From raphael.andre.bauer at gmail.com  Tue Feb  3 04:28:52 2009
From: raphael.andre.bauer at gmail.com (=?UTF-8?Q?Raphael_Andr=C3=A9_Bauer?=)
Date: Tue, 3 Feb 2009 10:28:52 +0100
Subject: [Biojava-l] Different chain lengths using struc.getChainByPDB and
	iterating over a structure and it's chain
Message-ID: <9b46aa30902030128nfea24f5x94e7882a8d80e542@mail.gmail.com>

Hey everybody,


suppose the following PDB file:
	
....
ATOM   2847  OD1 ASP A 370      14.470   9.116  16.553  1.00 57.47           O
ATOM   2848  OD2 ASP A 370      12.601   9.313  15.410  1.00 57.77           O
ATOM   2849  N   ASN A 371      17.114   9.968  15.979  1.00 46.04           N
ATOM   2850  CA  ASN A 371      18.177   9.691  16.946  1.00 46.67           C
ATOM   2851  C   ASN A 371      19.555  10.072  16.403  1.00 46.52           C
ATOM   2852  O   ASN A 371      19.848  11.250  16.177  1.00 43.37           O
ATOM   2853  CB  ASN A 371      18.174   8.209  17.345  1.00 49.12           C
ATOM   2854  CG  ASN A 371      16.969   7.829  18.189  1.00 52.62           C
ATOM   2855  OD1 ASN A 371      16.762   6.652  18.502  1.00 55.93           O
ATOM   2856  ND2 ASN A 371      16.168   8.824  18.568  1.00 52.06           N
TER    2857      ASN A 371
HETATM 2858 ZN    ZN A 400      43.465  12.734  15.463  1.00 24.94          ZN
HETATM 2859 ZN    ZN A 401      46.414  14.165  16.934  1.00 30.14          ZN
HETATM 2860  N9  ADE A1114      50.418   9.820  20.124  1.00 80.38           N
HETATM 2861  C8  ADE A1114      50.489  11.169  20.334  1.00 80.76           C
HETATM 2862  N7  ADE A1114      49.492  11.773  19.748  1.00 80.58           N
HETATM 2863  C5  ADE A1114      48.715  10.855  19.124  1.00 79.77           C
....


1) If I use

//struc being the parsed pdb file
returnChain = struc.getChainByPDB("A", 1);

I get chain A EXCEPT everything after the TER (ZN and ADE is excluded
in this example).

2) If I iterate over the complete file using something like

//struc being the parsed pdb file
int nrModels = struc.nrModels();
			
for (int modelNr = 0; modelNr < nrModels; modelNr++) {
List<Chain> chains = struc.getModel(modelNr);
int nrChains = chains.size();
for (int chainNr = 0; chainNr < nrChains; chainNr++) {

//this chain contains also the ZN and the ADE



So maybe I am getting something wrong here. Is this effect wanted by
the PDB parser?


Thanks!


Raphael

From andreas.prlic at gmail.com  Tue Feb  3 10:30:48 2009
From: andreas.prlic at gmail.com (Andreas Prlic)
Date: Tue, 3 Feb 2009 07:30:48 -0800
Subject: [Biojava-l] Different chain lengths using struc.getChainByPDB
	and iterating over a structure and it's chain
In-Reply-To: <9b46aa30902030128nfea24f5x94e7882a8d80e542@mail.gmail.com>
References: <9b46aa30902030128nfea24f5x94e7882a8d80e542@mail.gmail.com>
Message-ID: <1CAC30DC-06D7-4B0D-8799-0692C9591B11@gmail.com>

Hi Rafael,


>
> suppose the following PDB file:
>     ...

>
> 1) If I use
>
> //struc being the parsed pdb file
> returnChain = struc.getChainByPDB("A", 1);
>
> I get chain A EXCEPT everything after the TER (ZN and ADE is excluded
> in this example).

This seems wrong. You should get the full chain here. TERs are getting  
ignored. Let me check what might cause this. You are on the latest  
version from svn?

> 2) If I iterate over the complete file using something like
>
> //struc being the parsed pdb file
> int nrModels = struc.nrModels();
>
> for (int modelNr = 0; modelNr < nrModels; modelNr++) {
> List<Chain> chains = struc.getModel(modelNr);
> int nrChains = chains.size();
> for (int chainNr = 0; chainNr < nrChains; chainNr++) {
>
> //this chain contains also the ZN and the ADE

That's what I would expect...

Andreas






>
>
>
>
> So maybe I am getting something wrong here. Is this effect wanted by
> the PDB parser?
>
>
> Thanks!
>
>
> Raphael
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l

From raphael.andre.bauer at gmail.com  Tue Feb  3 14:01:09 2009
From: raphael.andre.bauer at gmail.com (=?UTF-8?Q?Raphael_Andr=C3=A9_Bauer?=)
Date: Tue, 3 Feb 2009 20:01:09 +0100
Subject: [Biojava-l] Different chain lengths using struc.getChainByPDB
	and iterating over a structure and it's chain
In-Reply-To: <1CAC30DC-06D7-4B0D-8799-0692C9591B11@gmail.com>
References: <9b46aa30902030128nfea24f5x94e7882a8d80e542@mail.gmail.com>
	<1CAC30DC-06D7-4B0D-8799-0692C9591B11@gmail.com>
Message-ID: <9b46aa30902031101r77aa6236qc6e92c4140f39ca8@mail.gmail.com>

On Tue, Feb 3, 2009 at 4:30 PM, Andreas Prlic <andreas.prlic at gmail.com> wrote:
...
>> 1) If I use
>>
>> //struc being the parsed pdb file
>> returnChain = struc.getChainByPDB("A", 1);
>>
>> I get chain A EXCEPT everything after the TER (ZN and ADE is excluded
>> in this example).
>
> This seems wrong. You should get the full chain here. TERs are getting
> ignored. Let me check what might cause this. You are on the latest version
> from svn?
Thanks for the quick response. And sorry for having bothered you -
after writing a quick unit test it became pretty clear that it is my
own fault. I thought I double checked that yesterday (and I should
write the unit test before writing to the list - I know). The
"supposed-to-be-bug-but-was-my-own-failure" came from
setParseCAOnly().

Sorry and thanks again!

Raphael

From aumanga at biggjapan.com  Thu Feb  5 00:57:37 2009
From: aumanga at biggjapan.com (Ashika Umanga Umagiliya)
Date: Thu, 05 Feb 2009 14:57:37 +0900
Subject: [Biojava-l] [Off the Topic] Homology prediction of large number of
	sequences!
Message-ID: <498A7FD1.2060203@biggjapan.com>

Greetings all,

I have about 60,000  sequences and want to predict the 3D structure 
(Homology modelling) for all the structures.I decided to use Modeller 
first , and seems that would take months to predict all those structures.
Is there any HighPerformance prediction server which I have use for 
this? Not submitting data through webbased interface , I want to 
automate the process , cuz 60K is alot of data!

Thanks in advance,
umanga

From markjschreiber at gmail.com  Thu Feb  5 08:51:39 2009
From: markjschreiber at gmail.com (Mark Schreiber)
Date: Thu, 5 Feb 2009 21:51:39 +0800
Subject: [Biojava-l] [Off the Topic] Homology prediction of large number
	of sequences!
In-Reply-To: <498A7FD1.2060203@biggjapan.com>
References: <498A7FD1.2060203@biggjapan.com>
Message-ID: <93b45ca50902050551s11574e7br9526f08ddae156f4@mail.gmail.com>

I don't know about high performance but the problem is very parallel
so if you can get your hands on a cluster you can run one sequence on
each processor.

Maybe there is a cloud compute facility you could use if a cluster is
not available.

You might also want to try a pilot experiment first. There is bound to
be some redundancy in some of those proteins which will give nearly
identical models.

- Mark

On Thu, Feb 5, 2009 at 1:57 PM, Ashika Umanga Umagiliya
<aumanga at biggjapan.com> wrote:
>
> Greetings all,
>
> I have about 60,000  sequences and want to predict the 3D structure (Homology modelling) for all the structures.I decided to use Modeller first , and seems that would take months to predict all those structures.
> Is there any HighPerformance prediction server which I have use for this? Not submitting data through webbased interface , I want to automate the process , cuz 60K is alot of data!
>
> Thanks in advance,
> umanga
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l

From willishf at ufl.edu  Fri Feb  6 14:39:17 2009
From: willishf at ufl.edu (Scooter Willis)
Date: Fri, 6 Feb 2009 14:39:17 -0500
Subject: [Biojava-l] Phylogenetic Trees
Message-ID: <7ceb4beb0902061139l6d49add6qb592cd389b0e176b@mail.gmail.com>

I was looking for Java code to construct a phylogenetic tree from
aligned sequence data. I came across org.biojavax.bio.phylo as an
experimental package in the latest release of BioJava. The docs were
thin and couldn't find any code examples so was wondering if anyone
has used the package with success.

I also couldn't decide if the package is intended to load
pre-constructed trees as Java objects or could be used to construct a
tree from aligned sequence data.

Does anyone know of an accepted Java package for tree construction
besides what is in JalView?

Thanks

Scooter

From simon.rayner.cn at gmail.com  Sun Feb  8 04:45:46 2009
From: simon.rayner.cn at gmail.com (simon rayner)
Date: Sun, 8 Feb 2009 04:45:46 -0500
Subject: [Biojava-l] alignments
Message-ID: <616a29410902080145m2ea0fe0fye091ac646071ac13@mail.gmail.com>

Hi,

i have a question about Alignment and FlexibleAlignment objects.
Basically, i have a sequence alignment in FASTA format so followed a code
sample i found from a previous posted query:

   BufferedReader br = new BufferedReader(new FileReader("file.txt"));
   FastaAlignmentFormat faf = new FastaAlignmentFormat();
   Alignment aligned = faf.read( br );

so now i have an alignment stored in an Alignment object.

1. I do something with these sequences using the access methods for
the Alignment object.
something like

         java.util.Iterator iter = l.listIterator();
         while(iter.hasNext())
         {
           String currLabel = (String) iter.next();
           String currAA
                   = aligned.symbolListForLabel(currLabel)
                   .seqString().substring(base, base+1);
         }

2. Now i want to do the same analysis but on a random sample of
sequences from this alignment.
So to get a subset of these sequences i created a FlexibleAlignment
and grabbed the sequences
i need from the original alignment...

      Alignment al;
      Iterator l = al.symbolListIterator();
      java.util.List<String> names = al.getLabels();
      Iterator n = names.listIterator();
      java.util.ArrayList seqList = new java.util.ArrayList(1);
      String refs = "";
      while(refs.length() < al.length())
      {
        refs = refs.concat("x");
      }

      try{
        FlexibleAlignment FA = new FlexibleAlignment(seqList);
        SymbolList aa = ProteinTools.createProtein(refs);

        seqList.add(
                new SimpleAlignmentElement(
                 "reference",
                 aa,
                 new RangeLocation(1, al.length()))
                );
        while (l.hasNext())
        {
          try{
            SymbolList sal = (SymbolList)l.next();
            String name = (String)n.next();

            FA.addSequence(new SimpleAlignmentElement(name,
                     sal,
                     new RangeLocation(1, al.length())));

          }
          catch (org.biojava.bio.BioException ex)
          {
            System.out.print("couldn't add sequence to alignment\n");
            System.err.print(ex);
          }
        }
        this.aligned = FA;
      }
      catch (org.biojava.bio.BioException ex)
      {
        System.out.print("couldn't add sequence to alignment\n");
        System.err.print(ex);
      }

So now i have my alignment of random sequences in a FlexibleAlignment
object, but my original analysis
was written for an Alignment object (because that's the format that
FastaAlignmentFormat spat back at me.

So, can i cast a FlexibleAlignment object into an Alignment object? or
am i just going about it the wrong way?

p.s. Why are there so many diverse Alignment related objects?
(AbstractULAlignment,
AbstractULAlignment.SubULAlignment, FlexibleAlignment, RelabeledAlignment,
EmptyPairwiseAlignment, SimpleAlignment, HappyAlignment,
SadAlignment..)  Is there any documentation (other than
the standard java docs) to clarify which object when?

thanks!

From holland at eaglegenomics.com  Mon Feb  9 09:43:03 2009
From: holland at eaglegenomics.com (Richard Holland)
Date: Mon, 09 Feb 2009 14:43:03 +0000
Subject: [Biojava-l] Phylogenetic Trees
In-Reply-To: <7ceb4beb0902061139l6d49add6qb592cd389b0e176b@mail.gmail.com>
References: <7ceb4beb0902061139l6d49add6qb592cd389b0e176b@mail.gmail.com>
Message-ID: <499040F7.3050009@eaglegenomics.com>

The package you found in biojavax was written with the intention of
parsing existing tree structures from NEXUS files, and to perform basic
analyses of them (neighbour joining, etc.). The code can represent trees
regardless of their source, and can output them as NEXUS files, but
there are no algorithm implementations in that package for constructing
new trees and so you'd probably have to write those from scratch.

cheers,
Richard

Scooter Willis wrote:
> I was looking for Java code to construct a phylogenetic tree from
> aligned sequence data. I came across org.biojavax.bio.phylo as an
> experimental package in the latest release of BioJava. The docs were
> thin and couldn't find any code examples so was wondering if anyone
> has used the package with success.
> 
> I also couldn't decide if the package is intended to load
> pre-constructed trees as Java objects or could be used to construct a
> tree from aligned sequence data.
> 
> Does anyone know of an accepted Java package for tree construction
> besides what is in JalView?
> 
> Thanks
> 
> Scooter
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l
> 

-- 
Richard Holland, BSc MBCS
Finance Director, Eagle Genomics Ltd
M: +44 7500 438846 | E: holland at eaglegenomics.com
http://www.eaglegenomics.com/

From holland at eaglegenomics.com  Mon Feb  9 09:47:45 2009
From: holland at eaglegenomics.com (Richard Holland)
Date: Mon, 09 Feb 2009 14:47:45 +0000
Subject: [Biojava-l] alignments
In-Reply-To: <616a29410902080145m2ea0fe0fye091ac646071ac13@mail.gmail.com>
References: <616a29410902080145m2ea0fe0fye091ac646071ac13@mail.gmail.com>
Message-ID: <49904211.7010404@eaglegenomics.com>

Yes, you can cast it back. In fact you don't need to actually cast it at
all, as Java will do that for you automatically. FlexibleAlignment is an
implementation of the Alignment interface, which defines general
behaviour for all alignments. If your algorithm is written to accept a
parameter of type Alignment, then it will accept any object which
implements the Alignment interface, including FlexibleAlignment, Happy
and SadAlignment, etc. etc.

Unfortunately I'm not sure why there are so many different kinds of
alignment objects. I think it was something to do with wanting to make
some that are modifiable, and others that are read-only, then making
different kinds that store the underlying alignment data in
different/more efficient/faster/cleverer representations. It does rather
over-complicate things, however if your algorithm only requires
Alignment as the type of its parameter, then you can safely use all and
any of these as they all implement the Alignment interface.

cheers,
Richard

simon rayner wrote:
> Hi,
> 
> i have a question about Alignment and FlexibleAlignment objects.
> Basically, i have a sequence alignment in FASTA format so followed a code
> sample i found from a previous posted query:
> 
>    BufferedReader br = new BufferedReader(new FileReader("file.txt"));
>    FastaAlignmentFormat faf = new FastaAlignmentFormat();
>    Alignment aligned = faf.read( br );
> 
> so now i have an alignment stored in an Alignment object.
> 
> 1. I do something with these sequences using the access methods for
> the Alignment object.
> something like
> 
>          java.util.Iterator iter = l.listIterator();
>          while(iter.hasNext())
>          {
>            String currLabel = (String) iter.next();
>            String currAA
>                    = aligned.symbolListForLabel(currLabel)
>                    .seqString().substring(base, base+1);
>          }
> 
> 2. Now i want to do the same analysis but on a random sample of
> sequences from this alignment.
> So to get a subset of these sequences i created a FlexibleAlignment
> and grabbed the sequences
> i need from the original alignment...
> 
>       Alignment al;
>       Iterator l = al.symbolListIterator();
>       java.util.List<String> names = al.getLabels();
>       Iterator n = names.listIterator();
>       java.util.ArrayList seqList = new java.util.ArrayList(1);
>       String refs = "";
>       while(refs.length() < al.length())
>       {
>         refs = refs.concat("x");
>       }
> 
>       try{
>         FlexibleAlignment FA = new FlexibleAlignment(seqList);
>         SymbolList aa = ProteinTools.createProtein(refs);
> 
>         seqList.add(
>                 new SimpleAlignmentElement(
>                  "reference",
>                  aa,
>                  new RangeLocation(1, al.length()))
>                 );
>         while (l.hasNext())
>         {
>           try{
>             SymbolList sal = (SymbolList)l.next();
>             String name = (String)n.next();
> 
>             FA.addSequence(new SimpleAlignmentElement(name,
>                      sal,
>                      new RangeLocation(1, al.length())));
> 
>           }
>           catch (org.biojava.bio.BioException ex)
>           {
>             System.out.print("couldn't add sequence to alignment\n");
>             System.err.print(ex);
>           }
>         }
>         this.aligned = FA;
>       }
>       catch (org.biojava.bio.BioException ex)
>       {
>         System.out.print("couldn't add sequence to alignment\n");
>         System.err.print(ex);
>       }
> 
> So now i have my alignment of random sequences in a FlexibleAlignment
> object, but my original analysis
> was written for an Alignment object (because that's the format that
> FastaAlignmentFormat spat back at me.
> 
> So, can i cast a FlexibleAlignment object into an Alignment object? or
> am i just going about it the wrong way?
> 
> p.s. Why are there so many diverse Alignment related objects?
> (AbstractULAlignment,
> AbstractULAlignment.SubULAlignment, FlexibleAlignment, RelabeledAlignment,
> EmptyPairwiseAlignment, SimpleAlignment, HappyAlignment,
> SadAlignment..)  Is there any documentation (other than
> the standard java docs) to clarify which object when?
> 
> thanks!
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l
> 

-- 
Richard Holland, BSc MBCS
Finance Director, Eagle Genomics Ltd
M: +44 7500 438846 | E: holland at eaglegenomics.com
http://www.eaglegenomics.com/

From aumanga at biggjapan.com  Mon Feb  9 20:27:34 2009
From: aumanga at biggjapan.com (Ashika Umanga Umagiliya)
Date: Tue, 10 Feb 2009 10:27:34 +0900
Subject: [Biojava-l] [Off the topic] Selecting template from clustering tree?
Message-ID: <4990D806.2030204@biggjapan.com>

Greetings,

I use 'Modeller' for homology modeling and,  during the process I get a clustering tree shown as following.And I have to select the best
template using this tree.I was wondering whether there are any tools/features in BioJava that I can use for this?
I don't know the conditions to select the best template (I am from Computer science background),but seems I can you fuzzylogic ,if I know the criteria well.
Any tips?

