChemCompInfo(false); > > params.setParseCAOnly(true); > > cache.setFileParsingParams(params); > > My algorithmName is simply from CeMain.algorithmName or > > FatCatFlexible.algorithmName, and I use the default CeParameters or > > FatCatParameters. > > I get the StructureException I described, and then a NullPointerException > > when trying to access the artificial structure (I also test specifically > > that the artificial structure is null). > > My apologies for not adding that (about the NPE) previously, I made a > bare > > bones version of my method to remove my application-specific code and > > looking at the output made me realize I hadn't mentioned it. > > -da > > On Sun, Aug 14, 2011 at 22:09, Andreas Prlic wrote: > >> > >> Hi Daniel, > >> > >> having problems to reproduce this... What is the algorithmName you are > >> using and any non standard parameters? Also, any parameters you are > >> setting on AtomCache? > >> > >> Andreas > >> > >> > >> On Sun, Aug 14, 2011 at 12:08 PM, Daniel Asarnow > >> wrote: > >> > Hello again, > >> > I'm getting a null value from DisplayAFP.createArtificialStructure > after > >> > a > >> > successful alignment. It appears that the Groups in hetatms aren't > set > >> > or > >> > are missing their Atom; There is a StructureException ("no atom found > at > >> > position 0") thrown from the Group.getAtom call at DisplayAFP line 487 > >> > (inside the getAtomArray call at line 679). > >> > > >> > Here is my code: > >> > > >> > Structure structure1 = cache.getStructure("2hhb.A"); // Hb A chain > >> > Structure structure2 = cache.getStructure("2v1k.A"); // Mb > >> > Atom[] ca1 = StructureTools.getAtomCAArray(structure1); > >> > Atom[] ca2 = StructureTools.getAtomCAArray(structure2); > >> > StructureAlignment alignment = > >> > StructureAlignmentFactory.getAlgorithm(algorithmName); > >> > AFPChain afpChain = alignment.align(ca1, ca2, params); // successful > w/ > >> > correct alignment score > >> > artificial = DisplayAFP.createArtificalStructure(afpChain, ca1, ca2); > // > >> > returns null > >> > > >> > This is with the 3.0.2 snapshot JARs. > >> > I'm a missing something or is this a bug? > >> > > >> > Thanks! > >> > > >> > -da > >> > _______________________________________________ > >> > Biojava-l mailing list - Biojava-l at lists.open-bio.org > >> > http://lists.open-bio.org/mailman/listinfo/biojava-l > >> > > > > > > From kohchuanhock at gmail.com Wed Aug 24 22:12:43 2011 From: kohchuanhock at gmail.com (Chuan Hock Koh) Date: Thu, 25 Aug 2011 10:12:43 +0800 Subject: [Biojava-l] Work completed for GSoC:AAPropertiesComputation In-Reply-To: References: Message-ID: Hi All, The Google Summer of Code has come to an end. Please allow me to share with you what was achieved during this summer by me, Andreas Prlic and Peter Troshin. 1) A set of APIs to compute Physico-Chemical properties of protein sequences. Please see CookBook ( http://biojava.org/wiki/BioJava:CookBook:AAPROP:main) on how to use them. Following is a list of properties that could be generated: - Molecular weight - Extinction coefficient - Instability index - Aliphatic index - Grand Average of Hydropathy - Isoelectric point - Amino acid composition 2) A executable jar to do the same thing as point 1. Please see CookBook ( http://biojava.org/wiki/BioJava:CookBook:AAPROP:commandprompt) for examples on usage. 3) A set of APIs to compute PROFEAT properties of protein sequences. Please see this paper ( http://nar.oxfordjournals.org/content/34/suppl_2/W32.abstract) for more details about PROFEAT properties. Also, do see CookBook ( http://biojava.org/wiki/BioJava:CookBook:AAPROP:profeat) on how to use them. 4) Another thing worth noting is that as requested by the BioJava community, we have enabled the customization for the computing of molecular weight for point 1 and 2. Please see CookBook ( http://biojava.org/wiki/BioJava:CookBook:AAPROP:xmlfiles) for more information. 5) Also, a SOAP web service for physico-chemical properties computation (point 1) was developed within the JABAWS framework for portable web services (http://www.compbio.dundee.ac.uk/jabaws/). This web service can be installed on your own computing infrastructure with ease. If you intend to use this web service, please contact us for further details. I would continue to improve and work on this package even after this summer. Therefore, if you have any feedback or comments. Please feel free to drop me a mail. Thanks! Regards, Chuan Hock Koh (aka Ah Fu), Andreas Prlic and Peter Troshin -- http://compbio.ddns.comp.nus.edu.sg/~ChuanHockKoh From andreas at sdsc.edu Thu Aug 25 13:06:50 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Thu, 25 Aug 2011 10:06:50 -0700 Subject: [Biojava-l] Work completed for GSoC:AAPropertiesComputation In-Reply-To: References: Message-ID: Hi Ah Fu and Peter, Thank you both for your dedicated work over the summer. It is great to see the new modules coming out of this and this further extends the list of useful things you can use BioJava for. Let's try to make access to these new features as easy as possible by making a new release within the next two weeks. I suggest to have a code freeze by Thursday September 1st (today in a week), then I will make the release during the days after. Until then lets make sure that the documentation is up to date and any outstanding commits are being made. Andreas On Wed, Aug 24, 2011 at 7:12 PM, Chuan Hock Koh wrote: > Hi All, > > The Google Summer of Code has come to an end. Please allow me to share with > you what was achieved during this summer by me, Andreas Prlic and Peter > Troshin. > > 1) A set of APIs to compute Physico-Chemical properties of protein > sequences. Please see CookBook ( > http://biojava.org/wiki/BioJava:CookBook:AAPROP:main) on how to use them. > Following is a list of properties that could be generated: > > ? - Molecular weight > ? - Extinction coefficient > ? - Instability index > ? - Aliphatic index > ? - Grand Average of Hydropathy > ? - Isoelectric point > ? - Amino acid composition > > > 2) A executable jar to do the same thing as point 1. Please see CookBook ( > http://biojava.org/wiki/BioJava:CookBook:AAPROP:commandprompt) for examples > on usage. > > 3) A set of APIs to compute PROFEAT properties of protein sequences. Please > see this paper ( > http://nar.oxfordjournals.org/content/34/suppl_2/W32.abstract) for more > details about PROFEAT properties. Also, do see CookBook ( > http://biojava.org/wiki/BioJava:CookBook:AAPROP:profeat) on how to use them. > > 4) Another thing worth noting is that as requested by the BioJava community, > we have enabled the customization for the computing of molecular weight for > point 1 and 2. Please see CookBook ( > http://biojava.org/wiki/BioJava:CookBook:AAPROP:xmlfiles) for more > information. > > 5) Also, a SOAP web service for physico-chemical properties computation > (point 1) was developed within the JABAWS framework for portable web > services (http://www.compbio.dundee.ac.uk/jabaws/). This web service can be > installed on your own computing infrastructure with ease. If you intend to > use this web service, please contact us for further details. > > I would continue to improve and work on this package even after this summer. > Therefore, if you have any feedback or comments. Please feel free to drop me > a mail. Thanks! > > Regards, > Chuan Hock Koh (aka Ah Fu), Andreas Prlic and Peter Troshin > > -- > http://compbio.ddns.comp.nus.edu.sg/~ChuanHockKoh > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From p.v.troshin at dundee.ac.uk Thu Aug 25 18:26:20 2011 From: p.v.troshin at dundee.ac.uk (Peter Troshin) Date: Thu, 25 Aug 2011 23:26:20 +0100 Subject: [Biojava-l] Work completed for GSoC:AAPropertiesComputation In-Reply-To: References: Message-ID: <4E56CC0C.8080209@dundee.ac.uk> Hi guys, New release sounds great! It nicely wraps up the work completed during this year's Google Summer of Code. Thank you for making it! Perhaps, I should say a few words about another, recently added piece of the functionality for prediction of disordered regions from a protein sequence. This work is wrapped up as a /biojava3-protein-disorder/ module. For now, this module contains one method for the prediction of disordered regions. This method is based on the Java implementation of RONN predictor. This code has been originally developed for another project and made its way into the BioJava. As the main code behind this is a Java implementation of RONN, unimaginatively we call it /JRONN/. JRONN is based on RONN version 3.1 which is still current in time of writing (August 2011) and so gives the same predictions as RONN. Main motivation behind JRONN development was providing an implementation of RONN more suitable to use by the automated analysis pipelines and web services. Robert Esnouf has kindly allowed us to explore the RONN code and share the results with the community. Original version of RONN is described in Yang,Z.R., Thomson,R., McMeil,P. and Esnouf,R.M. (2005) RONN: the bio-basis function neural network technique applied to the detection of natively disordered regions in proteins. Bioinformatics 21: 3369-3376 Please refer to the cookbook entry http://biojava.org/wiki/BioJava:CookBook#biojava3-protein-disorder for more information about disorder prediction module. Happy coding, Peter P.S. I think the documentation for biojava3-protein-disorder module is ok, unless someone can suggest any improvements. P.P.S. Andreas, it would be great if you could remove the content of this directory http://www.biojava.org/download/maven/org/biojava/biojava3-protein-disorder to get rid of outdated artefacts. On 25/08/2011 18:06, Andreas Prlic wrote: > Hi Ah Fu and Peter, > > Thank you both for your dedicated work over the summer. It is great to > see the new modules coming out of this and this further extends the > list of useful things you can use BioJava for. Let's try to make > access to these new features as easy as possible by making a new > release within the next two weeks. > > I suggest to have a code freeze by Thursday September 1st (today in a > week), then I will make the release during the days after. Until then > lets make sure that the documentation is up to date and any > outstanding commits are being made. > > Andreas > > > > > On Wed, Aug 24, 2011 at 7:12 PM, Chuan Hock Koh wrote: >> Hi All, >> >> The Google Summer of Code has come to an end. Please allow me to share with >> you what was achieved during this summer by me, Andreas Prlic and Peter >> Troshin. >> >> 1) A set of APIs to compute Physico-Chemical properties of protein >> sequences. Please see CookBook ( >> http://biojava.org/wiki/BioJava:CookBook:AAPROP:main) on how to use them. >> Following is a list of properties that could be generated: >> >> - Molecular weight >> - Extinction coefficient >> - Instability index >> - Aliphatic index >> - Grand Average of Hydropathy >> - Isoelectric point >> - Amino acid composition >> >> >> 2) A executable jar to do the same thing as point 1. Please see CookBook ( >> http://biojava.org/wiki/BioJava:CookBook:AAPROP:commandprompt) for examples >> on usage. >> >> 3) A set of APIs to compute PROFEAT properties of protein sequences. Please >> see this paper ( >> http://nar.oxfordjournals.org/content/34/suppl_2/W32.abstract) for more >> details about PROFEAT properties. Also, do see CookBook ( >> http://biojava.org/wiki/BioJava:CookBook:AAPROP:profeat) on how to use them. >> >> 4) Another thing worth noting is that as requested by the BioJava community, >> we have enabled the customization for the computing of molecular weight for >> point 1 and 2. Please see CookBook ( >> http://biojava.org/wiki/BioJava:CookBook:AAPROP:xmlfiles) for more >> information. >> >> 5) Also, a SOAP web service for physico-chemical properties computation >> (point 1) was developed within the JABAWS framework for portable web >> services (http://www.compbio.dundee.ac.uk/jabaws/). This web service can be >> installed on your own computing infrastructure with ease. If you intend to >> use this web service, please contact us for further details. >> >> I would continue to improve and work on this package even after this summer. >> Therefore, if you have any feedback or comments. Please feel free to drop me >> a mail. Thanks! >> >> Regards, >> Chuan Hock Koh (aka Ah Fu), Andreas Prlic and Peter Troshin >> >> -- >> http://compbio.ddns.comp.nus.edu.sg/~ChuanHockKoh >> _______________________________________________ >> Biojava-l mailing list -Biojava-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/biojava-l >> From hlapp at drycafe.net Mon Aug 1 22:36:27 2011 From: hlapp at drycafe.net (Hilmar Lapp) Date: Mon, 1 Aug 2011 18:36:27 -0400 Subject: [Biojava-l] Job opportunity: User Interface Design and Web Application Developer Message-ID: <7F0AE58E-6052-469B-ACD0-207FAD060472@drycafe.net> (Apologies if you have received this already or if this is considered spam - we're trying to reach out as broad as possible and I know that quite a few in the Bio* communities would be well qualified. Please feel free to pass on to anyone who might be interested, or might know someone who is.) User Interface Design and Web Application Developer The National Evolutionary Synthesis Center (NESCent) seeks a creative and enthusiastic individual to design user interfaces and web applications for scientific applications that manage, analyze, visualize and share data in support of evolutionary research. The incumbent will work as part of a small informatics team in close collaboration with domain scientists. NESCent (http://nescent.org) is an NSF-funded center dedicated to cross-disciplinary research in evolutionary science. Our informatics team works closely with visiting and resident scientists to support their custom software and database development needs (http://informatics.nescent.org ), and collaborates broadly with other biodiversity informatics projects. All NESCent software products are open-source, and the Center has a number of initiatives to actively promote collaborative development of community software resources. Above all, we are enthusiastic about our work, about the mission of the Center, and about the contribution of informatics to that mission. Job description: The incumbent will design and develop user interfaces and web applications for databases and other software tools for sponsored scientists and staff. The job responsibilities include all stages of the software development process, including requirements gathering, design, implementation, release packaging and documentation, as part of a small team (typically 2-3 individuals). We expect the incumbent to present their work at conferences and contribute to publications with scientific collaborators; interact regularly with visiting and resident scientists, other members of the informatics team and Center staff; and generally serve as an expert resource for Center personnel. The position provides opportunities for professional development and encourages research into new technologies. Most informatics staff work at our Durham NC offices, located adjacent to Duke University, but we support a wide range of technologies for virtual communication with off-site staff and collaborators. Salary range: $70,000 - $80,000, depending on education and experience Required Qualifications: * Demonstrated success collaborating with clients on custom software solutions * Experience with various stages of the software development cycle * Expertise in development and testing of user