Best Regards,
umanga


-------------------------------------------------------------------------------------------------

Sequence identity comparison (ID_TABLE):

   Diagonal       ... number of residues;
   Upper triangle ... number of identical residues;
   Lower triangle ... % sequence identity, id/min(length).

         1b8pA @11bdmA @11civA @25mdhA @27mdhA @21smkA @2
1b8pA @1      327     194     147     151     153      49
1bdmA @1       61     318     152     167     155      56
1civA @2       45      48     374     139     304      53
5mdhA @2       46      53      42     333     139      57
7mdhA @2       47      49      87      42     351      48
1smkA @2       16      18      17      18      15     313


Weighted pair-group average clustering based on a distance matrix:


                                           .----------------------- 1b8pA @1.9    39.0000
                                           |
                                  .-------------------------------- 1bdmA @1.8    50.5000
                                  |
                              .------------------------------------ 5mdhA @2.4    55.3750
                              |
                              |                                .--- 1civA @2.8    13.0000
                              |                                |
        .---------------------------------------------------------- 7mdhA @2.4    83.2500
        |
      .------------------------------------------------------------ 1smkA @2.5

      +----+----+----+----+----+----+----+----+----+----+----+----+
    86.0600   73.4150   60.7700   48.1250   35.4800   22.8350   10.1900
         79.7375   67.0925   54.4475   41.8025   29.1575   16.5125


From bopfannkuche at gmx.de  Thu Feb 12 07:06:36 2009
From: bopfannkuche at gmx.de (=?ISO-8859-15?Q?Bj=F6rn_Ole_Pfannkuche?=)
Date: Thu, 12 Feb 2009 13:06:36 +0100
Subject: [Biojava-l] DNA/DNA Folding
Message-ID: <499410CC.8090704@gmx.de>

Hi!

Has anyone of you writen a programme or classes which aim on folding DNA?
Like the projects UNAFold or PairFold, but in Java...

Greetz
BO

From willishf at ufl.edu  Thu Feb 12 07:13:57 2009
From: willishf at ufl.edu (Scooter Willis)
Date: Thu, 12 Feb 2009 07:13:57 -0500
Subject: [Biojava-l] Multiple Sequence Viewer
Message-ID: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>

I am getting my feet wet with the various parts and pieces of BioJava and
needed a multiple sequence viewer. Searched around in the code and did some
google searches and looks like one does not exist but someone faked one with
a MultipleLineReader to render each sequence as a label.

As part of the learning exercise I cloned SequencePanel to
MultipleSequencePanel and SequenceRenderContext to
MultipleSequenceRenderContext(to define returning a collection of sequences)
and SymbolSequenceRenderer to SymbolMultipleSequenceRenderer. In
SymbolMultipleSequenceRenderer I handle the rendering of multiple sequences.


I need to add in labels as a non scroll region on the left and then add
support for horizontal and vertical scroll.

Before I finish the last 10% of what I think need to be done and always
takes the longest does a multiple sequence viewer exist in BioJava and I
can't find it?

Thanks

Scooter Willis

From russ at kepler-eng.com  Thu Feb 12 09:31:39 2009
From: russ at kepler-eng.com (Russ Kepler)
Date: Thu, 12 Feb 2009 07:31:39 -0700
Subject: [Biojava-l] Multiple Sequence Viewer
In-Reply-To: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>
References: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>
Message-ID: <200902120731.39355.russ@kepler-eng.com>

On Thursday 12 February 2009 05:13:57 Scooter Willis wrote:

> Before I finish the last 10% of what I think need to be done and always
> takes the longest does a multiple sequence viewer exist in BioJava and I
> can't find it?

In mine I simply have a TranslatedSequencePanel with a MultiLineRenderer, the 
MLR having a renderer for each sequence or sequence element).  This gave me 
the control over the individual sequence display I needed for cursors and 
such.

From willishf at ufl.edu  Thu Feb 12 10:20:55 2009
From: willishf at ufl.edu (Scooter Willis)
Date: Thu, 12 Feb 2009 10:20:55 -0500
Subject: [Biojava-l] Multiple Sequence Viewer
In-Reply-To: <200902120731.39355.russ@kepler-eng.com>
References: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>
	<200902120731.39355.russ@kepler-eng.com>
Message-ID: <7ceb4beb0902120720y7d9dad85sb232575e9f3b4099@mail.gmail.com>

My plan is to model the multiple sequence viewer used in JALView. Sequence
name on the left to fire events when clicked. I also typically work with
large sequences so need both horizontal and vertical scroll which does not
appear to be in the current viewers. I do see support for viewing a range of
a sequence but nothing to scroll or I could be missing something on how the
current viewer would scroll not using a ScrollPane.

This should be something easy to do in BioJava based on the importance of
viewing multiple sequence alignments.

Thanks

Scooter Willis

On Thu, Feb 12, 2009 at 9:31 AM, Russ Kepler <russ at kepler-eng.com> wrote:

> On Thursday 12 February 2009 05:13:57 Scooter Willis wrote:
>
> > Before I finish the last 10% of what I think need to be done and always
> > takes the longest does a multiple sequence viewer exist in BioJava and I
> > can't find it?
>
> In mine I simply have a TranslatedSequencePanel with a MultiLineRenderer,
> the
> MLR having a renderer for each sequence or sequence element).  This gave me
> the control over the individual sequence display I needed for cursors and
> such.
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l
>
>

From russ at kepler-eng.com  Thu Feb 12 10:55:19 2009
From: russ at kepler-eng.com (Russ Kepler)
Date: Thu, 12 Feb 2009 08:55:19 -0700
Subject: [Biojava-l] Multiple Sequence Viewer
In-Reply-To: <7ceb4beb0902120720y7d9dad85sb232575e9f3b4099@mail.gmail.com>
References: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>
	<200902120731.39355.russ@kepler-eng.com>
	<7ceb4beb0902120720y7d9dad85sb232575e9f3b4099@mail.gmail.com>
Message-ID: <200902120855.20480.russ@kepler-eng.com>

On Thursday 12 February 2009 08:20:55 Scooter Willis wrote:
> My plan is to model the multiple sequence viewer used in JALView. Sequence
> name on the left to fire events when clicked. I also typically work with
> large sequences so need both horizontal and vertical scroll which does not
> appear to be in the current viewers. I do see support for viewing a range
> of a sequence but nothing to scroll or I could be missing something on how
> the current viewer would scroll not using a ScrollPane.

I guess I don't see the problem with using a ScrollPane, it works well in the 
app I've written.

> This should be something easy to do in BioJava based on the importance of
> viewing multiple sequence alignments.

It not all *that* hard, in my case it's a ScrollPane with a 
TranslatedSequencePanel with a MultiLineRenderer with a bunch of 
GappedRenderers containing individual sequence or other renderers.  The TSP 
holds the alignment and feeds the individual renderers with the appropriate 
sequence.

Somewhere around here I have something I scratched up in BioJava 1.4 that 
worked as a Clustal alignment viewer, I'll see if I can find it and pop it 
your way.

From hlapp at gmx.net  Fri Feb 13 11:53:53 2009
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 13 Feb 2009 11:53:53 -0500
Subject: [Biojava-l] Google Summer of Code: Call for Bio* Volunteers
Message-ID: <1F570555-12DF-42DF-8D0E-95AAE298D76A@gmx.net>

Google is committed to run the Summer of Code program [1] again this  
year. It will be for the 5th time.

In broad strokes, the program funds what you might call remote summer  
internships for students to contribute to an open-source software  
project. Participating projects (or umbrella organizations) provide  
project ideas and supply mentors that guide the work on those.  
Students apply to a project within the program with specific project  
ideas, based on those suggested or based on their own idea, get ranked  
by the mentors of the project, and those accepted into the program get  
paired up with mentors. Projects are chiefly about programming, the  
coding period is 3 months (Jun-Aug), and there is no travel required  
by either student or mentor. The program is global; other than the US  
trade restrictions that Google is under, there are no restrictions as  
to where student or mentor reside. The main motivations behind the  
program are to recruit new contributors to open-source projects, and  
to produce more open-source code. See the program FAQs [2] for more  
information.

I've had the honor of being part of the program for the last two  
years, administering NESCent's participation as an organization [3]  
and in 2007 mentoring a student. I have to say I find it the most  
awesome open-source program since sliced bread (or the invention of  
BLAST if that means more to you). Despite that and sadly enough, there  
has been a dearth of participating bioinformatics projects (though  
some notable ones, such as CytoScape have participated).

There have been two Bio* Summer of Code projects under the NESCent  
umbrella, one in 2007 [4] and one in 2008 [5]. I would be willing to  
volunteer to take the lead on and administer a full-blown  
participation of O|B|F as a Bio* umbrella organization, provided 1) at  
least one Bio* person volunteers to serve as backup administrator, and  
2) enough Bio* contributors volunteer to serve as prospective mentors.

Mentoring involves participating in creating the page of project ideas  
(I'd provide template and guidance), corresponding with applicants who  
have questions, participating in student application ranking, and for  
primary mentors (those directly assigned to a student) based on  
empirical evidence at least 5hrs/week of time spent with the student  
to help him/her get over obstacles or avoid wrong paths.

I think almost all mentors would concur that the experience was very  
gratifying, but as a mentor you will be spending a non-negligible  
amount of time with the student. I think it is the student-mentor  
pairing and interaction, not the stipend, that in the end makes the  
participation for students uniquely productive in terms of learning,  
and different from simply contributing to the project of choice (which  
they could always do).

For a personal impression for how the program is from a mentor  
perspective, I'll let Chris Fields speak who was the mentor for the  
2008 phyloXML in BioPerl project. From a student's perspective, I'll  
leave it to the 2007 Biojava student Bohyun Lee (blee34-at- 
mail.gatech.edu) and the 2008 BioPerl student Mira Han (mirhan-at- 
indiana.edu) to comment (if they are still on the list).

So if you think this is a good idea for Bio* to be part of, if you  
would like to help in some way, if you can see yourself as a mentor,  
or if you are a lurking would-be student, please let yourself be  
heard. Email either to the list or to me.

Cheers,

	-hilmar

[1] http://code.google.com/soc/2008

[2] http://code.google.com/opensource/gsoc/2009/faqs.html

[3] http://hackathon.nescent.org/Phyloinformatics_Summer_of_Code_2007
http://hackathon.nescent.org/Phyloinformatics_Summer_of_Code_2008

[4] http://biojava.org/wiki/BioJava:PhyloSOC07

[5] http://bioperl.org/wiki/PhyloXML_support_in_BioPerl
-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================




From jeedward at yahoo.com  Fri Feb 13 19:23:48 2009
From: jeedward at yahoo.com (John Edward)
Date: Fri, 13 Feb 2009 16:23:48 -0800 (PST)
Subject: [Biojava-l] Draft paper submission deadline extended: BCBGC-09
Message-ID: <421505.231.qm@web45914.mail.sp1.yahoo.com>

Draft paper submission deadline extended: BCBGC-09
?
The deadline for draft paper submission at the 2009 International Conference on Bioinformatics, Computational Biology, Genomics and Chemoinformatics (BCBGC-09) (website: http://www.PromoteResearch.org ) is extended due to numerous requests from the authors. The conference will be held during July 13-16 2009 in Orlando, FL, USA. We invite draft paper submissions. The conference will take place at the same time and venue where several other international conferences are taking place. The other conferences include:
????????? International Conference on Artificial Intelligence and Pattern Recognition (AIPR-09) 
????????? International Conference on Automation, Robotics and Control Systems (ARCS-09)
????????? International Conference on Enterprise Information Systems and Web Technologies (EISWT-09)
????????? International Conference on High Performance Computing, Networking and Communication Systems (HPCNCS-09) 
????????? International Conference on Information Security and Privacy (ISP-09)
????????? International Conference on Recent Advances in Information Technology and Applications (RAITA-09)
????????? International Conference on Software Engineering Theory and Practice (SETP-09) 
????????? International Conference on Theory and Applications of Computational Science (TACS-09)
????????? International Conference on Theoretical and Mathematical Foundations of Computer Science (TMFCS-09)
?
The website http://www.PromoteResearch.org contains more details.
?
Sincerely
John Edward
Publicity committee
?
?


      

From anantpossible at gmail.com  Sat Feb 14 00:33:25 2009
From: anantpossible at gmail.com (Anant Jain)
Date: Sat, 14 Feb 2009 11:03:25 +0530
Subject: [Biojava-l] Multiple Sequence Viewer
In-Reply-To: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>
References: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>
Message-ID: <bd096e3c0902132133n6fd1015cgf3d1a4c48e0f11a1@mail.gmail.com>

Good Morning,
  I am student of B.Tech Bioinformatics (4th year) & learning Biojava from
Internet. Can you sent me some important pdf documents on BioJava.
Thank You
ANANT JAIN
DYPBBI, PUNE, INDIA

From holland at eaglegenomics.com  Sat Feb 14 01:39:40 2009
From: holland at eaglegenomics.com (Richard Holland)
Date: Sat, 14 Feb 2009 06:39:40 +0000
Subject: [Biojava-l] Multiple Sequence Viewer
In-Reply-To: <bd096e3c0902132133n6fd1015cgf3d1a4c48e0f11a1@mail.gmail.com>
References: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>
	<bd096e3c0902132133n6fd1015cgf3d1a4c48e0f11a1@mail.gmail.com>
Message-ID: <4996672C.2050907@eaglegenomics.com>

Everything you need to know to get started is on our website:

  http://www.biojava.org/

thanks,
Richard

Anant Jain wrote:
> Good Morning,
>   I am student of B.Tech Bioinformatics (4th year) & learning Biojava from
> Internet. Can you sent me some important pdf documents on BioJava.
> Thank You
> ANANT JAIN
> DYPBBI, PUNE, INDIA
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l
> 

-- 
Richard Holland, BSc MBCS
Finance Director, Eagle Genomics Ltd
T: +44 (0)1223 654481 ext 3 | E: holland at eaglegenomics.com
http://www.eaglegenomics.com/

From markjschreiber at gmail.com  Sat Feb 14 02:17:48 2009
From: markjschreiber at gmail.com (Mark Schreiber)
Date: Sat, 14 Feb 2009 15:17:48 +0800
Subject: [Biojava-l] Multiple Sequence Viewer
In-Reply-To: <4996672C.2050907@eaglegenomics.com>
References: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>
	<bd096e3c0902132133n6fd1015cgf3d1a4c48e0f11a1@mail.gmail.com>
	<4996672C.2050907@eaglegenomics.com>
Message-ID: <93b45ca50902132317s34fbbab6pacd9f68080e10940@mail.gmail.com>

Also look at the recent publication
(http://dx.doi.org/10.1093/bioinformatics/btn397)

- Mark


On Sat, Feb 14, 2009 at 2:39 PM, Richard Holland
<holland at eaglegenomics.com> wrote:
>
> Everything you need to know to get started is on our website:
>
>  http://www.biojava.org/
>
> thanks,
> Richard
>
> Anant Jain wrote:
> > Good Morning,
> >   I am student of B.Tech Bioinformatics (4th year) & learning Biojava from
> > Internet. Can you sent me some important pdf documents on BioJava.
> > Thank You
> > ANANT JAIN
> > DYPBBI, PUNE, INDIA
> > _______________________________________________
> > Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/biojava-l
> >
>
> --
> Richard Holland, BSc MBCS
> Finance Director, Eagle Genomics Ltd
> T: +44 (0)1223 654481 ext 3 | E: holland at eaglegenomics.com
> http://www.eaglegenomics.com/
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l

From anantpossible at gmail.com  Tue Feb 17 00:55:00 2009
From: anantpossible at gmail.com (Anant Jain)
Date: Tue, 17 Feb 2009 11:25:00 +0530
Subject: [Biojava-l] A little problem
Message-ID: <op.upheptba6ll4wo@dypbbi-50>


Good Morning,
	     i want to retrieve dna sequnce from a GenBank file. So, I am using
SeqIOTools.redGenbank(br) method. There is one flaw, example of tutorials  
says that i will return a sequence but its returning SequenceIterator.
That's not a problem, we can get the sequence using nextSequence() method.

Now, i want to print the sequence which i have got from genbank file,so i  
used a for loop (below)

for (int pos = 1;pos<seq.length();pos++)
{

System.out.println(seq.symbolAt(pos));

}



Problem 1: It prints the nucleotides in random order, means i want it from  
begining to last as i did in loop
            plz help me out, because i want to write the sequence in file



Thank You
Anant Jain
PUNE, INDIA
-- 

From holland at eaglegenomics.com  Tue Feb 17 03:59:17 2009
From: holland at eaglegenomics.com (Richard Holland)
Date: Tue, 17 Feb 2009 08:59:17 +0000
Subject: [Biojava-l] A little problem
In-Reply-To: <op.upheptba6ll4wo@dypbbi-50>
References: <op.upheptba6ll4wo@dypbbi-50>
Message-ID: <499A7C65.5040401@eaglegenomics.com>

To convert the sequence into a String, use the seqString() method of the
Sequence object.

Also you should take a look at the replacement for SeqIOTools -
RichSequence.IOTools - as this is more up-to-date and handles file
parsing more sensibly.

cheers,
Richard

Anant Jain wrote:
> 
> Good Morning,
>          i want to retrieve dna sequnce from a GenBank file. So, I am using
> SeqIOTools.redGenbank(br) method. There is one flaw, example of
> tutorials says that i will return a sequence but its returning
> SequenceIterator.
> That's not a problem, we can get the sequence using nextSequence() method.
> 
> Now, i want to print the sequence which i have got from genbank file,so
> i used a for loop (below)
> 
> for (int pos = 1;pos<seq.length();pos++)
> {
> 
> System.out.println(seq.symbolAt(pos));
> 
> }
> 
> 
> 
> Problem 1: It prints the nucleotides in random order, means i want it
> from begining to last as i did in loop
>            plz help me out, because i want to write the sequence in file
> 
> 
> 
> Thank You
> Anant Jain
> PUNE, INDIA

-- 
Richard Holland, BSc MBCS
Finance Director, Eagle Genomics Ltd
T: +44 (0)1223 654481 ext 3 | E: holland at eaglegenomics.com
http://www.eaglegenomics.com/

From crackeur at comcast.net  Wed Feb 18 22:25:13 2009
From: crackeur at comcast.net (crackeur at comcast.net)
Date: Thu, 19 Feb 2009 03:25:13 +0000 (UTC)
Subject: [Biojava-l] [ANN]VTD-XML 2.5
In-Reply-To: <499A7C65.5040401@eaglegenomics.com>
Message-ID: <2083482873.1632131235013913327.JavaMail.root@sz0167a.emeryville.ca.mail.comcast.net>


VTD-XML 2.5 is now released. Please go to https://sourceforge.net/project/showfiles.php?group_id=110612&package_id=120172&release_id=661376 ?to download the latest version. 

Changes from Version 2.4 (2/2009) 

* Added separate VTD indexing generating and loading (see http://vtd-xml.sf.net/persistence.html for further info) 
* Integrated extended VTD supporting 256 GB doc (In Java only). 
* Added duplicateNav() for replicate multiple VTDNav instances sharing XML, VTD and LC buffer (availabe in Java and C#). 
* Various bug fixes and enhancements 


From aumanga at biggjapan.com  Wed Feb 18 21:50:01 2009
From: aumanga at biggjapan.com (Ashika Umanga Umagiliya)
Date: Thu, 19 Feb 2009 11:50:01 +0900
Subject: [Biojava-l] Saving back chromatogram?
Message-ID: <499CC8D9.4090906@biggjapan.com>

Greetings all,

I was able to display chromatogram using ABIFChromatogram class .
Now what I want to implement is a chromatogram Editor,where user can 
edit base calls and save aback to AB1 files.
Is there a way to do this in BioJava?

Best Regards,
umanga

From ayates at ebi.ac.uk  Thu Feb 19 04:23:00 2009
From: ayates at ebi.ac.uk (Andy Yates)
Date: Thu, 19 Feb 2009 09:23:00 +0000
Subject: [Biojava-l] Saving back chromatogram?
In-Reply-To: <499CC8D9.4090906@biggjapan.com>
References: <499CC8D9.4090906@biggjapan.com>
Message-ID: <499D24F4.8040607@ebi.ac.uk>

Hi Umanga,

Unfortunately there is no write feature available in the BioJava API. My
advice would be to store these new basecalls in a separate file & look
into using the Staden IO package which does support write functions (not
sure if it will write into AB1 but it will do SCF & ZTR). Sadly this is
written in C so you will have to write either some glue code with JNI to
get it working or write a small C program to munge an AB1 trace & your
new file together.

Sorry I can't be of any more help,

Andy

Ashika Umanga Umagiliya wrote:
> Greetings all,
> 
> I was able to display chromatogram using ABIFChromatogram class .
> Now what I want to implement is a chromatogram Editor,where user can
> edit base calls and save aback to AB1 files.
> Is there a way to do this in BioJava?
> 
> Best Regards,
> umanga
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l

From holland at eaglegenomics.com  Thu Feb 19 03:23:31 2009
From: holland at eaglegenomics.com (Richard Holland)
Date: Thu, 19 Feb 2009 08:23:31 +0000
Subject: [Biojava-l] Saving back chromatogram?
In-Reply-To: <499CC8D9.4090906@biggjapan.com>
References: <499CC8D9.4090906@biggjapan.com>
Message-ID: <499D1703.4020803@eaglegenomics.com>

No, BioJava does not include the ability to write ABI files. Technically
you could write your own code to do it though because the file format is
fully understood by the parser and is formally described by a paper
linked to from the Javadoc for ABIFChromatogram. By combining the
information from the paper with the code from the parser, it should be
possible to create a writer.

Richard

Ashika Umanga Umagiliya wrote:
> Greetings all,
> 
> I was able to display chromatogram using ABIFChromatogram class .
> Now what I want to implement is a chromatogram Editor,where user can
> edit base calls and save aback to AB1 files.
> Is there a way to do this in BioJava?
> 
> Best Regards,
> umanga
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l
> 

-- 
Richard Holland, BSc MBCS
Finance Director, Eagle Genomics Ltd
T: +44 (0)1223 654481 ext 3 | E: holland at eaglegenomics.com
http://www.eaglegenomics.com/

From anantpossible at gmail.com  Fri Feb 20 00:40:17 2009
From: anantpossible at gmail.com (Anant Jain)
Date: Fri, 20 Feb 2009 11:10:17 +0530
Subject: [Biojava-l] Regarding BioJava
Message-ID: <bd096e3c0902192140h5324b2d0t89a3b7820e95fa6@mail.gmail.com>

Greetings all,

                     Do we have any BioJava runtime eviorment like jre coz
if i give a s/w to anybody then he also include all the jar files in his
class path.

If i am compile and run my biojava program from my editplus then its working
but if i run it from command prompt then its giving error like  unable to
load PDBFilereader.class. plz tel me how to run our program through cmd

From aumanga at biggjapan.com  Fri Feb 20 00:48:45 2009
From: aumanga at biggjapan.com (Ashika Umanga Umagiliya)
Date: Fri, 20 Feb 2009 14:48:45 +0900
Subject: [Biojava-l] Saving back chromatogram?
In-Reply-To: <499D24F4.8040607@ebi.ac.uk>
References: <499CC8D9.4090906@biggjapan.com> <499D24F4.8040607@ebi.ac.uk>
Message-ID: <499E443D.30206@biggjapan.com>

Greetings all,

Thank you for all your answers.
What I want to do is ,after modifying callbases, I need to use the 
sequences with 'phrad' foro DNA assembly.For 'phrad', I need to give 
Fasta files and Quality files.
I can modify callbases using my chromatogram editor , and save the new 
sequence in Fasta file.But my problem is , If I change the original 
callbases from AB1  file ,does it effect the Qualitiy files also? Or can 
I use the original Quality files generated by 'phred' with  the new 
callbases.


Here is a image demonstrating my scenario:

http://img3.imageshack.us/img3/3564/f92df0815fab523f3c72aa3qx7.png


Step (2) Ab1 files are passed into 'phred' and Fasta,Quality files are 
generated.
Step (3) If user want to edit callbases , he can use the chromatogram 
editor.Then the Fasta files generated by 'phred' are replaced with new 
onces generated by editor.

My problem is can I use the same Quality files ,with  the modified 
callbases ?


Sorry if this is off the topic.

Thanks in advance,
Umanga



Andy Yates wrote:
> Hi Umanga,
>
> Unfortunately there is no write feature available in the BioJava API. My
> advice would be to store these new basecalls in a separate file & look
> into using the Staden IO package which does support write functions (not
> sure if it will write into AB1 but it will do SCF & ZTR). Sadly this is
> written in C so you will have to write either some glue code with JNI to
> get it working or write a small C program to munge an AB1 trace & your
> new file together.
>
> Sorry I can't be of any more help,
>
> Andy
>
> Ashika Umanga Umagiliya wrote:
>   
>> Greetings all,
>>
>> I was able to display chromatogram using ABIFChromatogram class .
>> Now what I want to implement is a chromatogram Editor,where user can
>> edit base calls and save aback to AB1 files.
>> Is there a way to do this in BioJava?
>>
>> Best Regards,
>> umanga
>> _______________________________________________
>> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biojava-l
>>     
>
>   


From russ at kepler-eng.com  Fri Feb 20 01:16:46 2009
From: russ at kepler-eng.com (Russ Kepler)
Date: Thu, 19 Feb 2009 23:16:46 -0700
Subject: [Biojava-l] Saving back chromatogram?
In-Reply-To: <499E443D.30206@biggjapan.com>
References: <499CC8D9.4090906@biggjapan.com> <499D24F4.8040607@ebi.ac.uk>
	<499E443D.30206@biggjapan.com>
Message-ID: <200902192316.46735.russ@kepler-eng.com>

On Thursday 19 February 2009 22:48:45 Ashika Umanga Umagiliya wrote:

> My problem is can I use the same Quality files ,with  the modified
> callbases ?

Edit the quality data in parallel with the chromatogram.  I would assume that 
the editor is relatively sure of their edits, so I would give them a high 
confidence level when I generate the trace fasta and quality file.

From aumanga at biggjapan.com  Fri Feb 20 01:54:15 2009
From: aumanga at biggjapan.com (Ashika Umanga Umagiliya)
Date: Fri, 20 Feb 2009 15:54:15 +0900
Subject: [Biojava-l] Saving back chromatogram?
In-Reply-To: <200902192316.46735.russ@kepler-eng.com>
References: <499CC8D9.4090906@biggjapan.com>
	<499D24F4.8040607@ebi.ac.uk>	<499E443D.30206@biggjapan.com>
	<200902192316.46735.russ@kepler-eng.com>
Message-ID: <499E5397.4060502@biggjapan.com>

Cheers.


I still haven't implemented the editor.I assume for basecall editing, I 
can use 'Edit' class.

Like:

ABIFChromatogram a;
..
..
a.getBaseCalls().edit(new Edit(.......))


And for Quality values, I am hoping to read and store Qualitly files 
generated by 'phred'.And when user edit the basecall, I am planing to 
edit stored quality values accordinly.
Finally the fasta file is generated using ABIFChromatogram.getBaseCalls()...
and Quality file will be generated using the structure I used above.

Any issues with this approach?

Many thanks,
Umanga


Russ Kepler wrote:
> On Thursday 19 February 2009 22:48:45 Ashika Umanga Umagiliya wrote:
>
>   
>> My problem is can I use the same Quality files ,with  the modified
>> callbases ?
>>     
>
> Edit the quality data in parallel with the chromatogram.  I would assume that 
> the editor is relatively sure of their edits, so I would give them a high 
> confidence level when I generate the trace fasta and quality file.
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l
>
>   


From holland at eaglegenomics.com  Fri Feb 20 03:43:23 2009
From: holland at eaglegenomics.com (Richard Holland)
Date: Fri, 20 Feb 2009 08:43:23 +0000
Subject: [Biojava-l] Regarding BioJava
In-Reply-To: <bd096e3c0902192140h5324b2d0t89a3b7820e95fa6@mail.gmail.com>
References: <bd096e3c0902192140h5324b2d0t89a3b7820e95fa6@mail.gmail.com>
Message-ID: <499E6D2B.90904@eaglegenomics.com>

Like any other Java software, you need to have all the BioJava jars on
your classpath to run it from the command line. If you want to avoid
having to do that, you can copy the jars into $JAVA_HOME/ext.

Please read Sun's documentation on the Java programming language to
learn more about the classpath.

Richard

Anant Jain wrote:
> Greetings all,
> 
>                      Do we have any BioJava runtime eviorment like jre coz
> if i give a s/w to anybody then he also include all the jar files in his
> class path.
> 
> If i am compile and run my biojava program from my editplus then its working
> but if i run it from command prompt then its giving error like  unable to
> load PDBFilereader.class. plz tel me how to run our program through cmd
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l
> 

-- 
Richard Holland, BSc MBCS
Finance Director, Eagle Genomics Ltd
T: +44 (0)1223 654481 ext 3 | E: holland at eaglegenomics.com
http://www.eaglegenomics.com/

From ayates at ebi.ac.uk  Fri Feb 20 06:02:52 2009
From: ayates at ebi.ac.uk (Andy Yates)
Date: Fri, 20 Feb 2009 11:02:52 +0000
Subject: [Biojava-l] Saving back chromatogram?
In-Reply-To: <499E5397.4060502@biggjapan.com>
References: <499CC8D9.4090906@biggjapan.com>	<499D24F4.8040607@ebi.ac.uk>	<499E443D.30206@biggjapan.com>	<200902192316.46735.russ@kepler-eng.com>
	<499E5397.4060502@biggjapan.com>
Message-ID: <499E8DDC.7090100@ebi.ac.uk>

As far as I'm aware no there shouldn't be a problem with this solution.

However have you investigated any other mechanisms for doing this kind
of contig editing/assembly work? I know that people at the Sanger Centre
use a program called gap4 which has powered just about every assembly
they have done. It's available from:

http://www.sanger.ac.uk/Software/production/staden/ (bit of info here)

http://staden.sourceforge.net/staden_home.html

Have a look at it as I feel that this is exactly what you are attempting
to do.

Andy

Ashika Umanga Umagiliya wrote:
> Cheers.
> 
> 
> I still haven't implemented the editor.I assume for basecall editing, I
> can use 'Edit' class.
> 
> Like:
> 
> ABIFChromatogram a;
> ..
> ..
> a.getBaseCalls().edit(new Edit(.......))
> 
> 
> And for Quality values, I am hoping to read and store Qualitly files
> generated by 'phred'.And when user edit the basecall, I am planing to
> edit stored quality values accordinly.
> Finally the fasta file is generated using
> ABIFChromatogram.getBaseCalls()...
> and Quality file will be generated using the structure I used above.
> 
> Any issues with this approach?
> 
> Many thanks,
> Umanga
> 
> 
> Russ Kepler wrote:
>> On Thursday 19 February 2009 22:48:45 Ashika Umanga Umagiliya wrote:
>>
>>  
>>> My problem is can I use the same Quality files ,with  the modified
>>> callbases ?
>>>     
>>
>> Edit the quality data in parallel with the chromatogram.  I would
>> assume that the editor is relatively sure of their edits, so I would
>> give them a high confidence level when I generate the trace fasta and
>> quality file.
>> _______________________________________________
>> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biojava-l
>>
>>   
> 
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l

From jeedward at yahoo.com  Fri Feb 20 10:27:09 2009
From: jeedward at yahoo.com (John Edward)
Date: Fri, 20 Feb 2009 07:27:09 -0800 (PST)
Subject: [Biojava-l] Draft paper submission deadline extended: BCBGC-09
Message-ID: <483752.12181.qm@web45903.mail.sp1.yahoo.com>

Draft paper submission deadline extended: BCBGC-09
?
The deadline for draft paper submission at the 2009 International Conference on Bioinformatics, Computational Biology, Genomics and Chemoinformatics (BCBGC-09) (website: http://www.PromoteResearch.org ) is extended due to numerous requests from the authors. The conference will be held during July 13-16 2009 in Orlando, FL, USA. We invite draft paper submissions. The conference will take place at the same time and venue where several other international conferences are taking place. The other conferences include:
????????? International Conference on Artificial Intelligence and Pattern Recognition (AIPR-09) 
????????? International Conference on Automation, Robotics and Control Systems (ARCS-09)
????????? International Conference on Enterprise Information Systems and Web Technologies (EISWT-09)
????????? International Conference on High Performance Computing, Networking and Communication Systems (HPCNCS-09) 
????????? International Conference on Information Security and Privacy (ISP-09)
????????? International Conference on Recent Advances in Information Technology and Applications (RAITA-09)
????????? International Conference on Software Engineering Theory and Practice (SETP-09) 
????????? International Conference on Theory and Applications of Computational Science (TACS-09)
????????? International Conference on Theoretical and Mathematical Foundations of Computer Science (TMFCS-09)
?
The website http://www.PromoteResearch.org contains more details.
?
Sincerely
John Edward
Publicity committee


      

From anantpossible at gmail.com  Mon Feb 23 04:45:45 2009
From: anantpossible at gmail.com (Anant Jain)
Date: Mon, 23 Feb 2009 15:15:45 +0530
Subject: [Biojava-l] problem in alignment
Message-ID: <bd096e3c0902230145v4b35582eid135568873c40e12@mail.gmail.com>

Greeetings all,

                       i am aligning two protein sequences using BLOSUM62
substitution matrix but an runtime error is coming which is " this
tokenization does not contain character ' * ' " some IllegalSymbolException

please suggest me solution or any substitution matrix

or do i have to change my sequence format.

plz rply

From andreas.draeger at uni-tuebingen.de  Mon Feb 23 05:48:20 2009
From: andreas.draeger at uni-tuebingen.de (=?ISO-8859-1?Q?Andreas_Dr=E4ger?=)
Date: Mon, 23 Feb 2009 11:48:20 +0100
Subject: [Biojava-l] problem in alignment
In-Reply-To: <bd096e3c0902230145v4b35582eid135568873c40e12@mail.gmail.com>
References: <bd096e3c0902230145v4b35582eid135568873c40e12@mail.gmail.com>
Message-ID: <49A27EF4.1050109@uni-tuebingen.de>

Dear Anant Jain,

>                        i am aligning two protein sequences using BLOSUM62
> substitution matrix but an runtime error is coming which is " this
> tokenization does not contain character ' * ' " some IllegalSymbolException
> 
> please suggest me solution or any substitution matrix
> 
> or do i have to change my sequence format.