interface designs * Excellent communication skills, both virtual and face-to-face Preferred Qualifications: * M.S. or Ph.D. in Computer Science, Bioinformatics or related field * Demonstrated interest in science, particularly biology * Expertise in dynamic and interactive web technologies (JavaScript, CGI) * Expertise in rapid application development and respective programming technologies and languages (e.g., modern scripting languages and web-application frameworks such as Python/Django, Ruby/ Ruby-on-Rails, and Perl/Catalyst). * Expertise in graphic design * Expertise in data visualization and/or scientific data integration * Expertise in software usability design and assessment * Expertise in web service (SOAP, REST, XML, JSON) and semantic web technologies * Fluency in Java programming * Prior experience in relational database programming (PostgreSQL or MySQL) * Experience with open-source, and collaborative, software development How to apply: Please send cover letter, resume and contact information for three references to Dr. Karen Cranston, Training Coordinator and Bioinformatics Project Manager (karen.cranston at nescent.org); Please also complete the online application at the University of North Carolina HR website: http://bit.ly/r9HQ8r. Informal inquires or requests for additional information may be directed to Dr. Cranston by email or phone (+1-919-613-2275). Closing date is August 15, 2011. -- =========================================================== : Hilmar Lapp -:- Durham, NC -:- hlapp at drycafe dot net : =========================================================== From jayunit100 at gmail.com Wed Aug 3 21:45:54 2011 From: jayunit100 at gmail.com (Jay Vyas) Date: Wed, 3 Aug 2011 17:45:54 -0400 Subject: [Biojava-l] bioclojure Message-ID: Hi guys : We are working on extending biojava w/ a Clojure API for building bioinformatics workflows. Anyone out there interested in doing some functional bioinformatics ? Right now, we are looking for contributors for various modules and planning at a higher level. Lee Hinnman, has been helping me so far, and will be helping to drive the low-level, highly clojure specific design issues... so you don't have to be an "Expert" in clojure to contribute. -- Jay Vyas MMSB/UCHC From andreas at sdsc.edu Wed Aug 3 22:47:40 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Wed, 3 Aug 2011 15:47:40 -0700 Subject: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment In-Reply-To: References: Message-ID: Hi Tariq, thanks for the patch, I committed it to SVN. Please verify that it works for you now. (If you provide me with a junit test case for this, I can add that as well). Andreas On Tue, Jul 26, 2011 at 5:14 AM, Muhammad Tariq Pervez wrote: > > Eventaully, I succeeded in finding the exact location of exception and fixes it as well. The problem is with that in getMultipleSequenceAlignment Method of Alignments class there are two 'if' statements as follows: > > if (cs == AminoAcidCompoundSet.getAminoAcidCompoundSet()) { > ? ? ? ? ? ?@SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal > ? ? ? ? ? ?SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getBlosum62(); > ? ? ? ? ? ?subMatrix = temp; > ? ? ? ?}else if (cs == AmbiguityDNACompoundSet.getDNACompoundSet()) { > ? ? ? ? ? ?@SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal > ? ? ? ? ? ?SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getNuc4_4(); > ? ? ? ? ? ?subMatrix = temp; > ? ? ? ? ? ?System.out.println("Inside getMSA===" +subMatrix); > ? ? ? ?} > and 'subMatrix' remains null when we try to DNA sequences. But when i added the third 'if' statement as follows the problem fixes and DNA sequences are aligned correctly. > > if (cs == AminoAcidCompoundSet.getAminoAcidCompoundSet()) { > ? ? ? ? ? ?@SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal > ? ? ? ? ? ?SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getBlosum62(); > ? ? ? ? ? ?subMatrix = temp; > ? ? ? ?} else if (cs == DNACompoundSet.getDNACompoundSet()) { > ? ? ? ? ? ?@SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal > ? ? ? ? ? ?SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getNuc4_4(); > ? ? ? ? ? ?subMatrix = temp; > ? ? ? ? ? ?System.out.println("Inside getMSA===" +subMatrix); > ? ? ? ?} > ? ? ? else if (cs == AmbiguityDNACompoundSet.getDNACompoundSet()) { > ? ? ? ? ? ?@SuppressWarnings("unchecked") // compound types must be equal since compound sets are equal > ? ? ? ? ? ?SubstitutionMatrix temp = (SubstitutionMatrix) SubstitutionMatrixHelper.getNuc4_4(); > ? ? ? ? ? ?subMatrix = temp; > ? ? ? ? ? ?System.out.println("Inside getMSA===" +subMatrix); > ? ? ? ?} > > Tariq, Phd Scholar > > > From: HWillis at scripps.edu > To: tariq_cp at hotmail.com; biojava-l at lists.open-bio.org > Date: Mon, 25 Jul 2011 09:44:23 -0400 > Subject: Re: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment > > > > Not sure if this is an issue with the MultipleSequenceAlignment code versus the way you are doing pairwise is simply throwing a concurrency exception. Can you complete all pairwise comparisons independently to rule out a problem related to the code and the sequences you are trying to align? > From: ?Muhammad Tariq Pervez > Date: ?Mon, 25 Jul 2011 06:27:02 -0400 > To: ?Scooter Willis , "Biojava-l at lists.open-bio.org" > Subject: ?RE: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment > > > Following is tmpLst filled with two DNA sequences. Scorers object is displayed from inside the object of Alignments (getMultipleSequenceAlignment method). ?All==1 is displayed from inside the method of public static , C extends Compound> int[] runPairwiseScorers( > ? ? ? ? ? ?List> scorers) { (class is Alignments) ?as follows > > all = scorers.size(); > > But the line System.out.println("futures==="+futures.get(0).get()); causes NullPointer Exception. > > List> futures = new ArrayList>(); > ? ? ? ?for (PairwiseSequenceScorer scorer : scorers) { > ? ? ? ? ? ?futures.add(ConcurrencyTools.submit(new CallablePairwiseSequenceScorer(scorer), > ? ? ? ? ? ? ? ? ? ?String.format("Scoring pair %d of %d", n++, all))); > ? ? ? ?} > ? ? ? ?try{ // perhaps this code is not working fine. > ? ? ? ?System.out.println("futures==="+futures.get(0).get()); > > tmpLst==[GAATCTATAGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCAGGTAGTCGACTCAGATTCTTGTAGTGGCTCTCATCTGATCAAGGGTATTATTCCCAAGCCATAGTAAGGTCTTCTGTTGTGCCTTTTGCTTATACATCAGGTAACATGATAGAACTAGGCTAAGTG, ATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTAATGCTGATCACTCGGACTATGCTGATATTGAGCTGTATCCGTCTGACAAGCTCTCTTGACGGCAGGCCCCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGAGATAAGGAGGCATGTGCAAAAGCCCCATTGGAGGCATATAACAGAACACTGACTACTCTGCTCACTC] > sequences=== [GAATCTATAGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCAGGTAGTCGACTCAGATTCTTGTAGTGGCTCTCATCTGATCAAGGGTATTATTCCCAAGCCATAGTAAGGTCTTCTGTTGTGCCTTTTGCTTATACATCAGGTAACATGATAGAACTAGGCTAAGTG, ATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTAATGCTGATCACTCGGACTATGCTGATATTGAGCTGTATCCGTCTGACAAGCTCTCTTGACGGCAGGCCCCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGAGATAAGGAGGCATGTGCAAAAGCCCCATTGGAGGCATATAACAGAACACTGACTACTCTGCTCACTC] > scorers=== [org.biojava3.alignment.FractionalIdentityScorer at d337d3] > all===1 > scorers===org.biojava3.alignment.FractionalIdentityScorer at d337d3 > java.util.concurrent.ExecutionException: java.lang.NullPointerException > ? ?at java.util.concurrent.FutureTask$Sync.innerGet(FutureTask.java:222) > ? ?at java.util.concurrent.FutureTask.get(FutureTask.java:83) > ? ?at pakjalphiew.Alignments.getListFromFutures(Alignments.java:304) > ? ?at pakjalphiew.Alignments.runPairwiseScorers(Alignments.java:631) > ? ?at pakjalphiew.Alignments.getMultipleSequenceAlignment(Alignments.java:194) > ? ?at pakjalphiew.MSA.msaDNAFromFiles(MSA.java:109) > ? ?at pakjalphiew.MSACalculation.calculateDNAMSAFromFiles(MSACalculation.java:42) > ? ?at pakjalphiew.MSAInterFrame.(MSAInterFrame.java:60) > ? ?at pakjalphiew.LaunchingFrame.newDNAFromFileActionPerformed(LaunchingFrame.java:265) > ? ?at pakjalphiew.LaunchingFrame.access$000(LaunchingFrame.java:26) > ? ?at pakjalphiew.LaunchingFrame$1.actionPerformed(LaunchingFrame.java:83) > ? ?at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995) > ? ?at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318) > ? ?at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387) > ? ?at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242) > ? ?at javax.swing.AbstractButton.doClick(AbstractButton.java:357) > ? ?at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:809) > ? ?at javax.swing.plaf.basic.BasicMenuItemUI$Handler.mouseReleased(BasicMenuItemUI.java:850) > ? ?at java.awt.Component.processMouseEvent(Component.java:6288) > ? ?at javax.swing.JComponent.processMouseEvent(JComponent.java:3267) > ? ?at java.awt.Component.processEvent(Component.java:6053) > ? ?at java.awt.Container.processEvent(Container.java:2041) > ? ?at java.awt.Component.dispatchEventImpl(Component.java:4651) > ? ?at java.awt.Container.dispatchEventImpl(Container.java:2099) > ? ?at java.awt.Component.dispatchEvent(Component.java:4481) > ? ?at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4577) > ? ?at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238) > ? ?at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168) > ? ?at java.awt.Container.dispatchEventImpl(Container.java:2085) > ? ?at java.awt.Window.dispatchEventImpl(Window.java:2478) > ? ?at java.awt.Component.dispatchEvent(Component.java:4481) > ? ?at java.awt.EventQueue.dispatchEventImpl(EventQueue.java:643) > ? ?at java.awt.EventQueue.access$000(EventQueue.java:84) > ? ?at java.awt.EventQueue$1.run(EventQueue.java:602) > ? ?at java.awt.EventQueue$1.run(EventQueue.java:600) > ? ?at java.security.AccessController.doPrivileged(Native Method) > ? ?at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) > ? ?at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:98) > ? ?at java.awt.EventQueue$2.run(EventQueue.java:616) > ? ?at java.awt.EventQueue$2.run(EventQueue.java:614) > ? ?at java.security.AccessController.doPrivileged(Native Method) > ? ?at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) > ? ?at java.awt.EventQueue.dispatchEvent(EventQueue.java:613) > ? ?at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269) > ? ?at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184) > ? ?at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174) > ? ?at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169) > ? ?at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161) > ? ?at java.awt.EventDispatchThread.run(EventDispatchThread.java:122) > Caused by: java.lang.NullPointerException > ? ?at org.biojava3.alignment.FractionalIdentityScorer.align(FractionalIdentityScorer.java:112) > ? ?at org.biojava3.alignment.FractionalIdentityScorer.getScore(FractionalIdentityScorer.java:105) > ? ?at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:53) > ? ?at org.biojava3.alignment.template.CallablePairwiseSequenceScorer.call(CallablePairwiseSequenceScorer.java:38) > ? ?at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:303) > ? ?at java.util.concurrent.FutureTask.run(FutureTask.java:138) > ? ?at java.util.concurrent.ThreadPoolExecutor$Worker.runTask(ThreadPoolExecutor.java:886) > ? ?at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:908) > ? ?at java.lang.Thread.run(Thread.java:662) > Exception in thread "AWT-EventQueue-0" java.lang.NullPointerException > ? ?at pakjalphiew.AlignmentRuler.getRuler(AlignmentRuler.java:34) > ? ?at pakjalphiew.AlignmentRuler.(AlignmentRuler.java:26) > ? ?at pakjalphiew.MSAInterFrame.initComponents(MSAInterFrame.java:81) > ? ?at pakjalphiew.MSAInterFrame.(MSAInterFrame.java:62) > ? ?at pakjalphiew.LaunchingFrame.newDNAFromFileActionPerformed(LaunchingFrame.java:265) > ? ?at pakjalphiew.LaunchingFrame.access$000(LaunchingFrame.java:26) > ? ?at pakjalphiew.LaunchingFrame$1.actionPerformed(LaunchingFrame.java:83) > ? ?at javax.swing.AbstractButton.fireActionPerformed(AbstractButton.java:1995) > ? ?at javax.swing.AbstractButton$Handler.actionPerformed(AbstractButton.java:2318) > ? ?at javax.swing.DefaultButtonModel.fireActionPerformed(DefaultButtonModel.java:387) > ? ?at javax.swing.DefaultButtonModel.setPressed(DefaultButtonModel.java:242) > ? ?at javax.swing.AbstractButton.doClick(AbstractButton.java:357) > ? ?at javax.swing.plaf.basic.BasicMenuItemUI.doClick(BasicMenuItemUI.java:809) > ? ?at javax.swing.plaf.basic.BasicMenuItemUI$Handler.mouseReleased(BasicMenuItemUI.java:850) > ? ?at java.awt.Component.processMouseEvent(Component.java:6288) > ? ?at javax.swing.JComponent.processMouseEvent(JComponent.java:3267) > ? ?at java.awt.Component.processEvent(Component.java:6053) > ? ?at java.awt.Container.processEvent(Container.java:2041) > ? ?at java.awt.Component.dispatchEventImpl(Component.java:4651) > ? ?at java.awt.Container.dispatchEventImpl(Container.java:2099) > ? ?at java.awt.Component.dispatchEvent(Component.java:4481) > ? ?at java.awt.LightweightDispatcher.retargetMouseEvent(Container.java:4577) > ? ?at java.awt.LightweightDispatcher.processMouseEvent(Container.java:4238) > ? ?at java.awt.LightweightDispatcher.dispatchEvent(Container.java:4168) > ? ?at java.awt.Container.dispatchEventImpl(Container.java:2085) > ? ?at java.awt.Window.dispatchEventImpl(Window.java:2478) > ? ?at java.awt.Component.dispatchEvent(Component.java:4481) > ? ?at java.awt.EventQueue.dispatchEventImpl(EventQueue.java:643) > ? ?at java.awt.EventQueue.access$000(EventQueue.java:84) > ? ?at java.awt.EventQueue$1.run(EventQueue.java:602) > ? ?at java.awt.EventQueue$1.run(EventQueue.java:600) > ? ?at java.security.AccessController.doPrivileged(Native Method) > ? ?at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) > ? ?at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:98) > ? ?at java.awt.EventQueue$2.run(EventQueue.java:616) > ? ?at java.awt.EventQueue$2.run(EventQueue.java:614) > ? ?at java.security.AccessController.doPrivileged(Native Method) > ? ?at java.security.AccessControlContext$1.doIntersectionPrivilege(AccessControlContext.java:87) > ? ?at java.awt.EventQueue.dispatchEvent(EventQueue.java:613) > ? ?at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269) > ? ?at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184) > ? ?at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174) > ? ?at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169) > ? ?at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161) > ? ?at java.awt.EventDispatchThread.run(EventDispatchThread.java:122) > > > Muhammad Tariq Pervez > > Assistant Professor, > Department of Computer Science > Virtual University of Pakistan, Lahore > Tel: (042) 9203114-7 > URL: www.vu.edu.pk > Mobile: +923364120541, +923214602694 > > >> From: HWillis at scripps.edu >> To: tariq_cp at hotmail.com; biojava-l at lists.open-bio.org >> Date: Fri, 22 Jul 2011 08:11:34 -0400 >> Subject: Re: [Biojava-l] NullPointerException Exception While Creating DNA MultipleSequenceAlignment >> >> Can you include the output of the stack trace as well as a small working >> example that causes the exception? >> >> On 7/22/11 7:56 AM, "Muhammad Tariq Pervez" wrote: >> >> > >> > >> > >> >Dear all, >> > >> >I faced the NullPointerException exception while creating the DNA >> >MultipleSequenceAlignment. The same goes right with protein sequence. >> >Exception is thrown at the following line >> > >> >dnaProfile = Alignments.getMultipleSequenceAlignment(tmpLst); >> > >> >tmpLst is list of DNA sequences created/declared as follows >> >List tmpLst=new ArrayList(); >> > >> >Note: the tmpLst is filled/populated with two or more two sequences. >> > >> >I traced the exception by going into >> >Alignments.getMultipleSequenceAlignmen method of the Alignments class and >> >found the following line of code the cause of exception. >> > >> >static List getListFromFutures(List> futures) { >> > ? ? ? ?List list = new ArrayList(); >> > ? ? ? ?for (Future f : futures) { >> > ? ? ? ? ? ?