This problem occurs very frequently because in BioJava the * symbol (the 
termination symbol) belongs to the alphabet PROTEIN_TERM and not to the 
alphabet PROTEIN. Please use the correct alphabet and you'll be fine.

Cheers
Andreas

From andreas.draeger at uni-tuebingen.de  Mon Feb 23 15:48:54 2009
From: andreas.draeger at uni-tuebingen.de (Andreas =?iso-8859-1?b?RHLkZ2Vy?=)
Date: Mon, 23 Feb 2009 21:48:54 +0100
Subject: [Biojava-l] problem in alignment
In-Reply-To: <bd096e3c0902230900i1fd808afvcdc360de521225d4@mail.gmail.com>
References: <bd096e3c0902230145v4b35582eid135568873c40e12@mail.gmail.com>
	<49A27EF4.1050109@uni-tuebingen.de>
	<bd096e3c0902230900i1fd808afvcdc360de521225d4@mail.gmail.com>
Message-ID: <20090223214854.959059s53gtvecvq@webmail.uni-tuebingen.de>

Dear Anant Jain,

Yeah, the problem is that the substitution matrices, e.g., BLOSUM 50,  
contain the *-symbol. So you'll definitely need the PROTEIN_TERM  
alphabet when doing protein alignments. Just try and let me know if it  
works.

Cheers
Andreas Dr?ger


Dipl.-Bioinform. Andreas Dr?ger
Eberhard Karls University T?bingen
Center for Bioinformatics (ZBIT)
Sand 1
72076 T?bingen
Germany

Phone: +49-7071-29-70436
Fax:   +49-7071-29-5091


From andreas.draeger at uni-tuebingen.de  Tue Feb 24 02:34:28 2009
From: andreas.draeger at uni-tuebingen.de (=?ISO-8859-1?Q?Andreas_Dr=E4ger?=)
Date: Tue, 24 Feb 2009 08:34:28 +0100
Subject: [Biojava-l] Regarding problen in Alignment
In-Reply-To: <bd096e3c0902232140t49e45c75w653dea028986b00f@mail.gmail.com>
References: <bd096e3c0902232140t49e45c75w653dea028986b00f@mail.gmail.com>
Message-ID: <49A3A304.4010004@uni-tuebingen.de>

Dear Anant Jain,

Sorry for this misunderstanding. There is no substitution matrix 
"PROTEIN_TERM". The constructor of the BioJava SubstitutionMatrix class 
requires the following arguments: FiniteAlphabet alpha and File 
matrixFile. As the alphabet you should use the alphabet "PROTEIN_TERM" 
for matrixes of protein sequences like BLOSUM etc. In the BioJava 
repository there is a newer version of this class that provides a 
function to parse a matrix without explicitely providing an alphabet (it 
guesses the alphabet of the matrix). I hope this helps.

Cheers
Andreas Dr?ger

Anant Jain wrote:
> Thank You Sir,
>                        I  have searched through ftp/...blast/matrices,
> but did not got any file substitution matrix like PROTEIN_TERM,  if u
> have can u send me it OR tell me link from where i can download the it
> 
> Thank You
> Anant jain
> DYPBI
> Pune, India.
> 


From sauloal at gmail.com  Tue Feb 24 10:53:10 2009
From: sauloal at gmail.com (Saulo Alves)
Date: Tue, 24 Feb 2009 16:53:10 +0100
Subject: [Biojava-l] Sequence Annotation on Gui
Message-ID: <ee3dfd060902240753x7cd0df54nf4363d16966f28af@mail.gmail.com>

Hello,

I'm new here and in biojava and i have been strugling with this problem.

I have a chromossome with its gene annotations and i want to plot it in a GUI.

I used the tutorial to make the basic setup and i can have a good
picture of the chromossome and its genes position.

The problem is: how to plot the name of each gene along the arrow
which represents each gene?

thanks in advance,

S.

From andreas.draeger at uni-tuebingen.de  Wed Feb 25 01:54:29 2009
From: andreas.draeger at uni-tuebingen.de (=?ISO-8859-1?Q?Andreas_Dr=E4ger?=)
Date: Wed, 25 Feb 2009 07:54:29 +0100
Subject: [Biojava-l] Regarding problen in Alignment
In-Reply-To: <bd096e3c0902242225k2972a7ddkf10a0275639c5150@mail.gmail.com>
References: <bd096e3c0902232140t49e45c75w653dea028986b00f@mail.gmail.com>	
	<49A3A304.4010004@uni-tuebingen.de>
	<bd096e3c0902242225k2972a7ddkf10a0275639c5150@mail.gmail.com>
Message-ID: <49A4EB25.5070207@uni-tuebingen.de>

Anant Jain wrote:
> Thank Sir,
>                 
> So should i use this
>  
> SubstituionMatrix matrix = new SubstitutionMatrix("PROTEIN_TERM",new 
> File (BLOSUM62.50"));
>  
>  
> Anant Jain
> DYPBBI,
> Pune,India

Dear Anant Jain,


"PROTEIN_TERM" is a String and not a FiniteAlphabet. Please have a look 
at the following example, where the alphabet "DNA" is used. Just replace 
"DNA" by "PROTEIN_TERM" and it will work for you:
http://biojava.org/wiki/BioJava:CookBook:DP:PairWise2

Cheers
Andreas

From aumanga at biggjapan.com  Wed Feb 25 02:44:24 2009
From: aumanga at biggjapan.com (Ashika Umanga Umagiliya)
Date: Wed, 25 Feb 2009 16:44:24 +0900
Subject: [Biojava-l] Biojava Parsers : Apply quality values for contig ?
Message-ID: <49A4F6D8.9010307@biggjapan.com>

Greetings all,


I am using 'phred/phrap' to assemble DNA sequences ,and 'phrap' 
generates contig file and a contig-quality files for an assembly.
Now I want to parse these two files and generate final contig , by 
removing Bases with '0' quality values.

For example :
CGACTATG + 0 42 54 59 48 0 0 0 > _GACT____

Why I want to do this is; because only this "masking" will give the 
similar contig that of which generated by ChromasPro.

I can use Fasta-parser to parse contig file.But I wonder whether theres 
anyway to handle parsing of Quality file in BioJava.

Below I have give the structures of two file types:

thanks in advance,
Umanga



contig file:
------------
 >seqs_fasta.Contig1
TTGGAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCCTAACA
CATGCAAGTCGAACGGTAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGT
GGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAAC
TACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGG
GACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTA
GGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGA
TGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCA
GCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGC
GTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAG
GGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCAC
CGGCTAATTCCGTGCCAGCAGCCGCGGTAATATTNTTATTCTTTATGTAT
ACATATTCTTTTTACTTTATTCTATTAAATTTATTCTTTCATAATTAAAC
CTTCCCTTACACCCATTCCACCTCCCATCCCTCTTCCCCTCCCACTCTCC
ATCTCATATGGCGTTCGCGCCTCTCTCTTCATCTCCTCCTATATTTATTC
TAACTTCTTTCATCTCAATCATTTCTTCTGTCTCATCCTTCCATTCTTTC
CATGATCTCCCCCATTGTCATGTCTTCAAAAAACCACACAAAACACTAGA
ATCTTTTCTTATTACACACAAGTATATACAATTTTTAACAATCCATTAAA
ACACACACAACACCTAGCAATCAACAACGCTACCATCCCCAATATTCTCT
GTTCTCCTCTCTTTCTCCGCGTGCATCTGCGCACTACTCTCTAATTTCAT
CTCTATTATCTTTTTTTCTTAACTCATCCGCATACATCCAAGACTCTAGA
CCCATTTCTCGCCTCTTTCATTTACTGCCGATACAGAGCTTATAAATTCT
ATATCATTTATCCACACTCATTATTAAATAGGCTGACACCTCTAACCGTC
CACTACACCACCTTTCCCATGCCATCTCCCTAACACTGCACTCATCCGTA
ACTTCCTACTCTACCCTCTCTTTCTTTCCTTACTTTCTTTTCTTTCTCTT
ACATTTTTATTTAAAATTCCTCTTTTAGCCTCTATTTTCTGTTATCTACT
TTTCTCCTAAATTCCCCCTATTCTTCACGTCCCATACCTATCCCTACCAC
CACCACTACCACCCCTCTCTTCATTCTACTCGCTCTAAACCCTCCACCCT
CCCCTCCTTGCTCTTATGTATCTCCTCATCTTTTAAT



quality file
------------
 >seqs_fasta.Contig1
0 23 23 33 33 33 33 33 31 41 47 47 47 47 47 47 47 50 47 47 57 59 59 59 
42 42 35 42 42 54 59 48 48 48 48 48 48 54 57 57 57 57 57 54 54 57 54 54 
54 74
74 74 74 59 57 57 57 57 72 72 84 76 73 72 72 72 79 81 74 74 62 50 50 50 
59 39 43 32 35 32 43 58 44 48 70 70 58 73 55 69 67 87 87 90 90 90 90 90 
90 90
90 90 90 90 90 90 90 90 89 90 90 90 90 90 90 90 85 87 87 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 77 77 77 81 81 90 90 90 90 90 90 90 90 
90 90
90 90 90 90 90 87 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90
90 90 90 90 74 74 85 90 90 90 90 90 90 90 90 90 90 90 90 83 83 90 90 90 
90 90 90 90 75 83 83 89 89 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90
90 72 72 72 57 57 43 37 37 43 72 72 72 72 72 72 90 90 90 90 90 90 90 86 
90 90 90 90 90 90 90 79 85 83 90 90 90 89 87 87 90 90 90 90 67 67 79 78 
90 86
88 82 73 68 65 61 59 63 62 68 71 72 59 56 41 35 30 30 28 32 41 47 40 56 
49 42 49 51 50 37 37 39 39 37 52 54 51 46 20 20 27 24 32 24 20 20 21 24 
16 19
19 33 29 22 23 12 11 11 12 20 23 40 32 31 28 22 13 13 18 26 28 28 34 28 
25 24 28 23 26 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0



-- 
??? ???? ?????
???????????????????BiGG)
?140-0001
?????????3-6-9 ??????8F
TEL:03-6679-8763
FAX:03-6679-8764


From watson at ebi.ac.uk  Wed Feb 25 06:07:49 2009
From: watson at ebi.ac.uk (James Watson)
Date: Wed, 25 Feb 2009 11:07:49 +0000
Subject: [Biojava-l] Java programmatic access course at the EMBL-EBI
Message-ID: <49A52685.7090201@ebi.ac.uk>

We have a hands-on training course that might be of interest being run 
here at the European Bioinformatics Institute. Further details can be 
found at http://www.ebi.ac.uk/training/handson/

Title: Programmatic Access: to biological databases (Java)
Date: 27-29 April 2009
Venue: EMBL-EBI, Hinxton, Nr Cambridge, CB10 1SD, UK
Organisers: Samuel Patient & James Watson
Registration Deadline: 30th March 2009 - 12 noon (GMT)
Cost: ?50.00 (no travel or accomodation included)

James Watson

-- 
James D Watson
Scientific Training Officer
EMBL-EBI
Wellcome Trust Genome Campus
Hinxton
Tel: +44(0)1223 492541

http://www.ebi.ac.uk/training/

Upcoming hands on training courses (http://www.ebi.ac.uk/training/handson/):

16-18 March 2009: Sequence to Genes - Genome Informatics
27-29 April 2009: Programmatic access to biological databases
11-15 May 2009: A Walkthrough EBI Bioinformatics Resources

From koen.bruynseels at cropdesign.com  Wed Feb 25 06:18:32 2009
From: koen.bruynseels at cropdesign.com (koen.bruynseels at cropdesign.com)
Date: Wed, 25 Feb 2009 12:18:32 +0100
Subject: [Biojava-l] Koen Bruynseels is out of the office.
Message-ID: <OF283791AA.5126250A-ONC1257568.003E1F5B-C1257568.003E1F5B@basf-c-s.be>


I will be out of the office starting  02/24/2009 and will not return until
03/02/2009.

I will respond to your message when I return.


From andreas at sdsc.edu  Wed Feb 25 12:54:06 2009
From: andreas at sdsc.edu (Andreas Prlic)
Date: Wed, 25 Feb 2009 09:54:06 -0800
Subject: [Biojava-l] biojava 1.7 release schedule
Message-ID: <59a41c430902250954k4696f868hb5b8b50fa247a03a@mail.gmail.com>

Hi

I would like to propose the following release plan for biojava 1.7:

* the next couple of weeks:
  commit missing patches, write junit tests and improve documentation
(everybody with write access)

* Wed. April 8th:
  code freeze (declared on biojava-dev by me)
  final checks.
  at this point all unit tests should pass without problems

* Sat. April 11th :
  I will branch the svn,
  copy the release files on the biojava site,
  and write the announce email

Andreas

From andreas.prlic at gmail.com  Thu Feb 26 11:16:56 2009
From: andreas.prlic at gmail.com (Andreas Prlic)
Date: Thu, 26 Feb 2009 08:16:56 -0800
Subject: [Biojava-l] BioJava and backbone amino acids
In-Reply-To: <49A63722.40002@wp.pl>
References: <49A63722.40002@wp.pl>
Message-ID: <59a41c430902260816t1280caa1tb770a174d32fcc03@mail.gmail.com>

Hi Michal,

You could use the Calc class to calculate all the distances of Atoms
that are in proximity of a the ligand.

Andreas


On Wed, Feb 25, 2009 at 10:30 PM, Michal Lorenc <m.t.lorenc at wp.pl> wrote:
> Dear Andreas,
> do you know how it is possible to find backbone amino acids around the
> ligand with BioJava or do you know another software?
>
> Thank you in advance.
>
> Best regards,
>
> Michal
>

From bopfannkuche at gmx.de  Fri Feb 27 05:36:38 2009
From: bopfannkuche at gmx.de (=?ISO-8859-15?Q?Bj=F6rn_Ole_Pfannkuche?=)
Date: Fri, 27 Feb 2009 11:36:38 +0100
Subject: [Biojava-l] Zuker Algorithm
Message-ID: <49A7C236.6090807@gmx.de>

Hello!

I' m reading this mailinglist for quite a while and I often learned very 
nice tricks on different stuff *G*

Now I have a little problem/question of my own:

Has anyone implemented the Zuker-Algorithm for RNA Folding so far? I 
need a Java Version for a software project and due to the fact that all 
of you are developing software I hope that I do not have to implement it 
again in the case one of you have already done.

If someone can help me I would be very delighted,
thanks in advance!