// TODO when added to ConcurrencyTools, log completions and >> >exceptions instead of printing stack traces >> > ? ? ? ? ? ?try { >> > >> > ? ? ? ? ? ? ? ?list.add(f.get());** >> > ? ? ? ? ? ?} catch (InterruptedException e) { >> > ? ? ? ? ? ? ? ?e.printStackTrace(); >> > ? ? ? ? ? ?} catch (ExecutionException e) { >> > ? ? ? ? ? ? ? ?e.printStackTrace(); >> > ? ? ? ? ? ?} >> > ? ? ? ?} >> > ? ? ? ?return list; >> > ? ?} >> >** is the cause of exception. All is right with the protein sequences. >> >Can any body help/guide me regarding the problem. >> > >> >Best Regards. >> > >> > >> > >> >Tariq, PhD Scholar >> > >> >_______________________________________________ >> >Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org >> >http://lists.open-bio.org/mailman/listinfo/biojava-l >> > > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From chapmanb at 50mail.com Thu Aug 4 11:53:25 2011 From: chapmanb at 50mail.com (Brad Chapman) Date: Thu, 4 Aug 2011 07:53:25 -0400 Subject: [Biojava-l] bioclojure In-Reply-To: References: Message-ID: <20110804115325.GB30407@sobchak> Jay; Awesome that you and Lee are working on this. I've been doing more in Clojure recently and am really enjoying it. There are a few people I'm aware of doing biology related programming in Clojure that you might want to get in touch with: - Jan Aerts -- he has some bioclojure code on GitHub (https://github.com/jandot/bioclojure) and he's been leading some discussions about having a more formal collection of biological Clojure code. Definitely send him and e-mail and coordinate; it would be excellent to have a centralized community for this. - Ray Miller -- Ray has a BioMart Clojure interface on GitHub (https://github.com/ray1729) - Christopher Maier -- He's had a few recent blog posts talking about Clojure in the context of biological work: http://christophermaier.name/ Thanks again for taking this on, Brad > Hi guys : We are working on extending biojava w/ a Clojure API for building > bioinformatics workflows. > > Anyone out there interested in doing some functional bioinformatics ? > > Right now, we are looking for contributors for various modules and planning > at a higher level. > > Lee Hinnman, has been helping me so far, and will be helping to drive the > low-level, highly clojure specific design issues... so you don't have to be > an "Expert" in clojure to contribute. > > -- > Jay Vyas > MMSB/UCHC > _______________________________________________ > Biojava-l mailing list - Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l From daniel.quest at gmail.com Thu Aug 4 12:50:36 2011 From: daniel.quest at gmail.com (Daniel Quest) Date: Thu, 4 Aug 2011 08:50:36 -0400 Subject: [Biojava-l] bioclojure In-Reply-To: <20110804115325.GB30407@sobchak> References: <20110804115325.GB30407@sobchak> Message-ID: Hey guys, before you get too far into this you may want to consider Sun's JSR223. In theory JSR223 would allow you to write some code in Clojure, then write some code in plain old Java, then write some code in python (Jython actually). This would probably open up your technology stack and allow others to play. I successfully write code in Groovy using BioJava and that is kind of fun. One important thing to consider: As far as I know ScriptEngine implementations are is incorrect for Clojure and jRuby. They are not using bindings correctly. You may want to nag the authors about this. Rhino, Groovy, AppleScript, and Gremlin are all languages that are correctly implementing the specification. Jython apparently recently updated its implementations of JSR 223 to also be compliant. Just thought I would pass this information along. -Daniel On Thu, Aug 4, 2011 at 7:53 AM, Brad Chapman wrote: > Jay; > Awesome that you and Lee are working on this. I've been doing more > in Clojure recently and am really enjoying it. > > There are a few people I'm aware of doing biology related > programming in Clojure that you might want to get in touch with: > > - Jan Aerts -- he has some bioclojure code on GitHub > ?(https://github.com/jandot/bioclojure) and he's been leading some > ?discussions about having a more formal collection of biological > ?Clojure code. Definitely send him and e-mail and coordinate; it > ?would be excellent to have a centralized community for this. > > - Ray Miller -- Ray has a BioMart Clojure interface on GitHub > ?(https://github.com/ray1729) > > - Christopher Maier -- He's had a few recent blog posts talking about > ?Clojure in the context of biological work: http://christophermaier.name/ > > Thanks again for taking this on, > Brad > >> ?Hi guys : We are working on extending biojava w/ a Clojure API for building >> bioinformatics workflows. >> >> Anyone out there interested in doing some functional bioinformatics ? >> >> Right now, we are looking for contributors for various modules and planning >> at a higher level. >> >> Lee Hinnman, has been helping me so far, and will be helping to drive the >> low-level, highly clojure specific design issues... so you don't have to be >> an "Expert" in clojure to contribute. >> >> -- >> Jay Vyas >> MMSB/UCHC >> _______________________________________________ >> Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/biojava-l > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From andreas at sdsc.edu Thu Aug 4 16:02:09 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Thu, 4 Aug 2011 09:02:09 -0700 Subject: [Biojava-l] improving biojava documentation Message-ID: Hi, Is anybody interested in joining in an application for the Google Doc Sprint Summit? This would be a perfect opportunity to meet and write a BioJava 3 tutorial. Applications are due tomorrow. more about the Google Doc Sprint Summit: https://sites.google.com/site/docsprintsummit/ Let us know if you would be interested in this. Andreas From dasarnow at gmail.com Thu Aug 11 00:15:17 2011 From: dasarnow at gmail.com (Daniel Asarnow) Date: Wed, 10 Aug 2011 17:15:17 -0700 Subject: [Biojava-l] structure alignment display Message-ID: Hello everyone, I need to display alignments in an application and would like to do via the toPdb() of a "fake" structure containing the alignment. It appears that there are potentially a few ways to do this using the utility / display methods in structure-gui. I was wondering if I need to build from trunk to do this; the commit messages imply that there might have been some problems with some of the methods in StructureAlignmentDisplay and DisplayAFP at the time of the release. If it isn't necessary to build the libraries for that reason, I was planning on copying the code from DisplayAFP.createArtificialStructure(), as that method wasn't present at the time of the release. Thanks in advance and best regards, -da From andreas at sdsc.edu Thu Aug 11 00:55:42 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Wed, 10 Aug 2011 17:55:42 -0700 Subject: [Biojava-l] structure alignment display In-Reply-To: References: Message-ID: Hi Daniel, > I was wondering if I need to build from trunk to do this; No. There are several alternatives available for accessing the code. Are you using Maven? There is a public Maven repository at http://www.biojava.org/download/maven/ from which you could get the latest "snapshot" builds/releases. Alternatively there is also a compiled and bundled version of the structure alignment tools (for command line execution) available at http://source.rcsb.org/download.jsp which is usually not too far behind the latest trunk. the commit > messages imply that there might have been some problems with some of the > methods in StructureAlignmentDisplay and DisplayAFP at the time of the > release. There was an issue at some point causing problems with the display of flexible and circular permutated alignments, but I don't remember if that was also the case in the release. ?If it isn't necessary to build the libraries for that reason, I > was planning on copying the code from > DisplayAFP.createArtificialStructure(), as that method wasn't present at the > time of the release. If you are using Jmol, I recommend using StructureAlignmentDisplay.display(). If you want to export to another viewer, use DisplayAFP.createArtificialStructure() and then structure.toPDB(). You are right, that method is more recent, so try to get one of the builds as described above. Your comments suggest that we should tag another stable BioJava release soon. I guess a good time will be shortly after Google summer of code is over (in 2 weeks)... Andreas From dasarnow at gmail.com Sun Aug 14 19:08:52 2011 From: dasarnow at gmail.com (Daniel Asarnow) Date: Sun, 14 Aug 2011 12:08:52 -0700 Subject: [Biojava-l] exception in DisplayAFP.createArtificialStructure Message-ID: Hello again, I'm getting a null value from DisplayAFP.createArtificialStructure after a successful alignment. It appears that the Groups in hetatms aren't set or are missing their Atom; There is a StructureException ("no atom found at position 0") thrown from the Group.getAtom call at DisplayAFP line 487 (inside the getAtomArray call at line 679). Here is my code: Structure structure1 = cache.getStructure("2hhb.A"); // Hb A chain Structure structure2 = cache.getStructure("2v1k.A"); // Mb Atom[] ca1 = StructureTools.getAtomCAArray(structure1); Atom[] ca2 = StructureTools.getAtomCAArray(structure2); StructureAlignment alignment = StructureAlignmentFactory.getAlgorithm(algorithmName); AFPChain afpChain = alignment.align(ca1, ca2, params); // successful w/ correct alignment score artificial = DisplayAFP.createArtificalStructure(afpChain, ca1, ca2); // returns null This is with the 3.0.2 snapshot JARs. I'm a missing something or is this a bug? Thanks! -da From andreas at sdsc.edu Mon Aug 15 05:09:04 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Sun, 14 Aug 2011 22:09:04 -0700 Subject: [Biojava-l] exception in DisplayAFP.createArtificialStructure In-Reply-To: References: Message-ID: Hi Daniel, having problems to reproduce this... What is the algorithmName you are using and any non standard parameters? Also, any parameters you are setting on AtomCache? Andreas On Sun, Aug 14, 2011 at 12:08 PM, Daniel Asarnow wrote: > Hello again, > I'm getting a null value from DisplayAFP.createArtificialStructure after a > successful alignment. ?It appears that the Groups in hetatms aren't set or > are missing their Atom; There is a StructureException ("no atom found at > position 0") thrown from the Group.getAtom call at DisplayAFP line 487 > (inside the getAtomArray call at line 679). > > Here is my code: > > Structure structure1 = cache.getStructure("2hhb.A"); // Hb A chain > Structure structure2 = cache.getStructure("2v1k.A"); // Mb > Atom[] ca1 = StructureTools.getAtomCAArray(structure1); > Atom[] ca2 = StructureTools.getAtomCAArray(structure2); > StructureAlignment alignment = > StructureAlignmentFactory.getAlgorithm(algorithmName); > AFPChain afpChain = alignment.align(ca1, ca2, params); // successful w/ > correct alignment score > artificial = DisplayAFP.createArtificalStructure(afpChain, ca1, ca2); // > returns null > > This is with the 3.0.2 snapshot JARs. > I'm a missing something or is this a bug? > > Thanks! > > -da > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From dasarnow at gmail.com Mon Aug 15 08:02:41 2011 From: dasarnow at gmail.com (Daniel Asarnow) Date: Mon, 15 Aug 2011 01:02:41 -0700 Subject: [Biojava-l] exception in DisplayAFP.createArtificialStructure In-Reply-To: References: Message-ID: I create the AtomCache as follows: AtomCache cache = new AtomCache(pdbPath, divided); FileParsingParameters params = new FileParsingParameters(); params.setAlignSeqRes(false); params.setParseSecStruc(false); params.setLoadChemCompInfo(false); params.setParseCAOnly(true); cache.setFileParsingParams(params); My algorithmName is simply from CeMain.algorithmName or FatCatFlexible.algorithmName, and I use the default CeParameters or FatCatParameters. I get the StructureException I described, and then a NullPointerException when trying to access the artificial structure (I also test specifically that the artificial structure is null). My apologies for not adding that (about the NPE) previously, I made a bare bones version of my method to remove my application-specific code and looking at the output made me realize I hadn't mentioned it. -da On Sun, Aug 14, 2011 at 22:09, Andreas Prlic wrote: > Hi Daniel, > > having problems to reproduce this... What is the algorithmName you are > using and any non standard parameters? Also, any parameters you are > setting on AtomCache? > > Andreas > > > On Sun, Aug 14, 2011 at 12:08 PM, Daniel Asarnow > wrote: > > Hello again, > > I'm getting a null value from DisplayAFP.createArtificialStructure after > a > > successful alignment. It appears that the Groups in hetatms aren't set > or > > are missing their Atom; There is a StructureException ("no atom found at > > position 0") thrown from the Group.getAtom call at DisplayAFP line 487 > > (inside the getAtomArray call at line 679). > > > > Here is my code: > > > > Structure structure1 = cache.getStructure("2hhb.A"); // Hb A chain > > Structure structure2 = cache.getStructure("2v1k.A"); // Mb > > Atom[] ca1 = StructureTools.getAtomCAArray(structure1); > > Atom[] ca2 = StructureTools.getAtomCAArray(structure2); > > StructureAlignment alignment = > > StructureAlignmentFactory.getAlgorithm(algorithmName); > > AFPChain afpChain = alignment.align(ca1, ca2, params); // successful w/ > > correct alignment score > > artificial = DisplayAFP.createArtificalStructure(afpChain, ca1, ca2); // > > returns null > > > > This is with the 3.0.2 snapshot JARs. > > I'm a missing something or is this a bug? > > > > Thanks! > > > > -da > > _______________________________________________ > > Biojava-l mailing list - Biojava-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/biojava-l > > > From andreas at sdsc.edu Mon Aug 15 14:15:11 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Mon, 15 Aug 2011 07:15:11 -0700 Subject: [Biojava-l] exception in DisplayAFP.createArtificialStructure In-Reply-To: References: Message-ID: Ok, got it. This happened, since you are using a Calpha-only representation of the molecule. If you update the DisplayAFPChain class, this should be fixed now. Since you are not using all atoms for the alignment, ligands won't get superimposed This is something that some users find useful... Andreas On Mon, Aug 15, 2011 at 1:02 AM, Daniel Asarnow wrote: > I create the AtomCache as follows: > AtomCache cache = new AtomCache(pdbPath, divided); > FileParsingParameters params = new FileParsingParameters(); > params.setAlignSeqRes(false); > params.setParseSecStruc(false); > params.setLoadChemCompInfo(false); > params.setParseCAOnly(true); > cache.setFileParsingParams(params); > My algorithmName is simply from CeMain.algorithmName or > FatCatFlexible.algorithmName, and I use the default CeParameters or > FatCatParameters. > I get the StructureException I described, and then a NullPointerException > when trying to access the artificial structure (I also test specifically > that the artificial structure