Bj?rn

From andreas.prlic at gmail.com  Fri Feb 27 22:15:44 2009
From: andreas.prlic at gmail.com (Andreas Prlic)
Date: Fri, 27 Feb 2009 19:15:44 -0800
Subject: [Biojava-l] BioJava and backbone amino acids
In-Reply-To: <49A79EAD.7030000@wp.pl>
References: <49A63722.40002@wp.pl>
	<59a41c430902260816t1280caa1tb770a174d32fcc03@mail.gmail.com>
	<49A79EAD.7030000@wp.pl>
Message-ID: <59a41c430902271915l73a05533lc77d5dc69e439480@mail.gmail.com>

Hi Michal,

you can get the backbone atoms e.g. by using the StructureTools class:

StructureTools.getBackboneAtomArray(Structure s)

http://www.biojava.org/docs/api/org/biojava/bio/structure/StructureTools.html

Andreas

On Fri, Feb 27, 2009 at 12:05 AM, Michal Lorenc <m.t.lorenc at wp.pl> wrote:
> Hi Andreas,
> Thank you for your email. But how can I find backbone amino acids?
>
> Thank you in advance.
>
> Best regards,
>
> Michal
>
> Andreas Prlic wrote:
>>
>> Hi Michal,
>>
>> You could use the Calc class to calculate all the distances of Atoms
>> that are in proximity of a the ligand.
>>
>> Andreas
>>
>>
>> On Wed, Feb 25, 2009 at 10:30 PM, Michal Lorenc <m.t.lorenc at wp.pl> wrote:
>>>
>>> Dear Andreas,
>>> do you know how it is possible to find backbone amino acids around the
>>> ligand with BioJava or do you know another software?
>>>
>>> Thank you in advance.
>>>
>>> Best regards,
>>>
>>> Michal
>>>
>>
>>
>

From raphael.andre.bauer at gmail.com  Tue Feb  3 09:28:52 2009
From: raphael.andre.bauer at gmail.com (=?UTF-8?Q?Raphael_Andr=C3=A9_Bauer?=)
Date: Tue, 3 Feb 2009 10:28:52 +0100
Subject: [Biojava-l] Different chain lengths using struc.getChainByPDB and
	iterating over a structure and it's chain
Message-ID: <9b46aa30902030128nfea24f5x94e7882a8d80e542@mail.gmail.com>

Hey everybody,


suppose the following PDB file:
	
....
ATOM   2847  OD1 ASP A 370      14.470   9.116  16.553  1.00 57.47           O
ATOM   2848  OD2 ASP A 370      12.601   9.313  15.410  1.00 57.77           O
ATOM   2849  N   ASN A 371      17.114   9.968  15.979  1.00 46.04           N
ATOM   2850  CA  ASN A 371      18.177   9.691  16.946  1.00 46.67           C
ATOM   2851  C   ASN A 371      19.555  10.072  16.403  1.00 46.52           C
ATOM   2852  O   ASN A 371      19.848  11.250  16.177  1.00 43.37           O
ATOM   2853  CB  ASN A 371      18.174   8.209  17.345  1.00 49.12           C
ATOM   2854  CG  ASN A 371      16.969   7.829  18.189  1.00 52.62           C
ATOM   2855  OD1 ASN A 371      16.762   6.652  18.502  1.00 55.93           O
ATOM   2856  ND2 ASN A 371      16.168   8.824  18.568  1.00 52.06           N
TER    2857      ASN A 371
HETATM 2858 ZN    ZN A 400      43.465  12.734  15.463  1.00 24.94          ZN
HETATM 2859 ZN    ZN A 401      46.414  14.165  16.934  1.00 30.14          ZN
HETATM 2860  N9  ADE A1114      50.418   9.820  20.124  1.00 80.38           N
HETATM 2861  C8  ADE A1114      50.489  11.169  20.334  1.00 80.76           C
HETATM 2862  N7  ADE A1114      49.492  11.773  19.748  1.00 80.58           N
HETATM 2863  C5  ADE A1114      48.715  10.855  19.124  1.00 79.77           C
....


1) If I use

//struc being the parsed pdb file
returnChain = struc.getChainByPDB("A", 1);

I get chain A EXCEPT everything after the TER (ZN and ADE is excluded
in this example).

2) If I iterate over the complete file using something like

//struc being the parsed pdb file
int nrModels = struc.nrModels();
			
for (int modelNr = 0; modelNr < nrModels; modelNr++) {
List<Chain> chains = struc.getModel(modelNr);
int nrChains = chains.size();
for (int chainNr = 0; chainNr < nrChains; chainNr++) {

//this chain contains also the ZN and the ADE



So maybe I am getting something wrong here. Is this effect wanted by
the PDB parser?


Thanks!


Raphael


From andreas.prlic at gmail.com  Tue Feb  3 15:30:48 2009
From: andreas.prlic at gmail.com (Andreas Prlic)
Date: Tue, 3 Feb 2009 07:30:48 -0800
Subject: [Biojava-l] Different chain lengths using struc.getChainByPDB
	and iterating over a structure and it's chain
In-Reply-To: <9b46aa30902030128nfea24f5x94e7882a8d80e542@mail.gmail.com>
References: <9b46aa30902030128nfea24f5x94e7882a8d80e542@mail.gmail.com>
Message-ID: <1CAC30DC-06D7-4B0D-8799-0692C9591B11@gmail.com>

Hi Rafael,


>
> suppose the following PDB file:
>     ...

>
> 1) If I use
>
> //struc being the parsed pdb file
> returnChain = struc.getChainByPDB("A", 1);
>
> I get chain A EXCEPT everything after the TER (ZN and ADE is excluded
> in this example).

This seems wrong. You should get the full chain here. TERs are getting  
ignored. Let me check what might cause this. You are on the latest  
version from svn?

> 2) If I iterate over the complete file using something like
>
> //struc being the parsed pdb file
> int nrModels = struc.nrModels();
>
> for (int modelNr = 0; modelNr < nrModels; modelNr++) {
> List<Chain> chains = struc.getModel(modelNr);
> int nrChains = chains.size();
> for (int chainNr = 0; chainNr < nrChains; chainNr++) {
>
> //this chain contains also the ZN and the ADE

That's what I would expect...

Andreas






>
>
>
>
> So maybe I am getting something wrong here. Is this effect wanted by
> the PDB parser?
>
>
> Thanks!
>
>
> Raphael
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l


From raphael.andre.bauer at gmail.com  Tue Feb  3 19:01:09 2009
From: raphael.andre.bauer at gmail.com (=?UTF-8?Q?Raphael_Andr=C3=A9_Bauer?=)
Date: Tue, 3 Feb 2009 20:01:09 +0100
Subject: [Biojava-l] Different chain lengths using struc.getChainByPDB
	and iterating over a structure and it's chain
In-Reply-To: <1CAC30DC-06D7-4B0D-8799-0692C9591B11@gmail.com>
References: <9b46aa30902030128nfea24f5x94e7882a8d80e542@mail.gmail.com>
	<1CAC30DC-06D7-4B0D-8799-0692C9591B11@gmail.com>
Message-ID: <9b46aa30902031101r77aa6236qc6e92c4140f39ca8@mail.gmail.com>

On Tue, Feb 3, 2009 at 4:30 PM, Andreas Prlic <andreas.prlic at gmail.com> wrote:
...
>> 1) If I use
>>
>> //struc being the parsed pdb file
>> returnChain = struc.getChainByPDB("A", 1);
>>
>> I get chain A EXCEPT everything after the TER (ZN and ADE is excluded
>> in this example).
>
> This seems wrong. You should get the full chain here. TERs are getting
> ignored. Let me check what might cause this. You are on the latest version
> from svn?
Thanks for the quick response. And sorry for having bothered you -
after writing a quick unit test it became pretty clear that it is my
own fault. I thought I double checked that yesterday (and I should
write the unit test before writing to the list - I know). The
"supposed-to-be-bug-but-was-my-own-failure" came from
setParseCAOnly().

Sorry and thanks again!

Raphael


From aumanga at biggjapan.com  Thu Feb  5 05:57:37 2009
From: aumanga at biggjapan.com (Ashika Umanga Umagiliya)
Date: Thu, 05 Feb 2009 14:57:37 +0900
Subject: [Biojava-l] [Off the Topic] Homology prediction of large number of
	sequences!
Message-ID: <498A7FD1.2060203@biggjapan.com>

Greetings all,

I have about 60,000  sequences and want to predict the 3D structure 
(Homology modelling) for all the structures.I decided to use Modeller 
first , and seems that would take months to predict all those structures.
Is there any HighPerformance prediction server which I have use for 
this? Not submitting data through webbased interface , I want to 
automate the process , cuz 60K is alot of data!

Thanks in advance,
umanga


From markjschreiber at gmail.com  Thu Feb  5 13:51:39 2009
From: markjschreiber at gmail.com (Mark Schreiber)
Date: Thu, 5 Feb 2009 21:51:39 +0800
Subject: [Biojava-l] [Off the Topic] Homology prediction of large number
	of sequences!
In-Reply-To: <498A7FD1.2060203@biggjapan.com>
References: <498A7FD1.2060203@biggjapan.com>
Message-ID: <93b45ca50902050551s11574e7br9526f08ddae156f4@mail.gmail.com>

I don't know about high performance but the problem is very parallel
so if you can get your hands on a cluster you can run one sequence on
each processor.

Maybe there is a cloud compute facility you could use if a cluster is
not available.

You might also want to try a pilot experiment first. There is bound to
be some redundancy in some of those proteins which will give nearly
identical models.

- Mark

On Thu, Feb 5, 2009 at 1:57 PM, Ashika Umanga Umagiliya
<aumanga at biggjapan.com> wrote:
>
> Greetings all,
>
> I have about 60,000  sequences and want to predict the 3D structure (Homology modelling) for all the structures.I decided to use Modeller first , and seems that would take months to predict all those structures.
> Is there any HighPerformance prediction server which I have use for this? Not submitting data through webbased interface , I want to automate the process , cuz 60K is alot of data!
>
> Thanks in advance,
> umanga
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l


From willishf at ufl.edu  Fri Feb  6 19:39:17 2009
From: willishf at ufl.edu (Scooter Willis)
Date: Fri, 6 Feb 2009 14:39:17 -0500
Subject: [Biojava-l] Phylogenetic Trees
Message-ID: <7ceb4beb0902061139l6d49add6qb592cd389b0e176b@mail.gmail.com>

I was looking for Java code to construct a phylogenetic tree from
aligned sequence data. I came across org.biojavax.bio.phylo as an
experimental package in the latest release of BioJava. The docs were
thin and couldn't find any code examples so was wondering if anyone
has used the package with success.

I also couldn't decide if the package is intended to load
pre-constructed trees as Java objects or could be used to construct a
tree from aligned sequence data.

Does anyone know of an accepted Java package for tree construction
besides what is in JalView?

Thanks

Scooter


From simon.rayner.cn at gmail.com  Sun Feb  8 09:45:46 2009
From: simon.rayner.cn at gmail.com (simon rayner)
Date: Sun, 8 Feb 2009 04:45:46 -0500
Subject: [Biojava-l] alignments
Message-ID: <616a29410902080145m2ea0fe0fye091ac646071ac13@mail.gmail.com>

Hi,

i have a question about Alignment and FlexibleAlignment objects.
Basically, i have a sequence alignment in FASTA format so followed a code
sample i found from a previous posted query:

   BufferedReader br = new BufferedReader(new FileReader("file.txt"));
   FastaAlignmentFormat faf = new FastaAlignmentFormat();
   Alignment aligned = faf.read( br );

so now i have an alignment stored in an Alignment object.

1. I do something with these sequences using the access methods for
the Alignment object.
something like

         java.util.Iterator iter = l.listIterator();
         while(iter.hasNext())
         {
           String currLabel = (String) iter.next();
           String currAA
                   = aligned.symbolListForLabel(currLabel)
                   .seqString().substring(base, base+1);
         }

2. Now i want to do the same analysis but on a random sample of
sequences from this alignment.
So to get a subset of these sequences i created a FlexibleAlignment
and grabbed the sequences
i need from the original alignment...

      Alignment al;
      Iterator l = al.symbolListIterator();
      java.util.List<String> names = al.getLabels();
      Iterator n = names.listIterator();
      java.util.ArrayList seqList = new java.util.ArrayList(1);
      String refs = "";
      while(refs.length() < al.length())
      {
        refs = refs.concat("x");
      }

      try{
        FlexibleAlignment FA = new FlexibleAlignment(seqList);
        SymbolList aa = ProteinTools.createProtein(refs);

        seqList.add(
                new SimpleAlignmentElement(
                 "reference",
                 aa,
                 new RangeLocation(1, al.length()))
                );
        while (l.hasNext())
        {
          try{
            SymbolList sal = (SymbolList)l.next();
            String name = (String)n.next();

            FA.addSequence(new SimpleAlignmentElement(name,
                     sal,
                     new RangeLocation(1, al.length())));

          }
          catch (org.biojava.bio.BioException ex)
          {
            System.out.print("couldn't add sequence to alignment\n");
            System.err.print(ex);
          }
        }
        this.aligned = FA;
      }
      catch (org.biojava.bio.BioException ex)
      {
        System.out.print("couldn't add sequence to alignment\n");
        System.err.print(ex);
      }

So now i have my alignment of random sequences in a FlexibleAlignment
object, but my original analysis
was written for an Alignment object (because that's the format that
FastaAlignmentFormat spat back at me.

So, can i cast a FlexibleAlignment object into an Alignment object? or
am i just going about it the wrong way?

p.s. Why are there so many diverse Alignment related objects?
(AbstractULAlignment,
AbstractULAlignment.SubULAlignment, FlexibleAlignment, RelabeledAlignment,
EmptyPairwiseAlignment, SimpleAlignment, HappyAlignment,
SadAlignment..)  Is there any documentation (other than
the standard java docs) to clarify which object when?

thanks!


From holland at eaglegenomics.com  Mon Feb  9 14:43:03 2009
From: holland at eaglegenomics.com (Richard Holland)
Date: Mon, 09 Feb 2009 14:43:03 +0000
Subject: [Biojava-l] Phylogenetic Trees
In-Reply-To: <7ceb4beb0902061139l6d49add6qb592cd389b0e176b@mail.gmail.com>
References: <7ceb4beb0902061139l6d49add6qb592cd389b0e176b@mail.gmail.com>
Message-ID: <499040F7.3050009@eaglegenomics.com>

The package you found in biojavax was written with the intention of
parsing existing tree structures from NEXUS files, and to perform basic
analyses of them (neighbour joining, etc.). The code can represent trees
regardless of their source, and can output them as NEXUS files, but
there are no algorithm implementations in that package for constructing
new trees and so you'd probably have to write those from scratch.

cheers,
Richard

Scooter Willis wrote:
> I was looking for Java code to construct a phylogenetic tree from
> aligned sequence data. I came across org.biojavax.bio.phylo as an
> experimental package in the latest release of BioJava. The docs were
> thin and couldn't find any code examples so was wondering if anyone
> has used the package with success.
> 
> I also couldn't decide if the package is intended to load
> pre-constructed trees as Java objects or could be used to construct a
> tree from aligned sequence data.
> 
> Does anyone know of an accepted Java package for tree construction
> besides what is in JalView?
> 
> Thanks
> 
> Scooter
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l
> 

-- 
Richard Holland, BSc MBCS
Finance Director, Eagle Genomics Ltd
M: +44 7500 438846 | E: holland at eaglegenomics.com
http://www.eaglegenomics.com/


From holland at eaglegenomics.com  Mon Feb  9 14:47:45 2009
From: holland at eaglegenomics.com (Richard Holland)
Date: Mon, 09 Feb 2009 14:47:45 +0000
Subject: [Biojava-l] alignments
In-Reply-To: <616a29410902080145m2ea0fe0fye091ac646071ac13@mail.gmail.com>
References: <616a29410902080145m2ea0fe0fye091ac646071ac13@mail.gmail.com>
Message-ID: <49904211.7010404@eaglegenomics.com>

Yes, you can cast it back. In fact you don't need to actually cast it at
all, as Java will do that for you automatically. FlexibleAlignment is an
implementation of the Alignment interface, which defines general
behaviour for all alignments. If your algorithm is written to accept a
parameter of type Alignment, then it will accept any object which
implements the Alignment interface, including FlexibleAlignment, Happy
and SadAlignment, etc. etc.

Unfortunately I'm not sure why there are so many different kinds of
alignment objects. I think it was something to do with wanting to make
some that are modifiable, and others that are read-only, then making
different kinds that store the underlying alignment data in
different/more efficient/faster/cleverer representations. It does rather
over-complicate things, however if your algorithm only requires
Alignment as the type of its parameter, then you can safely use all and
any of these as they all implement the Alignment interface.

cheers,
Richard

simon rayner wrote:
> Hi,
> 
> i have a question about Alignment and FlexibleAlignment objects.
> Basically, i have a sequence alignment in FASTA format so followed a code
> sample i found from a previous posted query:
> 
>    BufferedReader br = new BufferedReader(new FileReader("file.txt"));
>    FastaAlignmentFormat faf = new FastaAlignmentFormat();
>    Alignment aligned = faf.read( br );
> 
> so now i have an alignment stored in an Alignment object.
> 
> 1. I do something with these sequences using the access methods for
> the Alignment object.
> something like
> 
>          java.util.Iterator iter = l.listIterator();
>          while(iter.hasNext())
>          {
>            String currLabel = (String) iter.next();
>            String currAA
>                    = aligned.symbolListForLabel(currLabel)
>                    .seqString().substring(base, base+1);
>          }
> 
> 2. Now i want to do the same analysis but on a random sample of
> sequences from this alignment.
> So to get a subset of these sequences i created a FlexibleAlignment
> and grabbed the sequences
> i need from the original alignment...
> 
>       Alignment al;
>       Iterator l = al.symbolListIterator();
>       java.util.List<String> names = al.getLabels();
>       Iterator n = names.listIterator();
>       java.util.ArrayList seqList = new java.util.ArrayList(1);
>       String refs = "";
>       while(refs.length() < al.length())
>       {
>         refs = refs.concat("x");
>       }
> 
>       try{
>         FlexibleAlignment FA = new FlexibleAlignment(seqList);
>         SymbolList aa = ProteinTools.createProtein(refs);
> 
>         seqList.add(
>                 new SimpleAlignmentElement(
>                  "reference",
>                  aa,
>                  new RangeLocation(1, al.length()))
>                 );
>         while (l.hasNext())
>         {
>           try{
>             SymbolList sal = (SymbolList)l.next();
>             String name = (String)n.next();
> 
>             FA.addSequence(new SimpleAlignmentElement(name,
>                      sal,
>                      new RangeLocation(1, al.length())));
> 
>           }
>           catch (org.biojava.bio.BioException ex)
>           {
>             System.out.print("couldn't add sequence to alignment\n");
>             System.err.print(ex);
>           }
>         }
>         this.aligned = FA;
>       }
>       catch (org.biojava.bio.BioException ex)
>       {
>         System.out.print("couldn't add sequence to alignment\n");
>         System.err.print(ex);
>       }
> 
> So now i have my alignment of random sequences in a FlexibleAlignment
> object, but my original analysis
> was written for an Alignment object (because that's the format that
> FastaAlignmentFormat spat back at me.
> 
> So, can i cast a FlexibleAlignment object into an Alignment object? or
> am i just going about it the wrong way?
> 
> p.s. Why are there so many diverse Alignment related objects?
> (AbstractULAlignment,
> AbstractULAlignment.SubULAlignment, FlexibleAlignment, RelabeledAlignment,
> EmptyPairwiseAlignment, SimpleAlignment, HappyAlignment,
> SadAlignment..)  Is there any documentation (other than
> the standard java docs) to clarify which object when?
> 
> thanks!
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l
> 

-- 
Richard Holland, BSc MBCS
Finance Director, Eagle Genomics Ltd
M: +44 7500 438846 | E: holland at eaglegenomics.com
http://www.eaglegenomics.com/


From aumanga at biggjapan.com  Tue Feb 10 01:27:34 2009
From: aumanga at biggjapan.com (Ashika Umanga Umagiliya)
Date: Tue, 10 Feb 2009 10:27:34 +0900
Subject: [Biojava-l] [Off the topic] Selecting template from clustering tree?
Message-ID: <4990D806.2030204@biggjapan.com>

Greetings,

I use 'Modeller' for homology modeling and,  during the process I get a clustering tree shown as following.And I have to select the best
template using this tree.I was wondering whether there are any tools/features in BioJava that I can use for this?
I don't know the conditions to select the best template (I am from Computer science background),but seems I can you fuzzylogic ,if I know the criteria well.
Any tips?

Best Regards,
umanga


-------------------------------------------------------------------------------------------------

Sequence identity comparison (ID_TABLE):

   Diagonal       ... number of residues;
   Upper triangle ... number of identical residues;
   Lower triangle ... % sequence identity, id/min(length).

         1b8pA @11bdmA @11civA @25mdhA @27mdhA @21smkA @2
1b8pA @1      327     194     147     151     153      49
1bdmA @1       61     318     152     167     155      56
1civA @2       45      48     374     139     304      53
5mdhA @2       46      53      42     333     139      57
7mdhA @2       47      49      87      42     351      48
1smkA @2       16      18      17      18      15     313


Weighted pair-group average clustering based on a distance matrix:


                                           .----------------------- 1b8pA @1.9    39.0000
                                           |
                                  .-------------------------------- 1bdmA @1.8    50.5000
                                  |
                              .------------------------------------ 5mdhA @2.4    55.3750
                              |
                              |                                .--- 1civA @2.8    13.0000
                              |                                |
        .---------------------------------------------------------- 7mdhA @2.4    83.2500
        |
      .------------------------------------------------------------ 1smkA @2.5

      +----+----+----+----+----+----+----+----+----+----+----+----+
    86.0600   73.4150   60.7700   48.1250   35.4800   22.8350   10.1900
         79.7375   67.0925   54.4475   41.8025   29.1575   16.5125



From bopfannkuche at gmx.de  Thu Feb 12 12:06:36 2009
From: bopfannkuche at gmx.de (=?ISO-8859-15?Q?Bj=F6rn_Ole_Pfannkuche?=)
Date: Thu, 12 Feb 2009 13:06:36 +0100
Subject: [Biojava-l] DNA/DNA Folding
Message-ID: <499410CC.8090704@gmx.de>

Hi!

Has anyone of you writen a programme or classes which aim on folding DNA?
Like the projects UNAFold or PairFold, but in Java...

Greetz
BO


From willishf at ufl.edu  Thu Feb 12 12:13:57 2009
From: willishf at ufl.edu (Scooter Willis)
Date: Thu, 12 Feb 2009 07:13:57 -0500
Subject: [Biojava-l] Multiple Sequence Viewer
Message-ID: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>

I am getting my feet wet with the various parts and pieces of BioJava and
needed a multiple sequence viewer. Searched around in the code and did some
google searches and looks like one does not exist but someone faked one with
a MultipleLineReader to render each sequence as a label.

As part of the learning exercise I cloned SequencePanel to
MultipleSequencePanel and SequenceRenderContext to
MultipleSequenceRenderContext(to define returning a collection of sequences)
and SymbolSequenceRenderer to SymbolMultipleSequenceRenderer. In
SymbolMultipleSequenceRenderer I handle the rendering of multiple sequences.


I need to add in labels as a non scroll region on the left and then add
support for horizontal and vertical scroll.

Before I finish the last 10% of what I think need to be done and always
takes the longest does a multiple sequence viewer exist in BioJava and I
can't find it?

Thanks

Scooter Willis


From russ at kepler-eng.com  Thu Feb 12 14:31:39 2009
From: russ at kepler-eng.com (Russ Kepler)
Date: Thu, 12 Feb 2009 07:31:39 -0700
Subject: [Biojava-l] Multiple Sequence Viewer
In-Reply-To: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>
References: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>
Message-ID: <200902120731.39355.russ@kepler-eng.com>

On Thursday 12 February 2009 05:13:57 Scooter Willis wrote:

> Before I finish the last 10% of what I think need to be done and always
> takes the longest does a multiple sequence viewer exist in BioJava and I
> can't find it?

In mine I simply have a TranslatedSequencePanel with a MultiLineRenderer, the 
MLR having a renderer for each sequence or sequence element).  This gave me 
the control over the individual sequence display I needed for cursors and 
such.


From willishf at ufl.edu  Thu Feb 12 15:20:55 2009
From: willishf at ufl.edu (Scooter Willis)
Date: Thu, 12 Feb 2009 10:20:55 -0500
Subject: [Biojava-l] Multiple Sequence Viewer
In-Reply-To: <200902120731.39355.russ@kepler-eng.com>
References: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>
	<200902120731.39355.russ@kepler-eng.com>
Message-ID: <7ceb4beb0902120720y7d9dad85sb232575e9f3b4099@mail.gmail.com>

My plan is to model the multiple sequence viewer used in JALView. Sequence
name on the left to fire events when clicked. I also typically work with
large sequences so need both horizontal and vertical scroll which does not
appear to be in the current viewers. I do see support for viewing a range of
a sequence but nothing to scroll or I could be missing something on how the
current viewer would scroll not using a ScrollPane.

This should be something easy to do in BioJava based on the importance of
viewing multiple sequence alignments.

Thanks

Scooter Willis

On Thu, Feb 12, 2009 at 9:31 AM, Russ Kepler <russ at kepler-eng.com> wrote:

> On Thursday 12 February 2009 05:13:57 Scooter Willis wrote:
>
> > Before I finish the last 10% of what I think need to be done and always
> > takes the longest does a multiple sequence viewer exist in BioJava and I
> > can't find it?
>
> In mine I simply have a TranslatedSequencePanel with a MultiLineRenderer,
> the
> MLR having a renderer for each sequence or sequence element).  This gave me
> the control over the individual sequence display I needed for cursors and
> such.
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l
>
>


From russ at kepler-eng.com  Thu Feb 12 15:55:19 2009
From: russ at kepler-eng.com (Russ Kepler)
Date: Thu, 12 Feb 2009 08:55:19 -0700
Subject: [Biojava-l] Multiple Sequence Viewer
In-Reply-To: <7ceb4beb0902120720y7d9dad85sb232575e9f3b4099@mail.gmail.com>
References: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>
	<200902120731.39355.russ@kepler-eng.com>
	<7ceb4beb0902120720y7d9dad85sb232575e9f3b4099@mail.gmail.com>
Message-ID: <200902120855.20480.russ@kepler-eng.com>

On Thursday 12 February 2009 08:20:55 Scooter Willis wrote:
> My plan is to model the multiple sequence viewer used in JALView. Sequence
> name on the left to fire events when clicked. I also typically work with
> large sequences so need both horizontal and vertical scroll which does not
> appear to be in the current viewers. I do see support for viewing a range
> of a sequence but nothing to scroll or I could be missing something on how
> the current viewer would scroll not using a ScrollPane.

I guess I don't see the problem with using a ScrollPane, it works well in the 
app I've written.

> This should be something easy to do in BioJava based on the importance of
> viewing multiple sequence alignments.

It not all *that* hard, in my case it's a ScrollPane with a 
TranslatedSequencePanel with a MultiLineRenderer with a bunch of 
GappedRenderers containing individual sequence or other renderers.  The TSP 
holds the alignment and feeds the individual renderers with the appropriate 
sequence.

Somewhere around here I have something I scratched up in BioJava 1.4 that 
worked as a Clustal alignment viewer, I'll see if I can find it and pop it 
your way.


From hlapp at gmx.net  Fri Feb 13 16:53:53 2009
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri, 13 Feb 2009 11:53:53 -0500
Subject: [Biojava-l] Google Summer of Code: Call for Bio* Volunteers
Message-ID: <1F570555-12DF-42DF-8D0E-95AAE298D76A@gmx.net>

Google is committed to run the Summer of Code program [1] again this  
year. It will be for the 5th time.

In broad strokes, the program funds what you might call remote summer  
internships for students to contribute to an open-source software  
project. Participating projects (or umbrella organizations) provide  
project ideas and supply mentors that guide the work on those.  
Students apply to a project within the program with specific project  
ideas, based on those suggested or based on their own idea, get ranked  
by the mentors of the project, and those accepted into the program get  
paired up with mentors. Projects are chiefly about programming, the  
coding period is 3 months (Jun-Aug), and there is no travel required  
by either student or mentor. The program is global; other than the US  
trade restrictions that Google is under, there are no restrictions as  
to where student or mentor reside. The main motivations behind the  
program are to recruit new contributors to open-source projects, and  
to produce more open-source code. See the program FAQs [2] for more  
information.

I've had the honor of being part of the program for the last two  
years, administering NESCent's participation as an organization [3]  
and in 2007 mentoring a student. I have to say I find it the most  
awesome open-source program since sliced bread (or the invention of  
BLAST if that means more to you). Despite that and sadly enough, there  
has been a dearth of participating bioinformatics projects (though  
some notable ones, such as CytoScape have participated).

There have been two Bio* Summer of Code projects under the NESCent  
umbrella, one in 2007 [4] and one in 2008 [5]. I would be willing to  
volunteer to take the lead on and administer a full-blown  
participation of O|B|F as a Bio* umbrella organization, provided 1) at  
least one Bio* person volunteers to serve as backup administrator, and  
2) enough Bio* contributors volunteer to serve as prospective mentors.

Mentoring involves participating in creating the page of project ideas  
(I'd provide template and guidance), corresponding with applicants who  
have questions, participating in student application ranking, and for  
primary mentors (those directly assigned to a student) based on  
empirical evidence at least 5hrs/week of time spent with the student  
to help him/her get over obstacles or avoid wrong paths.

I think almost all mentors would concur that the experience was very  
gratifying, but as a mentor you will be spending a non-negligible  
amount of time with the student. I think it is the student-mentor  
pairing and interaction, not the stipend, that in the end makes the  
participation for students uniquely productive in terms of learning,  
and different from simply contributing to the project of choice (which  
they could always do).

For a personal impression for how the program is from a mentor  
perspective, I'll let Chris Fields speak who was the mentor for the  
2008 phyloXML in BioPerl project. From a student's perspective, I'll  
leave it to the 2007 Biojava student Bohyun Lee (blee34-at- 
mail.gatech.edu) and the 2008 BioPerl student Mira Han (mirhan-at- 
indiana.edu) to comment (if they are still on the list).

So if you think this is a good idea for Bio* to be part of, if you  
would like to help in some way, if you can see yourself as a mentor,  
or if you are a lurking would-be student, please let yourself be  
heard. Email either to the list or to me.

Cheers,

	-hilmar

[1] http://code.google.com/soc/2008

[2] http://code.google.com/opensource/gsoc/2009/faqs.html

[3] http://hackathon.nescent.org/Phyloinformatics_Summer_of_Code_2007
http://hackathon.nescent.org/Phyloinformatics_Summer_of_Code_2008

[4] http://biojava.org/wiki/BioJava:PhyloSOC07

[5] http://bioperl.org/wiki/PhyloXML_support_in_BioPerl
-- 
===========================================================
: Hilmar Lapp  -:-  Durham, NC  -:-  hlapp at gmx dot net :
===========================================================





From jeedward at yahoo.com  Sat Feb 14 00:23:48 2009
From: jeedward at yahoo.com (John Edward)
Date: Fri, 13 Feb 2009 16:23:48 -0800 (PST)
Subject: [Biojava-l] Draft paper submission deadline extended: BCBGC-09
Message-ID: <421505.231.qm@web45914.mail.sp1.yahoo.com>

Draft paper submission deadline extended: BCBGC-09
?
The deadline for draft paper submission at the 2009 International Conference on Bioinformatics, Computational Biology, Genomics and Chemoinformatics (BCBGC-09) (website: http://www.PromoteResearch.org ) is extended due to numerous requests from the authors. The conference will be held during July 13-16 2009 in Orlando, FL, USA. We invite draft paper submissions. The conference will take place at the same time and venue where several other international conferences are taking place. The other conferences include:
????????? International Conference on Artificial Intelligence and Pattern Recognition (AIPR-09) 
????????? International Conference on Automation, Robotics and Control Systems (ARCS-09)
????????? International Conference on Enterprise Information Systems and Web Technologies (EISWT-09)
????????? International Conference on High Performance Computing, Networking and Communication Systems (HPCNCS-09) 
????????? International Conference on Information Security and Privacy (ISP-09)
????????? International Conference on Recent Advances in Information Technology and Applications (RAITA-09)
????????? International Conference on Software Engineering Theory and Practice (SETP-09) 
????????? International Conference on Theory and Applications of Computational Science (TACS-09)
????????? International Conference on Theoretical and Mathematical Foundations of Computer Science (TMFCS-09)
?
The website http://www.PromoteResearch.org contains more details.
?
Sincerely
John Edward
Publicity committee
?
?


      


From anantpossible at gmail.com  Sat Feb 14 05:33:25 2009
From: anantpossible at gmail.com (Anant Jain)
Date: Sat, 14 Feb 2009 11:03:25 +0530
Subject: [Biojava-l] Multiple Sequence Viewer
In-Reply-To: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>
References: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>
Message-ID: <bd096e3c0902132133n6fd1015cgf3d1a4c48e0f11a1@mail.gmail.com>

Good Morning,
  I am student of B.Tech Bioinformatics (4th year) & learning Biojava from
Internet. Can you sent me some important pdf documents on BioJava.
Thank You
ANANT JAIN
DYPBBI, PUNE, INDIA


From holland at eaglegenomics.com  Sat Feb 14 06:39:40 2009
From: holland at eaglegenomics.com (Richard Holland)
Date: Sat, 14 Feb 2009 06:39:40 +0000
Subject: [Biojava-l] Multiple Sequence Viewer
In-Reply-To: <bd096e3c0902132133n6fd1015cgf3d1a4c48e0f11a1@mail.gmail.com>
References: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>
	<bd096e3c0902132133n6fd1015cgf3d1a4c48e0f11a1@mail.gmail.com>
Message-ID: <4996672C.2050907@eaglegenomics.com>

Everything you need to know to get started is on our website:

  http://www.biojava.org/

thanks,
Richard

Anant Jain wrote:
> Good Morning,
>   I am student of B.Tech Bioinformatics (4th year) & learning Biojava from
> Internet. Can you sent me some important pdf documents on BioJava.
> Thank You
> ANANT JAIN
> DYPBBI, PUNE, INDIA
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l
> 

-- 
Richard Holland, BSc MBCS
Finance Director, Eagle Genomics Ltd
T: +44 (0)1223 654481 ext 3 | E: holland at eaglegenomics.com
http://www.eaglegenomics.com/


From markjschreiber at gmail.com  Sat Feb 14 07:17:48 2009
From: markjschreiber at gmail.com (Mark Schreiber)
Date: Sat, 14 Feb 2009 15:17:48 +0800
Subject: [Biojava-l] Multiple Sequence Viewer
In-Reply-To: <4996672C.2050907@eaglegenomics.com>
References: <7ceb4beb0902120413k2b380e84r10f4eae613971837@mail.gmail.com>
	<bd096e3c0902132133n6fd1015cgf3d1a4c48e0f11a1@mail.gmail.com>
	<4996672C.2050907@eaglegenomics.com>
Message-ID: <93b45ca50902132317s34fbbab6pacd9f68080e10940@mail.gmail.com>

Also look at the recent publication
(http://dx.doi.org/10.1093/bioinformatics/btn397)

- Mark


On Sat, Feb 14, 2009 at 2:39 PM, Richard Holland
<holland at eaglegenomics.com> wrote:
>
> Everything you need to know to get started is on our website:
>
>  http://www.biojava.org/
>
> thanks,
> Richard
>
> Anant Jain wrote:
> > Good Morning,
> >   I am student of B.Tech Bioinformatics (4th year) & learning Biojava from
> > Internet. Can you sent me some important pdf documents on BioJava.
> > Thank You
> > ANANT JAIN
> > DYPBBI, PUNE, INDIA
> > _______________________________________________
> > Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/biojava-l
> >
>
> --
> Richard Holland, BSc MBCS
> Finance Director, Eagle Genomics Ltd
> T: +44 (0)1223 654481 ext 3 | E: holland at eaglegenomics.com
> http://www.eaglegenomics.com/
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l


From anantpossible at gmail.com  Tue Feb 17 05:55:00 2009
From: anantpossible at gmail.com (Anant Jain)
Date: Tue, 17 Feb 2009 11:25:00 +0530
Subject: [Biojava-l] A little problem
Message-ID: <op.upheptba6ll4wo@dypbbi-50>


Good Morning,
	     i want to retrieve dna sequnce from a GenBank file. So, I am using
SeqIOTools.redGenbank(br) method. There is one flaw, example of tutorials  
says that i will return a sequence but its returning SequenceIterator.
That's not a problem, we can get the sequence using nextSequence() method.