is null). > My apologies for not adding that (about the NPE) previously, I made a bare > bones version of my method to remove my application-specific code and > looking at the output made me realize I hadn't mentioned it. > -da > On Sun, Aug 14, 2011 at 22:09, Andreas Prlic wrote: >> >> Hi Daniel, >> >> having problems to reproduce this... What is the algorithmName you are >> using and any non standard parameters? Also, any parameters you are >> setting on AtomCache? >> >> Andreas >> >> >> On Sun, Aug 14, 2011 at 12:08 PM, Daniel Asarnow >> wrote: >> > Hello again, >> > I'm getting a null value from DisplayAFP.createArtificialStructure after >> > a >> > successful alignment. ?It appears that the Groups in hetatms aren't set >> > or >> > are missing their Atom; There is a StructureException ("no atom found at >> > position 0") thrown from the Group.getAtom call at DisplayAFP line 487 >> > (inside the getAtomArray call at line 679). >> > >> > Here is my code: >> > >> > Structure structure1 = cache.getStructure("2hhb.A"); // Hb A chain >> > Structure structure2 = cache.getStructure("2v1k.A"); // Mb >> > Atom[] ca1 = StructureTools.getAtomCAArray(structure1); >> > Atom[] ca2 = StructureTools.getAtomCAArray(structure2); >> > StructureAlignment alignment = >> > StructureAlignmentFactory.getAlgorithm(algorithmName); >> > AFPChain afpChain = alignment.align(ca1, ca2, params); // successful w/ >> > correct alignment score >> > artificial = DisplayAFP.createArtificalStructure(afpChain, ca1, ca2); // >> > returns null >> > >> > This is with the 3.0.2 snapshot JARs. >> > I'm a missing something or is this a bug? >> > >> > Thanks! >> > >> > -da >> > _______________________________________________ >> > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org >> > http://lists.open-bio.org/mailman/listinfo/biojava-l >> > > > From dasarnow at gmail.com Wed Aug 24 07:06:11 2011 From: dasarnow at gmail.com (Daniel Asarnow) Date: Wed, 24 Aug 2011 00:06:11 -0700 Subject: [Biojava-l] exception in DisplayAFP.createArtificialStructure In-Reply-To: References: Message-ID: Sorry for the delay in replying, but I can confirm your fix is working. Thanks again for all your help. -da On Mon, Aug 15, 2011 at 07:15, Andreas Prlic wrote: > Ok, got it. This happened, since you are using a Calpha-only > representation of the molecule. If you update the DisplayAFPChain > class, this should be fixed now. Since you are not using all atoms for > the alignment, ligands won't get superimposed This is something that > some users find useful... > > Andreas > > > On Mon, Aug 15, 2011 at 1:02 AM, Daniel Asarnow > wrote: > > I create the AtomCache as follows: > > AtomCache cache = new AtomCache(pdbPath, divided); > > FileParsingParameters params = new FileParsingParameters(); > > params.setAlignSeqRes(false); > > params.setParseSecStruc(false); > > params.setLoadChemCompInfo(false); > > params.setParseCAOnly(true); > > cache.setFileParsingParams(params); > > My algorithmName is simply from CeMain.algorithmName or > > FatCatFlexible.algorithmName, and I use the default CeParameters or > > FatCatParameters. > > I get the StructureException I described, and then a NullPointerException > > when trying to access the artificial structure (I also test specifically > > that the artificial structure is null). > > My apologies for not adding that (about the NPE) previously, I made a > bare > > bones version of my method to remove my application-specific code and > > looking at the output made me realize I hadn't mentioned it. > > -da > > On Sun, Aug 14, 2011 at 22:09, Andreas Prlic wrote: > >> > >> Hi Daniel, > >> > >> having problems to reproduce this... What is the algorithmName you are > >> using and any non standard parameters? Also, any parameters you are > >> setting on AtomCache? > >> > >> Andreas > >> > >> > >> On Sun, Aug 14, 2011 at 12:08 PM, Daniel Asarnow > >> wrote: > >> > Hello again, > >> > I'm getting a null value from DisplayAFP.createArtificialStructure > after > >> > a > >> > successful alignment. It appears that the Groups in hetatms aren't > set > >> > or > >> > are missing their Atom; There is a StructureException ("no atom found > at > >> > position 0") thrown from the Group.getAtom call at DisplayAFP line 487 > >> > (inside the getAtomArray call at line 679). > >> > > >> > Here is my code: > >> > > >> > Structure structure1 = cache.getStructure("2hhb.A"); // Hb A chain > >> > Structure structure2 = cache.getStructure("2v1k.A"); // Mb > >> > Atom[] ca1 = StructureTools.getAtomCAArray(structure1); > >> > Atom[] ca2 = StructureTools.getAtomCAArray(structure2); > >> > StructureAlignment alignment = > >> > StructureAlignmentFactory.getAlgorithm(algorithmName); > >> > AFPChain afpChain = alignment.align(ca1, ca2, params); // successful > w/ > >> > correct alignment score > >> > artificial = DisplayAFP.createArtificalStructure(afpChain, ca1, ca2); > // > >> > returns null > >> > > >> > This is with the 3.0.2 snapshot JARs. > >> > I'm a missing something or is this a bug? > >> > > >> > Thanks! > >> > > >> > -da > >> > _______________________________________________ > >> > Biojava-l mailing list - Biojava-l at lists.open-bio.org > >> > http://lists.open-bio.org/mailman/listinfo/biojava-l > >> > > > > > > From kohchuanhock at gmail.com Thu Aug 25 02:12:43 2011 From: kohchuanhock at gmail.com (Chuan Hock Koh) Date: Thu, 25 Aug 2011 10:12:43 +0800 Subject: [Biojava-l] Work completed for GSoC:AAPropertiesComputation In-Reply-To: References: Message-ID: Hi All, The Google Summer of Code has come to an end. Please allow me to share with you what was achieved during this summer by me, Andreas Prlic and Peter Troshin. 1) A set of APIs to compute Physico-Chemical properties of protein sequences. Please see CookBook ( http://biojava.org/wiki/BioJava:CookBook:AAPROP:main) on how to use them. Following is a list of properties that could be generated: - Molecular weight - Extinction coefficient - Instability index - Aliphatic index - Grand Average of Hydropathy - Isoelectric point - Amino acid composition 2) A executable jar to do the same thing as point 1. Please see CookBook ( http://biojava.org/wiki/BioJava:CookBook:AAPROP:commandprompt) for examples on usage. 3) A set of APIs to compute PROFEAT properties of protein sequences. Please see this paper ( http://nar.oxfordjournals.org/content/34/suppl_2/W32.abstract) for more details about PROFEAT properties. Also, do see CookBook ( http://biojava.org/wiki/BioJava:CookBook:AAPROP:profeat) on how to use them. 4) Another thing worth noting is that as requested by the BioJava community, we have enabled the customization for the computing of molecular weight for point 1 and 2. Please see CookBook ( http://biojava.org/wiki/BioJava:CookBook:AAPROP:xmlfiles) for more information. 