Now, i want to print the sequence which i have got from genbank file,so i  
used a for loop (below)

for (int pos = 1;pos<seq.length();pos++)
{

System.out.println(seq.symbolAt(pos));

}



Problem 1: It prints the nucleotides in random order, means i want it from  
begining to last as i did in loop
            plz help me out, because i want to write the sequence in file



Thank You
Anant Jain
PUNE, INDIA
-- 


From holland at eaglegenomics.com  Tue Feb 17 08:59:17 2009
From: holland at eaglegenomics.com (Richard Holland)
Date: Tue, 17 Feb 2009 08:59:17 +0000
Subject: [Biojava-l] A little problem
In-Reply-To: <op.upheptba6ll4wo@dypbbi-50>
References: <op.upheptba6ll4wo@dypbbi-50>
Message-ID: <499A7C65.5040401@eaglegenomics.com>

To convert the sequence into a String, use the seqString() method of the
Sequence object.

Also you should take a look at the replacement for SeqIOTools -
RichSequence.IOTools - as this is more up-to-date and handles file
parsing more sensibly.

cheers,
Richard

Anant Jain wrote:
> 
> Good Morning,
>          i want to retrieve dna sequnce from a GenBank file. So, I am using
> SeqIOTools.redGenbank(br) method. There is one flaw, example of
> tutorials says that i will return a sequence but its returning
> SequenceIterator.
> That's not a problem, we can get the sequence using nextSequence() method.
> 
> Now, i want to print the sequence which i have got from genbank file,so
> i used a for loop (below)
> 
> for (int pos = 1;pos<seq.length();pos++)
> {
> 
> System.out.println(seq.symbolAt(pos));
> 
> }
> 
> 
> 
> Problem 1: It prints the nucleotides in random order, means i want it
> from begining to last as i did in loop
>            plz help me out, because i want to write the sequence in file
> 
> 
> 
> Thank You
> Anant Jain
> PUNE, INDIA

-- 
Richard Holland, BSc MBCS
Finance Director, Eagle Genomics Ltd
T: +44 (0)1223 654481 ext 3 | E: holland at eaglegenomics.com
http://www.eaglegenomics.com/


From crackeur at comcast.net  Thu Feb 19 03:25:13 2009
From: crackeur at comcast.net (crackeur at comcast.net)
Date: Thu, 19 Feb 2009 03:25:13 +0000 (UTC)
Subject: [Biojava-l] [ANN]VTD-XML 2.5
In-Reply-To: <499A7C65.5040401@eaglegenomics.com>
Message-ID: <2083482873.1632131235013913327.JavaMail.root@sz0167a.emeryville.ca.mail.comcast.net>


VTD-XML 2.5 is now released. Please go to https://sourceforge.net/project/showfiles.php?group_id=110612&package_id=120172&release_id=661376 ?to download the latest version. 

Changes from Version 2.4 (2/2009) 

* Added separate VTD indexing generating and loading (see http://vtd-xml.sf.net/persistence.html for further info) 
* Integrated extended VTD supporting 256 GB doc (In Java only). 
* Added duplicateNav() for replicate multiple VTDNav instances sharing XML, VTD and LC buffer (availabe in Java and C#). 
* Various bug fixes and enhancements 



From aumanga at biggjapan.com  Thu Feb 19 02:50:01 2009
From: aumanga at biggjapan.com (Ashika Umanga Umagiliya)
Date: Thu, 19 Feb 2009 11:50:01 +0900
Subject: [Biojava-l] Saving back chromatogram?
Message-ID: <499CC8D9.4090906@biggjapan.com>

Greetings all,

I was able to display chromatogram using ABIFChromatogram class .
Now what I want to implement is a chromatogram Editor,where user can 
edit base calls and save aback to AB1 files.
Is there a way to do this in BioJava?

Best Regards,
umanga


From ayates at ebi.ac.uk  Thu Feb 19 09:23:00 2009
From: ayates at ebi.ac.uk (Andy Yates)
Date: Thu, 19 Feb 2009 09:23:00 +0000
Subject: [Biojava-l] Saving back chromatogram?
In-Reply-To: <499CC8D9.4090906@biggjapan.com>
References: <499CC8D9.4090906@biggjapan.com>
Message-ID: <499D24F4.8040607@ebi.ac.uk>

Hi Umanga,

Unfortunately there is no write feature available in the BioJava API. My
advice would be to store these new basecalls in a separate file & look
into using the Staden IO package which does support write functions (not
sure if it will write into AB1 but it will do SCF & ZTR). Sadly this is
written in C so you will have to write either some glue code with JNI to
get it working or write a small C program to munge an AB1 trace & your
new file together.

Sorry I can't be of any more help,

Andy

Ashika Umanga Umagiliya wrote:
> Greetings all,
> 
> I was able to display chromatogram using ABIFChromatogram class .
> Now what I want to implement is a chromatogram Editor,where user can
> edit base calls and save aback to AB1 files.
> Is there a way to do this in BioJava?
> 
> Best Regards,
> umanga
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l


From holland at eaglegenomics.com  Thu Feb 19 08:23:31 2009
From: holland at eaglegenomics.com (Richard Holland)
Date: Thu, 19 Feb 2009 08:23:31 +0000
Subject: [Biojava-l] Saving back chromatogram?
In-Reply-To: <499CC8D9.4090906@biggjapan.com>
References: <499CC8D9.4090906@biggjapan.com>
Message-ID: <499D1703.4020803@eaglegenomics.com>

No, BioJava does not include the ability to write ABI files. Technically
you could write your own code to do it though because the file format is
fully understood by the parser and is formally described by a paper
linked to from the Javadoc for ABIFChromatogram. By combining the
information from the paper with the code from the parser, it should be
possible to create a writer.

Richard

Ashika Umanga Umagiliya wrote:
> Greetings all,
> 
> I was able to display chromatogram using ABIFChromatogram class .
> Now what I want to implement is a chromatogram Editor,where user can
> edit base calls and save aback to AB1 files.
> Is there a way to do this in BioJava?
> 
> Best Regards,
> umanga
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l
> 

-- 
Richard Holland, BSc MBCS
Finance Director, Eagle Genomics Ltd
T: +44 (0)1223 654481 ext 3 | E: holland at eaglegenomics.com
http://www.eaglegenomics.com/


From anantpossible at gmail.com  Fri Feb 20 05:40:17 2009
From: anantpossible at gmail.com (Anant Jain)
Date: Fri, 20 Feb 2009 11:10:17 +0530
Subject: [Biojava-l] Regarding BioJava
Message-ID: <bd096e3c0902192140h5324b2d0t89a3b7820e95fa6@mail.gmail.com>

Greetings all,

                     Do we have any BioJava runtime eviorment like jre coz
if i give a s/w to anybody then he also include all the jar files in his
class path.

If i am compile and run my biojava program from my editplus then its working
but if i run it from command prompt then its giving error like  unable to
load PDBFilereader.class. plz tel me how to run our program through cmd


From aumanga at biggjapan.com  Fri Feb 20 05:48:45 2009
From: aumanga at biggjapan.com (Ashika Umanga Umagiliya)
Date: Fri, 20 Feb 2009 14:48:45 +0900
Subject: [Biojava-l] Saving back chromatogram?
In-Reply-To: <499D24F4.8040607@ebi.ac.uk>
References: <499CC8D9.4090906@biggjapan.com> <499D24F4.8040607@ebi.ac.uk>
Message-ID: <499E443D.30206@biggjapan.com>

Greetings all,

Thank you for all your answers.
What I want to do is ,after modifying callbases, I need to use the 
sequences with 'phrad' foro DNA assembly.For 'phrad', I need to give 
Fasta files and Quality files.
I can modify callbases using my chromatogram editor , and save the new 
sequence in Fasta file.But my problem is , If I change the original 
callbases from AB1  file ,does it effect the Qualitiy files also? Or can 
I use the original Quality files generated by 'phred' with  the new 
callbases.


Here is a image demonstrating my scenario:

http://img3.imageshack.us/img3/3564/f92df0815fab523f3c72aa3qx7.png


Step (2) Ab1 files are passed into 'phred' and Fasta,Quality files are 
generated.
Step (3) If user want to edit callbases , he can use the chromatogram 
editor.Then the Fasta files generated by 'phred' are replaced with new 
onces generated by editor.

My problem is can I use the same Quality files ,with  the modified 
callbases ?


Sorry if this is off the topic.

Thanks in advance,
Umanga



Andy Yates wrote:
> Hi Umanga,
>
> Unfortunately there is no write feature available in the BioJava API. My
> advice would be to store these new basecalls in a separate file & look
> into using the Staden IO package which does support write functions (not
> sure if it will write into AB1 but it will do SCF & ZTR). Sadly this is
> written in C so you will have to write either some glue code with JNI to
> get it working or write a small C program to munge an AB1 trace & your
> new file together.
>
> Sorry I can't be of any more help,
>
> Andy
>
> Ashika Umanga Umagiliya wrote:
>   
>> Greetings all,
>>
>> I was able to display chromatogram using ABIFChromatogram class .
>> Now what I want to implement is a chromatogram Editor,where user can
>> edit base calls and save aback to AB1 files.
>> Is there a way to do this in BioJava?
>>
>> Best Regards,
>> umanga
>> _______________________________________________
>> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biojava-l
>>     
>
>   



From russ at kepler-eng.com  Fri Feb 20 06:16:46 2009
From: russ at kepler-eng.com (Russ Kepler)
Date: Thu, 19 Feb 2009 23:16:46 -0700
Subject: [Biojava-l] Saving back chromatogram?
In-Reply-To: <499E443D.30206@biggjapan.com>
References: <499CC8D9.4090906@biggjapan.com> <499D24F4.8040607@ebi.ac.uk>
	<499E443D.30206@biggjapan.com>
Message-ID: <200902192316.46735.russ@kepler-eng.com>

On Thursday 19 February 2009 22:48:45 Ashika Umanga Umagiliya wrote:

> My problem is can I use the same Quality files ,with  the modified
> callbases ?

Edit the quality data in parallel with the chromatogram.  I would assume that 
the editor is relatively sure of their edits, so I would give them a high 
confidence level when I generate the trace fasta and quality file.


From aumanga at biggjapan.com  Fri Feb 20 06:54:15 2009
From: aumanga at biggjapan.com (Ashika Umanga Umagiliya)
Date: Fri, 20 Feb 2009 15:54:15 +0900
Subject: [Biojava-l] Saving back chromatogram?
In-Reply-To: <200902192316.46735.russ@kepler-eng.com>
References: <499CC8D9.4090906@biggjapan.com>
	<499D24F4.8040607@ebi.ac.uk>	<499E443D.30206@biggjapan.com>
	<200902192316.46735.russ@kepler-eng.com>
Message-ID: <499E5397.4060502@biggjapan.com>

Cheers.


I still haven't implemented the editor.I assume for basecall editing, I 
can use 'Edit' class.

Like:

ABIFChromatogram a;
..
..
a.getBaseCalls().edit(new Edit(.......))


And for Quality values, I am hoping to read and store Qualitly files 
generated by 'phred'.And when user edit the basecall, I am planing to 
edit stored quality values accordinly.
Finally the fasta file is generated using ABIFChromatogram.getBaseCalls()...
and Quality file will be generated using the structure I used above.

Any issues with this approach?

Many thanks,
Umanga


Russ Kepler wrote:
> On Thursday 19 February 2009 22:48:45 Ashika Umanga Umagiliya wrote:
>
>   
>> My problem is can I use the same Quality files ,with  the modified
>> callbases ?
>>     
>
> Edit the quality data in parallel with the chromatogram.  I would assume that 
> the editor is relatively sure of their edits, so I would give them a high 
> confidence level when I generate the trace fasta and quality file.
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l
>
>   



From holland at eaglegenomics.com  Fri Feb 20 08:43:23 2009
From: holland at eaglegenomics.com (Richard Holland)
Date: Fri, 20 Feb 2009 08:43:23 +0000
Subject: [Biojava-l] Regarding BioJava
In-Reply-To: <bd096e3c0902192140h5324b2d0t89a3b7820e95fa6@mail.gmail.com>
References: <bd096e3c0902192140h5324b2d0t89a3b7820e95fa6@mail.gmail.com>
Message-ID: <499E6D2B.90904@eaglegenomics.com>

Like any other Java software, you need to have all the BioJava jars on
your classpath to run it from the command line. If you want to avoid
having to do that, you can copy the jars into $JAVA_HOME/ext.

Please read Sun's documentation on the Java programming language to
learn more about the classpath.

Richard

Anant Jain wrote:
> Greetings all,
> 
>                      Do we have any BioJava runtime eviorment like jre coz
> if i give a s/w to anybody then he also include all the jar files in his
> class path.
> 
> If i am compile and run my biojava program from my editplus then its working
> but if i run it from command prompt then its giving error like  unable to
> load PDBFilereader.class. plz tel me how to run our program through cmd
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l
> 

-- 
Richard Holland, BSc MBCS
Finance Director, Eagle Genomics Ltd
T: +44 (0)1223 654481 ext 3 | E: holland at eaglegenomics.com
http://www.eaglegenomics.com/


From ayates at ebi.ac.uk  Fri Feb 20 11:02:52 2009
From: ayates at ebi.ac.uk (Andy Yates)
Date: Fri, 20 Feb 2009 11:02:52 +0000
Subject: [Biojava-l] Saving back chromatogram?
In-Reply-To: <499E5397.4060502@biggjapan.com>
References: <499CC8D9.4090906@biggjapan.com>	<499D24F4.8040607@ebi.ac.uk>	<499E443D.30206@biggjapan.com>	<200902192316.46735.russ@kepler-eng.com>
	<499E5397.4060502@biggjapan.com>
Message-ID: <499E8DDC.7090100@ebi.ac.uk>

As far as I'm aware no there shouldn't be a problem with this solution.

However have you investigated any other mechanisms for doing this kind
of contig editing/assembly work? I know that people at the Sanger Centre
use a program called gap4 which has powered just about every assembly
they have done. It's available from:

http://www.sanger.ac.uk/Software/production/staden/ (bit of info here)

http://staden.sourceforge.net/staden_home.html

Have a look at it as I feel that this is exactly what you are attempting
to do.

Andy

Ashika Umanga Umagiliya wrote:
> Cheers.
> 
> 
> I still haven't implemented the editor.I assume for basecall editing, I
> can use 'Edit' class.
> 
> Like:
> 
> ABIFChromatogram a;
> ..
> ..
> a.getBaseCalls().edit(new Edit(.......))
> 
> 
> And for Quality values, I am hoping to read and store Qualitly files
> generated by 'phred'.And when user edit the basecall, I am planing to
> edit stored quality values accordinly.
> Finally the fasta file is generated using
> ABIFChromatogram.getBaseCalls()...
> and Quality file will be generated using the structure I used above.
> 
> Any issues with this approach?
> 
> Many thanks,
> Umanga
> 
> 
> Russ Kepler wrote:
>> On Thursday 19 February 2009 22:48:45 Ashika Umanga Umagiliya wrote:
>>
>>  
>>> My problem is can I use the same Quality files ,with  the modified
>>> callbases ?
>>>     
>>
>> Edit the quality data in parallel with the chromatogram.  I would
>> assume that the editor is relatively sure of their edits, so I would
>> give them a high confidence level when I generate the trace fasta and
>> quality file.
>> _______________________________________________
>> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biojava-l
>>
>>   
> 
> _______________________________________________
> Biojava-l mailing list  -  Biojava-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/biojava-l


From jeedward at yahoo.com  Fri Feb 20 15:27:09 2009
From: jeedward at yahoo.com (John Edward)
Date: Fri, 20 Feb 2009 07:27:09 -0800 (PST)
Subject: [Biojava-l] Draft paper submission deadline extended: BCBGC-09
Message-ID: <483752.12181.qm@web45903.mail.sp1.yahoo.com>

Draft paper submission deadline extended: BCBGC-09
?
The deadline for draft paper submission at the 2009 International Conference on Bioinformatics, Computational Biology, Genomics and Chemoinformatics (BCBGC-09) (website: http://www.PromoteResearch.org ) is extended due to numerous requests from the authors. The conference will be held during July 13-16 2009 in Orlando, FL, USA. We invite draft paper submissions. The conference will take place at the same time and venue where several other international conferences are taking place. The other conferences include:
????????? International Conference on Artificial Intelligence and Pattern Recognition (AIPR-09) 
????????? International Conference on Automation, Robotics and Control Systems (ARCS-09)
????????? International Conference on Enterprise Information Systems and Web Technologies (EISWT-09)
????????? International Conference on High Performance Computing, Networking and Communication Systems (HPCNCS-09) 
????????? International Conference on Information Security and Privacy (ISP-09)
????????? International Conference on Recent Advances in Information Technology and Applications (RAITA-09)
????????? International Conference on Software Engineering Theory and Practice (SETP-09) 
????????? International Conference on Theory and Applications of Computational Science (TACS-09)
????????? International Conference on Theoretical and Mathematical Foundations of Computer Science (TMFCS-09)
?
The website http://www.PromoteResearch.org contains more details.
?
Sincerely
John Edward
Publicity committee


      


From anantpossible at gmail.com  Mon Feb 23 09:45:45 2009
From: anantpossible at gmail.com (Anant Jain)
Date: Mon, 23 Feb 2009 15:15:45 +0530
Subject: [Biojava-l] problem in alignment
Message-ID: <bd096e3c0902230145v4b35582eid135568873c40e12@mail.gmail.com>

Greeetings all,

                       i am aligning two protein sequences using BLOSUM62
substitution matrix but an runtime error is coming which is " this
tokenization does not contain character ' * ' " some IllegalSymbolException

please suggest me solution or any substitution matrix

or do i have to change my sequence format.

plz rply


From andreas.draeger at uni-tuebingen.de  Mon Feb 23 10:48:20 2009
From: andreas.draeger at uni-tuebingen.de (=?ISO-8859-1?Q?Andreas_Dr=E4ger?=)
Date: Mon, 23 Feb 2009 11:48:20 +0100
Subject: [Biojava-l] problem in alignment
In-Reply-To: <bd096e3c0902230145v4b35582eid135568873c40e12@mail.gmail.com>
References: <bd096e3c0902230145v4b35582eid135568873c40e12@mail.gmail.com>
Message-ID: <49A27EF4.1050109@uni-tuebingen.de>

Dear Anant Jain,

>                        i am aligning two protein sequences using BLOSUM62
> substitution matrix but an runtime error is coming which is " this
> tokenization does not contain character ' * ' " some IllegalSymbolException
> 
> please suggest me solution or any substitution matrix
> 
> or do i have to change my sequence format.

This problem occurs very frequently because in BioJava the * symbol (the 
termination symbol) belongs to the alphabet PROTEIN_TERM and not to the 
alphabet PROTEIN. Please use the correct alphabet and you'll be fine.

Cheers
Andreas


From andreas.draeger at uni-tuebingen.de  Mon Feb 23 20:48:54 2009
From: andreas.draeger at uni-tuebingen.de (Andreas =?iso-8859-1?b?RHLkZ2Vy?=)
Date: Mon, 23 Feb 2009 21:48:54 +0100
Subject: [Biojava-l] problem in alignment
In-Reply-To: <bd096e3c0902230900i1fd808afvcdc360de521225d4@mail.gmail.com>
References: <bd096e3c0902230145v4b35582eid135568873c40e12@mail.gmail.com>
	<49A27EF4.1050109@uni-tuebingen.de>
	<bd096e3c0902230900i1fd808afvcdc360de521225d4@mail.gmail.com>
Message-ID: <20090223214854.959059s53gtvecvq@webmail.uni-tuebingen.de>

Dear Anant Jain,

Yeah, the problem is that the substitution matrices, e.g., BLOSUM 50,  
contain the *-symbol. So you'll definitely need the PROTEIN_TERM  
alphabet when doing protein alignments. Just try and let me know if it  
works.

Cheers
Andreas Dr?ger


Dipl.-Bioinform. Andreas Dr?ger
Eberhard Karls University T?bingen
Center for Bioinformatics (ZBIT)
Sand 1
72076 T?bingen
Germany

Phone: +49-7071-29-70436
Fax:   +49-7071-29-5091



From andreas.draeger at uni-tuebingen.de  Tue Feb 24 07:34:28 2009
From: andreas.draeger at uni-tuebingen.de (=?ISO-8859-1?Q?Andreas_Dr=E4ger?=)
Date: Tue, 24 Feb 2009 08:34:28 +0100
Subject: [Biojava-l] Regarding problen in Alignment
In-Reply-To: <bd096e3c0902232140t49e45c75w653dea028986b00f@mail.gmail.com>
References: <bd096e3c0902232140t49e45c75w653dea028986b00f@mail.gmail.com>
Message-ID: <49A3A304.4010004@uni-tuebingen.de>

Dear Anant Jain,

Sorry for this misunderstanding. There is no substitution matrix 
"PROTEIN_TERM". The constructor of the BioJava SubstitutionMatrix class 
requires the following arguments: FiniteAlphabet alpha and File 
matrixFile. As the alphabet you should use the alphabet "PROTEIN_TERM" 
for matrixes of protein sequences like BLOSUM etc. In the BioJava 
repository there is a newer version of this class that provides a 
function to parse a matrix without explicitely providing an alphabet (it 
guesses the alphabet of the matrix). I hope this helps.

Cheers
Andreas Dr?ger

Anant Jain wrote:
> Thank You Sir,
>                        I  have searched through ftp/...blast/matrices,
> but did not got any file substitution matrix like PROTEIN_TERM,  if u
> have can u send me it OR tell me link from where i can download the it
> 
> Thank You
> Anant jain
> DYPBI
> Pune, India.
> 



From sauloal at gmail.com  Tue Feb 24 15:53:10 2009
From: sauloal at gmail.com (Saulo Alves)
Date: Tue, 24 Feb 2009 16:53:10 +0100
Subject: [Biojava-l] Sequence Annotation on Gui
Message-ID: <ee3dfd060902240753x7cd0df54nf4363d16966f28af@mail.gmail.com>

Hello,

I'm new here and in biojava and i have been strugling with this problem.

I have a chromossome with its gene annotations and i want to plot it in a GUI.

I used the tutorial to make the basic setup and i can have a good
picture of the chromossome and its genes position.

The problem is: how to plot the name of each gene along the arrow
which represents each gene?

thanks in advance,

S.


From andreas.draeger at uni-tuebingen.de  Wed Feb 25 06:54:29 2009
From: andreas.draeger at uni-tuebingen.de (=?ISO-8859-1?Q?Andreas_Dr=E4ger?=)
Date: Wed, 25 Feb 2009 07:54:29 +0100
Subject: [Biojava-l] Regarding problen in Alignment
In-Reply-To: <bd096e3c0902242225k2972a7ddkf10a0275639c5150@mail.gmail.com>
References: <bd096e3c0902232140t49e45c75w653dea028986b00f@mail.gmail.com>	
	<49A3A304.4010004@uni-tuebingen.de>
	<bd096e3c0902242225k2972a7ddkf10a0275639c5150@mail.gmail.com>
Message-ID: <49A4EB25.5070207@uni-tuebingen.de>

Anant Jain wrote:
> Thank Sir,
>                 
> So should i use this
>  
> SubstituionMatrix matrix = new SubstitutionMatrix("PROTEIN_TERM",new 
> File (BLOSUM62.50"));
>  
>  
> Anant Jain
> DYPBBI,
> Pune,India

Dear Anant Jain,


"PROTEIN_TERM" is a String and not a FiniteAlphabet. Please have a look 
at the following example, where the alphabet "DNA" is used. Just replace 
"DNA" by "PROTEIN_TERM" and it will work for you:
http://biojava.org/wiki/BioJava:CookBook:DP:PairWise2

Cheers
Andreas


From aumanga at biggjapan.com  Wed Feb 25 07:44:24 2009
From: aumanga at biggjapan.com (Ashika Umanga Umagiliya)
Date: Wed, 25 Feb 2009 16:44:24 +0900
Subject: [Biojava-l] Biojava Parsers : Apply quality values for contig ?
Message-ID: <49A4F6D8.9010307@biggjapan.com>

Greetings all,


I am using 'phred/phrap' to assemble DNA sequences ,and 'phrap' 
generates contig file and a contig-quality files for an assembly.
Now I want to parse these two files and generate final contig , by 
removing Bases with '0' quality values.

For example :
CGACTATG + 0 42 54 59 48 0 0 0 > _GACT____

Why I want to do this is; because only this "masking" will give the 
similar contig that of which generated by ChromasPro.

I can use Fasta-parser to parse contig file.But I wonder whether theres 
anyway to handle parsing of Quality file in BioJava.

Below I have give the structures of two file types:

thanks in advance,
Umanga



contig file:
------------
 >seqs_fasta.Contig1
TTGGAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCCTAACA
CATGCAAGTCGAACGGTAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGT
GGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAAC
TACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGG
GACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTA
GGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGA
TGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCA
GCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGC
GTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAG
GGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCAC
CGGCTAATTCCGTGCCAGCAGCCGCGGTAATATTNTTATTCTTTATGTAT
ACATATTCTTTTTACTTTATTCTATTAAATTTATTCTTTCATAATTAAAC
CTTCCCTTACACCCATTCCACCTCCCATCCCTCTTCCCCTCCCACTCTCC
ATCTCATATGGCGTTCGCGCCTCTCTCTTCATCTCCTCCTATATTTATTC
TAACTTCTTTCATCTCAATCATTTCTTCTGTCTCATCCTTCCATTCTTTC
CATGATCTCCCCCATTGTCATGTCTTCAAAAAACCACACAAAACACTAGA
ATCTTTTCTTATTACACACAAGTATATACAATTTTTAACAATCCATTAAA
ACACACACAACACCTAGCAATCAACAACGCTACCATCCCCAATATTCTCT
GTTCTCCTCTCTTTCTCCGCGTGCATCTGCGCACTACTCTCTAATTTCAT
CTCTATTATCTTTTTTTCTTAACTCATCCGCATACATCCAAGACTCTAGA
CCCATTTCTCGCCTCTTTCATTTACTGCCGATACAGAGCTTATAAATTCT
ATATCATTTATCCACACTCATTATTAAATAGGCTGACACCTCTAACCGTC
CACTACACCACCTTTCCCATGCCATCTCCCTAACACTGCACTCATCCGTA
ACTTCCTACTCTACCCTCTCTTTCTTTCCTTACTTTCTTTTCTTTCTCTT
ACATTTTTATTTAAAATTCCTCTTTTAGCCTCTATTTTCTGTTATCTACT
TTTCTCCTAAATTCCCCCTATTCTTCACGTCCCATACCTATCCCTACCAC
CACCACTACCACCCCTCTCTTCATTCTACTCGCTCTAAACCCTCCACCCT
CCCCTCCTTGCTCTTATGTATCTCCTCATCTTTTAAT



quality file
------------
 >seqs_fasta.Contig1
0 23 23 33 33 33 33 33 31 41 47 47 47 47 47 47 47 50 47 47 57 59 59 59 
42 42 35 42 42 54 59 48 48 48 48 48 48 54 57 57 57 57 57 54 54 57 54 54 
54 74
74 74 74 59 57 57 57 57 72 72 84 76 73 72 72 72 79 81 74 74 62 50 50 50 
59 39 43 32 35 32 43 58 44 48 70 70 58 73 55 69 67 87 87 90 90 90 90 90 
90 90
90 90 90 90 90 90 90 90 89 90 90 90 90 90 90 90 85 87 87 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 77 77 77 81 81 90 90 90 90 90 90 90 90 
90 90
90 90 90 90 90 87 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90
90 90 90 90 74 74 85 90 90 90 90 90 90 90 90 90 90 90 90 83 83 90 90 90 
90 90 90 90 75 83 83 89 89 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90
90 72 72 72 57 57 43 37 37 43 72 72 72 72 72 72 90 90 90 90 90 90 90 86 
90 90 90 90 90 90 90 79 85 83 90 90 90 89 87 87 90 90 90 90 67 67 79 78 
90 86
88 82 73 68 65 61 59 63 62 68 71 72 59 56 41 35 30 30 28 32 41 47 40 56 
49 42 49 51 50 37 37 39 39 37 52 54 51 46 20 20 27 24 32 24 20 20 21 24 
16 19
19 33 29 22 23 12 11 11 12 20 23 40 32 31 28 22 13 13 18 26 28 28 34 28 
25 24 28 23 26 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0



-- 
??? ???? ?????
???????????????????BiGG)
?140-0001
?????????3-6-9 ??????8F
TEL:03-6679-8763
FAX:03-6679-8764



From watson at ebi.ac.uk  Wed Feb 25 11:07:49 2009
From: watson at ebi.ac.uk (James Watson)
Date: Wed, 25 Feb 2009 11:07:49 +0000
Subject: [Biojava-l] Java programmatic access course at the EMBL-EBI
Message-ID: <49A52685.7090201@ebi.ac.uk>

We have a hands-on training course that might be of interest being run 
here at the European Bioinformatics Institute. Further details can be 
found at http://www.ebi.ac.uk/training/handson/

Title: Programmatic Access: to biological databases (Java)
Date: 27-29 April 2009
Venue: EMBL-EBI, Hinxton, Nr Cambridge, CB10 1SD, UK
Organisers: Samuel Patient & James Watson
Registration Deadline: 30th March 2009 - 12 noon (GMT)
Cost: ?50.00 (no travel or accomodation included)

James Watson

-- 
James D Watson
Scientific Training Officer
EMBL-EBI
Wellcome Trust Genome Campus
Hinxton
Tel: +44(0)1223 492541

http://www.ebi.ac.uk/training/

Upcoming hands on training courses (http://www.ebi.ac.uk/training/handson/):

16-18 March 2009: Sequence to Genes - Genome Informatics
27-29 April 2009: Programmatic access to biological databases
11-15 May 2009: A Walkthrough EBI Bioinformatics Resources


From koen.bruynseels at cropdesign.com  Wed Feb 25 11:18:32 2009
From: koen.bruynseels at cropdesign.com (koen.bruynseels at cropdesign.com)
Date: Wed, 25 Feb 2009 12:18:32 +0100
Subject: [Biojava-l] Koen Bruynseels is out of the office.
Message-ID: <OF283791AA.5126250A-ONC1257568.003E1F5B-C1257568.003E1F5B@basf-c-s.be>


I will be out of the office starting  02/24/2009 and will not return until
03/02/2009.

I will respond to your message when I return.



From andreas at sdsc.edu  Wed Feb 25 17:54:06 2009
From: andreas at sdsc.edu (Andreas Prlic)
Date: Wed, 25 Feb 2009 09:54:06 -0800
Subject: [Biojava-l] biojava 1.7 release schedule
Message-ID: <59a41c430902250954k4696f868hb5b8b50fa247a03a@mail.gmail.com>

Hi

I would like to propose the following release plan for biojava 1.7:

* the next couple of weeks:
  commit missing patches, write junit tests and improve documentation
(everybody with write access)

* Wed. April 8th:
  code freeze (declared on biojava-dev by me)
  final checks.
  at this point all unit tests should pass without problems

* Sat. April 11th :
  I will branch the svn,
  copy the release files on the biojava site,
  and write the announce email

Andreas


From andreas.prlic at gmail.com  Thu Feb 26 16:16:56 2009
From: andreas.prlic at gmail.com (Andreas Prlic)
Date: Thu, 26 Feb 2009 08:16:56 -0800
Subject: [Biojava-l] BioJava and backbone amino acids
In-Reply-To: <49A63722.40002@wp.pl>
References: <49A63722.40002@wp.pl>
Message-ID: <59a41c430902260816t1280caa1tb770a174d32fcc03@mail.gmail.com>

Hi Michal,

You could use the Calc class to calculate all the distances of Atoms
that are in proximity of a the ligand.

Andreas


On Wed, Feb 25, 2009 at 10:30 PM, Michal Lorenc <m.t.lorenc at wp.pl> wrote:
> Dear Andreas,
> do you know how it is possible to find backbone amino acids around the
> ligand with BioJava or do you know another software?
>
> Thank you in advance.
>
> Best regards,
>
> Michal
>


From bopfannkuche at gmx.de  Fri Feb 27 10:36:38 2009
From: bopfannkuche at gmx.de (=?ISO-8859-15?Q?Bj=F6rn_Ole_Pfannkuche?=)
Date: Fri, 27 Feb 2009 11:36:38 +0100
Subject: [Biojava-l] Zuker Algorithm
Message-ID: <49A7C236.6090807@gmx.de>

Hello!

I' m reading this mailinglist for quite a while and I often learned very 
nice tricks on different stuff *G*

Now I have a little problem/question of my own:

Has anyone implemented the Zuker-Algorithm for RNA Folding so far? I 
need a Java Version for a software project and due to the fact that all 
of you are developing software I hope that I do not have to implement it 
again in the case one of you have already done.

If someone can help me I would be very delighted,
thanks in advance!

Bj?rn


From andreas.prlic at gmail.com  Sat Feb 28 03:15:44 2009
From: andreas.prlic at gmail.com (Andreas Prlic)
Date: Fri, 27 Feb 2009 19:15:44 -0800
Subject: [Biojava-l] BioJava and backbone amino acids
In-Reply-To: <49A79EAD.7030000@wp.pl>
References: <49A63722.40002@wp.pl>
	<59a41c430902260816t1280caa1tb770a174d32fcc03@mail.gmail.com>
	<49A79EAD.7030000@wp.pl>
Message-ID: <59a41c430902271915l73a05533lc77d5dc69e439480@mail.gmail.com>

Hi Michal,

you can get the backbone atoms e.g. by using the StructureTools class:

StructureTools.getBackboneAtomArray(Structure s)

http://www.biojava.org/docs/api/org/biojava/bio/structure/StructureTools.html

Andreas

On Fri, Feb 27, 2009 at 12:05 AM, Michal Lorenc <m.t.lorenc at wp.pl> wrote:
> Hi Andreas,
> Thank you for your email. But how can I find backbone amino acids?
>
> Thank you in advance.
>
> Best regards,
>
> Michal
>
> Andreas Prlic wrote:
>>
>> Hi Michal,
>>
>> You could use the Calc class to calculate all the distances of Atoms
>> that are in proximity of a the ligand.
>>
>> Andreas
>>
>>
>> On Wed, Feb 25, 2009 at 10:30 PM, Michal Lorenc <m.t.lorenc at wp.pl> wrote:
>>>
>>> Dear Andreas,
>>> do you know how it is possible to find backbone amino acids around the
>>> ligand with BioJava or do you know another software?
>>>
>>> Thank you in advance.
>>>
>>> Best regards,
>>>
>>> Michal
>>>
>>
>>
>