5) Also, a SOAP web service for physico-chemical properties computation (point 1) was developed within the JABAWS framework for portable web services (http://www.compbio.dundee.ac.uk/jabaws/). This web service can be installed on your own computing infrastructure with ease. If you intend to use this web service, please contact us for further details. I would continue to improve and work on this package even after this summer. Therefore, if you have any feedback or comments. Please feel free to drop me a mail. Thanks! Regards, Chuan Hock Koh (aka Ah Fu), Andreas Prlic and Peter Troshin -- http://compbio.ddns.comp.nus.edu.sg/~ChuanHockKoh From andreas at sdsc.edu Thu Aug 25 17:06:50 2011 From: andreas at sdsc.edu (Andreas Prlic) Date: Thu, 25 Aug 2011 10:06:50 -0700 Subject: [Biojava-l] Work completed for GSoC:AAPropertiesComputation In-Reply-To: References: Message-ID: Hi Ah Fu and Peter, Thank you both for your dedicated work over the summer. It is great to see the new modules coming out of this and this further extends the list of useful things you can use BioJava for. Let's try to make access to these new features as easy as possible by making a new release within the next two weeks. I suggest to have a code freeze by Thursday September 1st (today in a week), then I will make the release during the days after. Until then lets make sure that the documentation is up to date and any outstanding commits are being made. Andreas On Wed, Aug 24, 2011 at 7:12 PM, Chuan Hock Koh wrote: > Hi All, > > The Google Summer of Code has come to an end. Please allow me to share with > you what was achieved during this summer by me, Andreas Prlic and Peter > Troshin. > > 1) A set of APIs to compute Physico-Chemical properties of protein > sequences. Please see CookBook ( > http://biojava.org/wiki/BioJava:CookBook:AAPROP:main) on how to use them. > Following is a list of properties that could be generated: > > ? - Molecular weight > ? - Extinction coefficient > ? - Instability index > ? - Aliphatic index > ? - Grand Average of Hydropathy > ? - Isoelectric point > ? - Amino acid composition > > > 2) A executable jar to do the same thing as point 1. Please see CookBook ( > http://biojava.org/wiki/BioJava:CookBook:AAPROP:commandprompt) for examples > on usage. > > 3) A set of APIs to compute PROFEAT properties of protein sequences. Please > see this paper ( > http://nar.oxfordjournals.org/content/34/suppl_2/W32.abstract) for more > details about PROFEAT properties. Also, do see CookBook ( > http://biojava.org/wiki/BioJava:CookBook:AAPROP:profeat) on how to use them. > > 4) Another thing worth noting is that as requested by the BioJava community, > we have enabled the customization for the computing of molecular weight for > point 1 and 2. Please see CookBook ( > http://biojava.org/wiki/BioJava:CookBook:AAPROP:xmlfiles) for more > information. > > 5) Also, a SOAP web service for physico-chemical properties computation > (point 1) was developed within the JABAWS framework for portable web > services (http://www.compbio.dundee.ac.uk/jabaws/). This web service can be > installed on your own computing infrastructure with ease. If you intend to > use this web service, please contact us for further details. > > I would continue to improve and work on this package even after this summer. > Therefore, if you have any feedback or comments. Please feel free to drop me > a mail. Thanks! > > Regards, > Chuan Hock Koh (aka Ah Fu), Andreas Prlic and Peter Troshin > > -- > http://compbio.ddns.comp.nus.edu.sg/~ChuanHockKoh > _______________________________________________ > Biojava-l mailing list ?- ?Biojava-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/biojava-l > From p.v.troshin at dundee.ac.uk Thu Aug 25 22:26:20 2011 From: p.v.troshin at dundee.ac.uk (Peter Troshin) Date: Thu, 25 Aug 2011 23:26:20 +0100 Subject: [Biojava-l] Work completed for GSoC:AAPropertiesComputation In-Reply-To: References: Message-ID: <4E56CC0C.8080209@dundee.ac.uk> Hi guys, New release sounds great! It nicely wraps up the work completed during this year's Google Summer of Code. Thank you for making it! Perhaps, I should say a few words about another, recently added piece of the functionality for prediction of disordered regions from a protein sequence. This work is wrapped up as a /biojava3-protein-disorder/ module. For now, this module contains one method for the prediction of disordered regions. This method is based on the Java implementation of RONN predictor. This code has been originally developed for another project and made its way into the BioJava. As the main code behind this is a Java implementation of RONN, unimaginatively we call it /JRONN/. JRONN is based on RONN version 3.1 which is still current in time of writing (August 2011) and so gives the same predictions as RONN. Main motivation behind JRONN development was providing an implementation of RONN more suitable to use by the automated analysis pipelines and web services. Robert Esnouf has kindly allowed us to explore the RONN code and share the results with the community. Original version of RONN is described in Yang,Z.R., Thomson,R., McMeil,P. and Esnouf,R.M. (2005) RONN: the bio-basis function neural network technique applied to the detection of natively disordered regions in proteins. Bioinformatics 21: 3369-3376 Please refer to the cookbook entry http://biojava.org/wiki/BioJava:CookBook#biojava3-protein-disorder for more information about disorder prediction module. Happy coding, Peter P.S. I think the documentation for biojava3-protein-disorder module is ok, unless someone can suggest any improvements. P.P.S. Andreas, it would be great if you could remove the content of this directory http://www.biojava.org/download/maven/org/biojava/biojava3-protein-disorder to get rid of outdated artefacts. On 25/08/2011 18:06, Andreas Prlic wrote: > Hi Ah Fu and Peter, > > Thank you both for your dedicated work over the summer. It is great to > see the new modules coming out of this and this further extends the > list of useful things you can use BioJava for. Let's try to make > access to these new features as easy as possible by making a new > release within the next two weeks. > > I suggest to have a code freeze by Thursday September 1st (today in a > week), then I will make the release during the days after. Until then > lets make sure that the documentation is up to date and any > outstanding commits are being made. > > Andreas > > > > > On Wed, Aug 24, 2011 at 7:12 PM, Chuan Hock Koh wrote: >> Hi All, >> >> The Google Summer of Code has come to an end. Please allow me to share with >> you what was achieved during this summer by me, Andreas Prlic and Peter >> Troshin. >> >> 1) A set of APIs to compute Physico-Chemical properties of protein >> sequences. Please see CookBook ( >> http://biojava.org/wiki/BioJava:CookBook:AAPROP:main) on how to use them. >> Following is a list of properties that could be generated: >> >> - Molecular weight >> - Extinction coefficient >> - Instability index >> - Aliphatic index >> - Grand Average of Hydropathy >> - Isoelectric point >> - Amino acid composition >> >> >> 2) A executable jar to do the same thing as point 1. Please see CookBook ( >> http://biojava.org/wiki/BioJava:CookBook:AAPROP:commandprompt) for examples >> on usage. >> >> 3) A set of APIs to compute PROFEAT properties of protein sequences. Please >> see this paper ( >> http://nar.oxfordjournals.org/content/34/suppl_2/W32.abstract) for more >> details about PROFEAT properties. Also, do see CookBook ( >> http://biojava.org/wiki/BioJava:CookBook:AAPROP:profeat) on how to use them. >> >> 4) Another thing worth noting is that as requested by the BioJava community, >> we have enabled the customization for the computing of molecular weight for >> point 1 and 2. Please see CookBook ( >> http://biojava.org/wiki/BioJava:CookBook:AAPROP:xmlfiles) for more >> information. >> >> 5) Also, a SOAP web service for physico-chemical properties computation >> (point 1) was developed within the JABAWS framework for portable web >> services (http://www.compbio.dundee.ac.uk/jabaws/). This web service can be >> installed on your own computing infrastructure with ease. If you intend to >> use this web service, please contact us for further details. >> >> I would continue to improve and work on this package even after this summer. >> Therefore, if you have any feedback or comments. Please feel free to drop me >> a mail. Thanks! >> >> Regards, >> Chuan Hock Koh (aka Ah Fu), Andreas Prlic and Peter Troshin >> >> -- >> http://compbio.ddns.comp.nus.edu.sg/~ChuanHockKoh >> _______________________________________________ >> Biojava-l mailing list -Biojava-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/biojava-l >>